
GALK2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol GALK2
Entrez Gene ID 2585
Full Name galactokinase 2
Synonyms GK2
General protein information
Preferred Names
N-acetylgalactosamine kinase
N-acetylgalactosamine kinase
galNAc kinase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_001289030 NP_001275959 N-acetylgalactosamine kinase isoform 3
XM_005254279 XP_005254336 N-acetylgalactosamine kinase isoform X1
XM_006720461 XP_006720524 N-acetylgalactosamine kinase isoform X2
XM_005254280 XP_005254337 N-acetylgalactosamine kinase isoform X3
XM_006720462 XP_006720525 N-acetylgalactosamine kinase isoform X4
XM_006720463 XP_006720526 N-acetylgalactosamine kinase isoform X5
XM_005254284 XP_005254341 N-acetylgalactosamine kinase isoform X6
XM_006720464 XP_006720527 N-acetylgalactosamine kinase isoform X7
XM_011521440 XP_011519742 N-acetylgalactosamine kinase isoform X8
XM_011521441 XP_011519743 N-acetylgalactosamine kinase isoform X9
XM_011521442 XP_011519744 N-acetylgalactosamine kinase isoform X10
NM_001289031 NP_001275960 N-acetylgalactosamine kinase isoform 3
NM_002044 NP_002035 N-acetylgalactosamine kinase isoform 1
NM_001001556 NP_001001556 N-acetylgalactosamine kinase isoform 2

Homo sapiens (human) GALK2 NP_002035.1
Pan troglodytes (chimpanzee) GALK2 XP_001167197.1
Macaca mulatta (Rhesus monkey) GALK2 XP_001113758.1
Canis lupus familiaris (dog) GALK2 XP_544673.2
Bos taurus (cattle) GALK2 NP_001033259.1
Mus musculus (house mouse) Galk2 NP_780363.1
Rattus norvegicus (Norway rat) Galk2 NP_001013941.1
Gallus gallus (chicken) GALK2 NP_001025728.1
Danio rerio (zebrafish) galk2 NP_001007433.2
Drosophila melanogaster (fruit fly) Galk NP_001189074.1
Caenorhabditis elegans tag-96 NP_490909.2
Arabidopsis thaliana (thale cress) GALK NP_187310.1
Xenopus (Silurana) tropicalis (western clawed frog) galk2 NP_001005803.1


ID Name Evidence
GO:0005737 cytoplasm IEA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004335 galactokinase activity IDA
GO:0005524 ATP binding IEA
GO:0016301 kinase activity IEA
GO:0016740 transferase activity IEA
GO:0033858 N-acetylgalactosamine kinase activity IEA


ID Name Evidence
GO:0005975 carbohydrate metabolic process TAS
GO:0006012 galactose metabolic process IEA
GO:0008152 metabolic process IEA
GO:0046835 carbohydrate phosphorylation IEA

Related articles in PubMed

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following GALK2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GALK2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu00201 NM_001289030 Homo sapiens galactokinase 2 (GALK2), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48212 XM_005254279 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48213 XM_006720461 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48214 XM_005254280 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48215 XM_006720462 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48216 XM_006720463 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48217 XM_005254284 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu48218 XM_006720464 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu57916 XM_011521440 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu57917 XM_011521441 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu57918 XM_011521442 PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu00201 NM_001289031 Homo sapiens galactokinase 2 (GALK2), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu03808 NM_002044 Homo sapiens galactokinase 2 (GALK2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99.00
OHu00978 NM_001001556 Homo sapiens galactokinase 2 (GALK2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu00201
Accession Version NM_001289030.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1305bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-AUG-2014
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB457948.1, DC298656.1, AK316440.1, EB386877.1 and AC022306.6. On Jan 10, 2014 this sequence version replaced gi:530405641. Summary: This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]. Transcript Variant: This variant (3) contains an alternate 5' exon and uses a downstream translation start codon, compared to variant 1. The encoded protein (isoform 3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AK316440.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)450..452(+)
Misc Feature(2)513..1802(+)
Misc Feature(3)513..656(+)
Misc Feature(4)837..1007(+)
Misc Feature(5)1485..1727(+)
Exon (1)1..360
Gene Synonym:
Exon (2)361..490
Gene Synonym:
Exon (3)491..579
Gene Synonym:
Exon (4)580..703
Gene Synonym:
Exon (5)704..794
Gene Synonym:
Exon (6)795..941
Gene Synonym:
Exon (7)942..1040
Gene Synonym:
Exon (8)1041..1193
Gene Synonym:
Exon (9)1194..1404
Gene Synonym:
Exon (10)1405..1606
Gene Synonym:
Exon (11)1607..3460
Gene Synonym:
Position Chain Variation Link
15 15 c, g dbSNP:756358744
21 21 a, c dbSNP:764303003
36 36 g, t dbSNP:184156669
43 43 c, t dbSNP:572331304
51 51 c, t dbSNP:571425168
54 54 c, t dbSNP:570803635
92 92 a, t dbSNP:532320830
133 133 a, g dbSNP:757754577
148 148 a, g dbSNP:547687166
163 163 c, t dbSNP:565885520
226 226 c, t dbSNP:536412560
232 232 a, g dbSNP:779463005
251 251 c, t dbSNP:187183178
258 258 a, g dbSNP:780565014
268 268 c, g dbSNP:746488062
285 285 c, g dbSNP:768276574
290 290 a, c dbSNP:776132660
298 298 c, g dbSNP:376738182
309 309 c, t dbSNP:769334130
313 313 -, t dbSNP:752395604
315 315 a, c dbSNP:202114334
316 316 a, g dbSNP:150631282
317 317 a, g dbSNP:766397303
320 320 a, g dbSNP:751588077
321 321 c, g dbSNP:760667559
326 326 a, g dbSNP:764293707
331 331 a, g dbSNP:753879403
332 332 c, t dbSNP:757436137
335 335 c, t dbSNP:779141520
338 338 g, t dbSNP:750741381
342 342 a, g dbSNP:758797905
344 344 g, t dbSNP:780530278
356 356 c, t dbSNP:747605997
359 359 a, c, g dbSNP:769054090
360 360 a, g dbSNP:747641556
361 361 a, g dbSNP:189968039
404 404 a, g dbSNP:576540152
410 410 c, t dbSNP:765407724
411 411 a, g dbSNP:151334901
434 434 a, g dbSNP:758760998
465 465 c, t dbSNP:766666589
471 471 c, t dbSNP:535295613
475 475 a, g dbSNP:556723180
494 494 a, t dbSNP:775325553
497 497 a, g dbSNP:761943991
506 506 a, g dbSNP:765372528
510 510 a, g dbSNP:139521545
511 511 c, t dbSNP:763106907
518 518 c, t dbSNP:766613319
526 526 c, t dbSNP:751913991
548 548 c, t dbSNP:755338980
552 552 c, t dbSNP:768046007
553 553 a, g dbSNP:558491610
555 555 a, g dbSNP:755680551
556 556 c, t dbSNP:777350810
564 564 -, ag dbSNP:763844076
573 573 a, g dbSNP:747232695
574 574 c, t dbSNP:756918705
583 583 a, g dbSNP:770973590
586 586 a, g dbSNP:774627733
588 588 a, g dbSNP:35720727
592 592 a, c dbSNP:772351482
607 607 c, g, t dbSNP:75689896
610 610 c, t dbSNP:761149976
612 612 c, g dbSNP:764662841
618 618 a, g dbSNP:754442774
622 622 c, g, t dbSNP:761389243
624 624 a, g, t dbSNP:764224604
625 625 c, t dbSNP:573044562
627 627 g, t dbSNP:147777330
642 642 a, g dbSNP:751326500
646 646 c, t dbSNP:754818092
647 647 c, t dbSNP:781096044
650 650 a, g dbSNP:748150281
662 662 a, c dbSNP:756081633
664 664 c, g, t dbSNP:147019358
665 665 a, g dbSNP:772142490
667 667 a, g dbSNP:775892131
668 668 c, t dbSNP:776852711
669 669 a, g dbSNP:370698577
670 670 a, c dbSNP:777144504
678 678 c, g dbSNP:762173228
683 683 c, t dbSNP:529083306
685 685 a, g dbSNP:117291857
693 693 a, c dbSNP:371025596
696 696 a, t dbSNP:765995152
698 698 a, g dbSNP:562566800
703 703 a, c, t dbSNP:149095986
705 705 -, t dbSNP:770178533
715 715 a, c dbSNP:753575527
726 726 a, g dbSNP:150063259
735 735 a, g dbSNP:370436045
738 738 g, t dbSNP:751661500
751 751 c, t dbSNP:755161315
752 752 a, t dbSNP:143136439
754 754 g, t dbSNP:753031753
764 764 c, g dbSNP:756294556
765 765 a, t dbSNP:778142701
766 766 a, g dbSNP:374849566
773 773 a, c dbSNP:546498438
789 789 a, t dbSNP:779435434
793 793 a, g dbSNP:745356915
804 804 a, c, g, t dbSNP:148234101
815 815 c, t dbSNP:372905837
839 839 a, g dbSNP:758830352
859 859 a, g dbSNP:779555164
862 862 c, g dbSNP:201904223
869 869 c, t dbSNP:531037984
887 887 c, g dbSNP:573578687
895 895 g, t dbSNP:768327888
903 903 a, t dbSNP:374871677
909 909 a, g dbSNP:747946698
910 910 c, t dbSNP:769779855
911 911 a, g dbSNP:544545223
914 914 c, t dbSNP:141479055
919 919 g, t dbSNP:766251479
930 930 a, g dbSNP:775598902
937 937 c, g dbSNP:760709272
938 938 c, t dbSNP:764352990
948 948 a, c dbSNP:565828321
952 952 c, g dbSNP:776691679
966 966 a, c dbSNP:761963687
971 971 c, t dbSNP:765464723
973 973 a, g dbSNP:750757835
975 975 c, t dbSNP:201505722
976 976 a, g dbSNP:371610941
981 981 a, g dbSNP:35507772
982 982 c, t dbSNP:138250523
986 986 c, t dbSNP:780791959
990 990 a, g dbSNP:752280215
998 998 a, g dbSNP:374509174
1002 1002 a, g dbSNP:777606798
1009 1009 a, g dbSNP:749084823
1010 1010 c, g dbSNP:537774136
1015 1015 c, t dbSNP:200800702
1016 1016 a, c, g dbSNP:577447875
1023 1023 a, c dbSNP:142740588
1028 1028 -, aga dbSNP:759148993
1035 1035 -, g dbSNP:771750846
1041 1041 a, g dbSNP:777555320
1046 1046 g, t dbSNP:753501002
1060 1060 a, g dbSNP:756934839
1062 1062 a, c dbSNP:778510124
1074 1074 -, c dbSNP:35345200
1075 1075 c, t dbSNP:745694860
1076 1076 c, t dbSNP:771953979
1077 1077 a, g, t dbSNP:369854223
1079 1079 c, t dbSNP:374001931
1080 1080 a, g dbSNP:373914978
1084 1084 a, g dbSNP:748039439
1097 1097 a, g dbSNP:146167779
1108 1108 c, t dbSNP:771207083
1111 1111 c, t dbSNP:774542031
1116 1116 a, g dbSNP:539882250
1117 1117 a, g dbSNP:139978578
1119 1119 a, c dbSNP:768114700
1123 1123 a, g dbSNP:776195272
1132 1132 c, t dbSNP:760258023
1134 1134 a, g dbSNP:763630223
1139 1139 a, g dbSNP:753399317
1144 1144 c, t dbSNP:756808842
1146 1146 a, g dbSNP:764970657
1164 1164 a, g dbSNP:750165510
1175 1175 a, g dbSNP:376077359
1179 1179 c, t dbSNP:370443921
1180 1180 a, g dbSNP:201091452
1188 1188 g, t dbSNP:754923275
1189 1189 c, g, t dbSNP:199727284
1190 1190 a, g dbSNP:771028607
1196 1196 c, t dbSNP:750159008
1208 1208 a, c dbSNP:372217244
1213 1213 c, g dbSNP:766107811
1222 1222 a, g dbSNP:751379440
1261 1261 c, t dbSNP:754871023
1262 1262 a, g dbSNP:781232988
1265 1265 a, g, t dbSNP:183088402
1273 1273 c, t dbSNP:375576432
1277 1277 a, g dbSNP:778996637
1282 1282 c, t dbSNP:746020361
1286 1286 a, g dbSNP:772436716
1290 1290 g, t dbSNP:780514168
1296 1296 a, g dbSNP:367574130
1300 1300 a, t dbSNP:769009217
1309 1309 a, g dbSNP:777255659
1312 1312 a, c, g dbSNP:77917939
1321 1321 a, g dbSNP:371808630
1336 1336 g, t dbSNP:772725587
1340 1340 a, c dbSNP:75004292
1343 1343 a, g dbSNP:78829055
1345 1345 c, g dbSNP:74851274
1346 1346 c, t dbSNP:762544798
1347 1347 c, t dbSNP:562452298
1353 1353 a, g dbSNP:529513884
1358 1358 c, t dbSNP:759426348
1360 1360 c, t dbSNP:767342487
1361 1361 a, g dbSNP:752745507
1362 1362 a, g dbSNP:756009604
1372 1372 a, g dbSNP:778993014
1375 1375 c, t dbSNP:750548811
1381 1381 g, t dbSNP:758650847
1383 1383 a, c dbSNP:144789254
1389 1389 a, c dbSNP:747353720
1392 1392 a, g dbSNP:769133403
1393 1393 a, g dbSNP:781417290
1396 1396 c, g dbSNP:748634113
1417 1417 a, g dbSNP:755192521
1419 1419 a, c, t dbSNP:374431370
1421 1421 c, g dbSNP:573842028
1426 1426 a, g dbSNP:778250145
1428 1428 c, t dbSNP:746862792
1429 1429 -, ggcaaa dbSNP:779532295
1431 1431 a, g dbSNP:368842223
1436 1436 a, c, g dbSNP:113276417
1442 1442 a, g dbSNP:745400492
1446 1446 a, g dbSNP:374804284
1448 1448 a, c, t dbSNP:771720042
1449 1449 a, g dbSNP:148552843
1456 1456 c, t dbSNP:146874010
1457 1457 a, g dbSNP:199834761
1458 1458 c, t dbSNP:144322038
1459 1459 a, g dbSNP:376875144
1461 1461 a, g dbSNP:774458462
1462 1462 c, t dbSNP:759584308
1467 1467 c, t dbSNP:767767481
1478 1478 a, g dbSNP:761365640
1482 1482 g, t dbSNP:147794087
1484 1484 -, gaa dbSNP:746428107
1489 1489 a, c dbSNP:764382586
1494 1494 c, t dbSNP:577880125
1511 1511 c, g dbSNP:757721106
1517 1517 a, g dbSNP:779324128
1534 1534 -, a dbSNP:771599120
1541 1541 c, t dbSNP:749923600
1542 1542 a, g dbSNP:757900171
1547 1547 c, t dbSNP:779749859
1551 1551 c, t dbSNP:375693032
1552 1552 a, g dbSNP:768448154
1554 1554 g, t dbSNP:781098649
1558 1558 c, g, t dbSNP:748001624
1560 1560 c, t dbSNP:773083023
1565 1565 c, g dbSNP:759659124
1571 1571 c, g dbSNP:771981013
1574 1574 c, t dbSNP:367931698
1577 1577 c, t dbSNP:370063191
1578 1578 c, g dbSNP:764331208
1581 1581 c, t dbSNP:754169869
1584 1584 a, g dbSNP:762209891
1595 1595 a, g dbSNP:765758424
1603 1603 a, g dbSNP:750955571
1605 1605 a, c, t dbSNP:769469670
1606 1606 a, g dbSNP:758947223
1615 1615 a, g dbSNP:776896239
1618 1618 c, t dbSNP:762160419
1629 1629 c, g, t dbSNP:767130682
1633 1633 a, t dbSNP:750823699
1636 1636 c, g dbSNP:139485976
1639 1639 a, g dbSNP:766949973
1645 1645 g, t dbSNP:751092726
1648 1648 a, g dbSNP:754598196
1649 1649 a, c, g dbSNP:767278183
1651 1651 g, t dbSNP:755806512
1657 1657 a, g dbSNP:777379469
1658 1658 c, t dbSNP:1055254
1661 1661 a, g dbSNP:757107457
1668 1668 a, g dbSNP:377181822
1669 1669 c, t dbSNP:747078307
1674 1674 a, c dbSNP:768789510
1678 1678 c, t dbSNP:373620147
1679 1679 a, g dbSNP:371198789
1686 1686 c, g dbSNP:770088619
1687 1687 c, t dbSNP:376206527
1690 1690 a, c dbSNP:150920378
1691 1691 a, c dbSNP:746306645
1694 1694 c, t dbSNP:538069623
1699 1699 a, t dbSNP:758981126
1706 1706 c, t dbSNP:766787587
1707 1707 a, g dbSNP:775068164
1709 1709 g, t dbSNP:760127486
1710 1710 c, t dbSNP:767081825
1711 1711 a, c dbSNP:752276156
1716 1716 a, g dbSNP:755679971
1729 1729 a, g dbSNP:780775645
1735 1735 a, g dbSNP:763844729
1739 1739 -, agctt dbSNP:761561337
1743 1743 c, t dbSNP:556418019
1746 1746 c, g dbSNP:757133440
1750 1750 c, t dbSNP:370217644
1751 1751 a, c, g dbSNP:745738396
1761 1761 -, gttt dbSNP:765062312
1765 1765 g, t dbSNP:781211218
1770 1770 a, g dbSNP:200728035
1777 1777 a, g dbSNP:747073827
1783 1783 c, g dbSNP:773542023
1785 1785 -, gt dbSNP:750345601
1787 1787 c, t dbSNP:147218231
1803 1803 c, t dbSNP:199516811
1810 1810 c, t dbSNP:774873579
1813 1813 -, a dbSNP:762942743
1820 1820 -, atta dbSNP:767565189
1821 1821 -, gtaaaaa dbSNP:752730802
1821 1821 -, aaccta dbSNP:756310332
1832 1832 c, g dbSNP:760074206
1842 1842 a, g dbSNP:768167821
1844 1844 c, t dbSNP:774828410
1847 1847 -, g dbSNP:764253278
1863 1863 a, g dbSNP:760278080
1869 1869 c, g dbSNP:182130124
1928 1928 a, g dbSNP:776952706
1932 1932 c, t dbSNP:748423606
1968 1968 c, g dbSNP:542597283
1988 1988 a, c dbSNP:554876731
2007 2007 c, t dbSNP:576306720
2033 2033 a, t dbSNP:186777348
2042 2042 c, t dbSNP:148622656
2107 2107 c, t dbSNP:532696312
2111 2111 c, t dbSNP:541168646
2142 2142 -, aatta dbSNP:758596429
2153 2153 c, t dbSNP:559791513
2183 2183 a, g dbSNP:763636823
2205 2205 a, g dbSNP:753592849
2223 2223 g, t dbSNP:761376123
2229 2229 -, ttc dbSNP:754154694
2229 2229 c, t dbSNP:375041430
2231 2231 c, t dbSNP:367997810
2234 2234 c, g dbSNP:77994602
2235 2235 c, t dbSNP:769416028
2239 2239 g, t dbSNP:750239325
2250 2250 c, g dbSNP:758303417
2251 2251 -, tgtc dbSNP:757674601
2251 2251 c, t dbSNP:141143208
2258 2258 -, tgatgatggtga dbSNP:779480779
2259 2259 -, tgatgatggtgatgatgatga dbSNP:746374746
2259 2259 -, tgatgatgg dbSNP:779561225
2259 2259 -, tga dbSNP:758836221
2262 2262 -, tgatgg dbSNP:756949145
2264 2264 a, g dbSNP:752706367
2267 2267 -, tga, tgatgatga dbSNP:776241001
2268 2268 -, tgatga dbSNP:747851240
2268 2268 -, tga dbSNP:768317870
2272 2272 a, g, t dbSNP:184970229
2278 2278 -, gatgatgac dbSNP:772992443
2283 2283 c, t dbSNP:749471661
2284 2284 -, gac dbSNP:769958202
2286 2286 a, c, t dbSNP:771303406
2291 2291 c, g dbSNP:773063173
2305 2305 -, tctc dbSNP:762888521
2306 2306 c, g dbSNP:746272410
2324 2324 c, t dbSNP:373923791
2325 2325 a, g dbSNP:766287938
2326 2326 c, g dbSNP:150753064
2329 2329 c, t dbSNP:774318678
2330 2330 a, g dbSNP:776016532
2351 2351 g, t dbSNP:761403515
2355 2355 a, g dbSNP:368311811
2365 2365 -, tct dbSNP:570050686
2371 2371 a, t dbSNP:764911836
2377 2377 c, t dbSNP:750198502
2387 2387 g, t dbSNP:762795276
2393 2393 a, g dbSNP:766300150
2396 2396 c, t dbSNP:751451584
2429 2429 -, at dbSNP:78262056
2430 2430 -, tt dbSNP:780168469
2430 2430 -, t dbSNP:5812480
2431 2431 -, t dbSNP:759545218
2443 2443 -, tt dbSNP:3075141
2444 2444 -, t dbSNP:570528482
2475 2475 a, g dbSNP:550061066
2492 2492 a, g dbSNP:190065403
2531 2531 g, t dbSNP:576217437
2558 2558 a, g dbSNP:553628122
2559 2559 c, t dbSNP:192926937
2580 2580 c, t dbSNP:375999919
2617 2617 c, t dbSNP:80110211
2664 2664 -, ttc dbSNP:201186301
2666 2666 -, ctt dbSNP:375628334
2673 2673 -, ct dbSNP:3075142
2675 2675 -, ct dbSNP:397774483
2675 2675 c, t dbSNP:202094466
2687 2687 -, t dbSNP:34484949
2717 2717 a, g dbSNP:767049086
2718 2718 a, g dbSNP:750010916
2767 2767 g, t dbSNP:370667288
2798 2798 c, t dbSNP:185562132
2817 2817 a, g dbSNP:189368783
2877 2877 a, g dbSNP:752246309
2886 2886 -, t dbSNP:534910406
2893 2893 c, t dbSNP:182022714
2898 2898 a, g dbSNP:760392476
2965 2965 c, g, t dbSNP:185268010
2968 2968 c, g dbSNP:765456127
2989 2989 a, c dbSNP:116742387
3068 3068 a, g dbSNP:2078024
3071 3071 a, c dbSNP:566823136
3074 3074 -, t dbSNP:770783109
3078 3078 a, c dbSNP:542311505
3214 3214 c, t dbSNP:563682553
3233 3233 a, c dbSNP:780685761
3351 3351 c, t dbSNP:534277253
3356 3356 a, c dbSNP:368454790
3416 3416 g, t dbSNP:188461311

Target ORF information:

RefSeq Version NM_001289030
Organism Homo sapiens (human)
Definition Homo sapiens galactokinase 2 (GALK2), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48212
Accession Version XM_005254279.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1389bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530405633. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)148..1449(+)
Misc Feature(2)172..315(+)
Misc Feature(3)496..666(+)
Misc Feature(4)1144..1386(+)
Position Chain Variation Link
15 15 c, t dbSNP:536412560
21 21 a, g dbSNP:779463005
40 40 c, t dbSNP:187183178
47 47 a, g dbSNP:780565014
57 57 c, g dbSNP:746488062
74 74 c, g dbSNP:768276574
79 79 a, c dbSNP:776132660
87 87 c, g dbSNP:376738182
98 98 c, t dbSNP:769334130
102 102 -, t dbSNP:752395604
104 104 a, c dbSNP:202114334
105 105 a, g dbSNP:150631282
106 106 a, g dbSNP:766397303
109 109 a, g dbSNP:751588077
110 110 c, g dbSNP:760667559
115 115 a, g dbSNP:764293707
120 120 a, g dbSNP:753879403
121 121 c, t dbSNP:757436137
124 124 c, t dbSNP:779141520
127 127 g, t dbSNP:750741381
131 131 a, g dbSNP:758797905
133 133 g, t dbSNP:780530278
145 145 c, t dbSNP:747605997
148 148 a, c, g dbSNP:769054090
149 149 a, g dbSNP:747641556
153 153 a, t dbSNP:775325553
156 156 a, g dbSNP:761943991
165 165 a, g dbSNP:765372528
169 169 a, g dbSNP:139521545
170 170 c, t dbSNP:763106907
177 177 c, t dbSNP:766613319
185 185 c, t dbSNP:751913991
207 207 c, t dbSNP:755338980
211 211 c, t dbSNP:768046007
212 212 a, g dbSNP:558491610
214 214 a, g dbSNP:755680551
215 215 c, t dbSNP:777350810
223 223 -, ag dbSNP:763844076
232 232 a, g dbSNP:747232695
233 233 c, t dbSNP:756918705
242 242 a, g dbSNP:770973590
245 245 a, g dbSNP:774627733
247 247 a, g dbSNP:35720727
251 251 a, c dbSNP:772351482
266 266 c, g, t dbSNP:75689896
269 269 c, t dbSNP:761149976
271 271 c, g dbSNP:764662841
277 277 a, g dbSNP:754442774
281 281 c, g, t dbSNP:761389243
283 283 a, g, t dbSNP:764224604
284 284 c, t dbSNP:573044562
286 286 g, t dbSNP:147777330
301 301 a, g dbSNP:751326500
305 305 c, t dbSNP:754818092
306 306 c, t dbSNP:781096044
309 309 a, g dbSNP:748150281
321 321 a, c dbSNP:756081633
323 323 c, g, t dbSNP:147019358
324 324 a, g dbSNP:772142490
326 326 a, g dbSNP:775892131
327 327 c, t dbSNP:776852711
328 328 a, g dbSNP:370698577
329 329 a, c dbSNP:777144504
337 337 c, g dbSNP:762173228
342 342 c, t dbSNP:529083306
344 344 a, g dbSNP:117291857
352 352 a, c dbSNP:371025596
355 355 a, t dbSNP:765995152
357 357 a, g dbSNP:562566800
362 362 a, c, t dbSNP:149095986
364 364 -, t dbSNP:770178533
374 374 a, c dbSNP:753575527
385 385 a, g dbSNP:150063259
394 394 a, g dbSNP:370436045
397 397 g, t dbSNP:751661500
410 410 c, t dbSNP:755161315
411 411 a, t dbSNP:143136439
413 413 g, t dbSNP:753031753
423 423 c, g dbSNP:756294556
424 424 a, t dbSNP:778142701
425 425 a, g dbSNP:374849566
432 432 a, c dbSNP:546498438
448 448 a, t dbSNP:779435434
452 452 a, g dbSNP:745356915
463 463 a, c, g, t dbSNP:148234101
474 474 c, t dbSNP:372905837
498 498 a, g dbSNP:758830352
518 518 a, g dbSNP:779555164
521 521 c, g dbSNP:201904223
528 528 c, t dbSNP:531037984
546 546 c, g dbSNP:573578687
554 554 g, t dbSNP:768327888
562 562 a, t dbSNP:374871677
568 568 a, g dbSNP:747946698
569 569 c, t dbSNP:769779855
570 570 a, g dbSNP:544545223
573 573 c, t dbSNP:141479055
578 578 g, t dbSNP:766251479
589 589 a, g dbSNP:775598902
596 596 c, g dbSNP:760709272
597 597 c, t dbSNP:764352990
607 607 a, c dbSNP:565828321
611 611 c, g dbSNP:776691679
625 625 a, c dbSNP:761963687
630 630 c, t dbSNP:765464723
632 632 a, g dbSNP:750757835
634 634 c, t dbSNP:201505722
635 635 a, g dbSNP:371610941
640 640 a, g dbSNP:35507772
641 641 c, t dbSNP:138250523
645 645 c, t dbSNP:780791959
649 649 a, g dbSNP:752280215
657 657 a, g dbSNP:374509174
661 661 a, g dbSNP:777606798
668 668 a, g dbSNP:749084823
669 669 c, g dbSNP:537774136
674 674 c, t dbSNP:200800702
675 675 a, c, g dbSNP:577447875
682 682 a, c dbSNP:142740588
687 687 -, aga dbSNP:759148993
694 694 -, g dbSNP:771750846
700 700 a, g dbSNP:777555320
705 705 g, t dbSNP:753501002
719 719 a, g dbSNP:756934839
721 721 a, c dbSNP:778510124
733 733 -, c dbSNP:35345200
734 734 c, t dbSNP:745694860
735 735 c, t dbSNP:771953979
736 736 a, g, t dbSNP:369854223
738 738 c, t dbSNP:374001931
739 739 a, g dbSNP:373914978
743 743 a, g dbSNP:748039439
756 756 a, g dbSNP:146167779
767 767 c, t dbSNP:771207083
770 770 c, t dbSNP:774542031
775 775 a, g dbSNP:539882250
776 776 a, g dbSNP:139978578
778 778 a, c dbSNP:768114700
782 782 a, g dbSNP:776195272
791 791 c, t dbSNP:760258023
793 793 a, g dbSNP:763630223
798 798 a, g dbSNP:753399317
803 803 c, t dbSNP:756808842
805 805 a, g dbSNP:764970657
823 823 a, g dbSNP:750165510
834 834 a, g dbSNP:376077359
838 838 c, t dbSNP:370443921
839 839 a, g dbSNP:201091452
847 847 g, t dbSNP:754923275
848 848 c, g, t dbSNP:199727284
849 849 a, g dbSNP:771028607
855 855 c, t dbSNP:750159008
867 867 a, c dbSNP:372217244
872 872 c, g dbSNP:766107811
881 881 a, g dbSNP:751379440
920 920 c, t dbSNP:754871023
921 921 a, g dbSNP:781232988
924 924 a, g, t dbSNP:183088402
932 932 c, t dbSNP:375576432
936 936 a, g dbSNP:778996637
941 941 c, t dbSNP:746020361
945 945 a, g dbSNP:772436716
949 949 g, t dbSNP:780514168
955 955 a, g dbSNP:367574130
959 959 a, t dbSNP:769009217
968 968 a, g dbSNP:777255659
971 971 a, c, g dbSNP:77917939
980 980 a, g dbSNP:371808630
995 995 g, t dbSNP:772725587
999 999 a, c dbSNP:75004292
1002 1002 a, g dbSNP:78829055
1004 1004 c, g dbSNP:74851274
1005 1005 c, t dbSNP:762544798
1006 1006 c, t dbSNP:562452298
1012 1012 a, g dbSNP:529513884
1017 1017 c, t dbSNP:759426348
1019 1019 c, t dbSNP:767342487
1020 1020 a, g dbSNP:752745507
1021 1021 a, g dbSNP:756009604
1031 1031 a, g dbSNP:778993014
1034 1034 c, t dbSNP:750548811
1040 1040 g, t dbSNP:758650847
1042 1042 a, c dbSNP:144789254
1048 1048 a, c dbSNP:747353720
1051 1051 a, g dbSNP:769133403
1052 1052 a, g dbSNP:781417290
1055 1055 c, g dbSNP:748634113
1076 1076 a, g dbSNP:755192521
1078 1078 a, c, t dbSNP:374431370
1080 1080 c, g dbSNP:573842028
1085 1085 a, g dbSNP:778250145
1087 1087 c, t dbSNP:746862792
1088 1088 -, ggcaaa dbSNP:779532295
1090 1090 a, g dbSNP:368842223
1095 1095 a, c, g dbSNP:113276417
1101 1101 a, g dbSNP:745400492
1105 1105 a, g dbSNP:374804284
1107 1107 a, c, t dbSNP:771720042
1108 1108 a, g dbSNP:148552843
1115 1115 c, t dbSNP:146874010
1116 1116 a, g dbSNP:199834761
1117 1117 c, t dbSNP:144322038
1118 1118 a, g dbSNP:376875144
1120 1120 a, g dbSNP:774458462
1121 1121 c, t dbSNP:759584308
1126 1126 c, t dbSNP:767767481
1137 1137 a, g dbSNP:761365640
1141 1141 g, t dbSNP:147794087
1143 1143 -, gaa dbSNP:746428107
1148 1148 a, c dbSNP:764382586
1153 1153 c, t dbSNP:577880125
1170 1170 c, g dbSNP:757721106
1176 1176 a, g dbSNP:779324128
1193 1193 -, a dbSNP:771599120
1200 1200 c, t dbSNP:749923600
1201 1201 a, g dbSNP:757900171
1206 1206 c, t dbSNP:779749859
1210 1210 c, t dbSNP:375693032
1211 1211 a, g dbSNP:768448154
1213 1213 g, t dbSNP:781098649
1217 1217 c, g, t dbSNP:748001624
1219 1219 c, t dbSNP:773083023
1224 1224 c, g dbSNP:759659124
1230 1230 c, g dbSNP:771981013
1233 1233 c, t dbSNP:367931698
1236 1236 c, t dbSNP:370063191
1237 1237 c, g dbSNP:764331208
1240 1240 c, t dbSNP:754169869
1243 1243 a, g dbSNP:762209891
1254 1254 a, g dbSNP:765758424
1262 1262 a, g dbSNP:750955571
1264 1264 a, c, t dbSNP:769469670
1265 1265 a, g dbSNP:758947223
1274 1274 a, g dbSNP:776896239
1277 1277 c, t dbSNP:762160419
1288 1288 c, g, t dbSNP:767130682
1292 1292 a, t dbSNP:750823699
1295 1295 c, g dbSNP:139485976
1298 1298 a, g dbSNP:766949973
1304 1304 g, t dbSNP:751092726
1307 1307 a, g dbSNP:754598196
1308 1308 a, c, g dbSNP:767278183
1310 1310 g, t dbSNP:755806512
1316 1316 a, g dbSNP:777379469
1317 1317 c, t dbSNP:1055254
1320 1320 a, g dbSNP:757107457
1327 1327 a, g dbSNP:377181822
1328 1328 c, t dbSNP:747078307
1333 1333 a, c dbSNP:768789510
1337 1337 c, t dbSNP:373620147
1338 1338 a, g dbSNP:371198789
1345 1345 c, g dbSNP:770088619
1346 1346 c, t dbSNP:376206527
1349 1349 a, c dbSNP:150920378
1350 1350 a, c dbSNP:746306645
1353 1353 c, t dbSNP:538069623
1358 1358 a, t dbSNP:758981126
1365 1365 c, t dbSNP:766787587
1366 1366 a, g dbSNP:775068164
1368 1368 g, t dbSNP:760127486
1369 1369 c, t dbSNP:767081825
1370 1370 a, c dbSNP:752276156
1375 1375 a, g dbSNP:755679971
1388 1388 a, g dbSNP:780775645
1394 1394 a, g dbSNP:763844729
1398 1398 -, agctt dbSNP:761561337
1402 1402 c, t dbSNP:556418019
1405 1405 c, g dbSNP:757133440
1409 1409 c, t dbSNP:370217644
1410 1410 a, c, g dbSNP:745738396
1420 1420 -, gttt dbSNP:765062312
1424 1424 g, t dbSNP:781211218
1429 1429 a, g dbSNP:200728035
1436 1436 a, g dbSNP:747073827
1442 1442 c, g dbSNP:773542023
1467 1467 c, g dbSNP:371416601
1471 1471 c, t dbSNP:200160678
1485 1485 a, t dbSNP:756585144
1488 1488 c, t dbSNP:778305075
1496 1496 a, g dbSNP:753372861
1498 1498 a, g dbSNP:756782281
1503 1503 c, g dbSNP:778486123
1504 1504 c, t dbSNP:745451388
1512 1512 a, g dbSNP:771777388
1516 1516 c, t dbSNP:200556221
1517 1517 c, t dbSNP:768555380
1518 1518 a, g dbSNP:141588026
1525 1525 a, c dbSNP:150895583
1528 1528 c, t dbSNP:139377249
1529 1529 a, g dbSNP:761817125
1530 1530 a, c dbSNP:770858827
1536 1536 -, c dbSNP:750950812
1540 1540 a, g dbSNP:760190246
1547 1547 -, acta dbSNP:532275129
1549 1549 c, t dbSNP:781332253
1550 1550 c, t dbSNP:774513018
1552 1552 c, t dbSNP:759641323
1558 1558 c, t dbSNP:143970875
1560 1560 c, t dbSNP:202193146
1561 1561 a, g dbSNP:200898126
1565 1565 c, g dbSNP:368225098
1569 1569 a, g dbSNP:765828688
1571 1571 a, g dbSNP:754227723
1577 1577 a, c dbSNP:757792097
1581 1581 -, aatc dbSNP:747595528
1587 1587 a, c, g dbSNP:778236216
1589 1589 c, t dbSNP:758091348
1590 1590 a, c dbSNP:374422980
1592 1592 a, c, t dbSNP:779900462
1593 1593 c, g dbSNP:754755632
1594 1594 -, a dbSNP:754428362
1599 1599 -, tt dbSNP:780744742
1601 1601 c, t dbSNP:376332909
1602 1602 c, t dbSNP:747987177
1604 1604 c, t dbSNP:113970964
1610 1610 -, a dbSNP:747728689
1615 1615 a, c dbSNP:573084831
1664 1664 g, t dbSNP:534054758
1681 1681 a, c dbSNP:555464943
1726 1726 -, agtc dbSNP:555695591
1740 1740 a, g dbSNP:8038399
1752 1752 c, t dbSNP:112490507
1764 1764 -, ttgag dbSNP:565634501
1764 1764 c, t dbSNP:568971467
1790 1790 a, g dbSNP:562854785
1793 1793 a, g dbSNP:575499671
1810 1810 c, t dbSNP:56208309
1818 1818 a, c dbSNP:200225201
1820 1820 -, a, aa dbSNP:34096112
1820 1820 a, g dbSNP:80138105
1821 1821 -, a dbSNP:57784434
1822 1822 a, g dbSNP:79389607
1835 1835 -, c dbSNP:536303052
1835 1835 a, c dbSNP:72727270
1837 1837 -, a dbSNP:56133417
1838 1838 a, t dbSNP:77245685

Target ORF information:

RefSeq Version XM_005254279
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48213
Accession Version XM_006720461.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1377bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578826797. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)148..1440(+)
Misc Feature(2)172..315(+)
Misc Feature(3)496..666(+)
Misc Feature(4)1144..1386(+)
Position Chain Variation Link
15 15 c, t dbSNP:536412560
21 21 a, g dbSNP:779463005
40 40 c, t dbSNP:187183178
47 47 a, g dbSNP:780565014
57 57 c, g dbSNP:746488062
74 74 c, g dbSNP:768276574
79 79 a, c dbSNP:776132660
87 87 c, g dbSNP:376738182
98 98 c, t dbSNP:769334130
102 102 -, t dbSNP:752395604
104 104 a, c dbSNP:202114334
105 105 a, g dbSNP:150631282
106 106 a, g dbSNP:766397303
109 109 a, g dbSNP:751588077
110 110 c, g dbSNP:760667559
115 115 a, g dbSNP:764293707
120 120 a, g dbSNP:753879403
121 121 c, t dbSNP:757436137
124 124 c, t dbSNP:779141520
127 127 g, t dbSNP:750741381
131 131 a, g dbSNP:758797905
133 133 g, t dbSNP:780530278
145 145 c, t dbSNP:747605997
148 148 a, c, g dbSNP:769054090
149 149 a, g dbSNP:747641556
153 153 a, t dbSNP:775325553
156 156 a, g dbSNP:761943991
165 165 a, g dbSNP:765372528
169 169 a, g dbSNP:139521545
170 170 c, t dbSNP:763106907
177 177 c, t dbSNP:766613319
185 185 c, t dbSNP:751913991
207 207 c, t dbSNP:755338980
211 211 c, t dbSNP:768046007
212 212 a, g dbSNP:558491610
214 214 a, g dbSNP:755680551
215 215 c, t dbSNP:777350810
223 223 -, ag dbSNP:763844076
232 232 a, g dbSNP:747232695
233 233 c, t dbSNP:756918705
242 242 a, g dbSNP:770973590
245 245 a, g dbSNP:774627733
247 247 a, g dbSNP:35720727
251 251 a, c dbSNP:772351482
266 266 c, g, t dbSNP:75689896
269 269 c, t dbSNP:761149976
271 271 c, g dbSNP:764662841
277 277 a, g dbSNP:754442774
281 281 c, g, t dbSNP:761389243
283 283 a, g, t dbSNP:764224604
284 284 c, t dbSNP:573044562
286 286 g, t dbSNP:147777330
301 301 a, g dbSNP:751326500
305 305 c, t dbSNP:754818092
306 306 c, t dbSNP:781096044
309 309 a, g dbSNP:748150281
321 321 a, c dbSNP:756081633
323 323 c, g, t dbSNP:147019358
324 324 a, g dbSNP:772142490
326 326 a, g dbSNP:775892131
327 327 c, t dbSNP:776852711
328 328 a, g dbSNP:370698577
329 329 a, c dbSNP:777144504
337 337 c, g dbSNP:762173228
342 342 c, t dbSNP:529083306
344 344 a, g dbSNP:117291857
352 352 a, c dbSNP:371025596
355 355 a, t dbSNP:765995152
357 357 a, g dbSNP:562566800
362 362 a, c, t dbSNP:149095986
364 364 -, t dbSNP:770178533
374 374 a, c dbSNP:753575527
385 385 a, g dbSNP:150063259
394 394 a, g dbSNP:370436045
397 397 g, t dbSNP:751661500
410 410 c, t dbSNP:755161315
411 411 a, t dbSNP:143136439
413 413 g, t dbSNP:753031753
423 423 c, g dbSNP:756294556
424 424 a, t dbSNP:778142701
425 425 a, g dbSNP:374849566
432 432 a, c dbSNP:546498438
448 448 a, t dbSNP:779435434
452 452 a, g dbSNP:745356915
463 463 a, c, g, t dbSNP:148234101
474 474 c, t dbSNP:372905837
498 498 a, g dbSNP:758830352
518 518 a, g dbSNP:779555164
521 521 c, g dbSNP:201904223
528 528 c, t dbSNP:531037984
546 546 c, g dbSNP:573578687
554 554 g, t dbSNP:768327888
562 562 a, t dbSNP:374871677
568 568 a, g dbSNP:747946698
569 569 c, t dbSNP:769779855
570 570 a, g dbSNP:544545223
573 573 c, t dbSNP:141479055
578 578 g, t dbSNP:766251479
589 589 a, g dbSNP:775598902
596 596 c, g dbSNP:760709272
597 597 c, t dbSNP:764352990
607 607 a, c dbSNP:565828321
611 611 c, g dbSNP:776691679
625 625 a, c dbSNP:761963687
630 630 c, t dbSNP:765464723
632 632 a, g dbSNP:750757835
634 634 c, t dbSNP:201505722
635 635 a, g dbSNP:371610941
640 640 a, g dbSNP:35507772
641 641 c, t dbSNP:138250523
645 645 c, t dbSNP:780791959
649 649 a, g dbSNP:752280215
657 657 a, g dbSNP:374509174
661 661 a, g dbSNP:777606798
668 668 a, g dbSNP:749084823
669 669 c, g dbSNP:537774136
674 674 c, t dbSNP:200800702
675 675 a, c, g dbSNP:577447875
682 682 a, c dbSNP:142740588
687 687 -, aga dbSNP:759148993
694 694 -, g dbSNP:771750846
700 700 a, g dbSNP:777555320
705 705 g, t dbSNP:753501002
719 719 a, g dbSNP:756934839
721 721 a, c dbSNP:778510124
733 733 -, c dbSNP:35345200
734 734 c, t dbSNP:745694860
735 735 c, t dbSNP:771953979
736 736 a, g, t dbSNP:369854223
738 738 c, t dbSNP:374001931
739 739 a, g dbSNP:373914978
743 743 a, g dbSNP:748039439
756 756 a, g dbSNP:146167779
767 767 c, t dbSNP:771207083
770 770 c, t dbSNP:774542031
775 775 a, g dbSNP:539882250
776 776 a, g dbSNP:139978578
778 778 a, c dbSNP:768114700
782 782 a, g dbSNP:776195272
791 791 c, t dbSNP:760258023
793 793 a, g dbSNP:763630223
798 798 a, g dbSNP:753399317
803 803 c, t dbSNP:756808842
805 805 a, g dbSNP:764970657
823 823 a, g dbSNP:750165510
834 834 a, g dbSNP:376077359
838 838 c, t dbSNP:370443921
839 839 a, g dbSNP:201091452
847 847 g, t dbSNP:754923275
848 848 c, g, t dbSNP:199727284
849 849 a, g dbSNP:771028607
855 855 c, t dbSNP:750159008
867 867 a, c dbSNP:372217244
872 872 c, g dbSNP:766107811
881 881 a, g dbSNP:751379440
920 920 c, t dbSNP:754871023
921 921 a, g dbSNP:781232988
924 924 a, g, t dbSNP:183088402
932 932 c, t dbSNP:375576432
936 936 a, g dbSNP:778996637
941 941 c, t dbSNP:746020361
945 945 a, g dbSNP:772436716
949 949 g, t dbSNP:780514168
955 955 a, g dbSNP:367574130
959 959 a, t dbSNP:769009217
968 968 a, g dbSNP:777255659
971 971 a, c, g dbSNP:77917939
980 980 a, g dbSNP:371808630
995 995 g, t dbSNP:772725587
999 999 a, c dbSNP:75004292
1002 1002 a, g dbSNP:78829055
1004 1004 c, g dbSNP:74851274
1005 1005 c, t dbSNP:762544798
1006 1006 c, t dbSNP:562452298
1012 1012 a, g dbSNP:529513884
1017 1017 c, t dbSNP:759426348
1019 1019 c, t dbSNP:767342487
1020 1020 a, g dbSNP:752745507
1021 1021 a, g dbSNP:756009604
1031 1031 a, g dbSNP:778993014
1034 1034 c, t dbSNP:750548811
1040 1040 g, t dbSNP:758650847
1042 1042 a, c dbSNP:144789254
1048 1048 a, c dbSNP:747353720
1051 1051 a, g dbSNP:769133403
1052 1052 a, g dbSNP:781417290
1055 1055 c, g dbSNP:748634113
1076 1076 a, g dbSNP:755192521
1078 1078 a, c, t dbSNP:374431370
1080 1080 c, g dbSNP:573842028
1085 1085 a, g dbSNP:778250145
1087 1087 c, t dbSNP:746862792
1088 1088 -, ggcaaa dbSNP:779532295
1090 1090 a, g dbSNP:368842223
1095 1095 a, c, g dbSNP:113276417
1101 1101 a, g dbSNP:745400492
1105 1105 a, g dbSNP:374804284
1107 1107 a, c, t dbSNP:771720042
1108 1108 a, g dbSNP:148552843
1115 1115 c, t dbSNP:146874010
1116 1116 a, g dbSNP:199834761
1117 1117 c, t dbSNP:144322038
1118 1118 a, g dbSNP:376875144
1120 1120 a, g dbSNP:774458462
1121 1121 c, t dbSNP:759584308
1126 1126 c, t dbSNP:767767481
1137 1137 a, g dbSNP:761365640
1141 1141 g, t dbSNP:147794087
1143 1143 -, gaa dbSNP:746428107
1148 1148 a, c dbSNP:764382586
1153 1153 c, t dbSNP:577880125
1170 1170 c, g dbSNP:757721106
1176 1176 a, g dbSNP:779324128
1193 1193 -, a dbSNP:771599120
1200 1200 c, t dbSNP:749923600
1201 1201 a, g dbSNP:757900171
1206 1206 c, t dbSNP:779749859
1210 1210 c, t dbSNP:375693032
1211 1211 a, g dbSNP:768448154
1213 1213 g, t dbSNP:781098649
1217 1217 c, g, t dbSNP:748001624
1219 1219 c, t dbSNP:773083023
1224 1224 c, g dbSNP:759659124
1230 1230 c, g dbSNP:771981013
1233 1233 c, t dbSNP:367931698
1236 1236 c, t dbSNP:370063191
1237 1237 c, g dbSNP:764331208
1240 1240 c, t dbSNP:754169869
1243 1243 a, g dbSNP:762209891
1254 1254 a, g dbSNP:765758424
1262 1262 a, g dbSNP:750955571
1264 1264 a, c, t dbSNP:769469670
1265 1265 a, g dbSNP:758947223
1274 1274 a, g dbSNP:776896239
1277 1277 c, t dbSNP:762160419
1288 1288 c, g, t dbSNP:767130682
1292 1292 a, t dbSNP:750823699
1295 1295 c, g dbSNP:139485976
1298 1298 a, g dbSNP:766949973
1304 1304 g, t dbSNP:751092726
1307 1307 a, g dbSNP:754598196
1308 1308 a, c, g dbSNP:767278183
1310 1310 g, t dbSNP:755806512
1316 1316 a, g dbSNP:777379469
1317 1317 c, t dbSNP:1055254
1320 1320 a, g dbSNP:757107457
1327 1327 a, g dbSNP:377181822
1328 1328 c, t dbSNP:747078307
1333 1333 a, c dbSNP:768789510
1337 1337 c, t dbSNP:373620147
1338 1338 a, g dbSNP:371198789
1345 1345 c, g dbSNP:770088619
1346 1346 c, t dbSNP:376206527
1349 1349 a, c dbSNP:150920378
1350 1350 a, c dbSNP:746306645
1353 1353 c, t dbSNP:538069623
1358 1358 a, t dbSNP:758981126
1365 1365 c, t dbSNP:766787587
1366 1366 a, g dbSNP:775068164
1368 1368 g, t dbSNP:760127486
1369 1369 c, t dbSNP:767081825
1370 1370 a, c dbSNP:752276156
1375 1375 a, g dbSNP:755679971
1388 1388 a, g dbSNP:780775645
1394 1394 a, g dbSNP:763844729
1398 1398 -, agctt dbSNP:761561337
1402 1402 c, t dbSNP:556418019
1405 1405 c, g dbSNP:757133440
1409 1409 c, t dbSNP:370217644
1410 1410 a, c, g dbSNP:745738396
1420 1420 -, gttt dbSNP:765062312
1424 1424 g, t dbSNP:781211218
1429 1429 a, g dbSNP:200728035
1436 1436 a, g dbSNP:747073827
1442 1442 c, g dbSNP:773542023
1448 1448 c, t dbSNP:373923791
1449 1449 a, g dbSNP:766287938
1450 1450 c, g dbSNP:150753064
1453 1453 c, t dbSNP:774318678
1454 1454 a, g dbSNP:776016532
1475 1475 g, t dbSNP:761403515
1479 1479 a, g dbSNP:368311811
1489 1489 -, tct dbSNP:570050686
1495 1495 a, t dbSNP:764911836
1501 1501 c, t dbSNP:750198502
1511 1511 g, t dbSNP:762795276
1517 1517 a, g dbSNP:766300150
1520 1520 c, t dbSNP:751451584
1553 1553 -, at dbSNP:78262056
1554 1554 -, tt dbSNP:780168469
1554 1554 -, t dbSNP:5812480
1555 1555 -, t dbSNP:759545218
1567 1567 -, tt dbSNP:3075141
1568 1568 -, t dbSNP:570528482
1599 1599 a, g dbSNP:550061066
1616 1616 a, g dbSNP:190065403
1655 1655 g, t dbSNP:576217437
1682 1682 a, g dbSNP:553628122
1683 1683 c, t dbSNP:192926937
1704 1704 c, t dbSNP:375999919
1741 1741 c, t dbSNP:80110211
1788 1788 -, ttc dbSNP:201186301
1790 1790 -, ctt dbSNP:375628334
1797 1797 -, ct dbSNP:3075142
1799 1799 -, ct dbSNP:397774483
1799 1799 c, t dbSNP:202094466
1811 1811 -, t dbSNP:34484949
1841 1841 a, g dbSNP:767049086
1842 1842 a, g dbSNP:750010916
1891 1891 g, t dbSNP:370667288
1922 1922 c, t dbSNP:185562132
1941 1941 a, g dbSNP:189368783
2001 2001 a, g dbSNP:752246309
2010 2010 -, t dbSNP:534910406
2017 2017 c, t dbSNP:182022714
2022 2022 a, g dbSNP:760392476
2089 2089 c, g, t dbSNP:185268010
2092 2092 c, g dbSNP:765456127
2113 2113 a, c dbSNP:116742387
2192 2192 a, g dbSNP:2078024
2195 2195 a, c dbSNP:566823136
2198 2198 -, t dbSNP:770783109
2202 2202 a, c dbSNP:542311505
2338 2338 c, t dbSNP:563682553
2357 2357 a, c dbSNP:780685761
2475 2475 c, t dbSNP:534277253
2480 2480 a, c dbSNP:368454790
2540 2540 g, t dbSNP:188461311
2586 2586 -, a dbSNP:558009170
2602 2602 a, g dbSNP:74950266
2604 2604 a, g dbSNP:62012164
2607 2607 a, c dbSNP:571510838
2636 2636 a, g dbSNP:372707595
2672 2672 a, g dbSNP:532240549
2684 2684 a, t dbSNP:555615135
2687 2687 a, g dbSNP:780181000
2689 2689 a, g dbSNP:181095614
2695 2695 c, t dbSNP:74339964
2732 2732 a, t dbSNP:565708750
2733 2733 c, t dbSNP:537695536
2793 2793 c, t dbSNP:139105743
2837 2837 a, g dbSNP:554200469
2847 2847 a, g dbSNP:186378802
2851 2851 c, t dbSNP:12910584
2852 2852 a, g dbSNP:78582068
2869 2869 c, g dbSNP:577446009
2882 2882 a, g dbSNP:770048660
2893 2893 a, g dbSNP:778780218
2906 2906 a, g dbSNP:12910486
2913 2913 g, t dbSNP:919447
2926 2926 a, c dbSNP:770749904
2937 2937 a, g dbSNP:774227119
2966 2966 c, t dbSNP:191693642
2983 2983 c, t dbSNP:369186229
3078 3078 g, t dbSNP:574898263
3102 3102 -, tt dbSNP:369016728
3112 3112 a, g dbSNP:542346418
3114 3114 a, t dbSNP:759496663
3127 3127 c, t dbSNP:563768599
3192 3192 a, g dbSNP:771516567
3200 3200 a, g dbSNP:563026149
3210 3210 a, t dbSNP:575750370
3219 3219 c, g dbSNP:546204831
3229 3229 c, g dbSNP:565059845
3230 3230 a, g dbSNP:183527205
3250 3250 g, t dbSNP:547340663
3289 3289 c, g dbSNP:775073135
3329 3329 a, g dbSNP:746001076
3339 3339 a, g dbSNP:760172717
3348 3348 c, g dbSNP:559508232
3351 3351 c, t dbSNP:763790702
3354 3354 g, t dbSNP:185975656
3374 3374 a, g dbSNP:563242765
3376 3376 a, g dbSNP:569400906
3393 3393 a, t dbSNP:536677415
3521 3521 -, cc dbSNP:773857120
3521 3521 a, c dbSNP:62012165
3521 3521 -, c dbSNP:773381976
3522 3522 -, a dbSNP:779861558
3522 3522 -, c dbSNP:775317231
3522 3522 c, g dbSNP:113635971
3523 3523 -, aa dbSNP:546964057
3523 3523 -, a dbSNP:112232361
3524 3524 a, c dbSNP:78006762
3528 3528 -, g dbSNP:539042143
3534 3534 a, t dbSNP:551780162
3536 3536 a, g dbSNP:570320534
3540 3540 g, t dbSNP:115964375

Target ORF information:

RefSeq Version XM_006720461
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48214
Accession Version XM_005254280.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1356bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530405635. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)239..1540(+)
Misc Feature(2)263..406(+)
Misc Feature(3)1235..1477(+)
Position Chain Variation Link
13 13 c, t dbSNP:535454664
17 17 c, t dbSNP:376158843
30 30 a, c dbSNP:569927295
35 35 a, g dbSNP:146730067
39 39 a, c dbSNP:17435932
40 40 a, g dbSNP:767230489
50 50 g, t dbSNP:577087676
65 65 a, c dbSNP:757398343
85 85 c, g dbSNP:534747533
106 106 g, t dbSNP:79788893
110 110 c, t dbSNP:60899981
149 149 c, t dbSNP:112146243
172 172 a, c dbSNP:748242852
181 181 c, g dbSNP:756364780
188 188 g, t dbSNP:778079256
191 191 a, c dbSNP:373537285
197 197 a, g, t dbSNP:374696107
198 198 -, c dbSNP:772127477
204 204 a, g dbSNP:746434947
214 214 a, g dbSNP:541413519
216 216 a, c dbSNP:774917422
217 217 a, t dbSNP:760214055
221 221 a, g dbSNP:768166997
229 229 c, t dbSNP:202195090
233 233 a, t dbSNP:761505155
238 238 c, t dbSNP:113198138
244 244 a, t dbSNP:775325553
247 247 a, g dbSNP:761943991
256 256 a, g dbSNP:765372528
260 260 a, g dbSNP:139521545
261 261 c, t dbSNP:763106907
268 268 c, t dbSNP:766613319
276 276 c, t dbSNP:751913991
298 298 c, t dbSNP:755338980
302 302 c, t dbSNP:768046007
303 303 a, g dbSNP:558491610
305 305 a, g dbSNP:755680551
306 306 c, t dbSNP:777350810
314 314 -, ag dbSNP:763844076
323 323 a, g dbSNP:747232695
324 324 c, t dbSNP:756918705
333 333 a, g dbSNP:770973590
336 336 a, g dbSNP:774627733
338 338 a, g dbSNP:35720727
342 342 a, c dbSNP:772351482
357 357 c, g, t dbSNP:75689896
360 360 c, t dbSNP:761149976
362 362 c, g dbSNP:764662841
368 368 a, g dbSNP:754442774
372 372 c, g, t dbSNP:761389243
374 374 a, g, t dbSNP:764224604
375 375 c, t dbSNP:573044562
377 377 g, t dbSNP:147777330
392 392 a, g dbSNP:751326500
396 396 c, t dbSNP:754818092
397 397 c, t dbSNP:781096044
400 400 a, g dbSNP:748150281
412 412 a, c dbSNP:756081633
414 414 c, g, t dbSNP:147019358
415 415 a, g dbSNP:772142490
417 417 a, g dbSNP:775892131
418 418 c, t dbSNP:776852711
419 419 a, g dbSNP:370698577
420 420 a, c dbSNP:777144504
428 428 c, g dbSNP:762173228
433 433 c, t dbSNP:529083306
435 435 a, g dbSNP:117291857
443 443 a, c dbSNP:371025596
446 446 a, t dbSNP:765995152
448 448 a, g dbSNP:562566800
453 453 a, c, t dbSNP:149095986
455 455 -, t dbSNP:770178533
465 465 a, c dbSNP:753575527
476 476 a, g dbSNP:150063259
485 485 a, g dbSNP:370436045
488 488 g, t dbSNP:751661500
501 501 c, t dbSNP:755161315
502 502 a, t dbSNP:143136439
504 504 g, t dbSNP:753031753
514 514 c, g dbSNP:756294556
515 515 a, t dbSNP:778142701
516 516 a, g dbSNP:374849566
523 523 a, c dbSNP:546498438
539 539 a, t dbSNP:779435434
543 543 a, g dbSNP:745356915
554 554 a, c, g, t dbSNP:148234101
565 565 c, t dbSNP:372905837
589 589 a, g dbSNP:758830352
609 609 a, g dbSNP:779555164
612 612 c, g dbSNP:201904223
619 619 c, t dbSNP:531037984
637 637 c, g dbSNP:573578687
645 645 g, t dbSNP:768327888
653 653 a, t dbSNP:374871677
659 659 a, g dbSNP:747946698
660 660 c, t dbSNP:769779855
661 661 a, g dbSNP:544545223
664 664 c, t dbSNP:141479055
669 669 g, t dbSNP:766251479
680 680 a, g dbSNP:775598902
687 687 c, g dbSNP:760709272
688 688 c, t dbSNP:764352990
698 698 a, c dbSNP:565828321
702 702 c, g dbSNP:776691679
716 716 a, c dbSNP:761963687
721 721 c, t dbSNP:765464723
723 723 a, g dbSNP:750757835
725 725 c, t dbSNP:201505722
726 726 a, g dbSNP:371610941
731 731 a, g dbSNP:35507772
732 732 c, t dbSNP:138250523
736 736 c, t dbSNP:780791959
740 740 a, g dbSNP:752280215
748 748 a, g dbSNP:374509174
752 752 a, g dbSNP:777606798
759 759 a, g dbSNP:749084823
760 760 c, g dbSNP:537774136
765 765 c, t dbSNP:200800702
766 766 a, c, g dbSNP:577447875
773 773 a, c dbSNP:142740588
778 778 -, aga dbSNP:759148993
785 785 -, g dbSNP:771750846
791 791 a, g dbSNP:777555320
796 796 g, t dbSNP:753501002
810 810 a, g dbSNP:756934839
812 812 a, c dbSNP:778510124
824 824 -, c dbSNP:35345200
825 825 c, t dbSNP:745694860
826 826 c, t dbSNP:771953979
827 827 a, g, t dbSNP:369854223
829 829 c, t dbSNP:374001931
830 830 a, g dbSNP:373914978
834 834 a, g dbSNP:748039439
847 847 a, g dbSNP:146167779
858 858 c, t dbSNP:771207083
861 861 c, t dbSNP:774542031
866 866 a, g dbSNP:539882250
867 867 a, g dbSNP:139978578
869 869 a, c dbSNP:768114700
873 873 a, g dbSNP:776195272
882 882 c, t dbSNP:760258023
884 884 a, g dbSNP:763630223
889 889 a, g dbSNP:753399317
894 894 c, t dbSNP:756808842
896 896 a, g dbSNP:764970657
914 914 a, g dbSNP:750165510
925 925 a, g dbSNP:376077359
929 929 c, t dbSNP:370443921
930 930 a, g dbSNP:201091452
938 938 g, t dbSNP:754923275
939 939 c, g, t dbSNP:199727284
940 940 a, g dbSNP:771028607
946 946 c, t dbSNP:750159008
958 958 a, c dbSNP:372217244
963 963 c, g dbSNP:766107811
972 972 a, g dbSNP:751379440
1011 1011 c, t dbSNP:754871023
1012 1012 a, g dbSNP:781232988
1015 1015 a, g, t dbSNP:183088402
1023 1023 c, t dbSNP:375576432
1027 1027 a, g dbSNP:778996637
1032 1032 c, t dbSNP:746020361
1036 1036 a, g dbSNP:772436716
1040 1040 g, t dbSNP:780514168
1046 1046 a, g dbSNP:367574130
1050 1050 a, t dbSNP:769009217
1059 1059 a, g dbSNP:777255659
1062 1062 a, c, g dbSNP:77917939
1071 1071 a, g dbSNP:371808630
1086 1086 g, t dbSNP:772725587
1090 1090 a, c dbSNP:75004292
1093 1093 a, g dbSNP:78829055
1095 1095 c, g dbSNP:74851274
1096 1096 c, t dbSNP:762544798
1097 1097 c, t dbSNP:562452298
1103 1103 a, g dbSNP:529513884
1108 1108 c, t dbSNP:759426348
1110 1110 c, t dbSNP:767342487
1111 1111 a, g dbSNP:752745507
1112 1112 a, g dbSNP:756009604
1122 1122 a, g dbSNP:778993014
1125 1125 c, t dbSNP:750548811
1131 1131 g, t dbSNP:758650847
1133 1133 a, c dbSNP:144789254
1139 1139 a, c dbSNP:747353720
1142 1142 a, g dbSNP:769133403
1143 1143 a, g dbSNP:781417290
1146 1146 c, g dbSNP:748634113
1167 1167 a, g dbSNP:755192521
1169 1169 a, c, t dbSNP:374431370
1171 1171 c, g dbSNP:573842028
1176 1176 a, g dbSNP:778250145
1178 1178 c, t dbSNP:746862792
1179 1179 -, ggcaaa dbSNP:779532295
1181 1181 a, g dbSNP:368842223
1186 1186 a, c, g dbSNP:113276417
1192 1192 a, g dbSNP:745400492
1196 1196 a, g dbSNP:374804284
1198 1198 a, c, t dbSNP:771720042
1199 1199 a, g dbSNP:148552843
1206 1206 c, t dbSNP:146874010
1207 1207 a, g dbSNP:199834761
1208 1208 c, t dbSNP:144322038
1209 1209 a, g dbSNP:376875144
1211 1211 a, g dbSNP:774458462
1212 1212 c, t dbSNP:759584308
1217 1217 c, t dbSNP:767767481
1228 1228 a, g dbSNP:761365640
1232 1232 g, t dbSNP:147794087
1234 1234 -, gaa dbSNP:746428107
1239 1239 a, c dbSNP:764382586
1244 1244 c, t dbSNP:577880125
1261 1261 c, g dbSNP:757721106
1267 1267 a, g dbSNP:779324128
1284 1284 -, a dbSNP:771599120
1291 1291 c, t dbSNP:749923600
1292 1292 a, g dbSNP:757900171
1297 1297 c, t dbSNP:779749859
1301 1301 c, t dbSNP:375693032
1302 1302 a, g dbSNP:768448154
1304 1304 g, t dbSNP:781098649
1308 1308 c, g, t dbSNP:748001624
1310 1310 c, t dbSNP:773083023
1315 1315 c, g dbSNP:759659124
1321 1321 c, g dbSNP:771981013
1324 1324 c, t dbSNP:367931698
1327 1327 c, t dbSNP:370063191
1328 1328 c, g dbSNP:764331208
1331 1331 c, t dbSNP:754169869
1334 1334 a, g dbSNP:762209891
1345 1345 a, g dbSNP:765758424
1353 1353 a, g dbSNP:750955571
1355 1355 a, c, t dbSNP:769469670
1356 1356 a, g dbSNP:758947223
1365 1365 a, g dbSNP:776896239
1368 1368 c, t dbSNP:762160419
1379 1379 c, g, t dbSNP:767130682
1383 1383 a, t dbSNP:750823699
1386 1386 c, g dbSNP:139485976
1389 1389 a, g dbSNP:766949973
1395 1395 g, t dbSNP:751092726
1398 1398 a, g dbSNP:754598196
1399 1399 a, c, g dbSNP:767278183
1401 1401 g, t dbSNP:755806512
1407 1407 a, g dbSNP:777379469
1408 1408 c, t dbSNP:1055254
1411 1411 a, g dbSNP:757107457
1418 1418 a, g dbSNP:377181822
1419 1419 c, t dbSNP:747078307
1424 1424 a, c dbSNP:768789510
1428 1428 c, t dbSNP:373620147
1429 1429 a, g dbSNP:371198789
1436 1436 c, g dbSNP:770088619
1437 1437 c, t dbSNP:376206527
1440 1440 a, c dbSNP:150920378
1441 1441 a, c dbSNP:746306645
1444 1444 c, t dbSNP:538069623
1449 1449 a, t dbSNP:758981126
1456 1456 c, t dbSNP:766787587
1457 1457 a, g dbSNP:775068164
1459 1459 g, t dbSNP:760127486
1460 1460 c, t dbSNP:767081825
1461 1461 a, c dbSNP:752276156
1466 1466 a, g dbSNP:755679971
1479 1479 a, g dbSNP:780775645
1485 1485 a, g dbSNP:763844729
1489 1489 -, agctt dbSNP:761561337
1493 1493 c, t dbSNP:556418019
1496 1496 c, g dbSNP:757133440
1500 1500 c, t dbSNP:370217644
1501 1501 a, c, g dbSNP:745738396
1511 1511 -, gttt dbSNP:765062312
1515 1515 g, t dbSNP:781211218
1520 1520 a, g dbSNP:200728035
1527 1527 a, g dbSNP:747073827
1533 1533 c, g dbSNP:773542023
1558 1558 c, g dbSNP:371416601
1562 1562 c, t dbSNP:200160678
1576 1576 a, t dbSNP:756585144
1579 1579 c, t dbSNP:778305075
1587 1587 a, g dbSNP:753372861
1589 1589 a, g dbSNP:756782281
1594 1594 c, g dbSNP:778486123
1595 1595 c, t dbSNP:745451388
1603 1603 a, g dbSNP:771777388
1607 1607 c, t dbSNP:200556221
1608 1608 c, t dbSNP:768555380
1609 1609 a, g dbSNP:141588026
1616 1616 a, c dbSNP:150895583
1619 1619 c, t dbSNP:139377249
1620 1620 a, g dbSNP:761817125
1621 1621 a, c dbSNP:770858827
1627 1627 -, c dbSNP:750950812
1631 1631 a, g dbSNP:760190246
1638 1638 -, acta dbSNP:532275129
1640 1640 c, t dbSNP:781332253
1641 1641 c, t dbSNP:774513018
1643 1643 c, t dbSNP:759641323
1649 1649 c, t dbSNP:143970875
1651 1651 c, t dbSNP:202193146
1652 1652 a, g dbSNP:200898126
1656 1656 c, g dbSNP:368225098
1660 1660 a, g dbSNP:765828688
1662 1662 a, g dbSNP:754227723
1668 1668 a, c dbSNP:757792097
1672 1672 -, aatc dbSNP:747595528
1678 1678 a, c, g dbSNP:778236216
1680 1680 c, t dbSNP:758091348
1681 1681 a, c dbSNP:374422980
1683 1683 a, c, t dbSNP:779900462
1684 1684 c, g dbSNP:754755632
1685 1685 -, a dbSNP:754428362
1690 1690 -, tt dbSNP:780744742
1692 1692 c, t dbSNP:376332909
1693 1693 c, t dbSNP:747987177
1695 1695 c, t dbSNP:113970964
1701 1701 -, a dbSNP:747728689
1706 1706 a, c dbSNP:573084831
1755 1755 g, t dbSNP:534054758
1772 1772 a, c dbSNP:555464943
1817 1817 -, agtc dbSNP:555695591
1831 1831 a, g dbSNP:8038399
1843 1843 c, t dbSNP:112490507
1855 1855 -, ttgag dbSNP:565634501
1855 1855 c, t dbSNP:568971467
1881 1881 a, g dbSNP:562854785
1884 1884 a, g dbSNP:575499671
1901 1901 c, t dbSNP:56208309
1909 1909 a, c dbSNP:200225201
1911 1911 -, a, aa dbSNP:34096112
1911 1911 a, g dbSNP:80138105
1912 1912 -, a dbSNP:57784434
1913 1913 a, g dbSNP:79389607
1926 1926 -, c dbSNP:536303052
1926 1926 a, c dbSNP:72727270
1928 1928 -, a dbSNP:56133417
1929 1929 a, t dbSNP:77245685

Target ORF information:

RefSeq Version XM_005254280
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48215
Accession Version XM_006720462.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1317bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578826799. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)153..1430(+)
Misc Feature(2)153..296(+)
Misc Feature(3)477..647(+)
Misc Feature(4)1125..1367(+)
Position Chain Variation Link
1 1 a, g dbSNP:189968039
44 44 a, g dbSNP:576540152
50 50 c, t dbSNP:765407724
51 51 a, g dbSNP:151334901
74 74 a, g dbSNP:758760998
105 105 c, t dbSNP:766666589
111 111 c, t dbSNP:535295613
115 115 a, g dbSNP:556723180
134 134 a, t dbSNP:775325553
137 137 a, g dbSNP:761943991
146 146 a, g dbSNP:765372528
150 150 a, g dbSNP:139521545
151 151 c, t dbSNP:763106907
158 158 c, t dbSNP:766613319
166 166 c, t dbSNP:751913991
188 188 c, t dbSNP:755338980
192 192 c, t dbSNP:768046007
193 193 a, g dbSNP:558491610
195 195 a, g dbSNP:755680551
196 196 c, t dbSNP:777350810
204 204 -, ag dbSNP:763844076
213 213 a, g dbSNP:747232695
214 214 c, t dbSNP:756918705
223 223 a, g dbSNP:770973590
226 226 a, g dbSNP:774627733
228 228 a, g dbSNP:35720727
232 232 a, c dbSNP:772351482
247 247 c, g, t dbSNP:75689896
250 250 c, t dbSNP:761149976
252 252 c, g dbSNP:764662841
258 258 a, g dbSNP:754442774
262 262 c, g, t dbSNP:761389243
264 264 a, g, t dbSNP:764224604
265 265 c, t dbSNP:573044562
267 267 g, t dbSNP:147777330
282 282 a, g dbSNP:751326500
286 286 c, t dbSNP:754818092
287 287 c, t dbSNP:781096044
290 290 a, g dbSNP:748150281
302 302 a, c dbSNP:756081633
304 304 c, g, t dbSNP:147019358
305 305 a, g dbSNP:772142490
307 307 a, g dbSNP:775892131
308 308 c, t dbSNP:776852711
309 309 a, g dbSNP:370698577
310 310 a, c dbSNP:777144504
318 318 c, g dbSNP:762173228
323 323 c, t dbSNP:529083306
325 325 a, g dbSNP:117291857
333 333 a, c dbSNP:371025596
336 336 a, t dbSNP:765995152
338 338 a, g dbSNP:562566800
343 343 a, c, t dbSNP:149095986
345 345 -, t dbSNP:770178533
355 355 a, c dbSNP:753575527
366 366 a, g dbSNP:150063259
375 375 a, g dbSNP:370436045
378 378 g, t dbSNP:751661500
391 391 c, t dbSNP:755161315
392 392 a, t dbSNP:143136439
394 394 g, t dbSNP:753031753
404 404 c, g dbSNP:756294556
405 405 a, t dbSNP:778142701
406 406 a, g dbSNP:374849566
413 413 a, c dbSNP:546498438
429 429 a, t dbSNP:779435434
433 433 a, g dbSNP:745356915
444 444 a, c, g, t dbSNP:148234101
455 455 c, t dbSNP:372905837
479 479 a, g dbSNP:758830352
499 499 a, g dbSNP:779555164
502 502 c, g dbSNP:201904223
509 509 c, t dbSNP:531037984
527 527 c, g dbSNP:573578687
535 535 g, t dbSNP:768327888
543 543 a, t dbSNP:374871677
549 549 a, g dbSNP:747946698
550 550 c, t dbSNP:769779855
551 551 a, g dbSNP:544545223
554 554 c, t dbSNP:141479055
559 559 g, t dbSNP:766251479
570 570 a, g dbSNP:775598902
577 577 c, g dbSNP:760709272
578 578 c, t dbSNP:764352990
588 588 a, c dbSNP:565828321
592 592 c, g dbSNP:776691679
606 606 a, c dbSNP:761963687
611 611 c, t dbSNP:765464723
613 613 a, g dbSNP:750757835
615 615 c, t dbSNP:201505722
616 616 a, g dbSNP:371610941
621 621 a, g dbSNP:35507772
622 622 c, t dbSNP:138250523
626 626 c, t dbSNP:780791959
630 630 a, g dbSNP:752280215
638 638 a, g dbSNP:374509174
642 642 a, g dbSNP:777606798
649 649 a, g dbSNP:749084823
650 650 c, g dbSNP:537774136
655 655 c, t dbSNP:200800702
656 656 a, c, g dbSNP:577447875
663 663 a, c dbSNP:142740588
668 668 -, aga dbSNP:759148993
675 675 -, g dbSNP:771750846
681 681 a, g dbSNP:777555320
686 686 g, t dbSNP:753501002
700 700 a, g dbSNP:756934839
702 702 a, c dbSNP:778510124
714 714 -, c dbSNP:35345200
715 715 c, t dbSNP:745694860
716 716 c, t dbSNP:771953979
717 717 a, g, t dbSNP:369854223
719 719 c, t dbSNP:374001931
720 720 a, g dbSNP:373914978
724 724 a, g dbSNP:748039439
737 737 a, g dbSNP:146167779
748 748 c, t dbSNP:771207083
751 751 c, t dbSNP:774542031
756 756 a, g dbSNP:539882250
757 757 a, g dbSNP:139978578
759 759 a, c dbSNP:768114700
763 763 a, g dbSNP:776195272
772 772 c, t dbSNP:760258023
774 774 a, g dbSNP:763630223
779 779 a, g dbSNP:753399317
784 784 c, t dbSNP:756808842
786 786 a, g dbSNP:764970657
804 804 a, g dbSNP:750165510
815 815 a, g dbSNP:376077359
819 819 c, t dbSNP:370443921
820 820 a, g dbSNP:201091452
828 828 g, t dbSNP:754923275
829 829 c, g, t dbSNP:199727284
830 830 a, g dbSNP:771028607
836 836 c, t dbSNP:750159008
848 848 a, c dbSNP:372217244
853 853 c, g dbSNP:766107811
862 862 a, g dbSNP:751379440
901 901 c, t dbSNP:754871023
902 902 a, g dbSNP:781232988
905 905 a, g, t dbSNP:183088402
913 913 c, t dbSNP:375576432
917 917 a, g dbSNP:778996637
922 922 c, t dbSNP:746020361
926 926 a, g dbSNP:772436716
930 930 g, t dbSNP:780514168
936 936 a, g dbSNP:367574130
940 940 a, t dbSNP:769009217
949 949 a, g dbSNP:777255659
952 952 a, c, g dbSNP:77917939
961 961 a, g dbSNP:371808630
976 976 g, t dbSNP:772725587
980 980 a, c dbSNP:75004292
983 983 a, g dbSNP:78829055
985 985 c, g dbSNP:74851274
986 986 c, t dbSNP:762544798
987 987 c, t dbSNP:562452298
993 993 a, g dbSNP:529513884
998 998 c, t dbSNP:759426348
1000 1000 c, t dbSNP:767342487
1001 1001 a, g dbSNP:752745507
1002 1002 a, g dbSNP:756009604
1012 1012 a, g dbSNP:778993014
1015 1015 c, t dbSNP:750548811
1021 1021 g, t dbSNP:758650847
1023 1023 a, c dbSNP:144789254
1029 1029 a, c dbSNP:747353720
1032 1032 a, g dbSNP:769133403
1033 1033 a, g dbSNP:781417290
1036 1036 c, g dbSNP:748634113
1057 1057 a, g dbSNP:755192521
1059 1059 a, c, t dbSNP:374431370
1061 1061 c, g dbSNP:573842028
1066 1066 a, g dbSNP:778250145
1068 1068 c, t dbSNP:746862792
1069 1069 -, ggcaaa dbSNP:779532295
1071 1071 a, g dbSNP:368842223
1076 1076 a, c, g dbSNP:113276417
1082 1082 a, g dbSNP:745400492
1086 1086 a, g dbSNP:374804284
1088 1088 a, c, t dbSNP:771720042
1089 1089 a, g dbSNP:148552843
1096 1096 c, t dbSNP:146874010
1097 1097 a, g dbSNP:199834761
1098 1098 c, t dbSNP:144322038
1099 1099 a, g dbSNP:376875144
1101 1101 a, g dbSNP:774458462
1102 1102 c, t dbSNP:759584308
1107 1107 c, t dbSNP:767767481
1118 1118 a, g dbSNP:761365640
1122 1122 g, t dbSNP:147794087
1124 1124 -, gaa dbSNP:746428107
1129 1129 a, c dbSNP:764382586
1134 1134 c, t dbSNP:577880125
1151 1151 c, g dbSNP:757721106
1157 1157 a, g dbSNP:779324128
1174 1174 -, a dbSNP:771599120
1181 1181 c, t dbSNP:749923600
1182 1182 a, g dbSNP:757900171
1187 1187 c, t dbSNP:779749859
1191 1191 c, t dbSNP:375693032
1192 1192 a, g dbSNP:768448154
1194 1194 g, t dbSNP:781098649
1198 1198 c, g, t dbSNP:748001624
1200 1200 c, t dbSNP:773083023
1205 1205 c, g dbSNP:759659124
1211 1211 c, g dbSNP:771981013
1214 1214 c, t dbSNP:367931698
1217 1217 c, t dbSNP:370063191
1218 1218 c, g dbSNP:764331208
1221 1221 c, t dbSNP:754169869
1224 1224 a, g dbSNP:762209891
1235 1235 a, g dbSNP:765758424
1243 1243 a, g dbSNP:750955571
1245 1245 a, c, t dbSNP:769469670
1246 1246 a, g dbSNP:758947223
1255 1255 a, g dbSNP:776896239
1258 1258 c, t dbSNP:762160419
1269 1269 c, g, t dbSNP:767130682
1273 1273 a, t dbSNP:750823699
1276 1276 c, g dbSNP:139485976
1279 1279 a, g dbSNP:766949973
1285 1285 g, t dbSNP:751092726
1288 1288 a, g dbSNP:754598196
1289 1289 a, c, g dbSNP:767278183
1291 1291 g, t dbSNP:755806512
1297 1297 a, g dbSNP:777379469
1298 1298 c, t dbSNP:1055254
1301 1301 a, g dbSNP:757107457
1308 1308 a, g dbSNP:377181822
1309 1309 c, t dbSNP:747078307
1314 1314 a, c dbSNP:768789510
1318 1318 c, t dbSNP:373620147
1319 1319 a, g dbSNP:371198789
1326 1326 c, g dbSNP:770088619
1327 1327 c, t dbSNP:376206527
1330 1330 a, c dbSNP:150920378
1331 1331 a, c dbSNP:746306645
1334 1334 c, t dbSNP:538069623
1339 1339 a, t dbSNP:758981126
1346 1346 c, t dbSNP:766787587
1347 1347 a, g dbSNP:775068164
1349 1349 g, t dbSNP:760127486
1350 1350 c, t dbSNP:767081825
1351 1351 a, c dbSNP:752276156
1356 1356 a, g dbSNP:755679971
1369 1369 a, g dbSNP:780775645
1375 1375 a, g dbSNP:763844729
1379 1379 -, agctt dbSNP:761561337
1383 1383 c, t dbSNP:556418019
1386 1386 c, g dbSNP:757133440
1390 1390 c, t dbSNP:370217644
1391 1391 a, c, g dbSNP:745738396
1401 1401 -, gttt dbSNP:765062312
1405 1405 g, t dbSNP:781211218
1410 1410 a, g dbSNP:200728035
1417 1417 a, g dbSNP:747073827
1423 1423 c, g dbSNP:773542023
1448 1448 c, g dbSNP:371416601
1452 1452 c, t dbSNP:200160678
1466 1466 a, t dbSNP:756585144
1469 1469 c, t dbSNP:778305075
1477 1477 a, g dbSNP:753372861
1479 1479 a, g dbSNP:756782281
1484 1484 c, g dbSNP:778486123
1485 1485 c, t dbSNP:745451388
1493 1493 a, g dbSNP:771777388
1497 1497 c, t dbSNP:200556221
1498 1498 c, t dbSNP:768555380
1499 1499 a, g dbSNP:141588026
1506 1506 a, c dbSNP:150895583
1509 1509 c, t dbSNP:139377249
1510 1510 a, g dbSNP:761817125
1511 1511 a, c dbSNP:770858827
1517 1517 -, c dbSNP:750950812
1521 1521 a, g dbSNP:760190246
1528 1528 -, acta dbSNP:532275129
1530 1530 c, t dbSNP:781332253
1531 1531 c, t dbSNP:774513018
1533 1533 c, t dbSNP:759641323
1539 1539 c, t dbSNP:143970875
1541 1541 c, t dbSNP:202193146
1542 1542 a, g dbSNP:200898126
1546 1546 c, g dbSNP:368225098
1550 1550 a, g dbSNP:765828688
1552 1552 a, g dbSNP:754227723
1558 1558 a, c dbSNP:757792097
1562 1562 -, aatc dbSNP:747595528
1568 1568 a, c, g dbSNP:778236216
1570 1570 c, t dbSNP:758091348
1571 1571 a, c dbSNP:374422980
1573 1573 a, c, t dbSNP:779900462
1574 1574 c, g dbSNP:754755632
1575 1575 -, a dbSNP:754428362
1580 1580 -, tt dbSNP:780744742
1582 1582 c, t dbSNP:376332909
1583 1583 c, t dbSNP:747987177
1585 1585 c, t dbSNP:113970964
1591 1591 -, a dbSNP:747728689
1596 1596 a, c dbSNP:573084831
1645 1645 g, t dbSNP:534054758
1662 1662 a, c dbSNP:555464943
1707 1707 -, agtc dbSNP:555695591
1721 1721 a, g dbSNP:8038399
1733 1733 c, t dbSNP:112490507
1745 1745 -, ttgag dbSNP:565634501
1745 1745 c, t dbSNP:568971467
1771 1771 a, g dbSNP:562854785
1774 1774 a, g dbSNP:575499671
1791 1791 c, t dbSNP:56208309
1799 1799 a, c dbSNP:200225201
1801 1801 -, a, aa dbSNP:34096112
1801 1801 a, g dbSNP:80138105
1802 1802 -, a dbSNP:57784434
1803 1803 a, g dbSNP:79389607
1816 1816 -, c dbSNP:536303052
1816 1816 a, c dbSNP:72727270
1818 1818 -, a dbSNP:56133417
1819 1819 a, t dbSNP:77245685

Target ORF information:

RefSeq Version XM_006720462
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens galactokinase 2 (GALK2), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48216
Accession Version XM_006720463.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1290bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product N-acetylgalactosamine kinase isoform X5
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578826801. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)128..1330(+)
Misc Feature(2)152..295(+)
Misc Feature(3)1025..1267(+)
Position Chain Variation Link
1 1 a, g dbSNP:779463005
20 20 c, t dbSNP:187183178
27 27 a, g dbSNP:780565014
37 37 c, g dbSNP:746488062
54 54 c, g dbSNP:768276574
59 59 a, c dbSNP:776132660
67 67 c, g dbSNP:376738182
78 78 c, t dbSNP:769334130
82 82 -, t dbSNP:752395604
84 84 a, c dbSNP:202114334
85 85 a, g dbSNP:150631282
86 86 a, g dbSNP:766397303
89 89 a, g dbSNP:751588077
90 90 c, g dbSNP:760667559
95 95 a, g dbSNP:764293707
100 100 a, g dbSNP:753879403
101 101 c, t dbSNP:757436137
104 104 c, t dbSNP:779141520
107 107 g, t dbSNP:750741381
111 111 a, g dbSNP:758797905
113 113 g, t dbSNP:780530278
125 125 c, t dbSNP:747605997
128 128 a, c, g dbSNP:769054090
129 129 a, g dbSNP:747641556
133 133 a, t dbSNP:775325553
136 136 a, g dbSNP:761943991
145 145 a, g dbSNP:765372528
149 149 a, g dbSNP:139521545
150 150 c, t dbSNP:763106907
157 157 c, t dbSNP:766613319
165 165 c, t dbSNP:751913991
187 187 c, t dbSNP:755338980
191 191 c, t dbSNP:768046007
192 192 a, g dbSNP:558491610
194 194 a, g dbSNP:755680551
195 195 c, t dbSNP:777350810
203 203 -, ag dbSNP:763844076
212 212 a, g dbSNP:747232695
213 213 c, t dbSNP:756918705
222 222 a, g dbSNP:770973590
225 225 a, g dbSNP:774627733
227 227 a, g dbSNP:35720727
231 231 a, c dbSNP:772351482
246 246 c, g, t dbSNP:75689896
249 249 c, t dbSNP:761149976
251 251 c, g dbSNP:764662841
257 257