
GBA cDNA ORF clone, Homo sapiens (human)

Gene Symbol GBA
Entrez Gene ID 2629
Full Name glucosidase, beta, acid
Synonyms GBA1, GCB, GLUC
General protein information
Preferred Names
acid beta-glucosidase
lysosomal glucocerebrosidase
D-glucosyl-N-acylsphingosine glucohydrolase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]. lac of sum
Disorder MIM:


Disorder Html: Gaucher disease, type I, 230800(3); Gaucher disease, type II, 230900

The following GBA gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GBA cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu22331 XM_006711270 PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379.00
OHu22331 XM_011509407 PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379.00
OHu54570 XM_006726211 PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu54570 XM_011546930 PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu22331 NM_001005742 Homo sapiens glucosidase, beta, acid (GBA), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379.00
OHu22331 NM_001005741 Homo sapiens glucosidase, beta, acid (GBA), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379.00
OHu22331 NM_000157 Homo sapiens glucosidase, beta, acid (GBA), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379.00
OHu22337 NM_001171811 Homo sapiens glucosidase, beta, acid (GBA), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379.00
OHu22347 NM_001171812 Homo sapiens glucosidase, beta, acid (GBA), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $409.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu22331
Accession Version XM_006711270.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1611bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucosylceramidase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_004487.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)447..1928(+)
Position Chain Variation Link
6 6 g, t dbSNP:527531505
7 7 c, t dbSNP:566752025
23 23 g, t dbSNP:376698321
33 33 c, t dbSNP:548224064
38 38 c, t dbSNP:771045561
65 65 g, t dbSNP:146422257
76 76 a, g dbSNP:761732863
122 122 a, g dbSNP:751033127
140 140 c, t dbSNP:149732676
149 149 c, g dbSNP:540373137
158 158 c, g dbSNP:574745231
191 191 a, g dbSNP:193125632
228 228 c, g dbSNP:537905430
229 229 c, g dbSNP:576924242
258 258 a, g dbSNP:558669512
280 280 c, g dbSNP:555143723
281 281 a, t dbSNP:756208042
283 283 a, g dbSNP:751503419
299 299 a, g dbSNP:780111782
300 300 c, g dbSNP:1064638
302 302 c, t dbSNP:537166707
304 304 -, tct dbSNP:759834373
306 306 -, t dbSNP:751685538
308 308 c, t dbSNP:1064639
311 311 a, g dbSNP:765067744
315 315 a, g dbSNP:41264927
316 316 a, g dbSNP:1064640
320 320 c, t dbSNP:550765395
321 321 c, t dbSNP:763568401
328 328 a, g, t dbSNP:1141801
337 337 c, t dbSNP:776015590
343 343 a, g dbSNP:201985614
352 352 c, g dbSNP:759983265
355 355 -, ag dbSNP:766291162
363 363 c, t dbSNP:763770350
365 365 c, t dbSNP:755682174
367 367 a, c, g dbSNP:150466109
369 369 c, t dbSNP:371238435
372 372 c, t dbSNP:774833277
373 373 c, t dbSNP:1141802
375 375 a, g dbSNP:1141804
378 378 a, g dbSNP:139626710
385 385 a, g dbSNP:376644484
387 387 a, g dbSNP:143187997
401 401 -, c dbSNP:397518433
410 410 a, t dbSNP:1059731
411 411 c, t dbSNP:201330214
413 413 -, g dbSNP:387906315
416 416 c, t dbSNP:748322959
422 422 -, g dbSNP:80356760
427 427 c, t dbSNP:776856496
429 429 a, g dbSNP:768854161
430 430 c, t dbSNP:745860677
433 433 c, g, t dbSNP:757041827
434 434 a, g dbSNP:148001886
437 437 a, g dbSNP:777383151
440 440 a, g dbSNP:755800314
445 445 a, g dbSNP:200378040
446 446 g, t dbSNP:747853210
450 450 c, t dbSNP:190207858
451 451 a, g, t dbSNP:751095441
453 453 c, t dbSNP:779377390
455 455 c, t dbSNP:758949381
461 461 c, t dbSNP:750891392
462 462 c, t dbSNP:765693058
465 465 a, g dbSNP:142761046
469 469 g, t dbSNP:543005460
473 473 c, t dbSNP:185884197
474 474 a, g dbSNP:760930573
477 477 c, t dbSNP:775652188
485 485 a, g dbSNP:756264143
489 489 g, t dbSNP:121908302
491 491 a, g dbSNP:763010874
493 493 c, g dbSNP:773007510
497 497 c, t dbSNP:145773486
502 502 a, g dbSNP:747971975
514 514 a, g dbSNP:145888253
518 518 a, c, g, t dbSNP:74953658
532 532 c, g, t dbSNP:141061530
533 533 a, g dbSNP:750712570
535 535 c, t dbSNP:757834551
544 544 a, c dbSNP:750990483
545 545 c, t dbSNP:151093421
548 548 -, t dbSNP:769900428
550 550 c, g dbSNP:371592589
551 551 -, tac dbSNP:761621516
552 552 a, g dbSNP:779258874
553 553 a, c dbSNP:373363286
557 557 a, c, g, t dbSNP:75954905
560 560 a, c dbSNP:368786234
561 561 c, t dbSNP:146774384
562 562 a, g dbSNP:752857428
566 566 g, t dbSNP:767693527
569 569 a, g dbSNP:76337315
572 572 c, t dbSNP:1141810
574 574 c, g, t dbSNP:1141811
576 576 a, c, t dbSNP:1141812
577 577 a, g dbSNP:765182795
583 583 a, g dbSNP:77829017
586 586 a, g dbSNP:144173415
588 588 c, t dbSNP:1141814
589 589 a, g dbSNP:78769774
590 590 a, g dbSNP:78669556
593 593 a, g dbSNP:746737219
596 596 a, g dbSNP:774985960
599 599 a, g dbSNP:771654706
604 604 c, t dbSNP:1141815
608 608 a, g dbSNP:1141816
612 612 a, g dbSNP:745398454
624 624 a, c, t dbSNP:1141818
625 625 a, g dbSNP:1141820
628 628 c, t dbSNP:757848523
629 629 c, g dbSNP:1141821
632 632 a, c dbSNP:778349378
637 637 a, g dbSNP:748485792
641 641 c, g dbSNP:781563451
647 647 g, t dbSNP:755161012
651 651 c, t dbSNP:368145008
653 653 a, g dbSNP:780169533
659 659 -, a dbSNP:779619231
683 683 c, g dbSNP:121908312
699 699 a, g dbSNP:758455177
700 700 g, t dbSNP:753816998
712 712 c, t dbSNP:763972468
716 716 a, c, t dbSNP:79175920
719 719 c, g dbSNP:752444566
741 741 c, g dbSNP:767272691
742 742 a, c dbSNP:759174705
751 751 a, g dbSNP:374003673
756 756 c, t dbSNP:770614424
766 766 a, c, t dbSNP:758447515
776 776 c, t dbSNP:772806479
783 783 a, g dbSNP:770218957
788 788 c, t dbSNP:772855106
789 789 a, g dbSNP:769343650
797 797 c, t dbSNP:77019233
802 802 g, t dbSNP:77834747
803 803 c, t dbSNP:147411159
804 804 c, t dbSNP:397515515
805 805 a, c, g dbSNP:79653797
806 806 a, g dbSNP:75249684
809 809 a, t dbSNP:747409352
810 810 c, t dbSNP:121908299
811 811 c, t dbSNP:79637617
812 812 c, t dbSNP:79767521
813 813 a, g dbSNP:377325220
815 815 a, g dbSNP:77959976
816 816 -, g dbSNP:398123529
819 819 a, t dbSNP:772293052
821 821 c, g dbSNP:746019841
826 826 a, t dbSNP:79796061
837 837 c, t dbSNP:398123530
838 838 a, g, t dbSNP:80356763
839 839 c, t dbSNP:74572011
845 845 c, t dbSNP:748085086
847 847 c, t dbSNP:78657146
848 848 a, c dbSNP:77191198
850 850 a, g dbSNP:781152868
853 853 a, c dbSNP:79660787
861 861 -, c dbSNP:397518434
864 864 c, g dbSNP:147138516
872 872 c, t dbSNP:563689350
874 874 a, g dbSNP:375193074
875 875 a, g dbSNP:545391048
879 879 c, t dbSNP:750077244
884 884 a, c dbSNP:764702561
915 915 a, c dbSNP:121908297
917 917 g, t dbSNP:78446355
919 919 c, t dbSNP:772419342
922 922 c, t dbSNP:80222298
923 923 a, c dbSNP:77916306
924 924 -, ct dbSNP:749714463
928 928 a, g, t dbSNP:77933015
931 931 a, c dbSNP:76500263
934 934 a, g dbSNP:398123531
952 952 a, g dbSNP:774609294
954 954 c, t dbSNP:398123532
955 955 a, g dbSNP:749416070
959 959 c, t dbSNP:201615998
960 960 a, g dbSNP:188760929
963 963 a, t dbSNP:398123533
965 965 a, g dbSNP:556008401
966 966 c, t dbSNP:374591570
968 968 c, t dbSNP:78659905
980 980 c, t dbSNP:76717906
986 986 a, c, t dbSNP:544083269
991 991 c, t dbSNP:80205046
992 992 a, c dbSNP:76727497
996 996 c, t dbSNP:61748906
1001 1001 c, t dbSNP:76682322
1009 1009 at, gg dbSNP:786200979
1009 1009 a, g dbSNP:364897
1010 1010 g, t dbSNP:381418
1012 1012 g, t dbSNP:78911246
1015 1015 a, c, t dbSNP:75636769
1016 1016 a, g dbSNP:75370695
1018 1018 a, c, g, t dbSNP:381427
1022 1022 c, t dbSNP:767914182
1025 1025 a, g dbSNP:375731497
1030 1030 a, g dbSNP:74462743
1031 1031 g, t dbSNP:774539868
1032 1032 c, t dbSNP:1064644
1034 1034 a, g dbSNP:76158190
1037 1037 c, t dbSNP:372785813
1038 1038 a, g dbSNP:773409311
1040 1040 a, g dbSNP:74486098
1049 1049 c, t dbSNP:376613535
1050 1050 a, g dbSNP:398123534
1051 1051 a, g dbSNP:77451368
1060 1060 a, g dbSNP:76026102
1069 1069 a, c dbSNP:772098596
1080 1080 c, t dbSNP:121908300
1083 1083 a, t dbSNP:381737
1085 1085 a, t dbSNP:79945741
1092 1092 g, t dbSNP:121908303
1093 1093 a, t dbSNP:74500255
1097 1097 a, g dbSNP:770615819
1105 1105 a, t dbSNP:749014188
1108 1108 c, t dbSNP:777370349
1109 1109 c, t dbSNP:546199839
1112 1112 a, g dbSNP:755722145
1117 1117 a, g dbSNP:752226690
1124 1124 a, g dbSNP:572370038
1138 1138 c, g dbSNP:76725886
1156 1156 c, t dbSNP:755512507
1166 1166 g, t dbSNP:371576958
1171 1171 a, g dbSNP:138246400
1175 1175 a, t dbSNP:763197747
1176 1176 c, t dbSNP:750777791
1178 1178 a, c dbSNP:765583147
1193 1193 a, g dbSNP:762073714
1199 1199 a, c dbSNP:121908313
1211 1211 g, t dbSNP:367968666
1216 1216 a, g dbSNP:78973108
1230 1230 c, t dbSNP:374117599
1231 1231 a, g dbSNP:140955685
1240 1240 a, g dbSNP:80116658
1242 1242 c, g dbSNP:770796008
1243 1243 c, g dbSNP:79215220
1246 1246 c, t dbSNP:199628072
1247 1247 c, g, t dbSNP:371856161
1250 1250 c, t dbSNP:708610
1251 1251 a, g dbSNP:368425393
1257 1257 a, g, t dbSNP:1057942
1258 1258 a, g dbSNP:74731340
1267 1267 a, g dbSNP:747591577
1268 1268 a, c dbSNP:780457481
1270 1270 a, g dbSNP:535896234
1280 1280 a, g dbSNP:575127557
1283 1283 c, g dbSNP:750834903
1299 1299 c, t dbSNP:765633380
1300 1300 a, g dbSNP:79696831
1304 1304 a, g dbSNP:753890133
1312 1312 c, t dbSNP:121908298
1316 1316 c, g dbSNP:142662866
1317 1317 g, t dbSNP:398123535
1329 1329 a, g dbSNP:764251205
1334 1334 c, g dbSNP:756307975
1341 1341 c, g dbSNP:374463271
1354 1354 a, t dbSNP:77714449
1355 1355 a, g dbSNP:1064646
1357 1357 a, g dbSNP:77321207
1362 1362 c, t dbSNP:181720335
1367 1367 c, t dbSNP:1064647
1372 1372 c, g, t dbSNP:78396650
1374 1374 a, g dbSNP:371083513
1378 1378 a, g dbSNP:78198234
1379 1379 c, t dbSNP:762944845
1382 1382 g, t dbSNP:121908304
1385 1385 c, t dbSNP:79311125
1387 1387 g, t dbSNP:540967271
1389 1389 a, c, g dbSNP:398123526
1394 1394 c, t dbSNP:530006262
1399 1399 a, c dbSNP:78188205
1405 1405 c, g dbSNP:761628930
1414 1414 c, t dbSNP:76539814
1415 1415 a, c, g dbSNP:760310921
1419 1419 a, g dbSNP:121908305
1421 1421 a, g dbSNP:143222798
1422 1422 a, g dbSNP:2230288
1424 1424 a, g dbSNP:80317710
1431 1431 c, t dbSNP:374306700
1432 1432 a, g dbSNP:1064648
1433 1433 c, t dbSNP:771522209
1442 1442 c, t dbSNP:749633975
1445 1445 c, t dbSNP:778140625
1458 1458 a, g dbSNP:80356765
1459 1459 c, t dbSNP:756292503
1460 1460 c, t dbSNP:752959907
1467 1467 a, g dbSNP:781306264
1470 1470 g, t dbSNP:121908306
1472 1472 c, t dbSNP:755021234
1483 1483 -, a dbSNP:781356917
1485 1485 c, t dbSNP:751598832
1488 1488 g, t dbSNP:765182863
1493 1493 a, g dbSNP:75391747
1496 1496 c, g dbSNP:761681845
1500 1500 c, g dbSNP:398123527
1502 1502 a, g dbSNP:753583304
1503 1503 c, g dbSNP:121908308
1504 1504 a, g dbSNP:11558184
1513 1513 c, t dbSNP:760307559
1521 1521 c, t dbSNP:121908309
1522 1522 a, g dbSNP:74979486
1529 1529 a, g dbSNP:149487315
1532 1532 a, g dbSNP:771744858
1534 1534 a, g dbSNP:76228122
1537 1537 c, g dbSNP:121908307
1538 1538 c, t dbSNP:773947710
1540 1540 a, c dbSNP:771575291
1544 1544 c, t dbSNP:75528494
1548 1548 a, g dbSNP:749736020
1552 1552 c, t dbSNP:75548401
1553 1553 a, g dbSNP:138498426
1555 1555 a, c, g dbSNP:76763715
1556 1556 c, t dbSNP:749227753
1557 1557 c, g dbSNP:121908314
1559 1559 c, g dbSNP:74498117
1569 1569 g, t dbSNP:398123528
1574 1574 c, t dbSNP:755952419
1575 1575 a, g dbSNP:121908311
1577 1577 a, c, g, t dbSNP:75034092
1579 1579 a, g dbSNP:754743440
1580 1580 g, t dbSNP:76014919
1583 1583 c, g dbSNP:751242076
1585 1585 a, c dbSNP:77284004
1586 1586 c, t dbSNP:78715199
1592 1592 -, ccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgt cgacagt dbSNP:80356768
1593 1593 a, c dbSNP:187143994
1597 1597 c, t dbSNP:762493290
1600 1600 c, t dbSNP:772548282
1607 1607 c, t dbSNP:201499639
1608 1608 a, g dbSNP:149171124
1618 1618 c, t dbSNP:76910485
1621 1621 a, g, t dbSNP:77738682
1622 1622 c, t dbSNP:777049786
1626 1626 g, t dbSNP:80356769
1629 1629 c, g dbSNP:747284798
1630 1630 a, g dbSNP:775661835
1631 1631 c, t dbSNP:772140702
1633 1633 a, c dbSNP:75385858
1634 1634 c, g, t dbSNP:778798290
1636 1636 c, t dbSNP:75243000
1638 1638 g, t dbSNP:121908310
1640 1640 c, g, t dbSNP:79032178
1643 1643 c, g, t dbSNP:75090908
1647 1647 c, t dbSNP:781189218
1648 1648 c, t dbSNP:74598136
1651 1651 c, t dbSNP:75564605
1661 1661 c, t dbSNP:754798497
1666 1666 a, c dbSNP:202221385
1671 1671 c, g dbSNP:1064651
1673 1673 c, g dbSNP:78802049
1675 1675 c, t dbSNP:757930613
1676 1676 a, c, g dbSNP:750193229
1679 1679 a, t dbSNP:77035024
1682 1682 c, t dbSNP:78346899
1690 1690 c, g dbSNP:121908295
1694 1694 a, g dbSNP:80020805
1697 1697 a, c dbSNP:79185870
1699 1699 a, g dbSNP:74752878
1718 1718 -, caag dbSNP:750282937
1720 1720 -, agttca dbSNP:765080222
1721 1721 a, g dbSNP:79226895
1729 1729 -, c dbSNP:144322275
1736 1736 c, t dbSNP:779648235
1742 1742 a, g dbSNP:12747811
1758 1758 a, g dbSNP:758139406
1760 1760 c, g, t dbSNP:778537279
1765 1765 a, c dbSNP:144389406
1772 1772 c, t dbSNP:550891964
1773 1773 a, g dbSNP:75671029
1776 1776 c, t dbSNP:369966551
1777 1777 c, g, t dbSNP:421016
1781 1781 c, t dbSNP:546737014
1782 1782 a, g dbSNP:759859002
1784 1784 a, g dbSNP:199928507
1791 1791 c, t dbSNP:771174638
1798 1798 a, c, g dbSNP:76071730
1800 1800 a, c dbSNP:773369177
1802 1802 c, t dbSNP:149257166
1803 1803 a, c, g dbSNP:779958429
1804 1804 a, t dbSNP:771744004
1808 1808 c, t dbSNP:745577975
1812 1812 c, g dbSNP:368060
1814 1814 c, t dbSNP:375973565
1815 1815 a, g dbSNP:756858487
1823 1823 c, t dbSNP:371779859
1824 1824 a, c, g dbSNP:369068553
1826 1826 c, g dbSNP:1135675
1829 1829 a, g dbSNP:189380051
1832 1832 c, t dbSNP:755265316
1833 1833 a, c, t dbSNP:80356771
1834 1834 a, g dbSNP:80356772
1838 1838 c, t dbSNP:765451257
1839 1839 c, t dbSNP:761833958
1840 1840 c, t dbSNP:150246414
1841 1841 c, g, t dbSNP:141710041
1844 1844 a, g dbSNP:767373402
1848 1848 a, g dbSNP:370349398
1850 1850 a, g dbSNP:573394742
1852 1852 -, c dbSNP:761827654
1857 1857 -, a dbSNP:776371650
1864 1864 a, g dbSNP:555079960
1865 1865 a, g dbSNP:748986225
1868 1868 a, c dbSNP:77409925
1878 1878 a, g dbSNP:121908301
1880 1880 c, t dbSNP:77130994
1883 1883 c, t dbSNP:772819385
1887 1887 c, g dbSNP:769446173
1911 1911 a, c, g dbSNP:536425950
1918 1918 c, t dbSNP:78016673
1929 1929 c, t dbSNP:146519305
1932 1932 c, t dbSNP:747506979
1933 1933 a, g dbSNP:75822236
1934 1934 c, t dbSNP:78297361
1935 1935 c, t dbSNP:758806595
1936 1936 a, g dbSNP:750779755
1945 1945 -, gcaga dbSNP:763661843
1955 1955 a, g dbSNP:779303984
1959 1959 a, c dbSNP:757446316
1969 1969 c, t dbSNP:375147122
1978 1978 a, g dbSNP:764226149
1980 1980 a, c, t dbSNP:751473661
2032 2032 a, g dbSNP:708606
2042 2042 c, t dbSNP:368275143
2055 2055 c, t dbSNP:571503214
2056 2056 a, g dbSNP:546969073
2105 2105 c, t dbSNP:375776699

Target ORF information:

RefSeq Version XM_006711270
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu22331
Accession Version XM_011509407.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1611bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucosylceramidase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_004487.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)528..2009(+)
Position Chain Variation Link
30 30 c, t dbSNP:12034326
63 63 c, t dbSNP:776513137
70 70 c, g dbSNP:551959522
90 90 g, t dbSNP:527531505
91 91 c, t dbSNP:566752025
107 107 g, t dbSNP:376698321
117 117 c, t dbSNP:548224064
122 122 c, t dbSNP:771045561
149 149 g, t dbSNP:146422257
160 160 a, g dbSNP:761732863
206 206 a, g dbSNP:751033127
221 221 c, t dbSNP:149732676
230 230 c, g dbSNP:540373137
239 239 c, g dbSNP:574745231
272 272 a, g dbSNP:193125632
309 309 c, g dbSNP:537905430
310 310 c, g dbSNP:576924242
339 339 a, g dbSNP:558669512
361 361 c, g dbSNP:555143723
362 362 a, t dbSNP:756208042
364 364 a, g dbSNP:751503419
380 380 a, g dbSNP:780111782
381 381 c, g dbSNP:1064638
383 383 c, t dbSNP:537166707
385 385 -, tct dbSNP:759834373
387 387 -, t dbSNP:751685538
389 389 c, t dbSNP:1064639
392 392 a, g dbSNP:765067744
396 396 a, g dbSNP:41264927
397 397 a, g dbSNP:1064640
401 401 c, t dbSNP:550765395
402 402 c, t dbSNP:763568401
409 409 a, g, t dbSNP:1141801
418 418 c, t dbSNP:776015590
424 424 a, g dbSNP:201985614
433 433 c, g dbSNP:759983265
436 436 -, ag dbSNP:766291162
444 444 c, t dbSNP:763770350
446 446 c, t dbSNP:755682174
448 448 a, c, g dbSNP:150466109
450 450 c, t dbSNP:371238435
453 453 c, t dbSNP:774833277
454 454 c, t dbSNP:1141802
456 456 a, g dbSNP:1141804
459 459 a, g dbSNP:139626710
466 466 a, g dbSNP:376644484
468 468 a, g dbSNP:143187997
482 482 -, c dbSNP:397518433
491 491 a, t dbSNP:1059731
492 492 c, t dbSNP:201330214
494 494 -, g dbSNP:387906315
497 497 c, t dbSNP:748322959
503 503 -, g dbSNP:80356760
508 508 c, t dbSNP:776856496
510 510 a, g dbSNP:768854161
511 511 c, t dbSNP:745860677
514 514 c, g, t dbSNP:757041827
515 515 a, g dbSNP:148001886
518 518 a, g dbSNP:777383151
521 521 a, g dbSNP:755800314
526 526 a, g dbSNP:200378040
527 527 g, t dbSNP:747853210
531 531 c, t dbSNP:190207858
532 532 a, g, t dbSNP:751095441
534 534 c, t dbSNP:779377390
536 536 c, t dbSNP:758949381
542 542 c, t dbSNP:750891392
543 543 c, t dbSNP:765693058
546 546 a, g dbSNP:142761046
550 550 g, t dbSNP:543005460
554 554 c, t dbSNP:185884197
555 555 a, g dbSNP:760930573
558 558 c, t dbSNP:775652188
566 566 a, g dbSNP:756264143
570 570 g, t dbSNP:121908302
572 572 a, g dbSNP:763010874
574 574 c, g dbSNP:773007510
578 578 c, t dbSNP:145773486
583 583 a, g dbSNP:747971975
595 595 a, g dbSNP:145888253
599 599 a, c, g, t dbSNP:74953658
613 613 c, g, t dbSNP:141061530
614 614 a, g dbSNP:750712570
616 616 c, t dbSNP:757834551
625 625 a, c dbSNP:750990483
626 626 c, t dbSNP:151093421
629 629 -, t dbSNP:769900428
631 631 c, g dbSNP:371592589
632 632 -, tac dbSNP:761621516
633 633 a, g dbSNP:779258874
634 634 a, c dbSNP:373363286
638 638 a, c, g, t dbSNP:75954905
641 641 a, c dbSNP:368786234
642 642 c, t dbSNP:146774384
643 643 a, g dbSNP:752857428
647 647 g, t dbSNP:767693527
650 650 a, g dbSNP:76337315
653 653 c, t dbSNP:1141810
655 655 c, g, t dbSNP:1141811
657 657 a, c, t dbSNP:1141812
658 658 a, g dbSNP:765182795
664 664 a, g dbSNP:77829017
667 667 a, g dbSNP:144173415
669 669 c, t dbSNP:1141814
670 670 a, g dbSNP:78769774
671 671 a, g dbSNP:78669556
674 674 a, g dbSNP:746737219
677 677 a, g dbSNP:774985960
680 680 a, g dbSNP:771654706
685 685 c, t dbSNP:1141815
689 689 a, g dbSNP:1141816
693 693 a, g dbSNP:745398454
705 705 a, c, t dbSNP:1141818
706 706 a, g dbSNP:1141820
709 709 c, t dbSNP:757848523
710 710 c, g dbSNP:1141821
713 713 a, c dbSNP:778349378
718 718 a, g dbSNP:748485792
722 722 c, g dbSNP:781563451
728 728 g, t dbSNP:755161012
732 732 c, t dbSNP:368145008
734 734 a, g dbSNP:780169533
740 740 -, a dbSNP:779619231
764 764 c, g dbSNP:121908312
780 780 a, g dbSNP:758455177
781 781 g, t dbSNP:753816998
793 793 c, t dbSNP:763972468
797 797 a, c, t dbSNP:79175920
800 800 c, g dbSNP:752444566
822 822 c, g dbSNP:767272691
823 823 a, c dbSNP:759174705
832 832 a, g dbSNP:374003673
837 837 c, t dbSNP:770614424
847 847 a, c, t dbSNP:758447515
857 857 c, t dbSNP:772806479
864 864 a, g dbSNP:770218957
869 869 c, t dbSNP:772855106
870 870 a, g dbSNP:769343650
878 878 c, t dbSNP:77019233
883 883 g, t dbSNP:77834747
884 884 c, t dbSNP:147411159
885 885 c, t dbSNP:397515515
886 886 a, c, g dbSNP:79653797
887 887 a, g dbSNP:75249684
890 890 a, t dbSNP:747409352
891 891 c, t dbSNP:121908299
892 892 c, t dbSNP:79637617
893 893 c, t dbSNP:79767521
894 894 a, g dbSNP:377325220
896 896 a, g dbSNP:77959976
897 897 -, g dbSNP:398123529
900 900 a, t dbSNP:772293052
902 902 c, g dbSNP:746019841
907 907 a, t dbSNP:79796061
918 918 c, t dbSNP:398123530
919 919 a, g, t dbSNP:80356763
920 920 c, t dbSNP:74572011
926 926 c, t dbSNP:748085086
928 928 c, t dbSNP:78657146
929 929 a, c dbSNP:77191198
931 931 a, g dbSNP:781152868
934 934 a, c dbSNP:79660787
942 942 -, c dbSNP:397518434
945 945 c, g dbSNP:147138516
953 953 c, t dbSNP:563689350
955 955 a, g dbSNP:375193074
956 956 a, g dbSNP:545391048
960 960 c, t dbSNP:750077244
965 965 a, c dbSNP:764702561
996 996 a, c dbSNP:121908297
998 998 g, t dbSNP:78446355
1000 1000 c, t dbSNP:772419342
1003 1003 c, t dbSNP:80222298
1004 1004 a, c dbSNP:77916306
1005 1005 -, ct dbSNP:749714463
1009 1009 a, g, t dbSNP:77933015
1012 1012 a, c dbSNP:76500263
1015 1015 a, g dbSNP:398123531
1033 1033 a, g dbSNP:774609294
1035 1035 c, t dbSNP:398123532
1036 1036 a, g dbSNP:749416070
1040 1040 c, t dbSNP:201615998
1041 1041 a, g dbSNP:188760929
1044 1044 a, t dbSNP:398123533
1046 1046 a, g dbSNP:556008401
1047 1047 c, t dbSNP:374591570
1049 1049 c, t dbSNP:78659905
1061 1061 c, t dbSNP:76717906
1067 1067 a, c, t dbSNP:544083269
1072 1072 c, t dbSNP:80205046
1073 1073 a, c dbSNP:76727497
1077 1077 c, t dbSNP:61748906
1082 1082 c, t dbSNP:76682322
1090 1090 at, gg dbSNP:786200979
1090 1090 a, g dbSNP:364897
1091 1091 g, t dbSNP:381418
1093 1093 g, t dbSNP:78911246
1096 1096 a, c, t dbSNP:75636769
1097 1097 a, g dbSNP:75370695
1099 1099 a, c, g, t dbSNP:381427
1103 1103 c, t dbSNP:767914182
1106 1106 a, g dbSNP:375731497
1111 1111 a, g dbSNP:74462743
1112 1112 g, t dbSNP:774539868
1113 1113 c, t dbSNP:1064644
1115 1115 a, g dbSNP:76158190
1118 1118 c, t dbSNP:372785813
1119 1119 a, g dbSNP:773409311
1121 1121 a, g dbSNP:74486098
1130 1130 c, t dbSNP:376613535
1131 1131 a, g dbSNP:398123534
1132 1132 a, g dbSNP:77451368
1141 1141 a, g dbSNP:76026102
1150 1150 a, c dbSNP:772098596
1161 1161 c, t dbSNP:121908300
1164 1164 a, t dbSNP:381737
1166 1166 a, t dbSNP:79945741
1173 1173 g, t dbSNP:121908303
1174 1174 a, t dbSNP:74500255
1178 1178 a, g dbSNP:770615819
1186 1186 a, t dbSNP:749014188
1189 1189 c, t dbSNP:777370349
1190 1190 c, t dbSNP:546199839
1193 1193 a, g dbSNP:755722145
1198 1198 a, g dbSNP:752226690
1205 1205 a, g dbSNP:572370038
1219 1219 c, g dbSNP:76725886
1237 1237 c, t dbSNP:755512507
1247 1247 g, t dbSNP:371576958
1252 1252 a, g dbSNP:138246400
1256 1256 a, t dbSNP:763197747
1257 1257 c, t dbSNP:750777791
1259 1259 a, c dbSNP:765583147
1274 1274 a, g dbSNP:762073714
1280 1280 a, c dbSNP:121908313
1292 1292 g, t dbSNP:367968666
1297 1297 a, g dbSNP:78973108
1311 1311 c, t dbSNP:374117599
1312 1312 a, g dbSNP:140955685
1321 1321 a, g dbSNP:80116658
1323 1323 c, g dbSNP:770796008
1324 1324 c, g dbSNP:79215220
1327 1327 c, t dbSNP:199628072
1328 1328 c, g, t dbSNP:371856161
1331 1331 c, t dbSNP:708610
1332 1332 a, g dbSNP:368425393
1338 1338 a, g, t dbSNP:1057942
1339 1339 a, g dbSNP:74731340
1348 1348 a, g dbSNP:747591577
1349 1349 a, c dbSNP:780457481
1351 1351 a, g dbSNP:535896234
1361 1361 a, g dbSNP:575127557
1364 1364 c, g dbSNP:750834903
1380 1380 c, t dbSNP:765633380
1381 1381 a, g dbSNP:79696831
1385 1385 a, g dbSNP:753890133
1393 1393 c, t dbSNP:121908298
1397 1397 c, g dbSNP:142662866
1398 1398 g, t dbSNP:398123535
1410 1410 a, g dbSNP:764251205
1415 1415 c, g dbSNP:756307975
1422 1422 c, g dbSNP:374463271
1435 1435 a, t dbSNP:77714449
1436 1436 a, g dbSNP:1064646
1438 1438 a, g dbSNP:77321207
1443 1443 c, t dbSNP:181720335
1448 1448 c, t dbSNP:1064647
1453 1453 c, g, t dbSNP:78396650
1455 1455 a, g dbSNP:371083513
1459 1459 a, g dbSNP:78198234
1460 1460 c, t dbSNP:762944845
1463 1463 g, t dbSNP:121908304
1466 1466 c, t dbSNP:79311125
1468 1468 g, t dbSNP:540967271
1470 1470 a, c, g dbSNP:398123526
1475 1475 c, t dbSNP:530006262
1480 1480 a, c dbSNP:78188205
1486 1486 c, g dbSNP:761628930
1495 1495 c, t dbSNP:76539814
1496 1496 a, c, g dbSNP:760310921
1500 1500 a, g dbSNP:121908305
1502 1502 a, g dbSNP:143222798
1503 1503 a, g dbSNP:2230288
1505 1505 a, g dbSNP:80317710
1512 1512 c, t dbSNP:374306700
1513 1513 a, g dbSNP:1064648
1514 1514 c, t dbSNP:771522209
1523 1523 c, t dbSNP:749633975
1526 1526 c, t dbSNP:778140625
1539 1539 a, g dbSNP:80356765
1540 1540 c, t dbSNP:756292503
1541 1541 c, t dbSNP:752959907
1548 1548 a, g dbSNP:781306264
1551 1551 g, t dbSNP:121908306
1553 1553 c, t dbSNP:755021234
1564 1564 -, a dbSNP:781356917
1566 1566 c, t dbSNP:751598832
1569 1569 g, t dbSNP:765182863
1574 1574 a, g dbSNP:75391747
1577 1577 c, g dbSNP:761681845
1581 1581 c, g dbSNP:398123527
1583 1583 a, g dbSNP:753583304
1584 1584 c, g dbSNP:121908308
1585 1585 a, g dbSNP:11558184
1594 1594 c, t dbSNP:760307559
1602 1602 c, t dbSNP:121908309
1603 1603 a, g dbSNP:74979486
1610 1610 a, g dbSNP:149487315
1613 1613 a, g dbSNP:771744858
1615 1615 a, g dbSNP:76228122
1618 1618 c, g dbSNP:121908307
1619 1619 c, t dbSNP:773947710
1621 1621 a, c dbSNP:771575291
1625 1625 c, t dbSNP:75528494
1629 1629 a, g dbSNP:749736020
1633 1633 c, t dbSNP:75548401
1634 1634 a, g dbSNP:138498426
1636 1636 a, c, g dbSNP:76763715
1637 1637 c, t dbSNP:749227753
1638 1638 c, g dbSNP:121908314
1640 1640 c, g dbSNP:74498117
1650 1650 g, t dbSNP:398123528
1655 1655 c, t dbSNP:755952419
1656 1656 a, g dbSNP:121908311
1658 1658 a, c, g, t dbSNP:75034092
1660 1660 a, g dbSNP:754743440
1661 1661 g, t dbSNP:76014919
1664 1664 c, g dbSNP:751242076
1666 1666 a, c dbSNP:77284004
1667 1667 c, t dbSNP:78715199
1673 1673 -, ccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgt cgacagt dbSNP:80356768
1674 1674 a, c dbSNP:187143994
1678 1678 c, t dbSNP:762493290
1681 1681 c, t dbSNP:772548282
1688 1688 c, t dbSNP:201499639
1689 1689 a, g dbSNP:149171124
1699 1699 c, t dbSNP:76910485
1702 1702 a, g, t dbSNP:77738682
1703 1703 c, t dbSNP:777049786
1707 1707 g, t dbSNP:80356769
1710 1710 c, g dbSNP:747284798
1711 1711 a, g dbSNP:775661835
1712 1712 c, t dbSNP:772140702
1714 1714 a, c dbSNP:75385858
1715 1715 c, g, t dbSNP:778798290
1717 1717 c, t dbSNP:75243000
1719 1719 g, t dbSNP:121908310
1721 1721 c, g, t dbSNP:79032178
1724 1724 c, g, t dbSNP:75090908
1728 1728 c, t dbSNP:781189218
1729 1729 c, t dbSNP:74598136
1732 1732 c, t dbSNP:75564605
1742 1742 c, t dbSNP:754798497
1747 1747 a, c dbSNP:202221385
1752 1752 c, g dbSNP:1064651
1754 1754 c, g dbSNP:78802049
1756 1756 c, t dbSNP:757930613
1757 1757 a, c, g dbSNP:750193229
1760 1760 a, t dbSNP:77035024
1763 1763 c, t dbSNP:78346899
1771 1771 c, g dbSNP:121908295
1775 1775 a, g dbSNP:80020805
1778 1778 a, c dbSNP:79185870
1780 1780 a, g dbSNP:74752878
1799 1799 -, caag dbSNP:750282937
1801 1801 -, agttca dbSNP:765080222
1802 1802 a, g dbSNP:79226895
1810 1810 -, c dbSNP:144322275
1817 1817 c, t dbSNP:779648235
1823 1823 a, g dbSNP:12747811
1839 1839 a, g dbSNP:758139406
1841 1841 c, g, t dbSNP:778537279
1846 1846 a, c dbSNP:144389406
1853 1853 c, t dbSNP:550891964
1854 1854 a, g dbSNP:75671029
1857 1857 c, t dbSNP:369966551
1858 1858 c, g, t dbSNP:421016
1862 1862 c, t dbSNP:546737014
1863 1863 a, g dbSNP:759859002
1865 1865 a, g dbSNP:199928507
1872 1872 c, t dbSNP:771174638
1879 1879 a, c, g dbSNP:76071730
1881 1881 a, c dbSNP:773369177
1883 1883 c, t dbSNP:149257166
1884 1884 a, c, g dbSNP:779958429
1885 1885 a, t dbSNP:771744004
1889 1889 c, t dbSNP:745577975
1893 1893 c, g dbSNP:368060
1895 1895 c, t dbSNP:375973565
1896 1896 a, g dbSNP:756858487
1904 1904 c, t dbSNP:371779859
1905 1905 a, c, g dbSNP:369068553
1907 1907 c, g dbSNP:1135675
1910 1910 a, g dbSNP:189380051
1913 1913 c, t dbSNP:755265316
1914 1914 a, c, t dbSNP:80356771
1915 1915 a, g dbSNP:80356772
1919 1919 c, t dbSNP:765451257
1920 1920 c, t dbSNP:761833958
1921 1921 c, t dbSNP:150246414
1922 1922 c, g, t dbSNP:141710041
1925 1925 a, g dbSNP:767373402
1929 1929 a, g dbSNP:370349398
1931 1931 a, g dbSNP:573394742
1933 1933 -, c dbSNP:761827654
1938 1938 -, a dbSNP:776371650
1945 1945 a, g dbSNP:555079960
1946 1946 a, g dbSNP:748986225
1949 1949 a, c dbSNP:77409925
1959 1959 a, g dbSNP:121908301
1961 1961 c, t dbSNP:77130994
1964 1964 c, t dbSNP:772819385
1968 1968 c, g dbSNP:769446173
1992 1992 a, c, g dbSNP:536425950
1999 1999 c, t dbSNP:78016673
2010 2010 c, t dbSNP:146519305
2013 2013 c, t dbSNP:747506979
2014 2014 a, g dbSNP:75822236
2015 2015 c, t dbSNP:78297361
2016 2016 c, t dbSNP:758806595
2017 2017 a, g dbSNP:750779755
2026 2026 -, gcaga dbSNP:763661843
2036 2036 a, g dbSNP:779303984
2040 2040 a, c dbSNP:757446316
2050 2050 c, t dbSNP:375147122
2059 2059 a, g dbSNP:764226149
2061 2061 a, c, t dbSNP:751473661
2113 2113 a, g dbSNP:708606
2123 2123 c, t dbSNP:368275143
2136 2136 c, t dbSNP:571503214
2137 2137 a, g dbSNP:546969073
2186 2186 c, t dbSNP:375776699

Target ORF information:

RefSeq Version XM_011509407
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54570
Accession Version XM_006726211.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1611bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucosylceramidase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003315906.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)447..1928(+)
Position Chain Variation Link
6 6 g, t dbSNP:527531505
7 7 c, t dbSNP:566752025
23 23 g, t dbSNP:376698321
33 33 c, t dbSNP:548224064
38 38 c, t dbSNP:771045561
65 65 g, t dbSNP:146422257
76 76 a, g dbSNP:761732863
122 122 a, g dbSNP:751033127
140 140 c, t dbSNP:149732676
149 149 c, g dbSNP:540373137
158 158 c, g dbSNP:574745231
191 191 a, g dbSNP:193125632
228 228 c, g dbSNP:537905430
229 229 c, g dbSNP:576924242
258 258 a, g dbSNP:558669512
280 280 c, g dbSNP:555143723
281 281 a, t dbSNP:756208042
283 283 a, g dbSNP:751503419
299 299 a, g dbSNP:780111782
300 300 c, g dbSNP:1064638
302 302 c, t dbSNP:537166707
304 304 -, tct dbSNP:759834373
306 306 -, t dbSNP:751685538
308 308 c, t dbSNP:1064639
311 311 a, g dbSNP:765067744
315 315 a, g dbSNP:41264927
316 316 a, g dbSNP:1064640
320 320 c, t dbSNP:550765395
321 321 c, t dbSNP:763568401
328 328 a, g, t dbSNP:1141801
337 337 c, t dbSNP:776015590
343 343 a, g dbSNP:201985614
352 352 c, g dbSNP:759983265
355 355 -, ag dbSNP:766291162
363 363 c, t dbSNP:763770350
365 365 c, t dbSNP:755682174
367 367 a, c, g dbSNP:150466109
369 369 c, t dbSNP:371238435
372 372 c, t dbSNP:774833277
373 373 c, t dbSNP:1141802
375 375 a, g dbSNP:1141804
378 378 a, g dbSNP:139626710
385 385 a, g dbSNP:376644484
387 387 a, g dbSNP:143187997
401 401 -, c dbSNP:397518433
410 410 a, t dbSNP:1059731
411 411 c, t dbSNP:201330214
413 413 -, g dbSNP:387906315
416 416 c, t dbSNP:748322959
422 422 -, g dbSNP:80356760
427 427 c, t dbSNP:776856496
429 429 a, g dbSNP:768854161
430 430 c, t dbSNP:745860677
433 433 c, g, t dbSNP:757041827
434 434 a, g dbSNP:148001886
437 437 a, g dbSNP:777383151
440 440 a, g dbSNP:755800314
445 445 a, g dbSNP:200378040
446 446 g, t dbSNP:747853210
450 450 c, t dbSNP:190207858
451 451 a, g, t dbSNP:751095441
453 453 c, t dbSNP:779377390
455 455 c, t dbSNP:758949381
461 461 c, t dbSNP:750891392
462 462 c, t dbSNP:765693058
465 465 a, g dbSNP:142761046
469 469 g, t dbSNP:543005460
473 473 c, t dbSNP:185884197
474 474 a, g dbSNP:760930573
477 477 c, t dbSNP:775652188
485 485 a, g dbSNP:756264143
489 489 g, t dbSNP:121908302
491 491 a, g dbSNP:763010874
493 493 c, g dbSNP:773007510
497 497 c, t dbSNP:145773486
502 502 a, g dbSNP:747971975
514 514 a, g dbSNP:145888253
518 518 a, c, g, t dbSNP:74953658
532 532 c, g, t dbSNP:141061530
533 533 a, g dbSNP:750712570
535 535 c, t dbSNP:757834551
544 544 a, c dbSNP:750990483
545 545 c, t dbSNP:151093421
548 548 -, t dbSNP:769900428
550 550 c, g dbSNP:371592589
551 551 -, tac dbSNP:761621516
552 552 a, g dbSNP:779258874
553 553 a, c dbSNP:373363286
557 557 a, c, g, t dbSNP:75954905
560 560 a, c dbSNP:368786234
561 561 c, t dbSNP:146774384
562 562 a, g dbSNP:752857428
566 566 g, t dbSNP:767693527
569 569 a, g dbSNP:76337315
572 572 c, t dbSNP:1141810
574 574 c, g, t dbSNP:1141811
576 576 a, c, t dbSNP:1141812
577 577 a, g dbSNP:765182795
583 583 a, g dbSNP:77829017
586 586 a, g dbSNP:144173415
588 588 c, t dbSNP:1141814
589 589 a, g dbSNP:78769774
590 590 a, g dbSNP:78669556
593 593 a, g dbSNP:746737219
596 596 a, g dbSNP:774985960
599 599 a, g dbSNP:771654706
604 604 c, t dbSNP:1141815
608 608 a, g dbSNP:1141816
612 612 a, g dbSNP:745398454
624 624 a, c, t dbSNP:1141818
625 625 a, g dbSNP:1141820
628 628 c, t dbSNP:757848523
629 629 c, g dbSNP:1141821
632 632 a, c dbSNP:778349378
637 637 a, g dbSNP:748485792
641 641 c, g dbSNP:781563451
647 647 g, t dbSNP:755161012
651 651 c, t dbSNP:368145008
653 653 a, g dbSNP:780169533
659 659 -, a dbSNP:779619231
683 683 c, g dbSNP:121908312
699 699 a, g dbSNP:758455177
700 700 g, t dbSNP:753816998
712 712 c, t dbSNP:763972468
716 716 a, c, t dbSNP:79175920
719 719 c, g dbSNP:752444566
741 741 c, g dbSNP:767272691
742 742 a, c dbSNP:759174705
751 751 a, g dbSNP:374003673
756 756 c, t dbSNP:770614424
766 766 a, c, t dbSNP:758447515
776 776 c, t dbSNP:772806479
783 783 a, g dbSNP:770218957
788 788 c, t dbSNP:772855106
789 789 a, g dbSNP:769343650
797 797 c, t dbSNP:77019233
802 802 g, t dbSNP:77834747
803 803 c, t dbSNP:147411159
804 804 c, t dbSNP:397515515
805 805 a, c, g dbSNP:79653797
806 806 a, g dbSNP:75249684
809 809 a, t dbSNP:747409352
810 810 c, t dbSNP:121908299
811 811 c, t dbSNP:79637617
812 812 c, t dbSNP:79767521
813 813 a, g dbSNP:377325220
815 815 a, g dbSNP:77959976
816 816 -, g dbSNP:398123529
819 819 a, t dbSNP:772293052
821 821 c, g dbSNP:746019841
826 826 a, t dbSNP:79796061
837 837 c, t dbSNP:398123530
838 838 a, g, t dbSNP:80356763
839 839 c, t dbSNP:74572011
845 845 c, t dbSNP:748085086
847 847 c, t dbSNP:78657146
848 848 a, c dbSNP:77191198
850 850 a, g dbSNP:781152868
853 853 a, c dbSNP:79660787
861 861 -, c dbSNP:397518434
864 864 c, g dbSNP:147138516
872 872 c, t dbSNP:563689350
874 874 a, g dbSNP:375193074
875 875 a, g dbSNP:545391048
879 879 c, t dbSNP:750077244
884 884 a, c dbSNP:764702561
915 915 a, c dbSNP:121908297
917 917 g, t dbSNP:78446355
919 919 c, t dbSNP:772419342
922 922 c, t dbSNP:80222298
923 923 a, c dbSNP:77916306
924 924 -, ct dbSNP:749714463
928 928 a, g, t dbSNP:77933015
931 931 a, c dbSNP:76500263
934 934 a, g dbSNP:398123531
952 952 a, g dbSNP:774609294
954 954 c, t dbSNP:398123532
955 955 a, g dbSNP:749416070
959 959 c, t dbSNP:201615998
960 960 a, g dbSNP:188760929
963 963 a, t dbSNP:398123533
965 965 a, g dbSNP:556008401
966 966 c, t dbSNP:374591570
968 968 c, t dbSNP:78659905
980 980 c, t dbSNP:76717906
986 986 a, c, t dbSNP:544083269
991 991 c, t dbSNP:80205046
992 992 a, c dbSNP:76727497
996 996 c, t dbSNP:61748906
1001 1001 c, t dbSNP:76682322
1009 1009 at, gg dbSNP:786200979
1009 1009 a, g dbSNP:364897
1010 1010 g, t dbSNP:381418
1012 1012 g, t dbSNP:78911246
1015 1015 a, c, t dbSNP:75636769
1016 1016 a, g dbSNP:75370695
1018 1018 a, c, g, t dbSNP:381427
1022 1022 c, t dbSNP:767914182
1025 1025 a, g dbSNP:375731497
1030 1030 a, g dbSNP:74462743
1031 1031 g, t dbSNP:774539868
1032 1032 c, t dbSNP:1064644
1034 1034 a, g dbSNP:76158190
1037 1037 c, t dbSNP:372785813
1038 1038 a, g dbSNP:773409311
1040 1040 a, g dbSNP:74486098
1049 1049 c, t dbSNP:376613535
1050 1050 a, g dbSNP:398123534
1051 1051 a, g dbSNP:77451368
1060 1060 a, g dbSNP:76026102
1069 1069 a, c dbSNP:772098596
1080 1080 c, t dbSNP:121908300
1083 1083 a, t dbSNP:381737
1085 1085 a, t dbSNP:79945741
1092 1092 g, t dbSNP:121908303
1093 1093 a, t dbSNP:74500255
1097 1097 a, g dbSNP:770615819
1105 1105 a, t dbSNP:749014188
1108 1108 c, t dbSNP:777370349
1109 1109 c, t dbSNP:546199839
1112 1112 a, g dbSNP:755722145
1117 1117 a, g dbSNP:752226690
1124 1124 a, g dbSNP:572370038
1138 1138 c, g dbSNP:76725886
1156 1156 c, t dbSNP:755512507
1166 1166 g, t dbSNP:371576958
1171 1171 a, g dbSNP:138246400
1175 1175 a, t dbSNP:763197747
1176 1176 c, t dbSNP:750777791
1178 1178 a, c dbSNP:765583147
1193 1193 a, g dbSNP:762073714
1199 1199 a, c dbSNP:121908313
1211 1211 g, t dbSNP:367968666
1216 1216 a, g dbSNP:78973108
1230 1230 c, t dbSNP:374117599
1231 1231 a, g dbSNP:140955685
1240 1240 a, g dbSNP:80116658
1242 1242 c, g dbSNP:770796008
1243 1243 c, g dbSNP:79215220
1246 1246 c, t dbSNP:199628072
1247 1247 c, g, t dbSNP:371856161
1250 1250 c, t dbSNP:708610
1251 1251 a, g dbSNP:368425393
1257 1257 a, g, t dbSNP:1057942
1258 1258 a, g dbSNP:74731340
1267 1267 a, g dbSNP:747591577
1268 1268 a, c dbSNP:780457481
1270 1270 a, g dbSNP:535896234
1280 1280 a, g dbSNP:575127557
1283 1283 c, g dbSNP:750834903
1299 1299 c, t dbSNP:765633380
1300 1300 a, g dbSNP:79696831
1304 1304 a, g dbSNP:753890133
1312 1312 c, t dbSNP:121908298
1316 1316 c, g dbSNP:142662866
1317 1317 g, t dbSNP:398123535
1329 1329 a, g dbSNP:764251205
1334 1334 c, g dbSNP:756307975
1341 1341 c, g dbSNP:374463271
1354 1354 a, t dbSNP:77714449
1355 1355 a, g dbSNP:1064646
1357 1357 a, g dbSNP:77321207
1362 1362 c, t dbSNP:181720335
1367 1367 c, t dbSNP:1064647
1372 1372 c, g, t dbSNP:78396650
1374 1374 a, g dbSNP:371083513
1378 1378 a, g dbSNP:78198234
1379 1379 c, t dbSNP:762944845
1382 1382 g, t dbSNP:121908304
1385 1385 c, t dbSNP:79311125
1387 1387 g, t dbSNP:540967271
1389 1389 a, c, g dbSNP:398123526
1394 1394 c, t dbSNP:530006262
1399 1399 a, c dbSNP:78188205
1405 1405 c, g dbSNP:761628930
1414 1414 c, t dbSNP:76539814
1415 1415 a, c, g dbSNP:760310921
1419 1419 a, g dbSNP:121908305
1421 1421 a, g dbSNP:143222798
1422 1422 a, g dbSNP:2230288
1424 1424 a, g dbSNP:80317710
1431 1431 c, t dbSNP:374306700
1432 1432 a, g dbSNP:1064648
1433 1433 c, t dbSNP:771522209
1442 1442 c, t dbSNP:749633975
1445 1445 c, t dbSNP:778140625
1458 1458 a, g dbSNP:80356765
1459 1459 c, t dbSNP:756292503
1460 1460 c, t dbSNP:752959907
1467 1467 a, g dbSNP:781306264
1470 1470 g, t dbSNP:121908306
1472 1472 c, t dbSNP:755021234
1483 1483 -, a dbSNP:781356917
1485 1485 c, t dbSNP:751598832
1488 1488 g, t dbSNP:765182863
1493 1493 a, g dbSNP:75391747
1496 1496 c, g dbSNP:761681845
1500 1500 c, g dbSNP:398123527
1502 1502 a, g dbSNP:753583304
1503 1503 c, g dbSNP:121908308
1504 1504 a, g dbSNP:11558184
1513 1513 c, t dbSNP:760307559
1521 1521 c, t dbSNP:121908309
1522 1522 a, g dbSNP:74979486
1529 1529 a, g dbSNP:149487315
1532 1532 a, g dbSNP:771744858
1534 1534 a, g dbSNP:76228122
1537 1537 c, g dbSNP:121908307
1538 1538 c, t dbSNP:773947710
1540 1540 a, c dbSNP:771575291
1544 1544 c, t dbSNP:75528494
1548 1548 a, g dbSNP:749736020
1552 1552 c, t dbSNP:75548401
1553 1553 a, g dbSNP:138498426
1555 1555 a, c, g dbSNP:76763715
1556 1556 c, t dbSNP:749227753
1557 1557 c, g dbSNP:121908314
1559 1559 c, g dbSNP:74498117
1569 1569 g, t dbSNP:398123528
1574 1574 c, t dbSNP:755952419
1575 1575 a, g dbSNP:121908311
1577 1577 a, c, g, t dbSNP:75034092
1579 1579 a, g dbSNP:754743440
1580 1580 g, t dbSNP:76014919
1583 1583 c, g dbSNP:751242076
1585 1585 a, c dbSNP:77284004
1586 1586 c, t dbSNP:78715199
1592 1592 -, ccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgt cgacagt dbSNP:80356768
1593 1593 a, c dbSNP:187143994
1597 1597 c, t dbSNP:762493290
1600 1600 c, t dbSNP:772548282
1607 1607 c, t dbSNP:201499639
1608 1608 a, g dbSNP:149171124
1618 1618 c, t dbSNP:76910485
1621 1621 a, g, t dbSNP:77738682
1622 1622 c, t dbSNP:777049786
1626 1626 g, t dbSNP:80356769
1629 1629 c, g dbSNP:747284798
1630 1630 a, g dbSNP:775661835
1631 1631 c, t dbSNP:772140702
1633 1633 a, c dbSNP:75385858
1634 1634 c, g, t dbSNP:778798290
1636 1636 c, t dbSNP:75243000
1638 1638 g, t dbSNP:121908310
1640 1640 c, g, t dbSNP:79032178
1643 1643 c, g, t dbSNP:75090908
1647 1647 c, t dbSNP:781189218
1648 1648 c, t dbSNP:74598136
1651 1651 c, t dbSNP:75564605
1661 1661 c, t dbSNP:754798497
1666 1666 a, c dbSNP:202221385
1671 1671 c, g dbSNP:1064651
1673 1673 c, g dbSNP:78802049
1675 1675 c, t dbSNP:757930613
1676 1676 a, c, g dbSNP:750193229
1679 1679 a, t dbSNP:77035024
1682 1682 c, t dbSNP:78346899
1690 1690 c, g dbSNP:121908295
1694 1694 a, g dbSNP:80020805
1697 1697 a, c dbSNP:79185870
1699 1699 a, g dbSNP:74752878
1718 1718 -, caag dbSNP:750282937
1720 1720 -, agttca dbSNP:765080222
1721 1721 a, g dbSNP:79226895
1729 1729 -, c dbSNP:144322275
1736 1736 c, t dbSNP:779648235
1742 1742 a, g dbSNP:12747811
1758 1758 a, g dbSNP:758139406
1760 1760 c, g, t dbSNP:778537279
1765 1765 a, c dbSNP:144389406
1772 1772 c, t dbSNP:550891964
1773 1773 a, g dbSNP:75671029
1776 1776 c, t dbSNP:369966551
1777 1777 c, g, t dbSNP:421016
1781 1781 c, t dbSNP:546737014
1782 1782 a, g dbSNP:759859002
1784 1784 a, g dbSNP:199928507
1791 1791 c, t dbSNP:771174638
1798 1798 a, c, g dbSNP:76071730
1800 1800 a, c dbSNP:773369177
1802 1802 c, t dbSNP:149257166
1803 1803 a, c, g dbSNP:779958429
1804 1804 a, t dbSNP:771744004
1808 1808 c, t dbSNP:745577975
1812 1812 c, g dbSNP:368060
1814 1814 c, t dbSNP:375973565
1815 1815 a, g dbSNP:756858487
1823 1823 c, t dbSNP:371779859
1824 1824 a, c, g dbSNP:369068553
1826 1826 c, g dbSNP:1135675
1829 1829 a, g dbSNP:189380051
1832 1832 c, t dbSNP:755265316
1833 1833 a, c, t dbSNP:80356771
1834 1834 a, g dbSNP:80356772
1838 1838 c, t dbSNP:765451257
1839 1839 c, t dbSNP:761833958
1840 1840 c, t dbSNP:150246414
1841 1841 c, g, t dbSNP:141710041
1844 1844 a, g dbSNP:767373402
1848 1848 a, g dbSNP:370349398
1850 1850 a, g dbSNP:573394742
1852 1852 -, c dbSNP:761827654
1857 1857 -, a dbSNP:776371650
1864 1864 a, g dbSNP:555079960
1865 1865 a, g dbSNP:748986225
1868 1868 a, c dbSNP:77409925
1878 1878 a, g dbSNP:121908301
1880 1880 c, t dbSNP:77130994
1883 1883 c, t dbSNP:772819385
1887 1887 c, g dbSNP:769446173
1911 1911 a, c, g dbSNP:536425950
1918 1918 c, t dbSNP:78016673
1929 1929 c, t dbSNP:146519305
1932 1932 c, t dbSNP:747506979
1933 1933 a, g dbSNP:75822236
1934 1934 c, t dbSNP:78297361
1935 1935 c, t dbSNP:758806595
1936 1936 a, g dbSNP:750779755
1945 1945 -, gcaga dbSNP:763661843
1955 1955 a, g dbSNP:779303984
1959 1959 a, c dbSNP:757446316
1969 1969 c, t dbSNP:375147122
1978 1978 a, g dbSNP:764226149
1980 1980 a, c, t dbSNP:751473661
2032 2032 a, g dbSNP:708606
2042 2042 c, t dbSNP:368275143
2055 2055 c, t dbSNP:571503214
2056 2056 a, g dbSNP:546969073
2105 2105 c, t dbSNP:375776699

Target ORF information:

RefSeq Version XM_006726211
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54570
Accession Version XM_011546930.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1611bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucosylceramidase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003315906.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)528..2009(+)
Position Chain Variation Link
30 30 c, t dbSNP:12034326
63 63 c, t dbSNP:776513137
70 70 c, g dbSNP:551959522
90 90 g, t dbSNP:527531505
91 91 c, t dbSNP:566752025
107 107 g, t dbSNP:376698321
117 117 c, t dbSNP:548224064
122 122 c, t dbSNP:771045561
149 149 g, t dbSNP:146422257
160 160 a, g dbSNP:761732863
206 206 a, g dbSNP:751033127
221 221 c, t dbSNP:149732676
230 230 c, g dbSNP:540373137
239 239 c, g dbSNP:574745231
272 272 a, g dbSNP:193125632
309 309 c, g dbSNP:537905430
310 310 c, g dbSNP:576924242
339 339 a, g dbSNP:558669512
361 361 c, g dbSNP:555143723
362 362 a, t dbSNP:756208042
364 364 a, g dbSNP:751503419
380 380 a, g dbSNP:780111782
381 381 c, g dbSNP:1064638
383 383 c, t dbSNP:537166707
385 385 -, tct dbSNP:759834373
387 387 -, t dbSNP:751685538
389 389 c, t dbSNP:1064639
392 392 a, g dbSNP:765067744
396 396 a, g dbSNP:41264927
397 397 a, g dbSNP:1064640
401 401 c, t dbSNP:550765395
402 402 c, t dbSNP:763568401
409 409 a, g, t dbSNP:1141801
418 418 c, t dbSNP:776015590
424 424 a, g dbSNP:201985614
433 433 c, g dbSNP:759983265
436 436 -, ag dbSNP:766291162
444 444 c, t dbSNP:763770350
446 446 c, t dbSNP:755682174
448 448 a, c, g dbSNP:150466109
450 450 c, t dbSNP:371238435
453 453 c, t dbSNP:774833277
454 454 c, t dbSNP:1141802
456 456 a, g dbSNP:1141804
459 459 a, g dbSNP:139626710
466 466 a, g dbSNP:376644484
468 468 a, g dbSNP:143187997
482 482 -, c dbSNP:397518433
491 491 a, t dbSNP:1059731
492 492 c, t dbSNP:201330214
494 494 -, g dbSNP:387906315
497 497 c, t dbSNP:748322959
503 503 -, g dbSNP:80356760
508 508 c, t dbSNP:776856496
510 510 a, g dbSNP:768854161
511 511 c, t dbSNP:745860677
514 514 c, g, t dbSNP:757041827
515 515 a, g dbSNP:148001886
518 518 a, g dbSNP:777383151
521 521 a, g dbSNP:755800314
526 526 a, g dbSNP:200378040
527 527 g, t dbSNP:747853210
531 531 c, t dbSNP:190207858
532 532 a, g, t dbSNP:751095441
534 534 c, t dbSNP:779377390
536 536 c, t dbSNP:758949381
542 542 c, t dbSNP:750891392
543 543 c, t dbSNP:765693058
546 546 a, g dbSNP:142761046
550 550 g, t dbSNP:543005460
554 554 c, t dbSNP:185884197
555 555 a, g dbSNP:760930573
558 558 c, t dbSNP:775652188
566 566 a, g dbSNP:756264143
570 570 g, t dbSNP:121908302
572 572 a, g dbSNP:763010874
574 574 c, g dbSNP:773007510
578 578 c, t dbSNP:145773486
583 583 a, g dbSNP:747971975
595 595 a, g dbSNP:145888253
599 599 a, c, g, t dbSNP:74953658
613 613 c, g, t dbSNP:141061530
614 614 a, g dbSNP:750712570
616 616 c, t dbSNP:757834551
625 625 a, c dbSNP:750990483
626 626 c, t dbSNP:151093421
629 629 -, t dbSNP:769900428
631 631 c, g dbSNP:371592589
632 632 -, tac dbSNP:761621516
633 633 a, g dbSNP:779258874
634 634 a, c dbSNP:373363286
638 638 a, c, g, t dbSNP:75954905
641 641 a, c dbSNP:368786234
642 642 c, t dbSNP:146774384
643 643 a, g dbSNP:752857428
647 647 g, t dbSNP:767693527
650 650 a, g dbSNP:76337315
653 653 c, t dbSNP:1141810
655 655 c, g, t dbSNP:1141811
657 657 a, c, t dbSNP:1141812
658 658 a, g dbSNP:765182795
664 664 a, g dbSNP:77829017
667 667 a, g dbSNP:144173415
669 669 c, t dbSNP:1141814
670 670 a, g dbSNP:78769774
671 671 a, g dbSNP:78669556
674 674 a, g dbSNP:746737219
677 677 a, g dbSNP:774985960
680 680 a, g dbSNP:771654706
685 685 c, t dbSNP:1141815
689 689 a, g dbSNP:1141816
693 693 a, g dbSNP:745398454
705 705 a, c, t dbSNP:1141818
706 706 a, g dbSNP:1141820
709 709 c, t dbSNP:757848523
710 710 c, g dbSNP:1141821
713 713 a, c dbSNP:778349378
718 718 a, g dbSNP:748485792
722 722 c, g dbSNP:781563451
728 728 g, t dbSNP:755161012
732 732 c, t dbSNP:368145008
734 734 a, g dbSNP:780169533
740 740 -, a dbSNP:779619231
764 764 c, g dbSNP:121908312
780 780 a, g dbSNP:758455177
781 781 g, t dbSNP:753816998
793 793 c, t dbSNP:763972468
797 797 a, c, t dbSNP:79175920
800 800 c, g dbSNP:752444566
822 822 c, g dbSNP:767272691
823 823 a, c dbSNP:759174705
832 832 a, g dbSNP:374003673
837 837 c, t dbSNP:770614424
847 847 a, c, t dbSNP:758447515
857 857 c, t dbSNP:772806479
864 864 a, g dbSNP:770218957
869 869 c, t dbSNP:772855106
870 870 a, g dbSNP:769343650
878 878 c, t dbSNP:77019233
883 883 g, t dbSNP:77834747
884 884 c, t dbSNP:147411159
885 885 c, t dbSNP:397515515
886 886 a, c, g dbSNP:79653797
887 887 a, g dbSNP:75249684
890 890 a, t dbSNP:747409352
891 891 c, t dbSNP:121908299
892 892 c, t dbSNP:79637617
893 893 c, t dbSNP:79767521
894 894 a, g dbSNP:377325220
896 896 a, g dbSNP:77959976
897 897 -, g dbSNP:398123529
900 900 a, t dbSNP:772293052
902 902 c, g dbSNP:746019841
907 907 a, t dbSNP:79796061
918 918 c, t dbSNP:398123530
919 919 a, g, t dbSNP:80356763
920 920 c, t dbSNP:74572011
926 926 c, t dbSNP:748085086
928 928 c, t dbSNP:78657146
929 929 a, c dbSNP:77191198
931 931 a, g dbSNP:781152868
934 934 a, c dbSNP:79660787
942 942 -, c dbSNP:397518434
945 945 c, g dbSNP:147138516
953 953 c, t dbSNP:563689350
955 955 a, g dbSNP:375193074
956 956 a, g dbSNP:545391048
960 960 c, t dbSNP:750077244
965 965 a, c dbSNP:764702561
996 996 a, c dbSNP:121908297
998 998 g, t dbSNP:78446355
1000 1000 c, t dbSNP:772419342
1003 1003 c, t dbSNP:80222298
1004 1004 a, c dbSNP:77916306
1005 1005 -, ct dbSNP:749714463
1009 1009 a, g, t dbSNP:77933015
1012 1012 a, c dbSNP:76500263
1015 1015 a, g dbSNP:398123531
1033 1033 a, g dbSNP:774609294
1035 1035 c, t dbSNP:398123532
1036 1036 a, g dbSNP:749416070
1040 1040 c, t dbSNP:201615998
1041 1041 a, g dbSNP:188760929
1044 1044 a, t dbSNP:398123533
1046 1046 a, g dbSNP:556008401
1047 1047 c, t dbSNP:374591570
1049 1049 c, t dbSNP:78659905
1061 1061 c, t dbSNP:76717906
1067 1067 a, c, t dbSNP:544083269
1072 1072 c, t dbSNP:80205046
1073 1073 a, c dbSNP:76727497
1077 1077 c, t dbSNP:61748906
1082 1082 c, t dbSNP:76682322
1090 1090 at, gg dbSNP:786200979
1090 1090 a, g dbSNP:364897
1091 1091 g, t dbSNP:381418
1093 1093 g, t dbSNP:78911246
1096 1096 a, c, t dbSNP:75636769
1097 1097 a, g dbSNP:75370695
1099 1099 a, c, g, t dbSNP:381427
1103 1103 c, t dbSNP:767914182
1106 1106 a, g dbSNP:375731497
1111 1111 a, g dbSNP:74462743
1112 1112 g, t dbSNP:774539868
1113 1113 c, t dbSNP:1064644
1115 1115 a, g dbSNP:76158190
1118 1118 c, t dbSNP:372785813
1119 1119 a, g dbSNP:773409311
1121 1121 a, g dbSNP:74486098
1130 1130 c, t dbSNP:376613535
1131 1131 a, g dbSNP:398123534
1132 1132 a, g dbSNP:77451368
1141 1141 a, g dbSNP:76026102
1150 1150 a, c dbSNP:772098596
1161 1161 c, t dbSNP:121908300
1164 1164 a, t dbSNP:381737
1166 1166 a, t dbSNP:79945741
1173 1173 g, t dbSNP:121908303
1174 1174 a, t dbSNP:74500255
1178 1178 a, g dbSNP:770615819
1186 1186 a, t dbSNP:749014188
1189 1189 c, t dbSNP:777370349
1190 1190 c, t dbSNP:546199839
1193 1193 a, g dbSNP:755722145
1198 1198 a, g dbSNP:752226690
1205 1205 a, g dbSNP:572370038
1219 1219 c, g dbSNP:76725886
1237 1237 c, t dbSNP:755512507
1247 1247 g, t dbSNP:371576958
1252 1252 a, g dbSNP:138246400
1256 1256 a, t dbSNP:763197747
1257 1257 c, t dbSNP:750777791
1259 1259 a, c dbSNP:765583147
1274 1274 a, g dbSNP:762073714
1280 1280 a, c dbSNP:121908313
1292 1292 g, t dbSNP:367968666
1297 1297 a, g dbSNP:78973108
1311 1311 c, t dbSNP:374117599
1312 1312 a, g dbSNP:140955685
1321 1321 a, g dbSNP:80116658
1323 1323 c, g dbSNP:770796008
1324 1324 c, g dbSNP:79215220
1327 1327 c, t dbSNP:199628072
1328 1328 c, g, t dbSNP:371856161
1331 1331 c, t dbSNP:708610
1332 1332 a, g dbSNP:368425393
1338 1338 a, g, t dbSNP:1057942
1339 1339 a, g dbSNP:74731340
1348 1348 a, g dbSNP:747591577
1349 1349 a, c dbSNP:780457481
1351 1351 a, g dbSNP:535896234
1361 1361 a, g dbSNP:575127557
1364 1364 c, g dbSNP:750834903
1380 1380 c, t dbSNP:765633380
1381 1381 a, g dbSNP:79696831
1385 1385 a, g dbSNP:753890133
1393 1393 c, t dbSNP:121908298
1397 1397 c, g dbSNP:142662866
1398 1398 g, t dbSNP:398123535
1410 1410 a, g dbSNP:764251205
1415 1415 c, g dbSNP:756307975
1422 1422 c, g dbSNP:374463271
1435 1435 a, t dbSNP:77714449
1436 1436 a, g dbSNP:1064646
1438 1438 a, g dbSNP:77321207
1443 1443 c, t dbSNP:181720335
1448 1448 c, t dbSNP:1064647
1453 1453 c, g, t dbSNP:78396650
1455 1455 a, g dbSNP:371083513
1459 1459 a, g dbSNP:78198234
1460 1460 c, t dbSNP:762944845
1463 1463 g, t dbSNP:121908304
1466 1466 c, t dbSNP:79311125
1468 1468 g, t dbSNP:540967271
1470 1470 a, c, g dbSNP:398123526
1475 1475 c, t dbSNP:530006262
1480 1480 a, c dbSNP:78188205
1486 1486 c, g dbSNP:761628930
1495 1495 c, t dbSNP:76539814
1496 1496 a, c, g dbSNP:760310921
1500 1500 a, g dbSNP:121908305
1502 1502 a, g dbSNP:143222798
1503 1503 a, g dbSNP:2230288
1505 1505 a, g dbSNP:80317710
1512 1512 c, t dbSNP:374306700
1513 1513 a, g dbSNP:1064648
1514 1514 c, t dbSNP:771522209
1523 1523 c, t dbSNP:749633975
1526 1526 c, t dbSNP:778140625
1539 1539 a, g dbSNP:80356765
1540 1540 c, t dbSNP:756292503
1541 1541 c, t dbSNP:752959907
1548 1548 a, g dbSNP:781306264
1551 1551 g, t dbSNP:121908306
1553 1553 c, t dbSNP:755021234
1564 1564 -, a dbSNP:781356917
1566 1566 c, t dbSNP:751598832
1569 1569 g, t dbSNP:765182863
1574 1574 a, g dbSNP:75391747
1577 1577 c, g dbSNP:761681845
1581 1581 c, g dbSNP:398123527
1583 1583 a, g dbSNP:753583304
1584 1584 c, g dbSNP:121908308
1585 1585 a, g dbSNP:11558184
1594 1594 c, t dbSNP:760307559
1602 1602 c, t dbSNP:121908309
1603 1603 a, g dbSNP:74979486
1610 1610 a, g dbSNP:149487315
1613 1613 a, g dbSNP:771744858
1615 1615 a, g dbSNP:76228122
1618 1618 c, g dbSNP:121908307
1619 1619 c, t dbSNP:773947710
1621 1621 a, c dbSNP:771575291
1625 1625 c, t dbSNP:75528494
1629 1629 a, g dbSNP:749736020
1633 1633 c, t dbSNP:75548401
1634 1634 a, g dbSNP:138498426
1636 1636 a, c, g dbSNP:76763715
1637 1637 c, t dbSNP:749227753
1638 1638 c, g dbSNP:121908314
1640 1640 c, g dbSNP:74498117
1650 1650 g, t dbSNP:398123528
1655 1655 c, t dbSNP:755952419
1656 1656 a, g dbSNP:121908311
1658 1658 a, c, g, t dbSNP:75034092
1660 1660 a, g dbSNP:754743440
1661 1661 g, t dbSNP:76014919
1664 1664 c, g dbSNP:751242076
1666 1666 a, c dbSNP:77284004
1667 1667 c, t dbSNP:78715199
1673 1673 -, ccttgccctgaaccccgaaggaggacccaattgggtgcgtaactttgt cgacagt dbSNP:80356768
1674 1674 a, c dbSNP:187143994
1678 1678 c, t dbSNP:762493290
1681 1681 c, t dbSNP:772548282
1688 1688 c, t dbSNP:201499639
1689 1689 a, g dbSNP:149171124
1699 1699 c, t dbSNP:76910485
1702 1702 a, g, t dbSNP:77738682
1703 1703 c, t dbSNP:777049786
1707 1707 g, t dbSNP:80356769
1710 1710 c, g dbSNP:747284798
1711 1711 a, g dbSNP:775661835
1712 1712 c, t dbSNP:772140702
1714 1714 a, c dbSNP:75385858
1715 1715 c, g, t dbSNP:778798290
1717 1717 c, t dbSNP:75243000
1719 1719 g, t dbSNP:121908310
1721 1721 c, g, t dbSNP:79032178
1724 1724 c, g, t dbSNP:75090908
1728 1728 c, t dbSNP:781189218
1729 1729 c, t dbSNP:74598136
1732 1732 c, t dbSNP:75564605
1742 1742 c, t dbSNP:754798497
1747 1747 a, c dbSNP:202221385
1752 1752 c, g dbSNP:1064651
1754 1754 c, g dbSNP:78802049
1756 1756 c, t dbSNP:757930613
1757 1757 a, c, g dbSNP:750193229
1760 1760 a, t dbSNP:77035024
1763 1763 c, t dbSNP:78346899
1771 1771 c, g dbSNP:121908295
1775 1775 a, g dbSNP:80020805
1778 1778 a, c dbSNP:79185870
1780 1780 a, g dbSNP:74752878
1799 1799 -, caag dbSNP:750282937
1801 1801 -, agttca dbSNP:765080222
1802 1802 a, g dbSNP:79226895
1810 1810 -, c dbSNP:144322275
1817 1817 c, t dbSNP:779648235
1823 1823 a, g dbSNP:12747811
1839 1839 a, g dbSNP:758139406
1841 1841 c, g, t dbSNP:778537279
1846 1846 a, c dbSNP:144389406
1853 1853 c, t dbSNP:550891964
1854 1854 a, g dbSNP:75671029
1857 1857 c, t dbSNP:369966551
1858 1858 c, g, t dbSNP:421016
1862 1862 c, t dbSNP:546737014
1863 1863 a, g dbSNP:759859002
1865 1865 a, g dbSNP:199928507
1872 1872 c, t dbSNP:771174638
1879 1879 a, c, g dbSNP:76071730
1881 1881 a, c dbSNP:773369177
1883 1883 c, t dbSNP:149257166
1884 1884 a, c, g dbSNP:779958429
1885 1885 a, t dbSNP:771744004
1889 1889 c, t dbSNP:745577975
1893 1893 c, g dbSNP:368060
1895 1895 c, t dbSNP:375973565
1896 1896 a, g dbSNP:756858487
1904 1904 c, t dbSNP:371779859
1905 1905 a, c, g dbSNP:369068553
1907 1907 c, g dbSNP:1135675
1910 1910 a, g dbSNP:189380051
1913 1913 c, t dbSNP:755265316
1914 1914 a, c, t dbSNP:80356771
1915 1915 a, g dbSNP:80356772
1919 1919 c, t dbSNP:765451257
1920 1920 c, t dbSNP:761833958
1921 1921 c, t dbSNP:150246414
1922 1922 c, g, t dbSNP:141710041
1925 1925 a, g dbSNP:767373402
1929 1929 a, g dbSNP:370349398
1931 1931 a, g dbSNP:573394742
1933 1933 -, c dbSNP:761827654
1938 1938 -, a dbSNP:776371650
1945 1945 a, g dbSNP:555079960
1946 1946 a, g dbSNP:748986225
1949 1949 a, c dbSNP:77409925
1959 1959 a, g dbSNP:121908301
1961 1961 c, t dbSNP:77130994
1964 1964 c, t dbSNP:772819385
1968 1968 c, g dbSNP:769446173
1992 1992 a, c, g dbSNP:536425950
1999 1999 c, t dbSNP:78016673
2010 2010 c, t dbSNP:146519305
2013 2013 c, t dbSNP:747506979
2014 2014 a, g dbSNP:75822236
2015 2015 c, t dbSNP:78297361
2016 2016 c, t dbSNP:758806595
2017 2017 a, g dbSNP:750779755
2026 2026 -, gcaga dbSNP:763661843
2036 2036 a, g dbSNP:779303984
2040 2040 a, c dbSNP:757446316
2050 2050 c, t dbSNP:375147122
2059 2059 a, g dbSNP:764226149
2061 2061 a, c, t dbSNP:751473661
2113 2113 a, g dbSNP:708606
2123 2123 c, t dbSNP:368275143
2136 2136 c, t dbSNP:571503214
2137 2137 a, g dbSNP:546969073
2186 2186 c, t dbSNP:375776699

Target ORF information:

RefSeq Version XM_011546930
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucosidase, beta, acid (GBA), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu22331
Accession Version NM_001005742.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1611bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucosylceramidase isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK300876.1 and AL713999.28. On Jan 28, 2010 this sequence version replaced gi:54607046. Summary: This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]. Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## CDS uses downstream in-frame AUG :: upstream AUG and CDS extension is not conserved ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AK300876.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)116..118(+)
Misc Feature(2)524..2005(+)
Exon (1)1..357
Gene Synonym:
Exon (2)358..433
Gene Synonym:
Exon (3)434..521
Gene Synonym:
Exon (4)522..713
Gene Synonym:
Exon (5)714..860
Gene Synonym:
Exon (6)861..994
Gene Synonym:
Exon (7)995..1167
Gene Synonym:
Exon (8)1168..1405
Gene Synonym:
Exon (9)1406..1630
Gene Synonym:
Exon (10)1631..1794
Gene Synonym:
Exon (11)1795..1911
Gene Synonym:
Exon (12)1912..2564
Gene Synonym:
Position Chain Variation Link
1 1 -, ct dbSNP:33949225
4 4 g, t dbSNP:548611379
6 6 g, t dbSNP:546478718
10 10 -, tctc dbSNP:757184315
10 10 -, tc dbSNP:771162499
12 12 -, tc dbSNP:3841430
13 13 -, tc dbSNP:545536977
18 18 g, t dbSNP:572778988
23 23 c, t dbSNP:531601426
38 38 g, t dbSNP:554214147
44 44 g, t dbSNP:535831354
52 52 g, t dbSNP:568394523
74 74 -, tctc dbSNP:752852362
74 74 -, tc dbSNP:778157646
79 79 c, g dbSNP:556596868
85 85 c, t dbSNP:537967633
181 181 c, t dbSNP:12034326
214 214 c, t dbSNP:776513137
221 221 c, g dbSNP:551959522
241 241 g, t dbSNP:527531505
242 242 c, t dbSNP:566752025
258 258 g, t dbSNP:376698321
268 268 c, t dbSNP:548224064
273 273 c, t dbSNP:771045561
300 300 g, t dbSNP:146422257
311 311 a, g dbSNP:761732863
357 357 a, g dbSNP:751033127
358 358 a, t dbSNP:756208042
360 360 a, g dbSNP:751503419
376 376 a, g dbSNP:780111782
377 377 c, g dbSNP:1064638
379 379 c, t dbSNP:537166707
381 381 -, tct dbSNP:759834373
383 383 -, t dbSNP:751685538
385 385 c, t dbSNP:1064639
388 388 a, g dbSNP:765067744
392 392 a, g dbSNP:41264927
393 393 a, g dbSNP:1064640
397 397 c, t dbSNP:550765395
398 398 c, t dbSNP:763568401
405 405 a, g, t dbSNP:1141801
414 414 c, t dbSNP:776015590
420 420 a, g dbSNP:201985614
429 429 c, g dbSNP:759983265
432 432 -, ag dbSNP:766291162
440 440 c, t dbSNP:763770350
442 442 c, t dbSNP:755682174
444 444 a, c, g dbSNP:150466109
446 446 c, t dbSNP:371238435
449 449 c, t dbSNP:774833277
450 450 c, t dbSNP:1141802
452 452 a, g dbSNP:1141804
455 455 a, g dbSNP:139626710
462 462 a, g dbSNP:376644484
464 464 a, g dbSNP:143187997
478 478 -, c dbSNP:397518433
487 487 a, t dbSNP:1059731
488 488 c, t dbSNP:201330214
490 490 -, g dbSNP:387906315
493 493 c, t dbSNP:748322959
499 499 -, g dbSNP:80356760
504 504 c, t dbSNP:776856496
506 506 a, g dbSNP:768854161
507 507 c, t dbSNP:745860677
510 510 c, g, t dbSNP:757041827
511 511 a, g dbSNP:148001886
514 514 a, g dbSNP:777383151
517 517 a, g dbSNP:755800314
522 522 a, g dbSNP:200378040
523 523 g, t dbSNP:747853210
527 527 c, t dbSNP:190207858
528 528 a, g, t dbSNP:751095441
530 530 c, t dbSNP:779377390
532 532 c, t dbSNP:758949381
538 538 c, t dbSNP:750891392
539 539 c, t dbSNP:765693058
542 542 a, g dbSNP:142761046
546 546 g, t dbSNP:543005460
550 550 c, t dbSNP:185884197
551 551 a, g dbSNP:760930573
554 554 c, t dbSNP:775652188
562 562 a, g dbSNP:756264143
566 566 g, t dbSNP:121908302
568 568 a, g dbSNP:763010874
570 570 c, g dbSNP:773007510
574 574 c, t dbSNP:145773486
579 579 a, g dbSNP:747971975
591 591 a, g dbSNP:145888253
595 595 a, c, g, t dbSNP:74953658
609 609 c, g, t dbSNP:141061530
610 610 a, g dbSNP:750712570
612 612 c, t dbSNP:757834551
621 621 a, c dbSNP:750990483
622 622 c, t dbSNP:151093421
625 625 -, t dbSNP:769900428
627 627 c, g dbSNP:371592589
628 628 -, tac dbSNP:761621516
629 629 a, g dbSNP:779258874
630 630 a, c dbSNP:373363286
634 634 a, c, g, t dbSNP:75954905
637 637 a, c dbSNP:368786234
638 638 c, t dbSNP:146774384
639 639 a, g dbSNP:752857428
643 643 g, t dbSNP:767693527
646 646 a, g dbSNP:76337315
649 649 c, t dbSNP:1141810
651 651 c, g, t dbSNP:1141811
653 653 a, c, t dbSNP:1141812
654 654 a, g dbSNP:765182795
660 660 a, g dbSNP:77829017
663 663 a, g dbSNP:144173415
665 665 c, t dbSNP:1141814
666 666 a, g dbSNP:78769774
667 667 a, g dbSNP:78669556
670 670 a, g dbSNP:746737219
673 673 a, g dbSNP:774985960
676 676 a, g dbSNP:771654706
681 681 c, t dbSNP:1141815
685 685 a, g dbSNP:1141816
689 689 a, g dbSNP:745398454
701 701 a, c, t dbSNP:1141818
702 702 a, g dbSNP:1141820
705 705 c, t dbSNP:757848523
706 706 c, g dbSNP:1141821
709 709 a, c dbSNP:778349378
714 714 a, g dbSNP:748485792
718 718 c, g dbSNP:781563451
724 724 g, t dbSNP:755161012
728 728 c, t dbSNP:368145008
730 730 a, g dbSNP:780169533
736 736 -, a dbSNP:779619231