Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

GJB2 gap junction protein, beta 2, 26kDa [Homo sapiens (human)]

Gene Symbol GJB2
Entrez Gene ID 2706
Full Name gap junction protein, beta 2, 26kDa
General protein information
Preferred Names
gap junction beta-2 protein
gap junction beta-2 protein
connexin 26
gap junction protein beta 2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html: Deafness, autosomal recessive 1A, 220290 (3); Deafness, autosomal
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu27143 XM_011535049 PREDICTED: Homo sapiens gap junction protein, beta 2, 26kDa (GJB2), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu27143 NM_004004 Homo sapiens gap junction protein, beta 2, 26kDa (GJB2), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu27143D
Sequence Information ORF Nucleotide Sequence (Length: 681bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product gap junction beta-2 protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_024524.15) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)210..530(+)
Misc Feature(2)642..845(+)
Position Chain Variation Link
6 6 a, g dbSNP:150477420
28 28 g, t dbSNP:140129661
32 32 a, g dbSNP:562487064
33 33 c, t dbSNP:555275262
100 100 a, g dbSNP:78674556
107 107 a, g dbSNP:536433706
139 139 a, t dbSNP:151141189
154 154 c, t dbSNP:7994748
191 191 c, g, t dbSNP:759745271
192 192 c, t dbSNP:72561725
193 193 a, g dbSNP:367567291
196 196 -, c dbSNP:752236945
199 199 a, g dbSNP:760844934
200 200 a, c, g dbSNP:398123813
201 201 a, t dbSNP:148136545
204 204 a, g dbSNP:774642294
206 206 a, g dbSNP:768338285
207 207 a, g dbSNP:111033293
208 208 c, t dbSNP:371086981
215 215 a, g dbSNP:111033401
217 217 a, g, t dbSNP:111033222
220 220 c, t dbSNP:781085903
221 221 a, g dbSNP:757226502
225 225 c, t dbSNP:111033451
227 227 a, g dbSNP:137932057
229 229 c, t dbSNP:529500747
230 230 a, g dbSNP:533231493
237 237 -, gggggtgtgaacaaacactccaccagcattggaaagat dbSNP:397516873
239 239 g, t dbSNP:753943758
240 240 c, g, t dbSNP:104894408
241 241 -, g dbSNP:398123814
241 241 a, g, t dbSNP:1801002
241 241 -, g dbSNP:80338939
243 243 a, g dbSNP:768130937
250 250 a, c dbSNP:111033217
252 252 c, t dbSNP:762466001
256 256 c, g, t dbSNP:28929485
262 262 c, g, t dbSNP:80338941
266 266 g, t dbSNP:749693224
277 277 a, g dbSNP:104894396
278 278 c, g dbSNP:769486081
284 284 c, t dbSNP:201848820
285 285 a, g dbSNP:2274084
294 294 a, g dbSNP:374625633
300 300 c, t dbSNP:371024165
301 301 a, g, t dbSNP:111033190
304 304 c, t dbSNP:575453513
305 305 -, tatgat dbSNP:751509573
306 306 a, t dbSNP:564084861
307 307 c, g, t dbSNP:35887622
310 310 g, t dbSNP:756467247
312 312 -, ccgtcctcttcatttttcgcattatgatcc dbSNP:398123815
313 313 c, t dbSNP:587783644
314 314 c, t dbSNP:138547875
315 315 a, g, t dbSNP:72474224
316 316 c, t dbSNP:141774369
324 324 a, g dbSNP:764693395
325 325 a, c, g dbSNP:111033296
326 326 a, c dbSNP:561870637
332 332 a, g, t dbSNP:535635403
334 334 c, t dbSNP:776267945
337 337 a, c, g dbSNP:104894413
338 338 a, c, g dbSNP:104894407
340 340 a, g dbSNP:72561723
341 341 a, t dbSNP:777528049
345 345 g, t dbSNP:104894398
347 347 a, g dbSNP:370164829
354 354 a, g, t dbSNP:28931594
358 358 -, tt dbSNP:766340495
364 364 a, g dbSNP:587783645
368 368 a, c dbSNP:104894412
373 373 -, t dbSNP:80338942
375 375 c, t dbSNP:111033297
380 380 a, g dbSNP:778922005
381 381 a, g dbSNP:104894410
382 382 a, c, g dbSNP:104894404
383 383 c, t dbSNP:375122728
389 389 a, g dbSNP:750618125
392 392 c, t dbSNP:397516869
393 393 a, g, t dbSNP:370696868
394 394 c, t dbSNP:727504309
400 400 a, g dbSNP:111033203
401 401 c, t dbSNP:763572195
402 402 c, g dbSNP:104894403
406 406 a, g dbSNP:527914983
409 409 a, g dbSNP:397516870
410 410 c, g dbSNP:759905442
414 414 c, g dbSNP:200023879
424 424 a, g dbSNP:121912968
425 425 c, t dbSNP:727504755
429 429 c, t dbSNP:104894402
430 430 a, g dbSNP:28931593
431 431 g, t dbSNP:149137695
433 433 c, t dbSNP:111033361
435 435 c, t dbSNP:104894397
436 436 a, g dbSNP:104894395
437 437 a, g dbSNP:80338944
441 441 -, c dbSNP:80338943
444 444 c, t dbSNP:199883710
445 445 a, c dbSNP:727504302
447 447 c, g, t dbSNP:145216882
452 452 c, g dbSNP:781534323
456 456 a, c, g, t dbSNP:104894409
464 464 a, g, t dbSNP:139362103
470 470 a, c, g dbSNP:754237172
471 471 c, t dbSNP:765921870
473 473 c, g dbSNP:727503067
475 475 -, t dbSNP:730880338
475 475 c, t dbSNP:80338945
485 485 a, g dbSNP:397516871
487 487 a, t dbSNP:397516872
488 488 c, t dbSNP:766998544
489 489 a, g dbSNP:111033299
493 493 c, g dbSNP:201839979
494 494 c, t dbSNP:768756034
496 496 -, a dbSNP:786204491
497 497 c, t dbSNP:749070779
498 498 c, t dbSNP:529440698
499 499 a, g dbSNP:771053295
504 504 -, c dbSNP:775828835
504 504 c, t dbSNP:143343083
505 505 -, at dbSNP:111033204
512 512 a, c, g dbSNP:758452984
518 518 a, g, t dbSNP:267603770
519 519 -, aagttcatcaaggg dbSNP:111033253
524 524 a, c dbSNP:779358271
532 532 a, g dbSNP:374572413
533 533 a, g dbSNP:199976861
534 534 g, t dbSNP:754202141
540 540 -, aa dbSNP:756484720
545 545 g, t dbSNP:80338946
546 546 a, g dbSNP:201855069
547 547 a, g dbSNP:2274083
556 556 a, g, t dbSNP:111033441
559 559 c, t dbSNP:761376869
561 561 a, g dbSNP:150529554
564 564 -, gag dbSNP:80338947
564 564 a, g dbSNP:528216023
571 571 a, t dbSNP:111033295
574 574 a, c dbSNP:111033188
576 576 c, t dbSNP:397516874
582 582 a, g dbSNP:745669787
585 585 c, t dbSNP:727503066
586 586 a, g, t dbSNP:111033196
590 590 c, t dbSNP:111033298
591 591 a, g dbSNP:397516875
595 595 a, g dbSNP:779018464
602 602 a, g dbSNP:755058488
605 605 a, g dbSNP:777225786
613 613 -, a dbSNP:771409330
614 614 a, c dbSNP:786204690
618 618 a, g dbSNP:397516876
622 622 a, g dbSNP:76434661
631 631 c, t dbSNP:116769964
632 632 a, c dbSNP:397516877
633 633 c, t dbSNP:80338948
634 634 a, g dbSNP:104894401
644 644 c, t dbSNP:750795475
645 645 a, g dbSNP:767178508
650 650 c, t dbSNP:757029266
651 651 a, g, t dbSNP:111033225
654 654 a, t dbSNP:762566184
658 658 c, t dbSNP:370044106
659 659 a, g dbSNP:765115961
662 662 a, c dbSNP:111033420
663 663 a, g dbSNP:111033186
670 670 a, g dbSNP:776335807
671 671 a, t dbSNP:772264564
676 676 c, t dbSNP:727504789
677 677 a, g dbSNP:774573673
680 680 c, t dbSNP:375759781
681 681 a, g, t dbSNP:373684994
682 682 a, t dbSNP:28931592
684 684 a, g dbSNP:34988750
693 693 a, g dbSNP:80338949
696 696 c, g dbSNP:757699303
699 699 c, t dbSNP:376898963
700 700 a, g dbSNP:777588424
705 705 a, g dbSNP:111033360
706 706 g, t dbSNP:201983374
708 708 a, g dbSNP:765196144
709 709 a, g dbSNP:200104362
711 711 a, c, g, t dbSNP:760489970
712 712 a, g dbSNP:774518779
715 715 -, a dbSNP:749675121
716 716 a, c, t dbSNP:763068053
717 717 -, aacg dbSNP:773528125
717 717 a, g dbSNP:201004645
720 720 a, t dbSNP:770330002
731 731 a, c dbSNP:746294614
732 732 a, g dbSNP:781767722
735 735 a, g dbSNP:771372934
739 739 c, t dbSNP:568612627
741 741 a, g, t dbSNP:28931595
743 743 c, t dbSNP:758171036
752 752 a, g dbSNP:752236261
757 757 a, c, g dbSNP:80338950
761 761 c, t dbSNP:754533609
763 763 c, t dbSNP:753674300
764 764 a, g dbSNP:547195492
767 767 a, g dbSNP:755875741
770 770 -, ga dbSNP:770116143
772 772 a, c dbSNP:199790409
777 777 c, t dbSNP:397516878
782 782 -, a dbSNP:747847191
789 789 a, g dbSNP:532203068
791 791 c, g, t dbSNP:570552952
793 793 g, t dbSNP:765172751
794 794 g, t dbSNP:759683824
795 795 a, g dbSNP:777236559
797 797 a, g dbSNP:771604140
798 798 cagtgttcatgacattc, gtgtctgga dbSNP:111033335
799 799 g, t dbSNP:747353660
800 800 a, g dbSNP:773768026
802 802 c, t dbSNP:771748289
804 804 g, t dbSNP:786204597
809 809 g, t dbSNP:747685846
811 811 g, t dbSNP:104894406
814 814 c, t dbSNP:76838169
818 818 g, t dbSNP:754409855
823 823 a, g dbSNP:111033294
832 832 a, g dbSNP:779948837
833 833 a, g dbSNP:765660346
838 838 -, gt dbSNP:587783646
848 848 a, g dbSNP:530484784
851 851 c, t dbSNP:750216973
853 853 -, gata dbSNP:587783647
853 853 g, t dbSNP:767233008
855 855 g, t dbSNP:757090268
856 856 a, g dbSNP:150217043
859 859 a, g dbSNP:752812448
862 862 c, t dbSNP:368602109
869 869 c, g dbSNP:375599392
870 870 a, t dbSNP:776899164
871 871 a, c dbSNP:766975999
876 876 a, c dbSNP:111033194
878 878 a, g dbSNP:757510867
881 881 a, t dbSNP:563151740
882 882 a, g dbSNP:370868313
883 883 g, t dbSNP:773846324
886 886 a, g dbSNP:768407446
888 888 c, t dbSNP:111033327
889 889 a, g dbSNP:779607423
890 890 a, c dbSNP:111033460
891 891 a, g dbSNP:745748793
896 896 c, g dbSNP:781210752
919 919 -, acag dbSNP:754515919
921 921 a, g dbSNP:756962156
922 922 a, g dbSNP:751408737
932 932 a, g dbSNP:112399473
942 942 a, c dbSNP:192824498
944 944 c, t dbSNP:760807742
956 956 c, t dbSNP:540815670
965 965 a, t dbSNP:576671031
968 968 c, t dbSNP:557786153
971 971 c, t dbSNP:3751385
983 983 a, g dbSNP:188027627
991 991 a, t dbSNP:7337074
998 998 c, t dbSNP:7329857
1001 1001 c, t dbSNP:182085649
1002 1002 a, c dbSNP:557953001
1004 1004 a, g dbSNP:189792278
1017 1017 a, c dbSNP:759708388
1020 1020 c, t dbSNP:774107664
1028 1028 g, t dbSNP:770765291
1055 1055 a, g dbSNP:55704559
1056 1056 a, g dbSNP:571065102
1069 1069 c, t dbSNP:769416676
1100 1100 c, t dbSNP:771632395
1127 1127 a, c dbSNP:537986752
1180 1180 g, t dbSNP:371517351
1204 1204 a, g dbSNP:747699704
1216 1216 c, t dbSNP:552266792
1261 1261 a, g dbSNP:530541021
1268 1268 g, t dbSNP:569759222
1287 1287 a, g dbSNP:186159183
1294 1294 c, t dbSNP:749657357
1299 1299 a, c dbSNP:547859391
1310 1310 c, t dbSNP:112457424
1390 1390 a, g dbSNP:529731731
1399 1399 a, c dbSNP:780715835
1400 1400 a, g dbSNP:754439420
1402 1402 g, t dbSNP:183396624
1405 1405 c, t dbSNP:540934092
1408 1408 c, g dbSNP:532137880
1431 1431 c, t dbSNP:564755659
1447 1447 a, g dbSNP:191541104
1468 1468 a, g dbSNP:569089105
1485 1485 a, c dbSNP:550600399
1497 1497 c, t dbSNP:141929561
1505 1505 -, t dbSNP:767918905
1612 1612 c, t dbSNP:147595498
1645 1645 a, g dbSNP:111732260
1673 1673 a, g dbSNP:187158699
1730 1730 a, g dbSNP:181728208
1736 1736 a, g dbSNP:746404073
1755 1755 a, g dbSNP:535474422
1779 1779 -, c dbSNP:35136382
1802 1802 c, g, t dbSNP:189685514
1809 1809 a, g dbSNP:149900249
1815 1815 -, catcg dbSNP:762265299
1818 1818 c, t dbSNP:5030700
1819 1819 a, g dbSNP:559171604
1827 1827 c, t dbSNP:757704123
1866 1866 a, g dbSNP:546826225
1872 1872 a, t dbSNP:111729919
1903 1903 a, g dbSNP:537683957
1919 1919 c, t dbSNP:764456740
1920 1920 a, g dbSNP:185790172
1954 1954 a, g, t dbSNP:9237
1969 1969 a, g dbSNP:752926267
1974 1974 c, g dbSNP:535822487
2039 2039 a, g dbSNP:7623
2084 2084 a, c, t dbSNP:11841182
2145 2145 a, c dbSNP:751581043
2164 2164 c, t dbSNP:7988691
2194 2194 a, c dbSNP:562612904
2256 2256 a, g dbSNP:180788420

Target ORF information:

RefSeq Version XM_011535049
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens gap junction protein, beta 2, 26kDa (GJB2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu27143D
Sequence Information ORF Nucleotide Sequence (Length: 681bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product gap junction beta-2 protein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA287424.1, BC017048.1, BC071703.1, AA962716.1 and BI491091.1. This sequence is a reference standard in the RefSeqGene project. On Aug 2, 2008 this sequence version replaced gi:118572604. Summary: This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BP220335.1, BC017048.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)210..212(+)
Misc Feature(2)219..539(+)
Misc Feature(3)276..335(+)
Misc Feature(4)441..509(+)
Misc Feature(5)609..677(+)
Misc Feature(6)651..854(+)
Misc Feature(7)792..860(+)
Exon (1)1..193
Gene Synonym:
Exon (2)194..2334
Gene Synonym:
Position Chain Variation Link
36 36 a, g dbSNP:553467990
42 42 c, g dbSNP:541058463
68 68 c, t dbSNP:577361302
89 89 c, g dbSNP:727503068
171 171 a, c dbSNP:397516868
186 186 c, t dbSNP:397516867
190 190 g, t dbSNP:112875543
193 193 g, t dbSNP:786204734
200 200 c, g, t dbSNP:759745271
201 201 c, t dbSNP:72561725
202 202 a, g dbSNP:367567291
205 205 -, c dbSNP:752236945
208 208 a, g dbSNP:760844934
209 209 a, c, g dbSNP:398123813
210 210 a, t dbSNP:148136545
213 213 a, g dbSNP:774642294
215 215 a, g dbSNP:768338285
216 216 a, g dbSNP:111033293
217 217 c, t dbSNP:371086981
224 224 a, g dbSNP:111033401
226 226 a, g, t dbSNP:111033222
229 229 c, t dbSNP:781085903
230 230 a, g dbSNP:757226502
234 234 c, t dbSNP:111033451
236 236 a, g dbSNP:137932057
238 238 c, t dbSNP:529500747
239 239 a, g dbSNP:533231493
246 246 -, gggggtgtgaacaaacactccaccagcattggaaagat dbSNP:397516873
248 248 g, t dbSNP:753943758
249 249 c, g, t dbSNP:104894408
250 250 -, g dbSNP:398123814
250 250 a, g, t dbSNP:1801002
250 250 -, g dbSNP:80338939
252 252 a, g dbSNP:768130937
259 259 a, c dbSNP:111033217
261 261 c, t dbSNP:762466001
265 265 c, g, t dbSNP:28929485
271 271 c, g, t dbSNP:80338941
275 275 g, t dbSNP:749693224
286 286 a, g dbSNP:104894396
287 287 c, g dbSNP:769486081
293 293 c, t dbSNP:201848820
294 294 a, g dbSNP:2274084
303 303 a, g dbSNP:374625633
309 309 c, t dbSNP:371024165
310 310 a, g, t dbSNP:111033190
313 313 c, t dbSNP:575453513
314 314 -, tatgat dbSNP:751509573
315 315 a, t dbSNP:564084861
316 316 c, g, t dbSNP:35887622
319 319 g, t dbSNP:756467247
321 321 -, ccgtcctcttcatttttcgcattatgatcc dbSNP:398123815
322 322 c, t dbSNP:587783644
323 323 c, t dbSNP:138547875
324 324 a, g, t dbSNP:72474224
325 325 c, t dbSNP:141774369
333 333 a, g dbSNP:764693395
334 334 a, c, g dbSNP:111033296
335 335 a, c dbSNP:561870637
341 341 a, g, t dbSNP:535635403
343 343 c, t dbSNP:776267945
346 346 a, c, g dbSNP:104894413
347 347 a, c, g dbSNP:104894407
349 349 a, g dbSNP:72561723
350 350 a, t dbSNP:777528049
354 354 g, t dbSNP:104894398
356 356 a, g dbSNP:370164829
363 363 a, g, t dbSNP:28931594
367 367 -, tt dbSNP:766340495
373 373 a, g dbSNP:587783645
377 377 a, c dbSNP:104894412
382 382 -, t dbSNP:80338942
384 384 c, t dbSNP:111033297
389 389 a, g dbSNP:778922005
390 390 a, g dbSNP:104894410
391 391 a, c, g dbSNP:104894404
392 392 c, t dbSNP:375122728
398 398 a, g dbSNP:750618125
401 401 c, t dbSNP:397516869
402 402 a, g, t dbSNP:370696868
403 403 c, t dbSNP:727504309
409 409 a, g dbSNP:111033203
410 410 c, t dbSNP:763572195
411 411 c, g dbSNP:104894403
415 415 a, g dbSNP:527914983
418 418 a, g dbSNP:397516870
419 419 c, g dbSNP:759905442
423 423 c, g dbSNP:200023879
433 433 a, g dbSNP:121912968
434 434 c, t dbSNP:727504755
438 438 c, t dbSNP:104894402
439 439 a, g dbSNP:28931593
440 440 g, t dbSNP:149137695
442 442 c, t dbSNP:111033361
444 444 c, t dbSNP:104894397
445 445 a, g dbSNP:104894395
446 446 a, g dbSNP:80338944
450 450 -, c dbSNP:80338943
453 453 c, t dbSNP:199883710
454 454 a, c dbSNP:727504302
456 456 c, g, t dbSNP:145216882
461 461 c, g dbSNP:781534323
465 465 a, c, g, t dbSNP:104894409
473 473 a, g, t dbSNP:139362103
479 479 a, c, g dbSNP:754237172
480 480 c, t dbSNP:765921870
482 482 c, g dbSNP:727503067
484 484 -, t dbSNP:730880338
484 484 c, t dbSNP:80338945
494 494 a, g dbSNP:397516871
496 496 a, t dbSNP:397516872
497 497 c, t dbSNP:766998544
498 498 a, g dbSNP:111033299
502 502 c, g dbSNP:201839979
503 503 c, t dbSNP:768756034
505 505 -, a dbSNP:786204491
506 506 c, t dbSNP:749070779
507 507 c, t dbSNP:529440698
508 508 a, g dbSNP:771053295
513 513 -, c dbSNP:775828835
513 513 c, t dbSNP:143343083
514 514 -, at dbSNP:111033204
521 521 a, c, g dbSNP:758452984
527 527 a, g, t dbSNP:267603770
528 528 -, aagttcatcaaggg dbSNP:111033253
533 533 a, c dbSNP:779358271
541 541 a, g dbSNP:374572413
542 542 a, g dbSNP:199976861
543 543 g, t dbSNP:754202141
549 549 -, aa dbSNP:756484720
554 554 g, t dbSNP:80338946
555 555 a, g dbSNP:201855069
556 556 a, g dbSNP:2274083
565 565 a, g, t dbSNP:111033441
568 568 c, t dbSNP:761376869
570 570 a, g dbSNP:150529554
573 573 -, gag dbSNP:80338947
573 573 a, g dbSNP:528216023
580 580 a, t dbSNP:111033295
583 583 a, c dbSNP:111033188
585 585 c, t dbSNP:397516874
591 591 a, g dbSNP:745669787
594 594 c, t dbSNP:727503066
595 595 a, g, t dbSNP:111033196
599 599 c, t dbSNP:111033298
600 600 a, g dbSNP:397516875
604 604 a, g dbSNP:779018464
611 611 a, g dbSNP:755058488
614 614 a, g dbSNP:777225786
622 622 -, a dbSNP:771409330
623 623 a, c dbSNP:786204690
627 627 a, g dbSNP:397516876
631 631 a, g dbSNP:76434661
640 640 c, t dbSNP:116769964
641 641 a, c dbSNP:397516877
642 642 c, t dbSNP:80338948
643 643 a, g dbSNP:104894401
653 653 c, t dbSNP:750795475
654 654 a, g dbSNP:767178508
659 659 c, t dbSNP:757029266
660 660 a, g, t dbSNP:111033225
663 663 a, t dbSNP:762566184
667 667 c, t dbSNP:370044106
668 668 a, g dbSNP:765115961
671 671 a, c dbSNP:111033420
672 672 a, g dbSNP:111033186
679 679 a, g dbSNP:776335807
680 680 a, t dbSNP:772264564
685 685 c, t dbSNP:727504789
686 686 a, g dbSNP:774573673
689 689 c, t dbSNP:375759781
690 690 a, g, t dbSNP:373684994
691 691 a, t dbSNP:28931592
693 693 a, g dbSNP:34988750
702 702 a, g dbSNP:80338949
705 705 c, g dbSNP:757699303
708 708 c, t dbSNP:376898963
709 709 a, g dbSNP:777588424
714 714 a, g dbSNP:111033360
715 715 g, t dbSNP:201983374
717 717 a, g dbSNP:765196144
718 718 a, g dbSNP:200104362
720 720 a, c, g, t dbSNP:760489970
721 721 a, g dbSNP:774518779
724 724 -, a dbSNP:749675121
725 725 a, c, t dbSNP:763068053
726 726 -, aacg dbSNP:773528125
726 726 a, g dbSNP:201004645
729 729 a, t dbSNP:770330002
740 740 a, c dbSNP:746294614
741 741 a, g dbSNP:781767722
744 744 a, g dbSNP:771372934
748 748 c, t dbSNP:568612627
750 750 a, g, t dbSNP:28931595
752 752 c, t dbSNP:758171036
761 761 a, g dbSNP:752236261
766 766 a, c, g dbSNP:80338950
770 770 c, t dbSNP:754533609
772 772 c, t dbSNP:753674300
773 773 a, g dbSNP:547195492
776 776 a, g dbSNP:755875741
779 779 -, ga dbSNP:770116143
781 781 a, c dbSNP:199790409
786 786 c, t dbSNP:397516878
791 791 -, a dbSNP:747847191
798 798 a, g dbSNP:532203068
800 800 c, g, t dbSNP:570552952
802 802 g, t dbSNP:765172751
803 803 g, t dbSNP:759683824
804 804 a, g dbSNP:777236559
806 806 a, g dbSNP:771604140
807 807 cagtgttcatgacattc, gtgtctgga dbSNP:111033335
808 808 g, t dbSNP:747353660
809 809 a, g dbSNP:773768026
811 811 c, t dbSNP:771748289
813 813 g, t dbSNP:786204597
818 818 g, t dbSNP:747685846
820 820 g, t dbSNP:104894406
823 823 c, t dbSNP:76838169
827 827 g, t dbSNP:754409855
832 832 a, g dbSNP:111033294
841 841 a, g dbSNP:779948837
842 842 a, g dbSNP:765660346
847 847 -, gt dbSNP:587783646
857 857 a, g dbSNP:530484784
860 860 c, t dbSNP:750216973
862 862 -, gata dbSNP:587783647
862 862 g, t dbSNP:767233008
864 864 g, t dbSNP:757090268
865 865 a, g dbSNP:150217043
868 868 a, g dbSNP:752812448
871 871 c, t dbSNP:368602109
878 878 c, g dbSNP:375599392
879 879 a, t dbSNP:776899164
880 880 a, c dbSNP:766975999
885 885 a, c dbSNP:111033194
887 887 a, g dbSNP:757510867
890 890 a, t dbSNP:563151740
891 891 a, g dbSNP:370868313
892 892 g, t dbSNP:773846324
895 895 a, g dbSNP:768407446
897 897 c, t dbSNP:111033327
898 898 a, g dbSNP:779607423
899 899 a, c dbSNP:111033460
900 900 a, g dbSNP:745748793
905 905 c, g dbSNP:781210752
928 928 -, acag dbSNP:754515919
930 930 a, g dbSNP:756962156
931 931 a, g dbSNP:751408737
941 941 a, g dbSNP:112399473
951 951 a, c dbSNP:192824498
953 953 c, t dbSNP:760807742
965 965 c, t dbSNP:540815670
974 974 a, t dbSNP:576671031
977 977 c, t dbSNP:557786153
980 980 c, t dbSNP:3751385
992 992 a, g dbSNP:188027627
1000 1000 a, t dbSNP:7337074
1007 1007 c, t dbSNP:7329857
1010 1010 c, t dbSNP:182085649
1011 1011 a, c dbSNP:557953001
1013 1013 a, g dbSNP:189792278
1026 1026 a, c dbSNP:759708388
1029 1029 c, t dbSNP:774107664
1037 1037 g, t dbSNP:770765291
1064 1064 a, g dbSNP:55704559
1065 1065 a, g dbSNP:571065102
1078 1078 c, t dbSNP:769416676
1109 1109 c, t dbSNP:771632395
1136 1136 a, c dbSNP:537986752
1189 1189 g, t dbSNP:371517351
1213 1213 a, g dbSNP:747699704
1225 1225 c, t dbSNP:552266792
1270 1270 a, g dbSNP:530541021
1277 1277 g, t dbSNP:569759222
1296 1296 a, g dbSNP:186159183
1303 1303 c, t dbSNP:749657357
1308 1308 a, c dbSNP:547859391
1319 1319 c, t dbSNP:112457424
1399 1399 a, g dbSNP:529731731
1408 1408 a, c dbSNP:780715835
1409 1409 a, g dbSNP:754439420
1411 1411 g, t dbSNP:183396624
1414 1414 c, t dbSNP:540934092
1417 1417 c, g dbSNP:532137880
1440 1440 c, t dbSNP:564755659
1456 1456 a, g dbSNP:191541104
1477 1477 a, g dbSNP:569089105
1494 1494 a, c dbSNP:550600399
1506 1506 c, t dbSNP:141929561
1514 1514 -, t dbSNP:767918905
1621 1621 c, t dbSNP:147595498
1654 1654 a, g dbSNP:111732260
1682 1682 a, g dbSNP:187158699
1739 1739 a, g dbSNP:181728208
1745 1745 a, g dbSNP:746404073
1764 1764 a, g dbSNP:535474422
1788 1788 -, c dbSNP:35136382
1811 1811 c, g, t dbSNP:189685514
1818 1818 a, g dbSNP:149900249
1824 1824 -, catcg dbSNP:762265299
1827 1827 c, t dbSNP:5030700
1828 1828 a, g dbSNP:559171604
1836 1836 c, t dbSNP:757704123
1875 1875 a, g dbSNP:546826225
1881 1881 a, t dbSNP:111729919
1912 1912 a, g dbSNP:537683957
1928 1928 c, t dbSNP:764456740
1929 1929 a, g dbSNP:185790172
1963 1963 a, g, t dbSNP:9237
1978 1978 a, g dbSNP:752926267
1983 1983 c, g dbSNP:535822487
2048 2048 a, g dbSNP:7623
2093 2093 a, c, t dbSNP:11841182
2154 2154 a, c dbSNP:751581043
2173 2173 c, t dbSNP:7988691
2203 2203 a, c dbSNP:562612904
2265 2265 a, g dbSNP:180788420

Target ORF information:

RefSeq Version NM_004004
Organism Homo sapiens (human)
Definition Homo sapiens gap junction protein, beta 2, 26kDa (GJB2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.