
GCK cDNA ORF clone, Homo sapiens (human)

Gene Symbol GCK
Entrez Gene ID 2645
Full Name glucokinase (hexokinase 4)
General protein information
Preferred Names
hexokinase type IV
hexokinase D, pancreatic isozyme
ATP:D-hexose 6-phosphotransferase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]. lac of sum
Disorder MIM:


Disorder Html: MODY, type II, 125851 (3); Diabetes mellitus, noninsulin-dependent,

mRNA and Protein(s)

mRNA Protein Name
NM_000162 NP_000153 glucokinase isoform 1
NM_033507 NP_277042 glucokinase isoform 2
NM_033508 NP_277043 glucokinase isoform 3

hsa00500 Starch and sucrose metabolism
hsa00520 Amino sugar and nucleotide sugar metabolism
hsa00052 Galactose metabolism
hsa00010 Glycolysis / Gluconeogenesis
hsa04910 Insulin signaling pathway
hsa04950 Maturity onset diabetes of the young
hsa04930 Type II diabetes mellitus
hsa01100 Metabolic pathways
hsa00524 Butirosin and neomycin biosynthesis
hsa_M00001 Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
hsa_M00549 Nucleotide sugar biosynthesis, glucose => UDP-glucose
hsa04911 Insulin secretion
hsa05230 Central carbon metabolism in cancer
hsa01130 Biosynthesis of antibiotics
hsa04922 Glucagon signaling pathway
hsa04917 Prolactin signaling pathway
hsa01200 Carbon metabolism
WP382 MAPK signaling pathway
WP534 Glycolysis and Gluconeogenesis
WP706 SIDS Susceptibility Pathways
R-HSA-425407 SLC-mediated transmembrane transport
R-HSA-170822 Regulation of Glucokinase by Glucokinase Regulatory Protein
R-HSA-1430728 Metabolism
R-HSA-71387 Metabolism of carbohydrates
R-HSA-382551 Transmembrane transport of small molecules
R-HSA-189200 Hexose transport
R-HSA-70326 Glucose metabolism
R-HSA-70171 Glycolysis
R-HSA-70153 Glucose transport
R-HSA-1266738 Developmental Biology
R-HSA-186712 Regulation of beta-cell development
R-HSA-210745 Regulation of gene expression in beta cells
Pathway Interaction Database
hnf3bpathway FOXA2 and FOXA3 transcription factor networks
hif1_tfpathway HIF-1-alpha transcription factor network
HUMAN_PWY-5514 UDP-N-acetyl-D-galactosamine biosynthesis II
HUMAN_PWY0-1182 trehalose degradation
META_ANAEROFRUCAT-PWY homolactic fermentation
HUMAN_PWY66-400 glycolysis
HUMAN_PWY66-407 superpathway of conversion of glucose to acetyl CoA and entry into the TCA cycle
META_PWY66-400 glycolysis VI (metazoan)
HUMAN_PWY-5661-1 GDP-glucose biosynthesis II

Homo sapiens (human) GCK NP_000153.1
Pan troglodytes (chimpanzee) GCK XP_001143302.1
Macaca mulatta (Rhesus monkey) GCK XP_001093035.2
Bos taurus (cattle) GCK NP_001095772.1
Mus musculus (house mouse) Gck NP_034422.2
Rattus norvegicus (Norway rat) Gck NP_036697.1
Gallus gallus (chicken) GCK XP_427930.4
Danio rerio (zebrafish) gck NP_001038850.2
Xenopus (Silurana) tropicalis (western clawed frog) gck NP_001096321.1


ID Name Evidence
GO:0005654 nucleoplasm EXP
GO:0005829 cytosol EXP
GO:0005829 cytosol TAS


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004340 glucokinase activity IDA
GO:0004340 glucokinase activity TAS
GO:0005515 protein binding IPI
GO:0005524 ATP binding IDA
GO:0005536 glucose binding IDA
GO:0016301 kinase activity IEA
GO:0016740 transferase activity IEA


ID Name Evidence
GO:0005975 carbohydrate metabolic process TAS
GO:0006110 regulation of glycolysis NAS
GO:0008645 hexose transport TAS
GO:0010827 regulation of glucose transport TAS
GO:0015758 glucose transport TAS
GO:0031018 endocrine pancreas development TAS
GO:0032024 positive regulation of insulin secretion IMP
GO:0032869 cellular response to insulin stimulus ISS
GO:0042593 glucose homeostasis IMP
GO:0044320 cellular response to leptin stimulus ISS
GO:0045721 negative regulation of gluconeogenesis IMP
GO:0045725 positive regulation of glycogen biosynthetic process IMP
GO:0050796 regulation of insulin secretion IMP
GO:0051156 glucose 6-phosphate metabolic process IDA
GO:0051156 glucose 6-phosphate metabolic process TAS
GO:0051594 detection of glucose IMP
GO:0055085 transmembrane transport TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following GCK gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GCK cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_000162 Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu17640 NM_033507 Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $389.00
OHu17606 NM_033508 Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $389.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu18369
Accession Version NM_000162.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1398bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucokinase isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC001890.1 and M90299.1. This sequence is a reference standard in the RefSeqGene project. On Feb 11, 2008 this sequence version replaced gi:15967157. Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (1) encodes the isoform expressed specifically in pancreatic islet beta cells. Its first exon is specific to this variant, which has a unique 5' UTR. Isoform 1 has a distinct N-terminus; the remainder of the protein is identical to isoforms 2 and 3. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC001890.1, M88011.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1968189 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)375..377(+)
Misc Feature(2)492..1844(+)
Misc Feature(3)693..1304(+)
Misc Feature(4)702..1154(+)
Misc Feature(5)921..926(+)
Misc Feature(6)972..977(+)
Misc Feature(7)1080..1085(+)
Misc Feature(8)1125..1838(+)
Exon (1)1..515
Gene Synonym:
Exon (2)516..678
Gene Synonym:
Exon (3)679..833
Gene Synonym:
Exon (4)834..953
Gene Synonym:
Exon (5)954..1049
Gene Synonym:
Exon (6)1050..1149
Gene Synonym:
Exon (7)1150..1333
Gene Synonym:
Exon (8)1334..1489
Gene Synonym:
Exon (9)1490..1723
Gene Synonym:
Exon (10)1724..2733
Gene Synonym:
Position Chain Variation Link
14 14 c, t dbSNP:548039601
15 15 a, g dbSNP:757266656
16 16 a, g dbSNP:140894490
18 18 c, t dbSNP:191795044
19 19 a, g dbSNP:187173652
21 21 c, t dbSNP:546934866
67 67 c, t dbSNP:571805300
96 96 c, t dbSNP:775776110
167 167 c, t dbSNP:550056688
168 168 a, c dbSNP:746013482
172 172 a, g dbSNP:765620490
183 183 c, t dbSNP:534888331
190 190 c, g dbSNP:570705419
204 204 g, t dbSNP:59914952
217 217 c, t dbSNP:530899135
224 224 a, g dbSNP:376294398
241 241 a, t dbSNP:530328690
254 254 c, g dbSNP:73691419
256 256 a, g dbSNP:13306390
272 272 c, t dbSNP:183018696
278 278 a, g dbSNP:540109318
290 290 a, t dbSNP:771525755
291 291 a, g dbSNP:573122416
336 336 a, g dbSNP:746492953
368 368 c, t dbSNP:772780022
369 369 a, g dbSNP:781377703
373 373 c, t dbSNP:200216829
387 387 c, g dbSNP:13306391
427 427 a, g dbSNP:369065537
430 430 a, g dbSNP:753961083
431 431 a, g dbSNP:777675119
439 439 a, g dbSNP:756144077
447 447 c, g dbSNP:372823615
449 449 c, t dbSNP:778813669
454 454 c, t dbSNP:190731555
455 455 a, g dbSNP:751227251
456 456 c, t dbSNP:556747056
466 466 c, t dbSNP:193922251
470 470 a, g dbSNP:772806662
476 476 a, g dbSNP:769133700
479 479 c, t dbSNP:142553382
480 480 a, g dbSNP:202091228
486 486 a, g dbSNP:754792276
490 490 a, g dbSNP:746248882
500 500 c, t dbSNP:779084403
501 501 a, g dbSNP:116093166
502 502 c, t dbSNP:749422860
505 505 a, g dbSNP:777958777
507 507 -, aag dbSNP:762876924
509 509 a, g dbSNP:756232246
512 512 a, g dbSNP:748165387
518 518 a, g dbSNP:201152574
520 520 a, g dbSNP:113565983
523 523 a, g dbSNP:765737449
527 527 c, g dbSNP:193922308
544 544 g, t dbSNP:193922325
546 546 c, t dbSNP:193922329
573 573 a, t dbSNP:193922259
576 576 c, t dbSNP:762263694
577 577 c, g dbSNP:193922261
578 578 a, g dbSNP:754169218
587 587 a, g dbSNP:193922270
598 598 a, g dbSNP:764232985
599 599 c, t dbSNP:760912915
600 600 a, g dbSNP:267601516
601 601 a, g dbSNP:193922279
602 602 c, t dbSNP:775456214
608 608 a, g dbSNP:550111033
612 612 a, g dbSNP:759514960
616 616 a, c dbSNP:193922286
626 626 a, g dbSNP:774271708
632 632 c, g, t dbSNP:749097393
645 645 c, t dbSNP:193922287
647 647 a, c dbSNP:769360432
649 649 c, t dbSNP:747783371
653 653 c, t dbSNP:780612692
657 657 c, t dbSNP:754479025
658 658 a, g dbSNP:746444094
668 668 a, g dbSNP:377410513
673 673 a, g dbSNP:373418736
677 677 a, g dbSNP:779548342
683 683 c, t dbSNP:143128547
684 684 a, g dbSNP:193922289
701 701 a, g dbSNP:770389460
707 707 a, c, g dbSNP:756496443
723 723 a, t dbSNP:193922290
734 734 a, g dbSNP:139817377
740 740 a, g dbSNP:571528578
754 754 a, g dbSNP:755129550
759 759 a, g dbSNP:751666458
770 770 c, t dbSNP:13306389
771 771 a, g dbSNP:762922697
774 774 a, t dbSNP:193922291
785 785 c, t dbSNP:750338803
792 792 g, t dbSNP:193922292
794 794 c, t dbSNP:765007563
797 797 a, c dbSNP:765543851
803 803 c, g, t dbSNP:61736250
804 804 a, g dbSNP:568894624
809 809 c, t dbSNP:149412035
810 810 a, g dbSNP:760356440
812 812 c, t dbSNP:775190578
813 813 a, g dbSNP:771677681
814 814 a, c, t dbSNP:778334710
818 818 c, t dbSNP:770145567
819 819 a, g dbSNP:748554061
827 827 c, t dbSNP:781498576
828 828 a, g dbSNP:755213414
840 840 a, g dbSNP:759072800
855 855 c, t dbSNP:377106269
861 861 c, t dbSNP:104894010
863 863 -, c dbSNP:193922295
863 863 c, t dbSNP:139139350
864 864 a, g dbSNP:762419802
869 869 c, t dbSNP:536833815
885 885 a, t dbSNP:368137186
903 903 c, t dbSNP:150779253
905 905 c, g, t dbSNP:773281783
910 910 a, g dbSNP:193922296
917 917 c, t dbSNP:746026875
919 919 a, c, t dbSNP:193922297
920 920 c, t dbSNP:193922299
927 927 c, t dbSNP:193922300
930 930 c, g dbSNP:779091112
933 933 a, g dbSNP:193922301
935 935 a, g dbSNP:757281286
938 938 c, t dbSNP:749296295
953 953 a, g dbSNP:193922302
979 979 g, t dbSNP:193922303
988 988 -, c dbSNP:34389297
988 988 c, t dbSNP:370966942
993 993 a, g dbSNP:587780344
997 997 c, g dbSNP:193922304
1002 1002 a, g dbSNP:193922305
1004 1004 a, g dbSNP:749386678
1012 1012 c, t dbSNP:193922306
1013 1013 c, t dbSNP:777964292
1014 1014 a, g dbSNP:587780345
1019 1019 a, g dbSNP:756145968
1026 1026 a, c, t dbSNP:104894006
1030 1030 a, t dbSNP:781077527
1031 1031 c, t dbSNP:754722633
1032 1032 a, g dbSNP:751279776
1033 1033 c, t dbSNP:193922307
1034 1034 c, t dbSNP:377355289
1035 1035 a, g dbSNP:757978639
1044 1044 a, c dbSNP:373262279
1045 1045 a, g dbSNP:764676295
1047 1047 c, g dbSNP:376050856
1052 1052 c, t dbSNP:766830747
1057 1057 a, g dbSNP:193922309
1064 1064 c, t dbSNP:376713590
1067 1067 c, g dbSNP:562434968
1070 1070 a, g dbSNP:773561406
1074 1074 a, g dbSNP:193922310
1075 1075 c, t dbSNP:193922311
1079 1079 a, g, t dbSNP:776703291
1085 1085 c, g dbSNP:193922312
1086 1086 a, c dbSNP:587780346
1088 1088 a, g dbSNP:142817246
1093 1093 c, t dbSNP:746913146
1097 1097 a, g dbSNP:779762447
1099 1099 a, t dbSNP:80356654
1100 1100 g, t dbSNP:193922313
1101 1101 a, g dbSNP:771822911
1105 1105 -, cct dbSNP:193922314
1105 1105 c, t dbSNP:150077934
1111 1111 a, g dbSNP:104894015
1115 1115 c, g, t dbSNP:144723656
1116 1116 a, g dbSNP:778550411
1119 1119 a, g dbSNP:147065275
1125 1125 c, t dbSNP:766809919
1128 1128 c, t dbSNP:193922315
1129 1129 a, g dbSNP:193922316
1130 1130 c, t dbSNP:142952813
1131 1131 a, g dbSNP:193922317
1136 1136 c, t dbSNP:193922318
1145 1145 c, t dbSNP:772754004
1146 1146 a, g dbSNP:148311934
1147 1147 c, t dbSNP:193922319
1153 1153 c, t dbSNP:80356655
1154 1154 a, g dbSNP:371616363
1164 1164 a, g dbSNP:193922322
1174 1174 c, t dbSNP:193922323
1176 1176 a, g dbSNP:587780347
1180 1180 -, a dbSNP:751505614
1186 1186 a, g dbSNP:764146649
1193 1193 a, g dbSNP:193922324
1196 1196 a, g dbSNP:373582283
1205 1205 a, g dbSNP:775481896
1211 1211 c, t dbSNP:767476001
1212 1212 a, g dbSNP:759421263
1215 1215 a, g dbSNP:763631453
1219 1219 a, g dbSNP:370375148
1222 1222 c, t dbSNP:193922326
1226 1226 c, t dbSNP:770730728
1227 1227 a, g dbSNP:748964205
1228 1228 c, g, t dbSNP:193921400
1230 1230 a, c dbSNP:193922327
1235 1235 c, t dbSNP:772908574
1236 1236 a, g dbSNP:769268803
1238 1238 c, g dbSNP:193922328
1243 1243 a, g dbSNP:747662793
1244 1244 c, t dbSNP:780806456
1249 1249 c, t dbSNP:193922330
1251 1251 a, g dbSNP:104894008
1253 1253 a, g dbSNP:746352566
1254 1254 a, g dbSNP:779460424
1257 1257 c, t dbSNP:193922331
1259 1259 c, t dbSNP:757636596
1260 1260 a, g dbSNP:193929373
1262 1262 c, t dbSNP:754094813
1263 1263 g, t dbSNP:104894011
1271 1271 c, t dbSNP:778060949
1282 1282 c, t dbSNP:193922332
1292 1292 c, t dbSNP:756251613
1293 1293 c, t dbSNP:556436603
1294 1294 a, g dbSNP:767565869
1296 1296 c, g dbSNP:143387473
1303 1303 a, t dbSNP:193922333
1304 1304 c, t dbSNP:200071687
1305 1305 c, g, t dbSNP:104894005
1306 1306 a, g dbSNP:143484733
1310 1310 c, t dbSNP:772811891
1315 1315 c, t dbSNP:769515448
1319 1319 c, t dbSNP:199851776
1322 1322 c, t dbSNP:145323719
1323 1323 c, g dbSNP:776328308
1333 1333 g, t dbSNP:768247903
1341 1341 a, t dbSNP:193922335
1352 1352 c, t dbSNP:748431922
1365 1365 c, g dbSNP:104894009
1377 1377 c, t dbSNP:193922336
1383 1383 c, g, t dbSNP:755123456
1387 1387 c, t dbSNP:193922337
1397 1397 c, t dbSNP:747140104
1399 1399 g, t dbSNP:779946341
1412 1412 c, g dbSNP:758407777
1414 1414 a, t dbSNP:193922338
1417 1417 a, t dbSNP:193922339
1418 1418 c, t dbSNP:111715157
1422 1422 g, t dbSNP:193922340
1424 1424 c, g dbSNP:145764627
1433 1433 c, t dbSNP:753628968
1434 1434 a, g dbSNP:763870160
1438 1438 a, g dbSNP:760356145
1441 1441 c, t dbSNP:193922341
1450 1450 a, g dbSNP:775116098
1451 1451 c, t dbSNP:766907428
1458 1458 g, t dbSNP:763586339
1460 1460 c, t dbSNP:773582328
1465 1465 c, t dbSNP:770231054
1472 1472 aa, cg dbSNP:193922252
1473 1473 -, aa dbSNP:193922253
1473 1473 -, g dbSNP:193922254
1485 1485 a, g dbSNP:397514580
1488 1488 a, g dbSNP:193922255
1495 1495 c, g dbSNP:749208290
1496 1496 c, g dbSNP:777780118
1512 1512 a, t dbSNP:193922260
1533 1533 c, t dbSNP:574954919
1538 1538 g, t dbSNP:369103069
1541 1541 c, g dbSNP:752481898
1542 1542 c, t dbSNP:780716926
1550 1550 a, g dbSNP:754623359
1556 1556 c, t dbSNP:751087372
1559 1559 c, t dbSNP:765849566
1575 1575 c, g, t dbSNP:754337045
1578 1578 g, t dbSNP:764575801
1582 1582 g, t dbSNP:587780343
1583 1583 c, t dbSNP:556581174
1584 1584 g, t dbSNP:193922262
1586 1586 a, g dbSNP:775856595
1588 1588 c, g dbSNP:574763474
1594 1594 c, t dbSNP:193922263
1600 1600 a, g dbSNP:193922264
1602 1602 a, g dbSNP:104894016
1603 1603 c, t dbSNP:193929374
1606 1606 a, c dbSNP:193922265
1607 1607 a, g dbSNP:759783300
1610 1610 a, c dbSNP:774614309
1611 1611 a, c dbSNP:771131882
1612 1612 g, t dbSNP:193922266
1617 1617 g, t dbSNP:749298368
1618 1618 a, c dbSNP:777870079
1622 1622 a, g dbSNP:769709550
1623 1623 a, g dbSNP:193922267
1627 1627 c, t dbSNP:193922268
1630 1630 a, c, t dbSNP:193921338
1631 1631 a, g dbSNP:780987378
1639 1639 a, c, t dbSNP:193921340
1645 1645 g, t dbSNP:193922269
1652 1652 c, g, t dbSNP:542306878
1654 1654 a, g dbSNP:751179138
1659 1659 c, t dbSNP:370464857
1660 1660 g, t dbSNP:193929375
1665 1665 a, g dbSNP:757888672
1669 1669 a, g dbSNP:749877032
1670 1670 c, g dbSNP:764512775
1671 1671 a, g dbSNP:761204125
1677 1677 c, g dbSNP:193922271
1685 1685 c, t dbSNP:753053384
1691 1691 a, c dbSNP:767892728
1703 1703 c, g, t dbSNP:755112715
1710 1710 a, g dbSNP:193922272
1718 1718 c, t dbSNP:766653778
1738 1738 a, t dbSNP:193922273
1742 1742 c, t dbSNP:776620750
1749 1749 gtgcgcaggctgacgcccagctgcgagatcaccttcatcgagtcggag gagggcagtggccggggcgcggccctggtctc, ttaca dbSNP:193922274
1751 1751 a, g dbSNP:768525470
1752 1752 c, t dbSNP:552762648
1753 1753 -, gc dbSNP:193922275
1754 1754 a, c dbSNP:775226028
1755 1755 a, c dbSNP:140672134
1756 1756 a, g dbSNP:146683328
1758 1758 c, t dbSNP:193922276
1759 1759 c, t dbSNP:193922277
1761 1761 a, g dbSNP:188718376
1763 1763 c, g dbSNP:748686229
1772 1772 c, t dbSNP:781723641
1776 1776 a, g dbSNP:755498926
1777 1777 a, t dbSNP:193922278
1781 1781 c, t dbSNP:751990384
1793 1793 a, g dbSNP:766824450
1794 1794 a, g dbSNP:758737171
1799 1799 a, g dbSNP:140886210
1802 1802 -, c dbSNP:193922280
1809 1809 c, g dbSNP:193922281
1814 1814 c, g dbSNP:570159732
1815 1815 a, g dbSNP:193922282
1828 1828 c, t dbSNP:193922283
1829 1829 g, t dbSNP:761968548
1833 1833 -, gggg dbSNP:377247972
1833 1833 a, g dbSNP:104894012
1834 1834 a, t dbSNP:753795627
1837 1837 c, t dbSNP:104894014
1842 1842 -, aa dbSNP:193922284
1850 1850 c, t dbSNP:764050932
1856 1856 a, g, t dbSNP:193922285
1861 1861 a, g dbSNP:771849602
1874 1874 a, g dbSNP:369520128
1879 1879 c, t dbSNP:200698755
1880 1880 a, c, g dbSNP:748858674
1884 1884 c, g dbSNP:41282709
1885 1885 c, g dbSNP:769332415
1886 1886 a, c, g dbSNP:559451844
1960 1960 a, c dbSNP:557990162
1984 1984 a, c dbSNP:528326399
1987 1987 a, c dbSNP:563950957
1998 1998 -, c dbSNP:139354711
2078 2078 a, g dbSNP:545586440
2081 2081 a, g dbSNP:762536430
2112 2112 c, g dbSNP:530568127
2122 2122 a, g dbSNP:563024661
2150 2150 g, t dbSNP:765045212
2165 2165 g, t dbSNP:527259972
2200 2200 a, g dbSNP:13306388
2224 2224 a, g dbSNP:146107173
2243 2243 c, t dbSNP:541720596
2244 2244 a, g dbSNP:577601329
2274 2274 c, t dbSNP:114431571
2301 2301 c, t dbSNP:770793950
2311 2311 a, g dbSNP:201235980
2345 2345 c, t dbSNP:2908275
2378 2378 c, t dbSNP:141645300
2477 2477 a, g dbSNP:570194904
2546 2546 g, t dbSNP:555058443
2559 2559 a, g dbSNP:568995709
2575 2575 a, t dbSNP:536317133
2601 2601 c, t dbSNP:138562953
2603 2603 a, c dbSNP:556996030
2607 2607 a, g dbSNP:528412344
2621 2621 a, g dbSNP:570413232
2627 2627 -, c dbSNP:761652517
2627 2627 -, c dbSNP:55714218
2627 2627 c, t dbSNP:200628800
2632 2632 c, t dbSNP:185418856
2642 2642 a, g dbSNP:530604939
2646 2646 -, cc dbSNP:34322372
2665 2665 c, t dbSNP:2908276
2669 2669 c, g dbSNP:749438148
2714 2714 c, t dbSNP:780243846
2715 2715 a, g dbSNP:76374134
2726 2726 -, ta dbSNP:35548117

Target ORF information:

RefSeq Version NM_000162
Organism Homo sapiens (human)
Definition Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17640
Accession Version NM_033507.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1401bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucokinase isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC006454.4, AK122876.1, M69051.1, CD251038.1 and M90299.1. Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (2) encodes the major isoform expressed in liver. Its first exon is specific to the liver transcripts, variants 2 and 3, but it lacks a second liver-specific exon found in variant 3. Isoform 2 has a distinct N-terminus; the remainder of the protein is identical to isoforms 1 and 3. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK122876.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2162895 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)154..156(+)
Misc Feature(2)217..1545(+)
Misc Feature(3)394..1005(+)
Misc Feature(4)403..855(+)
Misc Feature(5)826..1539(+)
Exon (1)1..216
Gene Synonym:
Exon (2)217..379
Gene Synonym:
Exon (3)380..534
Gene Synonym:
Exon (4)535..654
Gene Synonym:
Exon (5)655..750
Gene Synonym:
Exon (6)751..850
Gene Synonym:
Exon (7)851..1034
Gene Synonym:
Exon (8)1035..1190
Gene Synonym:
Exon (9)1191..1424
Gene Synonym:
Exon (10)1425..2434
Gene Synonym:
Position Chain Variation Link
26 26 g, t dbSNP:113260344
28 28 c, t dbSNP:554491393
112 112 c, t dbSNP:540471004
124 124 a, g dbSNP:150560724
125 125 c, t dbSNP:73314180
131 131 c, t dbSNP:773304385
133 133 a, c dbSNP:770054616
134 134 a, c dbSNP:367774728
135 135 -, t dbSNP:776654918
138 138 a, c dbSNP:374650442
142 142 a, g dbSNP:754996159
145 145 c, t dbSNP:191599719
150 150 c, t dbSNP:779944143
160 160 c, g, t dbSNP:750154659
162 162 c, t dbSNP:578238909
163 163 a, g dbSNP:372259487
168 168 a, g, t dbSNP:146701164
173 173 c, t dbSNP:753381934
174 174 a, g dbSNP:763550503
180 180 c, t dbSNP:760138967
182 182 c, t dbSNP:774691156
186 186 a, g dbSNP:368776779
203 203 c, g dbSNP:763215868
212 212 c, g, t dbSNP:770144386
219 219 a, g dbSNP:201152574
221 221 a, g dbSNP:113565983
224 224 a, g dbSNP:765737449
228 228 c, g dbSNP:193922308
245 245 g, t dbSNP:193922325
247 247 c, t dbSNP:193922329
274 274 a, t dbSNP:193922259
277 277 c, t dbSNP:762263694
278 278 c, g dbSNP:193922261
279 279 a, g dbSNP:754169218
288 288 a, g dbSNP:193922270
299 299 a, g dbSNP:764232985
300 300 c, t dbSNP:760912915
301 301 a, g dbSNP:267601516
302 302 a, g dbSNP:193922279
303 303 c, t dbSNP:775456214
309 309 a, g dbSNP:550111033
313 313 a, g dbSNP:759514960
317 317 a, c dbSNP:193922286
327 327 a, g dbSNP:774271708
333 333 c, g, t dbSNP:749097393
346 346 c, t dbSNP:193922287
348 348 a, c dbSNP:769360432
350 350 c, t dbSNP:747783371
354 354 c, t dbSNP:780612692
358 358 c, t dbSNP:754479025
359 359 a, g dbSNP:746444094
369 369 a, g dbSNP:377410513
374 374 a, g dbSNP:373418736
378 378 a, g dbSNP:779548342
384 384 c, t dbSNP:143128547
385 385 a, g dbSNP:193922289
402 402 a, g dbSNP:770389460
408 408 a, c, g dbSNP:756496443
424 424 a, t dbSNP:193922290
435 435 a, g dbSNP:139817377
441 441 a, g dbSNP:571528578
455 455 a, g dbSNP:755129550
460 460 a, g dbSNP:751666458
471 471 c, t dbSNP:13306389
472 472 a, g dbSNP:762922697
475 475 a, t dbSNP:193922291
486 486 c, t dbSNP:750338803
493 493 g, t dbSNP:193922292
495 495 c, t dbSNP:765007563
498 498 a, c dbSNP:765543851
504 504 c, g, t dbSNP:61736250
505 505 a, g dbSNP:568894624
510 510 c, t dbSNP:149412035
511 511 a, g dbSNP:760356440
513 513 c, t dbSNP:775190578
514 514 a, g dbSNP:771677681
515 515 a, c, t dbSNP:778334710
519 519 c, t dbSNP:770145567
520 520 a, g dbSNP:748554061
528 528 c, t dbSNP:781498576
529 529 a, g dbSNP:755213414
541 541 a, g dbSNP:759072800
556 556 c, t dbSNP:377106269
562 562 c, t dbSNP:104894010
564 564 -, c dbSNP:193922295
564 564 c, t dbSNP:139139350
565 565 a, g dbSNP:762419802
570 570 c, t dbSNP:536833815
586 586 a, t dbSNP:368137186
604 604 c, t dbSNP:150779253
606 606 c, g, t dbSNP:773281783
611 611 a, g dbSNP:193922296
618 618 c, t dbSNP:746026875
620 620 a, c, t dbSNP:193922297
621 621 c, t dbSNP:193922299
628 628 c, t dbSNP:193922300
631 631 c, g dbSNP:779091112
634 634 a, g dbSNP:193922301
636 636 a, g dbSNP:757281286
639 639 c, t dbSNP:749296295
654 654 a, g dbSNP:193922302
680 680 g, t dbSNP:193922303
689 689 -, c dbSNP:34389297
689 689 c, t dbSNP:370966942
694 694 a, g dbSNP:587780344
698 698 c, g dbSNP:193922304
703 703 a, g dbSNP:193922305
705 705 a, g dbSNP:749386678
713 713 c, t dbSNP:193922306
714 714 c, t dbSNP:777964292
715 715 a, g dbSNP:587780345
720 720 a, g dbSNP:756145968
727 727 a, c, t dbSNP:104894006
731 731 a, t dbSNP:781077527
732 732 c, t dbSNP:754722633
733 733 a, g dbSNP:751279776
734 734 c, t dbSNP:193922307
735 735 c, t dbSNP:377355289
736 736 a, g dbSNP:757978639
745 745 a, c dbSNP:373262279
746 746 a, g dbSNP:764676295
748 748 c, g dbSNP:376050856
753 753 c, t dbSNP:766830747
758 758 a, g dbSNP:193922309
765 765 c, t dbSNP:376713590
768 768 c, g dbSNP:562434968
771 771 a, g dbSNP:773561406
775 775 a, g dbSNP:193922310
776 776 c, t dbSNP:193922311
780 780 a, g, t dbSNP:776703291
786 786 c, g dbSNP:193922312
787 787 a, c dbSNP:587780346
789 789 a, g dbSNP:142817246
794 794 c, t dbSNP:746913146
798 798 a, g dbSNP:779762447
800 800 a, t dbSNP:80356654
801 801 g, t dbSNP:193922313
802 802 a, g dbSNP:771822911
806 806 -, cct dbSNP:193922314
806 806 c, t dbSNP:150077934
812 812 a, g dbSNP:104894015
816 816 c, g, t dbSNP:144723656
817 817 a, g dbSNP:778550411
820 820 a, g dbSNP:147065275
826 826 c, t dbSNP:766809919
829 829 c, t dbSNP:193922315
830 830 a, g dbSNP:193922316
831 831 c, t dbSNP:142952813
832 832 a, g dbSNP:193922317
837 837 c, t dbSNP:193922318
846 846 c, t dbSNP:772754004
847 847 a, g dbSNP:148311934
848 848 c, t dbSNP:193922319
854 854 c, t dbSNP:80356655
855 855 a, g dbSNP:371616363
865 865 a, g dbSNP:193922322
875 875 c, t dbSNP:193922323
877 877 a, g dbSNP:587780347
881 881 -, a dbSNP:751505614
887 887 a, g dbSNP:764146649
894 894 a, g dbSNP:193922324
897 897 a, g dbSNP:373582283
906 906 a, g dbSNP:775481896
912 912 c, t dbSNP:767476001
913 913 a, g dbSNP:759421263
916 916 a, g dbSNP:763631453
920 920 a, g dbSNP:370375148
923 923 c, t dbSNP:193922326
927 927 c, t dbSNP:770730728
928 928 a, g dbSNP:748964205
929 929 c, g, t dbSNP:193921400
931 931 a, c dbSNP:193922327
936 936 c, t dbSNP:772908574
937 937 a, g dbSNP:769268803
939 939 c, g dbSNP:193922328
944 944 a, g dbSNP:747662793
945 945 c, t dbSNP:780806456
950 950 c, t dbSNP:193922330
952 952 a, g dbSNP:104894008
954 954 a, g dbSNP:746352566
955 955 a, g dbSNP:779460424
958 958 c, t dbSNP:193922331
960 960 c, t dbSNP:757636596
961 961 a, g dbSNP:193929373
963 963 c, t dbSNP:754094813
964 964 g, t dbSNP:104894011
972 972 c, t dbSNP:778060949
983 983 c, t dbSNP:193922332
993 993 c, t dbSNP:756251613
994 994 c, t dbSNP:556436603
995 995 a, g dbSNP:767565869
997 997 c, g dbSNP:143387473
1004 1004 a, t dbSNP:193922333
1005 1005 c, t dbSNP:200071687
1006 1006 c, g, t dbSNP:104894005
1007 1007 a, g dbSNP:143484733
1011 1011 c, t dbSNP:772811891
1016 1016 c, t dbSNP:769515448
1020 1020 c, t dbSNP:199851776
1023 1023 c, t dbSNP:145323719
1024 1024 c, g dbSNP:776328308
1034 1034 g, t dbSNP:768247903
1042 1042 a, t dbSNP:193922335
1053 1053 c, t dbSNP:748431922
1066 1066 c, g dbSNP:104894009
1078 1078 c, t dbSNP:193922336
1084 1084 c, g, t dbSNP:755123456
1088 1088 c, t dbSNP:193922337
1098 1098 c, t dbSNP:747140104
1100 1100 g, t dbSNP:779946341
1113 1113 c, g dbSNP:758407777
1115 1115 a, t dbSNP:193922338
1118 1118 a, t dbSNP:193922339
1119 1119 c, t dbSNP:111715157
1123 1123 g, t dbSNP:193922340
1125 1125 c, g dbSNP:145764627
1134 1134 c, t dbSNP:753628968
1135 1135 a, g dbSNP:763870160
1139 1139 a, g dbSNP:760356145
1142 1142 c, t dbSNP:193922341
1151 1151 a, g dbSNP:775116098
1152 1152 c, t dbSNP:766907428
1159 1159 g, t dbSNP:763586339
1161 1161 c, t dbSNP:773582328
1166 1166 c, t dbSNP:770231054
1173 1173 aa, cg dbSNP:193922252
1174 1174 -, aa dbSNP:193922253
1174 1174 -, g dbSNP:193922254
1186 1186 a, g dbSNP:397514580
1189 1189 a, g dbSNP:193922255
1196 1196 c, g dbSNP:749208290
1197 1197 c, g dbSNP:777780118
1213 1213 a, t dbSNP:193922260
1234 1234 c, t dbSNP:574954919
1239 1239 g, t dbSNP:369103069
1242 1242 c, g dbSNP:752481898
1243 1243 c, t dbSNP:780716926
1251 1251 a, g dbSNP:754623359
1257 1257 c, t dbSNP:751087372
1260 1260 c, t dbSNP:765849566
1276 1276 c, g, t dbSNP:754337045
1279 1279 g, t dbSNP:764575801
1283 1283 g, t dbSNP:587780343
1284 1284 c, t dbSNP:556581174
1285 1285 g, t dbSNP:193922262
1287 1287 a, g dbSNP:775856595
1289 1289 c, g dbSNP:574763474
1295 1295 c, t dbSNP:193922263
1301 1301 a, g dbSNP:193922264
1303 1303 a, g dbSNP:104894016
1304 1304 c, t dbSNP:193929374
1307 1307 a, c dbSNP:193922265
1308 1308 a, g dbSNP:759783300
1311 1311 a, c dbSNP:774614309
1312 1312 a, c dbSNP:771131882
1313 1313 g, t dbSNP:193922266
1318 1318 g, t dbSNP:749298368
1319 1319 a, c dbSNP:777870079
1323 1323 a, g dbSNP:769709550
1324 1324 a, g dbSNP:193922267
1328 1328 c, t dbSNP:193922268
1331 1331 a, c, t dbSNP:193921338
1332 1332 a, g dbSNP:780987378
1340 1340 a, c, t dbSNP:193921340
1346 1346 g, t dbSNP:193922269
1353 1353 c, g, t dbSNP:542306878
1355 1355 a, g dbSNP:751179138
1360 1360 c, t dbSNP:370464857
1361 1361 g, t dbSNP:193929375
1366 1366 a, g dbSNP:757888672
1370 1370 a, g dbSNP:749877032
1371 1371 c, g dbSNP:764512775
1372 1372 a, g dbSNP:761204125
1378 1378 c, g dbSNP:193922271
1386 1386 c, t dbSNP:753053384
1392 1392 a, c dbSNP:767892728
1404 1404 c, g, t dbSNP:755112715
1411 1411 a, g dbSNP:193922272
1419 1419 c, t dbSNP:766653778
1439 1439 a, t dbSNP:193922273
1443 1443 c, t dbSNP:776620750
1450 1450 gtgcgcaggctgacgcccagctgcgagatcaccttcatcgagtcggag gagggcagtggccggggcgcggccctggtctc, ttaca dbSNP:193922274
1452 1452 a, g dbSNP:768525470
1453 1453 c, t dbSNP:552762648
1454 1454 -, gc dbSNP:193922275
1455 1455 a, c dbSNP:775226028
1456 1456 a, c dbSNP:140672134
1457 1457 a, g dbSNP:146683328
1459 1459 c, t dbSNP:193922276
1460 1460 c, t dbSNP:193922277
1462 1462 a, g dbSNP:188718376
1464 1464 c, g dbSNP:748686229
1473 1473 c, t dbSNP:781723641
1477 1477 a, g dbSNP:755498926
1478 1478 a, t dbSNP:193922278
1482 1482 c, t dbSNP:751990384
1494 1494 a, g dbSNP:766824450
1495 1495 a, g dbSNP:758737171
1500 1500 a, g dbSNP:140886210
1503 1503 -, c dbSNP:193922280
1510 1510 c, g dbSNP:193922281
1515 1515 c, g dbSNP:570159732
1516 1516 a, g dbSNP:193922282
1529 1529 c, t dbSNP:193922283
1530 1530 g, t dbSNP:761968548
1534 1534 -, gggg dbSNP:377247972
1534 1534 a, g dbSNP:104894012
1535 1535 a, t dbSNP:753795627
1538 1538 c, t dbSNP:104894014
1543 1543 -, aa dbSNP:193922284
1551 1551 c, t dbSNP:764050932
1557 1557 a, g, t dbSNP:193922285
1562 1562 a, g dbSNP:771849602
1575 1575 a, g dbSNP:369520128
1580 1580 c, t dbSNP:200698755
1581 1581 a, c, g dbSNP:748858674
1585 1585 c, g dbSNP:41282709
1586 1586 c, g dbSNP:769332415
1587 1587 a, c, g dbSNP:559451844
1661 1661 a, c dbSNP:557990162
1685 1685 a, c dbSNP:528326399
1688 1688 a, c dbSNP:563950957
1699 1699 -, c dbSNP:139354711
1779 1779 a, g dbSNP:545586440
1782 1782 a, g dbSNP:762536430
1813 1813 c, g dbSNP:530568127
1823 1823 a, g dbSNP:563024661
1851 1851 g, t dbSNP:765045212
1866 1866 g, t dbSNP:527259972
1901 1901 a, g dbSNP:13306388
1925 1925 a, g dbSNP:146107173
1944 1944 c, t dbSNP:541720596
1945 1945 a, g dbSNP:577601329
1975 1975 c, t dbSNP:114431571
2002 2002 c, t dbSNP:770793950
2012 2012 a, g dbSNP:201235980
2046 2046 c, t dbSNP:2908275
2079 2079 c, t dbSNP:141645300
2178 2178 a, g dbSNP:570194904
2247 2247 g, t dbSNP:555058443
2260 2260 a, g dbSNP:568995709
2276 2276 a, t dbSNP:536317133
2302 2302 c, t dbSNP:138562953
2304 2304 a, c dbSNP:556996030
2308 2308 a, g dbSNP:528412344
2322 2322 a, g dbSNP:570413232
2328 2328 -, c dbSNP:761652517
2328 2328 -, c dbSNP:55714218
2328 2328 c, t dbSNP:200628800
2333 2333 c, t dbSNP:185418856
2343 2343 a, g dbSNP:530604939
2347 2347 -, cc dbSNP:34322372
2366 2366 c, t dbSNP:2908276
2370 2370 c, g dbSNP:749438148
2415 2415 c, t dbSNP:780243846
2416 2416 a, g dbSNP:76374134
2427 2427 -, ta dbSNP:35548117

Target ORF information:

RefSeq Version NM_033507
Organism Homo sapiens (human)
Definition Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17606
Accession Version NM_033508.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1395bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucokinase isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC006454.4, M69051.1, DA640823.1, CD251038.1 and M90299.1. Summary: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. Alternative splicing of this gene results in three tissue-specific forms of glucokinase, one found in pancreatic islet beta cells and two found in liver. The protein localizes to the outer membrane of mitochondria. In contrast to other forms of hexokinase, this enzyme is not inhibited by its product glucose-6-phosphate but remains active while glucose is abundant. Mutations in this gene have been associated with non-insulin dependent diabetes mellitus (NIDDM), maturity onset diabetes of the young, type 2 (MODY2) and persistent hyperinsulinemic hypoglycemia of infancy (PHHI). [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (3) is the minor form expressed in liver. Its first exon is specific to the liver transcripts, variants 2 and 3; its second exon is unique to this transcript. Isoform 3 has a distinct N-terminus; the remainder of the protein is identical to isoforms 1 and 2. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: M69051.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA2162895 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)230..232(+)
Misc Feature(2)335..1669(+)
Misc Feature(3)518..1129(+)
Misc Feature(4)527..979(+)
Misc Feature(5)950..1663(+)
Exon (1)1..216
Gene Synonym:
Exon (2)217..340
Gene Synonym:
Exon (3)341..503
Gene Synonym:
Exon (4)504..658
Gene Synonym:
Exon (5)659..778
Gene Synonym:
Exon (6)779..874
Gene Synonym:
Exon (7)875..974
Gene Synonym:
Exon (8)975..1158
Gene Synonym:
Exon (9)1159..1314
Gene Synonym:
Exon (10)1315..1548
Gene Synonym:
Exon (11)1549..2558
Gene Synonym:
Position Chain Variation Link
26 26 g, t dbSNP:113260344
28 28 c, t dbSNP:554491393
112 112 c, t dbSNP:540471004
124 124 a, g dbSNP:150560724
125 125 c, t dbSNP:73314180
131 131 c, t dbSNP:773304385
133 133 a, c dbSNP:770054616
134 134 a, c dbSNP:367774728
135 135 -, t dbSNP:776654918
138 138 a, c dbSNP:374650442
142 142 a, g dbSNP:754996159
145 145 c, t dbSNP:191599719
150 150 c, t dbSNP:779944143
160 160 c, g, t dbSNP:750154659
162 162 c, t dbSNP:578238909
163 163 a, g dbSNP:372259487
168 168 a, g, t dbSNP:146701164
173 173 c, t dbSNP:753381934
174 174 a, g dbSNP:763550503
180 180 c, t dbSNP:760138967
182 182 c, t dbSNP:774691156
186 186 a, g dbSNP:368776779
203 203 c, g dbSNP:763215868
212 212 c, g, t dbSNP:770144386
237 237 a, g dbSNP:35140467
246 246 a, g dbSNP:142967368
256 256 a, g dbSNP:777309118
271 271 c, t dbSNP:368069931
272 272 c, t dbSNP:755578427
273 273 a, g dbSNP:752169118
277 277 -, c dbSNP:747046825
281 281 a, g dbSNP:766807950
293 293 a, g dbSNP:763447475
302 302 c, t dbSNP:750845201
308 308 c, g dbSNP:765643744
323 323 c, t dbSNP:762175784
326 326 c, t dbSNP:776960898
333 333 a, g dbSNP:552785770
343 343 a, g dbSNP:201152574
345 345 a, g dbSNP:113565983
348 348 a, g dbSNP:765737449
352 352 c, g dbSNP:193922308
369 369 g, t dbSNP:193922325
371 371 c, t dbSNP:193922329
398 398 a, t dbSNP:193922259
401 401 c, t dbSNP:762263694
402 402 c, g dbSNP:193922261
403 403 a, g dbSNP:754169218
412 412 a, g dbSNP:193922270
423 423 a, g dbSNP:764232985
424 424 c, t dbSNP:760912915
425 425 a, g dbSNP:267601516
426 426 a, g dbSNP:193922279
427 427 c, t dbSNP:775456214
433 433 a, g dbSNP:550111033
437 437 a, g dbSNP:759514960
441 441 a, c dbSNP:193922286
451 451 a, g dbSNP:774271708
457 457 c, g, t dbSNP:749097393
470 470 c, t dbSNP:193922287
472 472 a, c dbSNP:769360432
474 474 c, t dbSNP:747783371
478 478 c, t dbSNP:780612692
482 482 c, t dbSNP:754479025
483 483 a, g dbSNP:746444094
493 493 a, g dbSNP:377410513
498 498 a, g dbSNP:373418736
502 502 a, g dbSNP:779548342
508 508 c, t dbSNP:143128547
509 509 a, g dbSNP:193922289
526 526 a, g dbSNP:770389460
532 532 a, c, g dbSNP:756496443
548 548 a, t dbSNP:193922290
559 559 a, g dbSNP:139817377
565 565 a, g dbSNP:571528578
579 579 a, g dbSNP:755129550
584 584 a, g dbSNP:751666458
595 595 c, t dbSNP:13306389
596 596 a, g dbSNP:762922697
599 599 a, t dbSNP:193922291
610 610 c, t dbSNP:750338803
617 617 g, t dbSNP:193922292
619 619 c, t dbSNP:765007563
622 622 a, c dbSNP:765543851
628 628 c, g, t dbSNP:61736250
629 629 a, g dbSNP:568894624
634 634 c, t dbSNP:149412035
635 635 a, g dbSNP:760356440
637 637 c, t dbSNP:775190578
638 638 a, g dbSNP:771677681
639 639 a, c, t dbSNP:778334710
643 643 c, t dbSNP:770145567
644 644 a, g dbSNP:748554061
652 652 c, t dbSNP:781498576
653 653 a, g dbSNP:755213414
665 665 a, g dbSNP:759072800
680 680 c, t dbSNP:377106269
686 686 c, t dbSNP:104894010
688 688 -, c dbSNP:193922295
688 688 c, t dbSNP:139139350
689 689 a, g dbSNP:762419802
694 694 c, t dbSNP:536833815
710 710 a, t dbSNP:368137186
728 728 c, t dbSNP:150779253
730 730 c, g, t dbSNP:773281783
735 735 a, g dbSNP:193922296
742 742 c, t dbSNP:746026875
744 744 a, c, t dbSNP:193922297
745 745 c, t dbSNP:193922299
752 752 c, t dbSNP:193922300
755 755 c, g dbSNP:779091112
758 758 a, g dbSNP:193922301
760 760 a, g dbSNP:757281286
763 763 c, t dbSNP:749296295
778 778 a, g dbSNP:193922302
804 804 g, t dbSNP:193922303
813 813 -, c dbSNP:34389297
813 813 c, t dbSNP:370966942
818 818 a, g dbSNP:587780344
822 822 c, g dbSNP:193922304
827 827 a, g dbSNP:193922305
829 829 a, g dbSNP:749386678
837 837 c, t dbSNP:193922306
838 838 c, t dbSNP:777964292
839 839 a, g dbSNP:587780345
844 844 a, g dbSNP:756145968
851 851 a, c, t dbSNP:104894006
855 855 a, t dbSNP:781077527
856 856 c, t dbSNP:754722633
857 857 a, g dbSNP:751279776
858 858 c, t dbSNP:193922307
859 859 c, t dbSNP:377355289
860 860 a, g dbSNP:757978639
869 869 a, c dbSNP:373262279
870 870 a, g dbSNP:764676295
872 872 c, g dbSNP:376050856
877 877 c, t dbSNP:766830747
882 882 a, g dbSNP:193922309
889 889 c, t dbSNP:376713590
892 892 c, g dbSNP:562434968
895 895 a, g dbSNP:773561406
899 899 a, g dbSNP:193922310
900 900 c, t dbSNP:193922311
904 904 a, g, t dbSNP:776703291
910 910 c, g dbSNP:193922312
911 911 a, c dbSNP:587780346
913 913 a, g dbSNP:142817246
918 918 c, t dbSNP:746913146
922 922 a, g dbSNP:779762447
924 924 a, t dbSNP:80356654
925 925 g, t dbSNP:193922313
926 926 a, g dbSNP:771822911
930 930 -, cct dbSNP:193922314
930 930 c, t dbSNP:150077934
936 936 a, g dbSNP:104894015
940 940 c, g, t dbSNP:144723656
941 941 a, g dbSNP:778550411
944 944 a, g dbSNP:147065275
950 950 c, t dbSNP:766809919
953 953 c, t dbSNP:193922315
954 954 a, g dbSNP:193922316
955 955 c, t dbSNP:142952813
956 956 a, g dbSNP:193922317
961 961 c, t dbSNP:193922318
970 970 c, t dbSNP:772754004
971 971 a, g dbSNP:148311934
972 972 c, t dbSNP:193922319
978 978 c, t dbSNP:80356655
979 979 a, g dbSNP:371616363
989 989 a, g dbSNP:193922322
999 999 c, t dbSNP:193922323
1001 1001 a, g dbSNP:587780347
1005 1005 -, a dbSNP:751505614
1011 1011 a, g dbSNP:764146649
1018 1018 a, g dbSNP:193922324
1021 1021 a, g dbSNP:373582283
1030 1030 a, g dbSNP:775481896
1036 1036 c, t dbSNP:767476001
1037 1037 a, g dbSNP:759421263
1040 1040 a, g dbSNP:763631453
1044 1044 a, g dbSNP:370375148
1047 1047 c, t dbSNP:193922326
1051 1051 c, t dbSNP:770730728
1052 1052 a, g dbSNP:748964205
1053 1053 c, g, t dbSNP:193921400
1055 1055 a, c dbSNP:193922327
1060 1060 c, t dbSNP:772908574
1061 1061 a, g dbSNP:769268803
1063 1063 c, g dbSNP:193922328
1068 1068 a, g dbSNP:747662793
1069 1069 c, t dbSNP:780806456
1074 1074 c, t dbSNP:193922330
1076 1076 a, g dbSNP:104894008
1078 1078 a, g dbSNP:746352566
1079 1079 a, g dbSNP:779460424
1082 1082 c, t dbSNP:193922331
1084 1084 c, t dbSNP:757636596
1085 1085 a, g dbSNP:193929373
1087 1087 c, t dbSNP:754094813
1088 1088 g, t dbSNP:104894011
1096 1096 c, t dbSNP:778060949
1107 1107 c, t dbSNP:193922332
1117 1117 c, t dbSNP:756251613
1118 1118 c, t dbSNP:556436603
1119 1119 a, g dbSNP:767565869
1121 1121 c, g dbSNP:143387473
1128 1128 a, t dbSNP:193922333
1129 1129 c, t dbSNP:200071687
1130 1130 c, g, t dbSNP:104894005
1131 1131 a, g dbSNP:143484733
1135 1135 c, t dbSNP:772811891
1140 1140 c, t dbSNP:769515448
1144 1144 c, t dbSNP:199851776
1147 1147 c, t dbSNP:145323719
1148 1148 c, g dbSNP:776328308
1158 1158 g, t dbSNP:768247903
1166 1166 a, t dbSNP:193922335
1177 1177 c, t dbSNP:748431922
1190 1190 c, g dbSNP:104894009
1202 1202 c, t dbSNP:193922336
1208 1208 c, g, t dbSNP:755123456
1212 1212 c, t dbSNP:193922337
1222 1222 c, t dbSNP:747140104
1224 1224 g, t dbSNP:779946341
1237 1237 c, g dbSNP:758407777
1239 1239 a, t dbSNP:193922338
1242 1242 a, t dbSNP:193922339
1243 1243 c, t dbSNP:111715157
1247 1247 g, t dbSNP:193922340
1249 1249 c, g dbSNP:145764627
1258 1258 c, t dbSNP:753628968
1259 1259 a, g dbSNP:763870160
1263 1263 a, g dbSNP:760356145
1266 1266 c, t dbSNP:193922341
1275 1275 a, g dbSNP:775116098
1276 1276 c, t dbSNP:766907428
1283 1283 g, t dbSNP:763586339
1285 1285 c, t dbSNP:773582328
1290 1290 c, t dbSNP:770231054
1297 1297 aa, cg dbSNP:193922252
1298 1298 -, aa dbSNP:193922253
1298 1298 -, g dbSNP:193922254
1310 1310 a, g dbSNP:397514580
1313 1313 a, g dbSNP:193922255
1320 1320 c, g dbSNP:749208290
1321 1321 c, g dbSNP:777780118
1337 1337 a, t dbSNP:193922260
1358 1358 c, t dbSNP:574954919
1363 1363 g, t dbSNP:369103069
1366 1366 c, g dbSNP:752481898
1367 1367 c, t dbSNP:780716926
1375 1375 a, g dbSNP:754623359
1381 1381 c, t dbSNP:751087372
1384 1384 c, t dbSNP:765849566
1400 1400 c, g, t dbSNP:754337045
1403 1403 g, t dbSNP:764575801
1407 1407 g, t dbSNP:587780343
1408 1408 c, t dbSNP:556581174
1409 1409 g, t dbSNP:193922262
1411 1411 a, g dbSNP:775856595
1413 1413 c, g dbSNP:574763474
1419 1419 c, t dbSNP:193922263
1425 1425 a, g dbSNP:193922264
1427 1427 a, g dbSNP:104894016
1428 1428 c, t dbSNP:193929374
1431 1431 a, c dbSNP:193922265
1432 1432 a, g dbSNP:759783300
1435 1435 a, c dbSNP:774614309
1436 1436 a, c dbSNP:771131882
1437 1437 g, t dbSNP:193922266
1442 1442 g, t dbSNP:749298368
1443 1443 a, c dbSNP:777870079
1447 1447 a, g dbSNP:769709550
1448 1448 a, g dbSNP:193922267
1452 1452 c, t dbSNP:193922268
1455 1455 a, c, t dbSNP:193921338
1456 1456 a, g dbSNP:780987378
1464 1464 a, c, t dbSNP:193921340
1470 1470 g, t dbSNP:193922269
1477 1477 c, g, t dbSNP:542306878
1479 1479 a, g dbSNP:751179138
1484 1484 c, t dbSNP:370464857
1485 1485 g, t dbSNP:193929375
1490 1490 a, g dbSNP:757888672
1494 1494 a, g dbSNP:749877032
1495 1495 c, g dbSNP:764512775
1496 1496 a, g dbSNP:761204125
1502 1502 c, g dbSNP:193922271
1510 1510 c, t dbSNP:753053384
1516 1516 a, c dbSNP:767892728
1528 1528 c, g, t dbSNP:755112715
1535 1535 a, g dbSNP:193922272
1543 1543 c, t dbSNP:766653778
1563 1563 a, t dbSNP:193922273
1567 1567 c, t dbSNP:776620750
1574 1574 gtgcgcaggctgacgcccagctgcgagatcaccttcatcgagtcggag gagggcagtggccggggcgcggccctggtctc, ttaca dbSNP:193922274
1576 1576 a, g dbSNP:768525470
1577 1577 c, t dbSNP:552762648
1578 1578 -, gc dbSNP:193922275
1579 1579 a, c dbSNP:775226028
1580 1580 a, c dbSNP:140672134
1581 1581 a, g dbSNP:146683328
1583 1583 c, t dbSNP:193922276
1584 1584 c, t dbSNP:193922277
1586 1586 a, g dbSNP:188718376
1588 1588 c, g dbSNP:748686229
1597 1597 c, t dbSNP:781723641
1601 1601 a, g dbSNP:755498926
1602 1602 a, t dbSNP:193922278
1606 1606 c, t dbSNP:751990384
1618 1618 a, g dbSNP:766824450
1619 1619 a, g dbSNP:758737171
1624 1624 a, g dbSNP:140886210
1627 1627 -, c dbSNP:193922280
1634 1634 c, g dbSNP:193922281
1639 1639 c, g dbSNP:570159732
1640 1640 a, g dbSNP:193922282
1653 1653 c, t dbSNP:193922283
1654 1654 g, t dbSNP:761968548
1658 1658 -, gggg dbSNP:377247972
1658 1658 a, g dbSNP:104894012
1659 1659 a, t dbSNP:753795627
1662 1662 c, t dbSNP:104894014
1667 1667 -, aa dbSNP:193922284
1675 1675 c, t dbSNP:764050932
1681 1681 a, g, t dbSNP:193922285
1686 1686 a, g dbSNP:771849602
1699 1699 a, g dbSNP:369520128
1704 1704 c, t dbSNP:200698755
1705 1705 a, c, g dbSNP:748858674
1709 1709 c, g dbSNP:41282709
1710 1710 c, g dbSNP:769332415
1711 1711 a, c, g dbSNP:559451844
1785 1785 a, c dbSNP:557990162
1809 1809 a, c dbSNP:528326399
1812 1812 a, c dbSNP:563950957
1823 1823 -, c dbSNP:139354711
1903 1903 a, g dbSNP:545586440
1906 1906 a, g dbSNP:762536430
1937 1937 c, g dbSNP:530568127
1947 1947 a, g dbSNP:563024661
1975 1975 g, t dbSNP:765045212
1990 1990 g, t dbSNP:527259972
2025 2025 a, g dbSNP:13306388
2049 2049 a, g dbSNP:146107173
2068 2068 c, t dbSNP:541720596
2069 2069 a, g dbSNP:577601329
2099 2099 c, t dbSNP:114431571
2126 2126 c, t dbSNP:770793950
2136 2136 a, g dbSNP:201235980
2170 2170 c, t dbSNP:2908275
2203 2203 c, t dbSNP:141645300
2302 2302 a, g dbSNP:570194904
2371 2371 g, t dbSNP:555058443
2384 2384 a, g dbSNP:568995709
2400 2400 a, t dbSNP:536317133
2426 2426 c, t dbSNP:138562953
2428 2428 a, c dbSNP:556996030
2432 2432 a, g dbSNP:528412344
2446 2446 a, g dbSNP:570413232
2452 2452 -, c dbSNP:761652517
2452 2452 -, c dbSNP:55714218
2452 2452 c, t dbSNP:200628800
2457 2457 c, t dbSNP:185418856
2467 2467 a, g dbSNP:530604939
2471 2471 -, cc dbSNP:34322372
2490 2490 c, t dbSNP:2908276
2494 2494 c, g dbSNP:749438148
2539 2539 c, t dbSNP:780243846
2540 2540 a, g dbSNP:76374134
2551 2551 -, ta dbSNP:35548117

Target ORF information:

RefSeq Version NM_033508
Organism Homo sapiens (human)
Definition Homo sapiens glucokinase (hexokinase 4) (GCK), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Prevalence of vascular complications among patients with glucokinase mutations and prolonged, mild hyperglycemia
JAMA 311 (3), 279-286 (2014)
Steele AM, Shields BM, Wensley KJ, Colclough K, Ellard S and Hattersley AT.


Structural basis for regulation of human glucokinase by glucokinase regulatory protein
Biochemistry 52 (36), 6232-6239 (2013)
Beck T and Miller BG.


Maturity onset diabetes of the young: identification and diagnosis
Ann. Clin. Biochem. 50 (PT 5), 403-415 (2013)
McDonald TJ and Ellard S.


Large scale meta-analyses of fasting plasma glucose raising variants in GCK, GCKR, MTNR1B and G6PC2 and their impacts on type 2 diabetes mellitus risk
PLoS ONE 8 (6), E67665 (2013)
Wang H, Liu L, Zhao J, Cui G, Chen C, Ding H and Wang DW.


Permanent Neonatal Diabetes Mellitus
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
De Leon,D.D. and Stanley,C.A.


Familial Hyperinsulinism
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)


Nonsense mutation of glucokinase gene in late-onset non-insulin-dependent diabetes mellitus
Lancet 340 (8831), 1316-1317 (1992)
Katagiri H, Asano T, Ishihara H, Inukai K, Anai M, Miyazaki J, Tsukuda K, Kikuchi M, Yazaki Y and Oka Y.


Missense glucokinase mutation in maturity-onset diabetes of the young and mutation screening in late-onset diabetes
Nat. Genet. 2 (2), 153-156 (1992)
Stoffel M, Patel P, Lo YM, Hattersley AT, Lucassen AM, Page R, Bell JI, Bell GI, Turner RC and Wainscoat JS.


Human glucokinase gene: isolation, structural characterization, and identification of a microsatellite repeat polymorphism
Mol. Endocrinol. 6 (7), 1070-1081 (1992)
Tanizawa Y, Matsutani A, Chiu KC and Permutt MA.


Linkage of type 2 diabetes to the glucokinase gene
Lancet 339 (8805), 1307-1310 (1992)
Hattersley AT, Turner RC, Permutt MA, Patel P, Tanizawa Y, Chiu KC, O'Rahilly S, Watkins PJ and Wainscoat JS.
