
DISC1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol DISC1
Entrez Gene ID 27185
Full Name disrupted in schizophrenia 1
Synonyms C1orf136, SCZD9
General protein information
Preferred Names
disrupted in schizophrenia 1 protein
disrupted in schizophrenia 1 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Schizophrenia, susceptibility to}, 604906 (3); {Schizoaffective

The following DISC1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the DISC1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu25070 NM_001164556 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant t, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $269.00
OHu24906 NM_018662 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant L, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24960 NM_001012957 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant Lv, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu25035 NM_001012958 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant Es, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00
OHu24804 NM_001012959 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant S, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu25088 NM_001164537 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant a, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24863 NM_001164538 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant b, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24938 NM_001164539 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant c, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24750 NM_001164540 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant d, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24842 NM_001164541 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant e, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu25031 NM_001164542 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant f, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24946 NM_001164544 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant g, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu24760 NM_001164545 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant h, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $489.00
OHu24840 NM_001164546 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant i, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00
OHu24840 NM_001164547 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant j, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00
OHu25023 NM_001164548 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant k, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $459.00
OHu24871 NM_001164549 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant l, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $459.00
OHu24884 NM_001164550 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant m, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $359.00
OHu24838 NM_001164551 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant n, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $359.00
OHu24928 NM_001164552 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant o, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00
OHu24867 NM_001164553 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant p, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00
OHu24941 NM_001164554 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant q, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00
OHu24731 NM_001164555 Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant r, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $299.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu25070
Accession Version NM_001164556.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 606bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 17-MAY-2014
Organism Homo sapiens (human)
Product disrupted in schizophrenia 1 protein isoform t
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from FJ804204.1. Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (t) lacks four internal exons and multiple 3' exons but has an alternate 3' segment, as compared to variant L. The resulting isoform (t, also known as isoform 34) is the shortest, and has a distinct C-terminus, as compared to isoform L. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: FJ804204.1 [ECO:0000332] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Exon (1)1..120
Gene Synonym:
Exon (2)121..271
Gene Synonym:
Exon (3)272..401
Gene Synonym:
Exon (4)402..637
Gene Synonym:
Exon (5)638..1553
Gene Synonym:
Position Chain Variation Link
41 41 a, g dbSNP:778668737
47 47 a, g, t dbSNP:3738399
54 54 a, g dbSNP:779911990
61 61 a, g dbSNP:746960289
62 62 a, c dbSNP:768655605
67 67 g, t dbSNP:3738400
91 91 -, cgg dbSNP:775477136
91 91 c, g dbSNP:79978593
92 92 c, g dbSNP:761828898
95 95 c, t dbSNP:566458514
105 105 c, g dbSNP:773369045
107 107 a, g dbSNP:367543082
127 127 c, g, t dbSNP:547023544
128 128 a, g dbSNP:560642465
131 131 a, g dbSNP:200802543
135 135 c, t dbSNP:367652092
144 144 a, g dbSNP:774489082
156 156 c, t dbSNP:759829485
162 162 a, g dbSNP:767594296
167 167 a, c dbSNP:780966020
168 168 a, g dbSNP:760972690
183 183 c, t dbSNP:764644321
191 191 a, g dbSNP:754337105
202 202 c, g dbSNP:757885480
208 208 a, g dbSNP:779592106
218 218 c, g dbSNP:750983762
222 222 c, t dbSNP:372352273
224 224 a, c dbSNP:780639303
249 249 a, t dbSNP:529845499
252 252 c, t dbSNP:193024019
253 253 a, g dbSNP:201902199
255 255 c, t dbSNP:777900755
256 256 a, g dbSNP:144959108
261 261 -, gccactca dbSNP:777968689
262 262 c, t dbSNP:770728178
264 264 a, g dbSNP:148920333
273 273 a, g dbSNP:746021282
278 278 c, t dbSNP:772042563
279 279 a, g dbSNP:200019964
288 288 a, g dbSNP:747207245
289 289 c, g dbSNP:367543087
290 290 -, ccaca dbSNP:771321623
293 293 c, t dbSNP:768813899
294 294 a, g dbSNP:367543088
295 295 c, t dbSNP:777006898
296 296 c, g dbSNP:762016266
298 298 c, t dbSNP:78792190
311 311 c, g dbSNP:773578248
313 313 c, t dbSNP:142645368
314 314 a, g dbSNP:372535026
330 330 a, t dbSNP:752206990
350 350 c, t dbSNP:116628628
351 351 a, g dbSNP:149233802
355 355 c, g dbSNP:753685511
356 356 c, t dbSNP:548917148
358 358 c, t dbSNP:778978721
359 359 c, t dbSNP:34268403
361 361 c, t dbSNP:28930675
362 362 a, g dbSNP:144844117
366 366 c, t dbSNP:367543089
367 367 a, g dbSNP:78852015
375 375 c, t dbSNP:768866821
378 378 c, g dbSNP:776775347
395 395 a, g dbSNP:369934412
396 396 c, t dbSNP:3738402
404 404 a, g dbSNP:367543090
408 408 a, g dbSNP:770011117
410 410 c, g, t dbSNP:2492367
411 411 a, g dbSNP:138886515
420 420 c, t dbSNP:200412573
437 437 g, t dbSNP:144785732
444 444 c, g dbSNP:377426796
454 454 a, g dbSNP:199502948
455 455 a, g dbSNP:568973456
468 468 a, g dbSNP:761392527
470 470 a, t dbSNP:764901021
473 473 a, g dbSNP:750185997
486 486 c, t dbSNP:762674669
489 489 a, c dbSNP:766361575
492 492 c, g dbSNP:751493854
500 500 g, t dbSNP:755089027
501 501 c, g dbSNP:781107733
508 508 a, g dbSNP:752784334
509 509 c, t dbSNP:756296410
519 519 c, g, t dbSNP:150294573
521 521 a, g dbSNP:367543091
524 524 a, g dbSNP:779607667
536 536 g, t dbSNP:145261336
547 547 a, g dbSNP:772579757
549 549 c, t dbSNP:776032830
550 550 c, t dbSNP:761316458
551 551 a, g dbSNP:769340270
564 564 a, t dbSNP:143500026
569 569 c, g dbSNP:780298848
572 572 a, g dbSNP:762801662
576 576 g, t dbSNP:766129985
585 585 a, g dbSNP:774319025
592 592 c, g dbSNP:200669845
593 593 c, t dbSNP:767423842
594 594 a, c, g, t dbSNP:56229136
601 601 c, t dbSNP:754085491
605 605 c, t dbSNP:757748063
617 617 a, g dbSNP:779446123
619 619 c, g, t dbSNP:147158825
622 622 a, c, g, t dbSNP:143165003
623 623 a, g dbSNP:148583596
634 634 a, g dbSNP:772891200
637 637 a, g dbSNP:748914648
642 642 c, t dbSNP:752338225
643 643 a, c dbSNP:143689741
651 651 a, g dbSNP:757890223
653 653 a, c, t dbSNP:148111679
654 654 a, g dbSNP:117884450
664 664 c, t dbSNP:6675281
669 669 c, t dbSNP:140611432
670 670 a, g dbSNP:150138912
678 678 c, t dbSNP:778998186
680 680 a, g dbSNP:200043911
687 687 a, c dbSNP:772299277
689 689 c, t dbSNP:370202687
690 690 a, g, t dbSNP:780245731
693 693 a, g dbSNP:768867791
700 700 c, g dbSNP:777241274
708 708 a, g dbSNP:12133766
709 709 a, g dbSNP:770293338
722 722 a, g dbSNP:774002534
735 735 a, g, t dbSNP:372702363
738 738 g, t dbSNP:374457080
745 745 a, g dbSNP:752366478
751 751 a, g dbSNP:570993566
779 779 a, g, t dbSNP:763819357
781 781 c, g, t dbSNP:148065829
783 783 -, ttttttcagt dbSNP:751224220
785 785 -, at dbSNP:759827602
790 790 c, t dbSNP:750563912
797 797 a, g dbSNP:758465488
807 807 g, t dbSNP:780290940
814 814 c, g dbSNP:747175343
816 816 a, g dbSNP:770939443
818 818 c, t dbSNP:768871439
822 822 c, g dbSNP:781439697
824 824 a, g dbSNP:763302143
827 827 a, g dbSNP:748476505
828 828 c, t dbSNP:770215229
835 835 -, ac dbSNP:767934658
844 844 a, g dbSNP:781283061
846 846 -, a dbSNP:35525167
850 850 c, t dbSNP:371673083
851 851 a, g dbSNP:771685874
853 853 a, c, g dbSNP:202216120
869 869 -, t dbSNP:756693120
872 872 a, g dbSNP:571789580
876 876 c, t dbSNP:368980950
878 878 c, t dbSNP:574178027
878 878 -, t dbSNP:764050276
879 879 g, t dbSNP:761659860
917 917 -, t dbSNP:35435283
931 931 c, t dbSNP:140348041
935 935 a, g dbSNP:554532577
954 954 -, c dbSNP:34051282
990 990 c, t dbSNP:1535530
991 991 a, g dbSNP:769536500
1032 1032 c, t dbSNP:181226584
1043 1043 c, g dbSNP:186501853
1053 1053 -, c dbSNP:35301222
1069 1069 g, t dbSNP:576088518
1080 1080 a, g dbSNP:145427524
1081 1081 -, c dbSNP:35427992
1124 1124 c, g dbSNP:367654954
1154 1154 a, c dbSNP:199603966
1171 1171 c, t dbSNP:772371873
1172 1172 a, g dbSNP:1535529
1205 1205 c, g dbSNP:372684884
1206 1206 c, g dbSNP:200947305
1215 1215 a, g dbSNP:191490462
1234 1234 a, g dbSNP:181619542
1245 1245 c, t dbSNP:2295959
1270 1270 a, g dbSNP:368804544
1312 1312 a, g dbSNP:529913539
1316 1316 a, t dbSNP:756634772
1329 1329 c, t dbSNP:185884963
1331 1331 a, c dbSNP:766865009
1335 1335 a, t dbSNP:202227785
1348 1348 a, g dbSNP:562503068
1352 1352 c, t dbSNP:759920263
1354 1354 c, t dbSNP:746772515
1374 1374 a, g dbSNP:200770865
1390 1390 g, t dbSNP:531722909
1412 1412 -, c dbSNP:769671307
1435 1435 c, t dbSNP:11588937
1436 1436 a, g dbSNP:6699672
1438 1438 a, t dbSNP:756981405
1458 1458 c, t dbSNP:757934864
1462 1462 a, g dbSNP:138155658
1468 1468 g, t dbSNP:142627534
1523 1523 a, g dbSNP:567981419
1544 1544 a, g dbSNP:145945315

Target ORF information:

RefSeq Version NM_001164556
Organism Homo sapiens (human)
Definition Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant t, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu24906
Accession Version NM_018662.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2565bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product disrupted in schizophrenia 1 protein isoform L
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF222980.1, AJ506178.1, AB007926.1 and AI075754.1. This sequence is a reference standard in the RefSeqGene project. On Mar 24, 2005 this sequence version replaced gi:11037064. Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (L) encodes isoform L, also known as the 'Long' isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF222980.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA2152798 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)54..929(+)
Misc Feature(2)930..2141(+)
Misc Feature(3)1062..2087(+)
Misc Feature(4)1371..1844(+)
Misc Feature(5)1389..2615(+)
Misc Feature(6)1632..2579(+)
Misc Feature(7)1845..2615(+)
Misc Feature(8)2232..2615(+)
Misc Feature(9)2457..2558(+)
Exon (1)1..120
Gene Synonym:
Exon (2)121..1100
Gene Synonym:
Exon (3)1101..1170
Gene Synonym:
Exon (4)1171..1321
Gene Synonym:
Exon (5)1322..1451
Gene Synonym:
Exon (6)1452..1687
Gene Synonym:
Exon (7)1688..1742
Gene Synonym:
Exon (8)1743..1845
Gene Synonym:
Exon (9)1846..2034
Gene Synonym:
Exon (10)2035..2095
Gene Synonym:
Exon (11)2096..2360
Gene Synonym:
Exon (12)2361..2478
Gene Synonym:
Exon (13)2479..7059
Gene Synonym:
Position Chain Variation Link
41 41 a, g dbSNP:778668737
47 47 a, g, t dbSNP:3738399
54 54 a, g dbSNP:779911990
61 61 a, g dbSNP:746960289
62 62 a, c dbSNP:768655605
67 67 g, t dbSNP:3738400
91 91 -, cgg dbSNP:775477136
91 91 c, g dbSNP:79978593
92 92 c, g dbSNP:761828898
95 95 c, t dbSNP:566458514
105 105 c, g dbSNP:773369045
107 107 a, g dbSNP:367543082
122 122 a, c, g dbSNP:768658770
125 125 a, c dbSNP:142035917
126 126 c, t dbSNP:769854975
127 127 a, g dbSNP:143922209
129 129 a, g dbSNP:763133701
133 133 a, g dbSNP:771251513
136 136 c, t dbSNP:774803245
144 144 a, g dbSNP:371004195
148 148 c, t dbSNP:778380831
149 149 a, c, g, t dbSNP:374290063
153 153 c, t dbSNP:764834743
156 156 c, t dbSNP:368750072
157 157 a, g dbSNP:758045297
162 162 c, t dbSNP:202102981
165 165 c, t dbSNP:137948488
166 166 a, g dbSNP:754659008
174 174 c, t dbSNP:202017627
175 175 a, g dbSNP:559586748
181 181 c, t dbSNP:756229499
189 189 a, g dbSNP:372355962
193 193 a, g dbSNP:749280796
199 199 c, t dbSNP:374600796
207 207 c, t dbSNP:370600083
210 210 g, t dbSNP:774371342
214 214 g, t dbSNP:746258574
216 216 a, c, g dbSNP:367627719
230 230 -, a dbSNP:768678230
238 238 g, t dbSNP:761231571
246 246 a, t dbSNP:764887674
247 247 a, t dbSNP:541596242
248 248 a, c dbSNP:561467531
249 249 c, t dbSNP:147261047
253 253 c, t dbSNP:751110828
261 261 a, g dbSNP:754872907
262 262 g, t dbSNP:767273484
264 264 g, t dbSNP:149444280
272 272 c, t dbSNP:201590659
273 273 a, g dbSNP:777650012
279 279 g, t dbSNP:749391919
280 280 c, t dbSNP:77062350
283 283 a, g dbSNP:757227901
289 289 c, t dbSNP:138332232
290 290 a, g dbSNP:773046625
301 301 c, t dbSNP:76175896
308 308 a, g dbSNP:199501041
314 314 c, g dbSNP:747325439
316 316 c, t dbSNP:769316063
318 318 -, gactc dbSNP:776655587
322 322 c, t dbSNP:200850282
323 323 a, g dbSNP:145101392
326 326 a, g dbSNP:529902979
327 327 a, g dbSNP:747725366
329 329 c, t dbSNP:774097214
340 340 a, g dbSNP:759091145
343 343 c, g dbSNP:150563134
344 344 c, g, t dbSNP:149755964
357 357 a, g dbSNP:535168315
362 362 a, g dbSNP:764032506
369 369 a, c dbSNP:34574703
384 384 g, t dbSNP:757423806
393 393 a, t dbSNP:367543083
395 395 a, c dbSNP:778827055
397 397 c, t dbSNP:750705010
398 398 a, g dbSNP:758714637
400 400 c, t dbSNP:56020408
401 401 a, g dbSNP:189101828
419 419 a, c dbSNP:140910315
422 422 a, g dbSNP:769080854
427 427 a, g dbSNP:781750113
432 432 a, g dbSNP:748575787
442 442 a, g dbSNP:374924573
451 451 c, g dbSNP:770528086
457 457 c, t dbSNP:773758385
458 458 a, c, g dbSNP:759010166
471 471 a, g dbSNP:775068297
479 479 c, g dbSNP:760521090
486 486 c, t dbSNP:151311391
499 499 c, g dbSNP:750801544
505 505 a, g dbSNP:763792460
508 508 a, g dbSNP:753852441
510 510 c, t dbSNP:201600649
512 512 c, t dbSNP:765171325
516 516 a, t dbSNP:750498211
518 518 c, t dbSNP:758482654
519 519 a, c dbSNP:150489951
524 524 c, t dbSNP:780432594
525 525 a, g dbSNP:367543084
526 526 c, t dbSNP:755437485
532 532 g, t dbSNP:143796295
535 535 a, g dbSNP:139091980
537 537 a, g dbSNP:770237650
544 544 g, t dbSNP:181767113
548 548 c, t dbSNP:778277620
549 549 a, g dbSNP:745397878
551 551 c, t dbSNP:774425560
553 553 c, g dbSNP:771557495
561 561 c, t dbSNP:186593988
562 562 g, t dbSNP:760289681
564 564 a, g dbSNP:768544712
567 567 c, t dbSNP:776311202
568 568 a, g dbSNP:761627224
571 571 c, t dbSNP:765087160
574 574 c, t dbSNP:750325934
581 581 c, t dbSNP:763179161
587 587 a, g dbSNP:542010946
601 601 a, g dbSNP:766559698
603 603 a, g dbSNP:751883731
608 608 c, t dbSNP:139667828
611 611 a, c dbSNP:767741003
612 612 g, t dbSNP:761815665
630 630 c, t dbSNP:112577310
633 633 c, g dbSNP:756445061
638 638 a, c, t dbSNP:559000734
638 638 -, c dbSNP:761174007
639 639 c, t dbSNP:757944052
642 642 a, c, g dbSNP:141270877
647 647 a, c dbSNP:201901960
648 648 a, c dbSNP:369315072
653 653 g, t dbSNP:747906699
656 656 c, t dbSNP:769613668
657 657 c, g, t dbSNP:773346712
662 662 c, t dbSNP:766374745
663 663 a, g dbSNP:774606244
680 680 c, g, t dbSNP:200704946
684 684 a, c dbSNP:752952040
693 693 c, t dbSNP:756502841
694 694 a, g dbSNP:199617790
696 696 c, t dbSNP:754390526
700 700 c, t dbSNP:139420445
701 701 g, t dbSNP:779350258
712 712 c, t dbSNP:746525075
713 713 a, c, t dbSNP:754450096
714 714 a, g dbSNP:747828145
717 717 a, g dbSNP:769513744
720 720 c, t dbSNP:773166710
721 721 a, g dbSNP:146439119
735 735 a, g dbSNP:375607284
737 737 a, c dbSNP:774376929
742 742 c, t dbSNP:759594286
743 743 a, g dbSNP:767632505
751 751 a, g dbSNP:201249128
760 760 a, c dbSNP:201556843
763 763 a, c dbSNP:199530992
764 764 a, c dbSNP:373365825
775 775 c, g dbSNP:764251510
776 776 c, t dbSNP:754230811
780 780 c, g dbSNP:762545623
782 782 a, g dbSNP:762099070
795 795 a, g dbSNP:765745403
807 807 g, t dbSNP:750925617
812 812 c, t dbSNP:113312552
813 813 a, g dbSNP:780719614
819 819 c, g dbSNP:199893176
820 820 a, g dbSNP:755865070
821 821 c, t dbSNP:367543085
822 822 -, gag dbSNP:764811265
822 822 a, g dbSNP:777504676
829 829 c, t dbSNP:373288445
830 830 a, g dbSNP:377484189
832 832 a, g dbSNP:149702548
837 837 c, t dbSNP:779060951
843 843 c, t dbSNP:148973353
844 844 a, g dbSNP:3738401
855 855 c, t dbSNP:775660207
860 860 g, t dbSNP:760628896
866 866 a, g dbSNP:768870892
867 867 c, t dbSNP:776775277
868 868 a, g dbSNP:141459782
869 869 a, g dbSNP:201258158
874 874 c, t dbSNP:765577746
876 876 g, t dbSNP:750932225
877 877 c, t dbSNP:763492083
883 883 g, t dbSNP:766759086
885 885 a, g dbSNP:752258922
888 888 c, t dbSNP:755631643
893 893 c, t dbSNP:138228295
894 894 a, g dbSNP:367543086
901 901 a, c dbSNP:753537068
902 902 c, t dbSNP:757157671
908 908 c, t dbSNP:778749511
913 913 c, t dbSNP:146244276
914 914 a, c dbSNP:772075803
918 918 c, t dbSNP:201677901
921 921 a, c, g dbSNP:181037363
928 928 a, g dbSNP:776902304
938 938 a, g dbSNP:761988285
940 940 a, g dbSNP:770190113
942 942 a, g dbSNP:773660555
955 955 c, g dbSNP:763163271
956 956 c, t dbSNP:766927209
961 961 a, g dbSNP:779996183
966 966 c, g dbSNP:760329626
1003 1003 a, g dbSNP:763667017
1007 1007 c, t dbSNP:753596220
1008 1008 a, g dbSNP:756994353
1008 1008 -, g dbSNP:762711850
1015 1015 a, g dbSNP:764755492
1025 1025 c, t dbSNP:750234495
1026 1026 c, t dbSNP:758069816
1030 1030 g, t dbSNP:142641202
1033 1033 -, a dbSNP:766695450
1036 1036 a, c dbSNP:55795950
1038 1038 c, t dbSNP:755086664
1040 1040 a, g dbSNP:781223648
1041 1041 c, t dbSNP:34622148
1043 1043 c, g, t dbSNP:557511436
1064 1064 a, g, t dbSNP:547899710
1065 1065 c, g, t dbSNP:561520652
1066 1066 a, g dbSNP:530661133
1076 1076 a, g dbSNP:768090422
1086 1086 c, t dbSNP:776313827
1087 1087 a, g dbSNP:77080351
1088 1088 a, g dbSNP:764954250
1089 1089 a, g dbSNP:750030920
1090 1090 c, g dbSNP:758280361
1093 1093 a, g dbSNP:76372333
1095 1095 a, t dbSNP:751543084
1096 1096 c, t dbSNP:754929291
1100 1100 a, g dbSNP:781065374
1101 1101 g, t dbSNP:78640112
1103 1103 -, a dbSNP:781619215
1115 1115 a, t dbSNP:753905681
1136 1136 a, g dbSNP:757453905
1143 1143 a, g dbSNP:552589341
1153 1153 -, atg dbSNP:753252319
1155 1155 c, g dbSNP:746246110
1158 1158 a, g dbSNP:139096455
1177 1177 c, g, t dbSNP:547023544
1178 1178 a, g dbSNP:560642465
1181 1181 a, g dbSNP:200802543
1185 1185 c, t dbSNP:367652092
1194 1194 a, g dbSNP:774489082
1206 1206 c, t dbSNP:759829485
1212 1212 a, g dbSNP:767594296
1217 1217 a, c dbSNP:780966020
1218 1218 a, g dbSNP:760972690
1233 1233 c, t dbSNP:764644321
1241 1241 a, g dbSNP:754337105
1252 1252 c, g dbSNP:757885480
1258 1258 a, g dbSNP:779592106
1268 1268 c, g dbSNP:750983762
1272 1272 c, t dbSNP:372352273
1274 1274 a, c dbSNP:780639303
1299 1299 a, t dbSNP:529845499
1302 1302 c, t dbSNP:193024019
1303 1303 a, g dbSNP:201902199
1305 1305 c, t dbSNP:777900755
1306 1306 a, g dbSNP:144959108
1311 1311 -, gccactca dbSNP:777968689
1312 1312 c, t dbSNP:770728178
1314 1314 a, g dbSNP:148920333
1323 1323 a, g dbSNP:746021282
1328 1328 c, t dbSNP:772042563
1329 1329 a, g dbSNP:200019964
1338 1338 a, g dbSNP:747207245
1339 1339 c, g dbSNP:367543087
1340 1340 -, ccaca dbSNP:771321623
1343 1343 c, t dbSNP:768813899
1344 1344 a, g dbSNP:367543088
1345 1345 c, t dbSNP:777006898
1346 1346 c, g dbSNP:762016266
1348 1348 c, t dbSNP:78792190
1361 1361 c, g dbSNP:773578248
1363 1363 c, t dbSNP:142645368
1364 1364 a, g dbSNP:372535026
1380 1380 a, t dbSNP:752206990
1400 1400 c, t dbSNP:116628628
1401 1401 a, g dbSNP:149233802
1405 1405 c, g dbSNP:753685511
1406 1406 c, t dbSNP:548917148
1408 1408 c, t dbSNP:778978721
1409 1409 c, t dbSNP:34268403
1411 1411 c, t dbSNP:28930675
1412 1412 a, g dbSNP:144844117
1416 1416 c, t dbSNP:367543089
1417 1417 a, g dbSNP:78852015
1425 1425 c, t dbSNP:768866821
1428 1428 c, g dbSNP:776775347
1445 1445 a, g dbSNP:369934412
1446 1446 c, t dbSNP:3738402
1454 1454 a, g dbSNP:367543090
1458 1458 a, g dbSNP:770011117
1460 1460 c, g, t dbSNP:2492367
1461 1461 a, g dbSNP:138886515
1470 1470 c, t dbSNP:200412573
1487 1487 g, t dbSNP:144785732
1494 1494 c, g dbSNP:377426796
1504 1504 a, g dbSNP:199502948
1505 1505 a, g dbSNP:568973456
1518 1518 a, g dbSNP:761392527
1520 1520 a, t dbSNP:764901021
1523 1523 a, g dbSNP:750185997
1536 1536 c, t dbSNP:762674669
1539 1539 a, c dbSNP:766361575
1542 1542 c, g dbSNP:751493854
1550 1550 g, t dbSNP:755089027
1551 1551 c, g dbSNP:781107733
1558 1558 a, g dbSNP:752784334
1559 1559 c, t dbSNP:756296410
1569 1569 c, g, t dbSNP:150294573
1571 1571 a, g dbSNP:367543091
1574 1574 a, g dbSNP:779607667
1586 1586 g, t dbSNP:145261336
1597 1597 a, g dbSNP:772579757
1599 1599 c, t dbSNP:776032830
1600 1600 c, t dbSNP:761316458
1601 1601 a, g dbSNP:769340270
1614 1614 a, t dbSNP:143500026
1619 1619 c, g dbSNP:780298848
1622 1622 a, g dbSNP:762801662
1626 1626 g, t dbSNP:766129985
1635 1635 a, g dbSNP:774319025
1642 1642 c, g dbSNP:200669845
1643 1643 c, t dbSNP:767423842
1644 1644 a, c, g, t dbSNP:56229136
1651 1651 c, t dbSNP:754085491
1655 1655 c, t dbSNP:757748063
1667 1667 a, g dbSNP:779446123
1669 1669 c, g, t dbSNP:147158825
1672 1672 a, c, g, t dbSNP:143165003
1673 1673 a, g dbSNP:148583596
1684 1684 a, g dbSNP:772891200
1687 1687 a, g dbSNP:748914648
1688 1688 -, c dbSNP:746754821
1702 1702 -, a dbSNP:768588457
1713 1713 a, t dbSNP:760686953
1714 1714 a, g dbSNP:768678309
1715 1715 c, g dbSNP:776852329
1722 1722 c, t dbSNP:761924360
1731 1731 a, g dbSNP:765608848
1734 1734 a, g dbSNP:76230451
1740 1740 -, cgcctgtaatcccagcactttggg dbSNP:761880716
1743 1743 g, t dbSNP:763256346
1747 1747 g, t dbSNP:575022416
1749 1749 a, g, t dbSNP:751969064
1752 1752 a, g dbSNP:768079502
1757 1757 g, t dbSNP:753171376
1759 1759 a, g dbSNP:756813350
1760 1760 -, attct dbSNP:772815043
1771 1771 a, c, t dbSNP:367543092
1772 1772 c, t dbSNP:758078052
1775 1775 a, g dbSNP:201489476
1777 1777 a, g dbSNP:202013247
1781 1781 c, g dbSNP:543441277
1782 1782 a, g dbSNP:367543093
1789 1789 a, t dbSNP:748075518
1790 1790 c, t dbSNP:760982112
1794 1794 a, g dbSNP:773370574
1802 1802 c, t dbSNP:749258461
1803 1803 c, g dbSNP:771243765
1809 1809 c, g, t dbSNP:192018321
1816 1816 c, t dbSNP:767846705
1818 1818 c, t dbSNP:558450836
1819 1819 c, t dbSNP:775786666
1833 1833 -, catgc dbSNP:762477661
1835 1835 c, t dbSNP:761205750
1839 1839 a, g dbSNP:768995288
1841 1841 a, t dbSNP:749966615
1850 1850 c, t dbSNP:752338225
1851 1851 a, c dbSNP:143689741
1859 1859 a, g dbSNP:757890223
1861 1861 a, c, t dbSNP:148111679
1862 1862 a, g dbSNP:117884450
1872 1872 c, t dbSNP:6675281
1877 1877 c, t dbSNP:140611432
1878 1878 a, g dbSNP:150138912
1886 1886 c, t dbSNP:778998186
1888 1888 a, g dbSNP:200043911
1895 1895 a, c dbSNP:772299277
1897 1897 c, t dbSNP:370202687
1898 1898 a, g, t dbSNP:780245731
1901 1901 a, g dbSNP:768867791
1908 1908 c, g dbSNP:777241274
1916 1916 a, g dbSNP:12133766
1917 1917 a, g dbSNP:770293338
1930 1930 a, g dbSNP:774002534
1943 1943 a, g, t dbSNP:372702363
1946 1946 g, t dbSNP:374457080
1953 1953 a, g dbSNP:752366478
1959 1959 a, g dbSNP:570993566
1987 1987 a, g, t dbSNP:763819357
1989 1989 c, g, t dbSNP:148065829
1991 1991 -, ttttttcagt dbSNP:751224220
1993 1993 -, at dbSNP:759827602
1998 1998 c, t dbSNP:750563912
2005 2005 a, g dbSNP:758465488
2015 2015 g, t dbSNP:780290940
2022 2022 c, g dbSNP:747175343
2024 2024 a, g dbSNP:770939443
2026 2026 c, t dbSNP:768871439
2030 2030 c, g dbSNP:781439697
2032 2032 a, g dbSNP:763302143
2039 2039 a, t dbSNP:758778894
2040 2040 a, g dbSNP:780782871
2041 2041 a, g dbSNP:201138012
2042 2042 c, t dbSNP:747850416
2043 2043 a, g dbSNP:769447635
2058 2058 a, g dbSNP:777389083
2062 2062 a, g dbSNP:749146701
2067 2067 a, t dbSNP:569395146
2078 2078 g, t dbSNP:538866725
2083 2083 a, g dbSNP:759550751
2090 2090 c, g dbSNP:771839898
2098 2098 -, c dbSNP:781085620
2104 2104 a, g dbSNP:748961696
2108 2108 a, t dbSNP:770451894
2109 2109 c, t dbSNP:778774454
2116 2116 a, g dbSNP:367543094
2117 2117 a, g dbSNP:529752304
2125 2125 c, g dbSNP:527758402
2130 2130 a, g dbSNP:549783778
2136 2136 c, t dbSNP:760881595
2143 2143 c, t dbSNP:374463501
2148 2148 c, g, t dbSNP:190975963
2149 2149 a, g dbSNP:765307670
2159 2159 a, c dbSNP:2806455
2163 2163 a, t dbSNP:821616
2175 2175 c, t dbSNP:766936684
2182 2182 c, t dbSNP:752028732
2193 2193 c, t dbSNP:755669097
2199 2199 a, g dbSNP:570919103
2210 2210 a, g dbSNP:367543095
2213 2213 a, g, t dbSNP:763625640
2214 2214 c, g dbSNP:756949009
2217 2217 a, g dbSNP:778418318
2218 2218 c, g, t dbSNP:370604562
2225 2225 c, t dbSNP:112054353
2228 2228 a, c dbSNP:746969672
2231 2231 a, g dbSNP:768670397
2235 2235 g, t dbSNP:776852284
2247 2247 -, t dbSNP:769728969
2247 2247 a, g dbSNP:748115814
2249 2249 -, c dbSNP:773042612
2249 2249 g, t dbSNP:368129863
2250 2250 a, c dbSNP:773300398
2253 2253 c, t dbSNP:763414549
2254 2254 c, g dbSNP:371690077
2255 2255 a, c, t dbSNP:138051341
2261 2261 c, t dbSNP:374429738
2263 2263 a, c dbSNP:367601523
2267 2267 c, t dbSNP:565912178
2268 2268 a, g dbSNP:367543096
2274 2274 a, g dbSNP:367543097
2284 2284 c, t dbSNP:758023306
2285 2285 a, c dbSNP:534507948
2286 2286 c, g dbSNP:377170152
2298 2298 c, t dbSNP:754975683
2299 2299 c, t dbSNP:771272566
2304 2304 c, g dbSNP:115112816
2305 2305 a, c dbSNP:183265932
2306 2306 a, g dbSNP:149500705
2309 2309 -, gaa dbSNP:748736644
2316 2316 c, t dbSNP:61737326
2326 2326 c, t dbSNP:749494452
2331 2331 a, c dbSNP:369545518
2333 2333 c, g dbSNP:774712766
2337 2337 c, g, t dbSNP:759882962
2344 2344 a, g dbSNP:372827112
2348 2348 a, c, t dbSNP:367543098
2352 2352 c, t dbSNP:749913421
2364 2364 a, c, t dbSNP:777194183
2365 2365 a, c dbSNP:770545094
2372 2372 a, c dbSNP:773951758
2374 2374 a, t dbSNP:759294762
2407 2407 c, t dbSNP:767131548
2408 2408 a, t dbSNP:564821383
2410 2410 a, g, t dbSNP:760513137
2411 2411 c, t dbSNP:753751402
2419 2419 g, t dbSNP:757134520
2423 2423 a, g, t dbSNP:200687715
2424 2424 c, t dbSNP:759721497
2447 2447 -, a dbSNP:759245129
2451 2451 a, g dbSNP:547967126
2457 2457 a, g dbSNP:758566779
2473 2473 -, tcat dbSNP:767751519
2478 2478 c, g dbSNP:765507960
2484 2484 c, t dbSNP:755108024
2493 2493 -, g dbSNP:374285923
2505 2505 a, g dbSNP:577308599
2509 2509 a, g dbSNP:539919975
2513 2513 a, g dbSNP:756702307
2514 2514 a, t dbSNP:778419366
2519 2519 g, t dbSNP:745408546
2521 2521 a, c dbSNP:771586997
2523 2523 g, t dbSNP:375677364
2526 2526 a, g dbSNP:746702454
2527 2527 a, t dbSNP:768226865
2529 2529 a, t dbSNP:776420091
2530 2530 a, t dbSNP:553180312
2540 2540 c, g dbSNP:369926020
2541 2541 c, t dbSNP:773106511
2550 2550 a, c dbSNP:762995357
2555 2555 a, g dbSNP:41271517
2557 2557 c, t dbSNP:751554416
2558 2558 a, g dbSNP:759809991
2572 2572 c, g dbSNP:377376224
2574 2574 g, t dbSNP:370665515
2577 2577 g, t dbSNP:753179633
2581 2581 a, c dbSNP:374426194
2586 2586 a, g dbSNP:756515963
2594 2594 g, t dbSNP:778472143
2595 2595 c, g dbSNP:754389081
2596 2596 a, g dbSNP:367543099
2603 2603 c, t dbSNP:367543100
2604 2604 a, g dbSNP:376617666
2607 2607 g, t dbSNP:746443648
2614 2614 c, t dbSNP:768351409
2622 2622 a, g dbSNP:780822344
2626 2626 c, t dbSNP:562068421
2627 2627 a, g dbSNP:769558772
2631 2631 g, t dbSNP:575849683
2632 2632 a, c, g, t dbSNP:543876809
2634 2634 a, g dbSNP:774504655
2635 2635 a, g dbSNP:759522635
2638 2638 c, g dbSNP:112807868
2643 2643 -, t dbSNP:764614567
2652 2652 a, c dbSNP:532928612
2654 2654 c, t dbSNP:760930472
2664 2664 c, t dbSNP:370641830
2668 2668 a, g dbSNP:754082589
2691 2691 a, g dbSNP:560421413
2696 2696 c, t dbSNP:550458844
2716 2716 c, t dbSNP:549170615
2722 2722 c, t dbSNP:756955507
2738 2738 c, t dbSNP:572218516
2744 2744 a, g dbSNP:553341552
2756 2756 c, t dbSNP:569176649
2760 2760 a, t dbSNP:780931451
2769 2769 c, t dbSNP:538134489
2807 2807 a, t dbSNP:777459622
2815 2815 c, g dbSNP:75779221
2827 2827 a, c dbSNP:113238366
2829 2829 a, g dbSNP:779453406
2860 2860 a, c dbSNP:570803931
2869 2869 g, t dbSNP:79424400
2870 2870 a, t dbSNP:75712790
2879 2879 a, g dbSNP:3737597
2884 2884 a, g dbSNP:201730777
2918 2918 g, t dbSNP:11589636
2924 2924 a, c dbSNP:112303659
2934 2934 a, g dbSNP:553068072
2943 2943 a, g dbSNP:77178075
2962 2962 c, t dbSNP:768518349
2968 2968 c, t dbSNP:201571443
3009 3009 a, g dbSNP:535658789
3023 3023 a, g dbSNP:72762368
3026 3026 a, g dbSNP:575885768
3031 3031 a, g dbSNP:544883020
3133 3133 c, t dbSNP:563952182
3159 3159 a, t dbSNP:140751631
3215 3215 c, t dbSNP:60193126
3233 3233 c, t dbSNP:142965400
3234 3234 c, t dbSNP:150851326
3251 3251 a, g dbSNP:139283763
3259 3259 g, t dbSNP:776771262
3276 3276 c, t dbSNP:200513980
3281 3281 g, t dbSNP:193108907
3303 3303 c, t dbSNP:370318484
3391 3391 a, t dbSNP:78591239
3429 3429 a, g dbSNP:112847297
3437 3437 c, g dbSNP:150006709
3449 3449 g, t dbSNP:370943406
3455 3455 a, c dbSNP:374294770
3468 3468 c, t dbSNP:368214221
3482 3482 c, t dbSNP:113782883
3485 3485 a, g dbSNP:533386833
3486 3486 c, t dbSNP:546545506
3499 3499 -, agta dbSNP:544200764
3500 3500 a, g dbSNP:566636183
3505 3505 a, g dbSNP:535547055
3513 3513 a, g dbSNP:555584352
3519 3519 -, agta dbSNP:562497810
3535 3535 a, g dbSNP:372542602
3543 3543 -, gg dbSNP:569456954
3551 3551 a, g dbSNP:538188732
3562 3562 c, t dbSNP:11578905
3582 3582 c, t dbSNP:750047980
3584 3584 a, g dbSNP:755771881
3592 3592 c, t dbSNP:2776624
3601 3601 g, t dbSNP:61835610
3616 3616 c, g dbSNP:779587583
3634 3634 -, agtt dbSNP:766070569
3635 3635 -, agtt dbSNP:143247781
3637 3637 -, ttag dbSNP:370459377
3685 3685 a, g dbSNP:148449456
3695 3695 c, t dbSNP:144167464
3697 3697 -, gtactcagtaacacagtgca dbSNP:370424413
3702 3702 -, cagtaaca dbSNP:560294314
3707 3707 -, ac dbSNP:72376152
3710 3710 -, ca dbSNP:367798382
3716 3716 a, g dbSNP:549922228
3726 3726 -, ac dbSNP:200410500
3729 3729 -, ca dbSNP:200308759
3742 3742 a, g dbSNP:573827024
3744 3744 -, ac dbSNP:201348679
3759 3759 -, agta dbSNP:71927075
3761 3761 -, taag dbSNP:71162209
3764 3764 -, gg dbSNP:201912660
3764 3764 c, g dbSNP:542722689
3765 3765 a, g dbSNP:562575611
3783 3783 -, ac dbSNP:201249179
3784 3784 c, g dbSNP:748086623
3786 3786 -, ca dbSNP:372550466
3787 3787 a, t dbSNP:185364817
3799 3799 a, g dbSNP:544846938
3801 3801 g, t dbSNP:565186019
3810 3810 a, g dbSNP:527539042
3828 3828 g, t dbSNP:190557668
3835 3835 a, g dbSNP:566527365
3863 3863 -, ac dbSNP:374027856
3866 3866 -, ca dbSNP:369551753
3885 3885 a, g dbSNP:529377920
3912 3912 a, g dbSNP:771817197
3938 3938 c, t dbSNP:112263707
3963 3963 -, ac dbSNP:770887222
3964 3964 c, t dbSNP:746054603
3969 3969 c, g dbSNP:569221075
3971 3971 a, c dbSNP:768539978
3986 3986 a, g dbSNP:116099257
3989 3989 a, g dbSNP:769975229
3993 3993 a, g dbSNP:55900971
3997 3997 g, t dbSNP:199656948
4007 4007 c, t dbSNP:762882603
4009 4009 c, t dbSNP:572096035
4012 4012 a, g dbSNP:571919139
4054 4054 a, g dbSNP:534486682
4057 4057 c, g dbSNP:553831759
4065 4065 a, g dbSNP:573662584
4073 4073 a, g dbSNP:199803540
4084 4084 g, t dbSNP:371753743
4094 4094 a, t dbSNP:9661748
4116 4116 a, g dbSNP:576005479
4129 4129 c, t dbSNP:545195208
4155 4155 a, g dbSNP:146507244
4209 4209 c, t dbSNP:527624134
4214 4214 c, t dbSNP:9729179
4244 4244 c, t dbSNP:568753550
4271 4271 c, t dbSNP:774959446
4276 4276 a, c, g dbSNP:560150721
4306 4306 a, g dbSNP:549081650
4307 4307 a, g dbSNP:41303125
4334 4334 a, c dbSNP:531672147
4347 4347 c, t dbSNP:551991913
4356 4356 c, t dbSNP:41307732
4362 4362 a, g dbSNP:9793915
4385 4385 c, t dbSNP:534530633
4396 4396 c, t dbSNP:201868454
4400 4400 g, t dbSNP:562267206
4402 4402 g, t dbSNP:760373951
4440 4440 c, t dbSNP:200522264
4467 4467 c, t dbSNP:186349418
4484 4484 a, c dbSNP:187957550
4494 4494 g, t dbSNP:201271103
4575 4575 c, t dbSNP:754381371
4586 4586 a, g dbSNP:140824380
4612 4612 a, t dbSNP:778429961
4617 4617 c, t dbSNP:752586377
4628 4628 a, c dbSNP:758368936
4659 4659 c, t dbSNP:536255918
4727 4727 a, g dbSNP:201643607
4768 4768 a, g dbSNP:555843357
4788 4788 c, t dbSNP:576125347
4791 4791 c, g dbSNP:202081292
4816 4816 c, t dbSNP:1411771
4827 4827 c, t dbSNP:549183288
4828 4828 a, g dbSNP:201847001
4840 4840 c, g dbSNP:540795424
4864 4864 c, t dbSNP:370666148
4865 4865 a, t dbSNP:770771528
4955 4955 c, t dbSNP:144565562
4979 4979 a, g dbSNP:9661837
5014 5014 c, t dbSNP:200435335
5029 5029 a, g dbSNP:41303123
5047 5047 a, g dbSNP:531881342
5053 5053 c, t dbSNP:201683942
5061 5061 a, c dbSNP:539267858
5072 5072 c, t dbSNP:565344609
5075 5075 a, g dbSNP:72762370
5085 5085 a, g dbSNP:527908539
5094 5094 a, g dbSNP:202239225
5113 5113 c, t dbSNP:774622472
5131 5131 c, t dbSNP:180865071
5150 5150 a, g dbSNP:369472550
5154 5154 a, g dbSNP:567967401
5176 5176 a, c dbSNP:112775285
5189 5189 c, t dbSNP:151172119
5192 5192 c, t dbSNP:201198022
5208 5208 a, g dbSNP:201925191
5211 5211 a, t dbSNP:772775394
5227 5227 a, t dbSNP:185422574
5235 5235 c, t dbSNP:374570157
5279 5279 a, g dbSNP:569525838
5309 5309 a, g dbSNP:11122396
5320 5320 a, g dbSNP:558248630
5321 5321 c, t dbSNP:571782360
5331 5331 c, t dbSNP:760893287
5353 5353 a, c dbSNP:140238958
5359 5359 c, t dbSNP:766774009
5360 5360 a, g dbSNP:200225551
5367 5367 a, g dbSNP:150323238
5370 5370 a, g dbSNP:372207112
5372 5372 c, t dbSNP:549721033
5373 5373 a, g dbSNP:543349786
5379 5379 c, t dbSNP:562928532
5380 5380 c, t dbSNP:576374582
5399 5399 a, t dbSNP:753396797
5454 5454 c, t dbSNP:138289086
5462 5462 a, g dbSNP:76310864
5537 5537 a, t dbSNP:756718951
5546 5546 c, t dbSNP:143979122
5563 5563 a, g dbSNP:201096400
5568 5568 c, t dbSNP:758315767
5593 5593 c, t dbSNP:114066143
5596 5596 a, g dbSNP:201296840
5600 5600 g, t dbSNP:113563872
5610 5610 a, g dbSNP:41303103
5676 5676 c, t dbSNP:557888907
5706 5706 c, g dbSNP:78843900
5727 5727 a, c dbSNP:756960393
5737 5737 -, gtct dbSNP:139756128
5738 5738 -, ctgt dbSNP:35280852
5740 5740 -, gtct dbSNP:3028413
5741 5741 a, g dbSNP:200157280
5756 5756 a, c dbSNP:781062809
5786 5786 c, t dbSNP:9729647
5793 5793 -, t dbSNP:376027088
5794 5794 g, t dbSNP:79148624
5806 5806 a, c dbSNP:547651969
5820 5820 -, g dbSNP:770131721
5821 5821 -, g dbSNP:36040103
5839 5839 c, t dbSNP:543107020
5893 5893 c, t dbSNP:191369449
5907 5907 c, t dbSNP:139295216
5933 5933 a, c dbSNP:755292122
5934 5934 a, g dbSNP:183575865
5935 5935 a, g dbSNP:143007031
5969 5969 a, g dbSNP:554390562
5977 5977 c, t dbSNP:748298012
5985 5985 a, g dbSNP:186909557
6004 6004 a, c dbSNP:746753920
6006 6006 g, t dbSNP:539468648
6016 6016 c, t dbSNP:144699433
6020 6020 c, g dbSNP:776398272
6032 6032 c, t dbSNP:747585427
6060 6060 g, t dbSNP:77476692
6070 6070 c, t dbSNP:12404162
6071 6071 a, g dbSNP:777106448
6076 6076 c, t dbSNP:545081122
6077 6077 g, t dbSNP:191945184
6102 6102 c, t dbSNP:183285639
6160 6160 a, g dbSNP:367561483
6166 6166 g, t dbSNP:770932610
6192 6192 c, t dbSNP:74392082
6193 6193 a, g dbSNP:187910126
6207 6207 a, t dbSNP:543969899
6226 6226 a, g dbSNP:563832378
6236 6236 g, t dbSNP:980989
6238 6238 c, g dbSNP:775134107
6262 6262 c, t dbSNP:537504727
6293 6293 a, g dbSNP:148085646
6310 6310 -, taa dbSNP:758462442
6347 6347 a, g dbSNP:9308481
6349 6349 -, a dbSNP:34473218
6357 6357 a, t dbSNP:189689658
6363 6363 a, c dbSNP:547866854
6412 6412 a, g dbSNP:374361316
6437 6437 a, t dbSNP:568119027
6438 6438 a, t dbSNP:536855161
6439 6439 a, t dbSNP:557078129
6451 6451 a, c dbSNP:182466393
6455 6455 c, g dbSNP:539740168
6534 6534 a, g dbSNP:751403109
6535 6535 a, t dbSNP:559017190
6552 6552 a, g dbSNP:200923506
6564 6564 c, t dbSNP:541395441
6582 6582 a, g dbSNP:572453705
6597 6597 a, g dbSNP:187175205
6615 6615 c, g dbSNP:200835938
6628 6628 c, t dbSNP:759092023
6640 6640 c, t dbSNP:114459058
6698 6698 c, g dbSNP:553682637
6766 6766 c, t dbSNP:554790239
6796 6796 a, g dbSNP:578243345
6802 6802 -, tacttt dbSNP:545831785
6802 6802 c, t dbSNP:115493305
6810 6810 c, t dbSNP:11803088
6827 6827 g, t dbSNP:563898238
6881 6881 c, t dbSNP:577515620
6885 6885 c, t dbSNP:531313495
6909 6909 -, aaggcat dbSNP:771842030
6919 6919 a, g dbSNP:546066003
6939 6939 c, t dbSNP:192765612
6945 6945 a, g dbSNP:528097801
6957 6957 c, t dbSNP:141906238
7028 7028 c, t dbSNP:16856322
7029 7029 a, g dbSNP:530619101

Target ORF information:

RefSeq Version NM_018662
Organism Homo sapiens (human)
Definition Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant L, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu24960
Accession Version NM_001012957.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2499bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product disrupted in schizophrenia 1 protein isoform Lv
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ506177.1, AB007926.1, AJ506178.1 and AI075754.1. Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (Lv) has an alternate splice site in the 3' coding region, as compared to variant L. The reading frame is not changed, and the resulting isoform (Lv, also known as the 'Long variant' isoform) lacks an internal segment, as compared to isoform L. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC151225.1, AB007926.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2152798, SAMEA2155751 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1425..2447(+)
Exon (1)1..120
Gene Synonym:
Exon (2)121..1100
Gene Synonym:
Exon (3)1101..1170
Gene Synonym:
Exon (4)1171..1321
Gene Synonym:
Exon (5)1322..1451
Gene Synonym:
Exon (6)1452..1687
Gene Synonym:
Exon (7)1688..1742
Gene Synonym:
Exon (8)1743..1845
Gene Synonym:
Exon (9)1846..2034
Gene Synonym:
Exon (10)2035..2095
Gene Synonym:
Exon (11)2096..2294
Gene Synonym:
Exon (12)2295..2412
Gene Synonym:
Exon (13)2413..6993
Gene Synonym:
Position Chain Variation Link
41 41 a, g dbSNP:778668737
47 47 a, g, t dbSNP:3738399
54 54 a, g dbSNP:779911990
61 61 a, g dbSNP:746960289
62 62 a, c dbSNP:768655605
67 67 g, t dbSNP:3738400
91 91 -, cgg dbSNP:775477136
91 91 c, g dbSNP:79978593
92 92 c, g dbSNP:761828898
95 95 c, t dbSNP:566458514
105 105 c, g dbSNP:773369045
107 107 a, g dbSNP:367543082
122 122 a, c, g dbSNP:768658770
125 125 a, c dbSNP:142035917
126 126 c, t dbSNP:769854975
127 127 a, g dbSNP:143922209
129 129 a, g dbSNP:763133701
133 133 a, g dbSNP:771251513
136 136 c, t dbSNP:774803245
144 144 a, g dbSNP:371004195
148 148 c, t dbSNP:778380831
149 149 a, c, g, t dbSNP:374290063
153 153 c, t dbSNP:764834743
156 156 c, t dbSNP:368750072
157 157 a, g dbSNP:758045297
162 162 c, t dbSNP:202102981
165 165 c, t dbSNP:137948488
166 166 a, g dbSNP:754659008
174 174 c, t dbSNP:202017627
175 175 a, g dbSNP:559586748
181 181 c, t dbSNP:756229499
189 189 a, g dbSNP:372355962
193 193 a, g dbSNP:749280796
199 199 c, t dbSNP:374600796
207 207 c, t dbSNP:370600083
210 210 g, t dbSNP:774371342
214 214 g, t dbSNP:746258574
216 216 a, c, g dbSNP:367627719
230 230 -, a dbSNP:768678230
238 238 g, t dbSNP:761231571
246 246 a, t dbSNP:764887674
247 247 a, t dbSNP:541596242
248 248 a, c dbSNP:561467531
249 249 c, t dbSNP:147261047
253 253 c, t dbSNP:751110828
261 261 a, g dbSNP:754872907
262 262 g, t dbSNP:767273484
264 264 g, t dbSNP:149444280
272 272 c, t dbSNP:201590659
273 273 a, g dbSNP:777650012
279 279 g, t dbSNP:749391919
280 280 c, t dbSNP:77062350
283 283 a, g dbSNP:757227901
289 289 c, t dbSNP:138332232
290 290 a, g dbSNP:773046625
301 301 c, t dbSNP:76175896
308 308 a, g dbSNP:199501041
314 314 c, g dbSNP:747325439
316 316 c, t dbSNP:769316063
318 318 -, gactc dbSNP:776655587
322 322 c, t dbSNP:200850282
323 323 a, g dbSNP:145101392
326 326 a, g dbSNP:529902979
327 327 a, g dbSNP:747725366
329 329 c, t dbSNP:774097214
340 340 a, g dbSNP:759091145
343 343 c, g dbSNP:150563134
344 344 c, g, t dbSNP:149755964
357 357 a, g dbSNP:535168315
362 362 a, g dbSNP:764032506
369 369 a, c dbSNP:34574703
384 384 g, t dbSNP:757423806
393 393 a, t dbSNP:367543083
395 395 a, c dbSNP:778827055
397 397 c, t dbSNP:750705010
398 398 a, g dbSNP:758714637
400 400 c, t dbSNP:56020408
401 401 a, g dbSNP:189101828
419 419 a, c dbSNP:140910315
422 422 a, g dbSNP:769080854
427 427 a, g dbSNP:781750113
432 432 a, g dbSNP:748575787
442 442 a, g dbSNP:374924573
451 451 c, g dbSNP:770528086
457 457 c, t dbSNP:773758385
458 458 a, c, g dbSNP:759010166
471 471 a, g dbSNP:775068297
479 479 c, g dbSNP:760521090
486 486 c, t dbSNP:151311391
499 499 c, g dbSNP:750801544
505 505 a, g dbSNP:763792460
508 508 a, g dbSNP:753852441
510 510 c, t dbSNP:201600649
512 512 c, t dbSNP:765171325
516 516 a, t dbSNP:750498211
518 518 c, t dbSNP:758482654
519 519 a, c dbSNP:150489951
524 524 c, t dbSNP:780432594
525 525 a, g dbSNP:367543084
526 526 c, t dbSNP:755437485
532 532 g, t dbSNP:143796295
535 535 a, g dbSNP:139091980
537 537 a, g dbSNP:770237650
544 544 g, t dbSNP:181767113
548 548 c, t dbSNP:778277620
549 549 a, g dbSNP:745397878
551 551 c, t dbSNP:774425560
553 553 c, g dbSNP:771557495
561 561 c, t dbSNP:186593988
562 562 g, t dbSNP:760289681
564 564 a, g dbSNP:768544712
567 567 c, t dbSNP:776311202
568 568 a, g dbSNP:761627224
571 571 c, t dbSNP:765087160
574 574 c, t dbSNP:750325934
581 581 c, t dbSNP:763179161
587 587 a, g dbSNP:542010946
601 601 a, g dbSNP:766559698
603 603 a, g dbSNP:751883731
608 608 c, t dbSNP:139667828
611 611 a, c dbSNP:767741003
612 612 g, t dbSNP:761815665
630 630 c, t dbSNP:112577310
633 633 c, g dbSNP:756445061
638 638 a, c, t dbSNP:559000734
638 638 -, c dbSNP:761174007
639 639 c, t dbSNP:757944052
642 642 a, c, g dbSNP:141270877
647 647 a, c dbSNP:201901960
648 648 a, c dbSNP:369315072
653 653 g, t dbSNP:747906699
656 656 c, t dbSNP:769613668
657 657 c, g, t dbSNP:773346712
662 662 c, t dbSNP:766374745
663 663 a, g dbSNP:774606244
680 680 c, g, t dbSNP:200704946
684 684 a, c dbSNP:752952040
693 693 c, t dbSNP:756502841
694 694 a, g dbSNP:199617790
696 696 c, t dbSNP:754390526
700 700 c, t dbSNP:139420445
701 701 g, t dbSNP:779350258
712 712 c, t dbSNP:746525075
713 713 a, c, t dbSNP:754450096
714 714 a, g dbSNP:747828145
717 717 a, g dbSNP:769513744
720 720 c, t dbSNP:773166710
721 721 a, g dbSNP:146439119
735 735 a, g dbSNP:375607284
737 737 a, c dbSNP:774376929
742 742 c, t dbSNP:759594286
743 743 a, g dbSNP:767632505
751 751 a, g dbSNP:201249128
760 760 a, c dbSNP:201556843
763 763 a, c dbSNP:199530992
764 764 a, c dbSNP:373365825
775 775 c, g dbSNP:764251510
776 776 c, t dbSNP:754230811
780 780 c, g dbSNP:762545623
782 782 a, g dbSNP:762099070
795 795 a, g dbSNP:765745403
807 807 g, t dbSNP:750925617
812 812 c, t dbSNP:113312552
813 813 a, g dbSNP:780719614
819 819 c, g dbSNP:199893176
820 820 a, g dbSNP:755865070
821 821 c, t dbSNP:367543085
822 822 -, gag dbSNP:764811265
822 822 a, g dbSNP:777504676
829 829 c, t dbSNP:373288445
830 830 a, g dbSNP:377484189
832 832 a, g dbSNP:149702548
837 837 c, t dbSNP:779060951
843 843 c, t dbSNP:148973353
844 844 a, g dbSNP:3738401
855 855 c, t dbSNP:775660207
860 860 g, t dbSNP:760628896
866 866 a, g dbSNP:768870892
867 867 c, t dbSNP:776775277
868 868 a, g dbSNP:141459782
869 869 a, g dbSNP:201258158
874 874 c, t dbSNP:765577746
876 876 g, t dbSNP:750932225
877 877 c, t dbSNP:763492083
883 883 g, t dbSNP:766759086
885 885 a, g dbSNP:752258922
888 888 c, t dbSNP:755631643
893 893 c, t dbSNP:138228295
894 894 a, g dbSNP:367543086
901 901 a, c dbSNP:753537068
902 902 c, t dbSNP:757157671
908 908 c, t dbSNP:778749511
913 913 c, t dbSNP:146244276
914 914 a, c dbSNP:772075803
918 918 c, t dbSNP:201677901
921 921 a, c, g dbSNP:181037363
928 928 a, g dbSNP:776902304
938 938 a, g dbSNP:761988285
940 940 a, g dbSNP:770190113
942 942 a, g dbSNP:773660555
955 955 c, g dbSNP:763163271
956 956 c, t dbSNP:766927209
961 961 a, g dbSNP:779996183
966 966 c, g dbSNP:760329626
1003 1003 a, g dbSNP:763667017
1007 1007 c, t dbSNP:753596220
1008 1008 a, g dbSNP:756994353
1008 1008 -, g dbSNP:762711850
1015 1015 a, g dbSNP:764755492
1025 1025 c, t dbSNP:750234495
1026 1026 c, t dbSNP:758069816
1030 1030 g, t dbSNP:142641202
1033 1033 -, a dbSNP:766695450
1036 1036 a, c dbSNP:55795950
1038 1038 c, t dbSNP:755086664
1040 1040 a, g dbSNP:781223648
1041 1041 c, t dbSNP:34622148
1043 1043 c, g, t dbSNP:557511436
1064 1064 a, g, t dbSNP:547899710
1065 1065 c, g, t dbSNP:561520652
1066 1066 a, g dbSNP:530661133
1076 1076 a, g dbSNP:768090422
1086 1086 c, t dbSNP:776313827
1087 1087 a, g dbSNP:77080351
1088 1088 a, g dbSNP:764954250
1089 1089 a, g dbSNP:750030920
1090 1090 c, g dbSNP:758280361
1093 1093 a, g dbSNP:76372333
1095 1095 a, t dbSNP:751543084
1096 1096 c, t dbSNP:754929291
1100 1100 a, g dbSNP:781065374
1101 1101 g, t dbSNP:78640112
1103 1103 -, a dbSNP:781619215
1115 1115 a, t dbSNP:753905681
1136 1136 a, g dbSNP:757453905
1143 1143 a, g dbSNP:552589341
1153 1153 -, atg dbSNP:753252319
1155 1155 c, g dbSNP:746246110
1158 1158 a, g dbSNP:139096455
1177 1177 c, g, t dbSNP:547023544
1178 1178 a, g dbSNP:560642465
1181 1181 a, g dbSNP:200802543
1185 1185 c, t dbSNP:367652092
1194 1194 a, g dbSNP:774489082
1206 1206 c, t dbSNP:759829485
1212 1212 a, g dbSNP:767594296
1217 1217 a, c dbSNP:780966020
1218 1218 a, g dbSNP:760972690
1233 1233 c, t dbSNP:764644321
1241 1241 a, g dbSNP:754337105
1252 1252 c, g dbSNP:757885480
1258 1258 a, g dbSNP:779592106
1268 1268 c, g dbSNP:750983762
1272 1272 c, t dbSNP:372352273
1274 1274 a, c dbSNP:780639303
1299 1299 a, t dbSNP:529845499
1302 1302 c, t dbSNP:193024019
1303 1303 a, g dbSNP:201902199
1305 1305 c, t dbSNP:777900755
1306 1306 a, g dbSNP:144959108
1311 1311 -, gccactca dbSNP:777968689
1312 1312 c, t dbSNP:770728178
1314 1314 a, g dbSNP:148920333
1323 1323 a, g dbSNP:746021282
1328 1328 c, t dbSNP:772042563
1329 1329 a, g dbSNP:200019964
1338 1338 a, g dbSNP:747207245
1339 1339 c, g dbSNP:367543087
1340 1340 -, ccaca dbSNP:771321623
1343 1343 c, t dbSNP:768813899
1344 1344 a, g dbSNP:367543088
1345 1345 c, t dbSNP:777006898
1346 1346 c, g dbSNP:762016266
1348 1348 c, t dbSNP:78792190
1361 1361 c, g dbSNP:773578248
1363 1363 c, t dbSNP:142645368
1364 1364 a, g dbSNP:372535026
1380 1380 a, t dbSNP:752206990
1400 1400 c, t dbSNP:116628628
1401 1401 a, g dbSNP:149233802
1405 1405 c, g dbSNP:753685511
1406 1406 c, t dbSNP:548917148
1408 1408 c, t dbSNP:778978721
1409 1409 c, t dbSNP:34268403
1411 1411 c, t dbSNP:28930675
1412 1412 a, g dbSNP:144844117
1416 1416 c, t dbSNP:367543089
1417 1417 a, g dbSNP:78852015
1425 1425 c, t dbSNP:768866821
1428 1428 c, g dbSNP:776775347
1445 1445 a, g dbSNP:369934412
1446 1446 c, t dbSNP:3738402
1454 1454 a, g dbSNP:367543090
1458 1458 a, g dbSNP:770011117
1460 1460 c, g, t dbSNP:2492367
1461 1461 a, g dbSNP:138886515
1470 1470 c, t dbSNP:200412573
1487 1487 g, t dbSNP:144785732
1494 1494 c, g dbSNP:377426796
1504 1504 a, g dbSNP:199502948
1505 1505 a, g dbSNP:568973456
1518 1518 a, g dbSNP:761392527
1520 1520 a, t dbSNP:764901021
1523 1523 a, g dbSNP:750185997
1536 1536 c, t dbSNP:762674669
1539 1539 a, c dbSNP:766361575
1542 1542 c, g dbSNP:751493854
1550 1550 g, t dbSNP:755089027
1551 1551 c, g dbSNP:781107733
1558 1558 a, g dbSNP:752784334
1559 1559 c, t dbSNP:756296410
1569 1569 c, g, t dbSNP:150294573
1571 1571 a, g dbSNP:367543091
1574 1574 a, g dbSNP:779607667
1586 1586 g, t dbSNP:145261336
1597 1597 a, g dbSNP:772579757
1599 1599 c, t dbSNP:776032830
1600 1600 c, t dbSNP:761316458
1601 1601 a, g dbSNP:769340270
1614 1614 a, t dbSNP:143500026
1619 1619 c, g dbSNP:780298848
1622 1622 a, g dbSNP:762801662
1626 1626 g, t dbSNP:766129985
1635 1635 a, g dbSNP:774319025
1642 1642 c, g dbSNP:200669845
1643 1643 c, t dbSNP:767423842
1644 1644 a, c, g, t dbSNP:56229136
1651 1651 c, t dbSNP:754085491
1655 1655 c, t dbSNP:757748063
1667 1667 a, g dbSNP:779446123
1669 1669 c, g, t dbSNP:147158825
1672 1672 a, c, g, t dbSNP:143165003
1673 1673 a, g dbSNP:148583596
1684 1684 a, g dbSNP:772891200
1687 1687 a, g dbSNP:748914648
1688 1688 -, c dbSNP:746754821
1702 1702 -, a dbSNP:768588457
1713 1713 a, t dbSNP:760686953
1714 1714 a, g dbSNP:768678309
1715 1715 c, g dbSNP:776852329
1722 1722 c, t dbSNP:761924360
1731 1731 a, g dbSNP:765608848
1734 1734 a, g dbSNP:76230451
1740 1740 -, cgcctgtaatcccagcactttggg dbSNP:761880716
1743 1743 g, t dbSNP:763256346
1747 1747 g, t dbSNP:575022416
1749 1749 a, g, t dbSNP:751969064
1752 1752 a, g dbSNP:768079502
1757 1757 g, t dbSNP:753171376
1759 1759 a, g dbSNP:756813350
1760 1760 -, attct dbSNP:772815043
1771 1771 a, c, t dbSNP:367543092
1772 1772 c, t dbSNP:758078052
1775 1775 a, g dbSNP:201489476
1777 1777 a, g dbSNP:202013247
1781 1781 c, g dbSNP:543441277
1782 1782 a, g dbSNP:367543093
1789 1789 a, t dbSNP:748075518
1790 1790 c, t dbSNP:760982112
1794 1794 a, g dbSNP:773370574
1802 1802 c, t dbSNP:749258461
1803 1803 c, g dbSNP:771243765
1809 1809 c, g, t dbSNP:192018321
1816 1816 c, t dbSNP:767846705
1818 1818 c, t dbSNP:558450836
1819 1819 c, t dbSNP:775786666
1833 1833 -, catgc dbSNP:762477661
1835 1835 c, t dbSNP:761205750
1839 1839 a, g dbSNP:768995288
1841 1841 a, t dbSNP:749966615
1850 1850 c, t dbSNP:752338225
1851 1851 a, c dbSNP:143689741
1859 1859 a, g dbSNP:757890223
1861 1861 a, c, t dbSNP:148111679
1862 1862 a, g dbSNP:117884450
1872 1872 c, t dbSNP:6675281
1877 1877 c, t dbSNP:140611432
1878 1878 a, g dbSNP:150138912
1886 1886 c, t dbSNP:778998186
1888 1888 a, g dbSNP:200043911
1895 1895 a, c dbSNP:772299277
1897 1897 c, t dbSNP:370202687
1898 1898 a, g, t dbSNP:780245731
1901 1901 a, g dbSNP:768867791
1908 1908 c, g dbSNP:777241274
1916 1916 a, g dbSNP:12133766
1917 1917 a, g dbSNP:770293338
1930 1930 a, g dbSNP:774002534
1943 1943 a, g, t dbSNP:372702363
1946 1946 g, t dbSNP:374457080
1953 1953 a, g dbSNP:752366478
1959 1959 a, g dbSNP:570993566
1987 1987 a, g, t dbSNP:763819357
1989 1989 c, g, t dbSNP:148065829
1991 1991 -, ttttttcagt dbSNP:751224220
1993 1993 -, at dbSNP:759827602
1998 1998 c, t dbSNP:750563912
2005 2005 a, g dbSNP:758465488
2015 2015 g, t dbSNP:780290940
2022 2022 c, g dbSNP:747175343
2024 2024 a, g dbSNP:770939443
2026 2026 c, t dbSNP:768871439
2030 2030 c, g dbSNP:781439697
2032 2032 a, g dbSNP:763302143
2039 2039 a, t dbSNP:758778894
2040 2040 a, g dbSNP:780782871
2041 2041 a, g dbSNP:201138012
2042 2042 c, t dbSNP:747850416
2043 2043 a, g dbSNP:769447635
2058 2058 a, g dbSNP:777389083
2062 2062 a, g dbSNP:749146701
2067 2067 a, t dbSNP:569395146
2078 2078 g, t dbSNP:538866725
2083 2083 a, g dbSNP:759550751
2090 2090 c, g dbSNP:771839898
2098 2098 -, c dbSNP:781085620
2104 2104 a, g dbSNP:748961696
2108 2108 a, t dbSNP:770451894
2109 2109 c, t dbSNP:778774454
2116 2116 a, g dbSNP:367543094
2117 2117 a, g dbSNP:529752304
2125 2125 c, g dbSNP:527758402
2130 2130 a, g dbSNP:549783778
2136 2136 c, t dbSNP:760881595
2143 2143 c, t dbSNP:374463501
2148 2148 c, g, t dbSNP:190975963
2149 2149 a, g dbSNP:765307670
2159 2159 a, c dbSNP:2806455
2163 2163 a, t dbSNP:821616
2175 2175 c, t dbSNP:766936684
2182 2182 c, t dbSNP:752028732
2193 2193 c, t dbSNP:755669097
2199 2199 a, g dbSNP:570919103
2210 2210 a, g dbSNP:367543095
2213 2213 a, g, t dbSNP:763625640
2214 2214 c, g dbSNP:756949009
2217 2217 a, g dbSNP:778418318
2218 2218 c, g, t dbSNP:370604562
2225 2225 c, t dbSNP:112054353
2228 2228 a, c dbSNP:746969672
2231 2231 a, g dbSNP:768670397
2235 2235 g, t dbSNP:776852284
2247 2247 -, t dbSNP:769728969
2247 2247 a, g dbSNP:748115814
2249 2249 -, c dbSNP:773042612
2249 2249 g, t dbSNP:368129863
2250 2250 a, c dbSNP:773300398
2253 2253 c, t dbSNP:763414549
2254 2254 c, g dbSNP:371690077
2255 2255 a, c, t dbSNP:138051341
2261 2261 c, t dbSNP:374429738
2263 2263 a, c dbSNP:367601523
2267 2267 c, t dbSNP:565912178
2268 2268 a, g dbSNP:367543096
2274 2274 a, g dbSNP:367543097
2284 2284 c, t dbSNP:758023306
2285 2285 a, c dbSNP:534507948
2286 2286 c, g dbSNP:377170152
2298 2298 a, c, t dbSNP:777194183
2299 2299 a, c dbSNP:770545094
2306 2306 a, c dbSNP:773951758
2308 2308 a, t dbSNP:759294762
2341 2341 c, t dbSNP:767131548
2342 2342 a, t dbSNP:564821383
2344 2344 a, g, t dbSNP:760513137
2345 2345 c, t dbSNP:753751402
2353 2353 g, t dbSNP:757134520
2357 2357 a, g, t dbSNP:200687715
2358 2358 c, t dbSNP:759721497
2381 2381 -, a dbSNP:759245129
2385 2385 a, g dbSNP:547967126
2391 2391 a, g dbSNP:758566779
2407 2407 -, tcat dbSNP:767751519
2412 2412 c, g dbSNP:765507960
2418 2418 c, t dbSNP:755108024
2427 2427 -, g dbSNP:374285923
2439 2439 a, g dbSNP:577308599
2443 2443 a, g dbSNP:539919975
2447 2447 a, g dbSNP:756702307
2448 2448 a, t dbSNP:778419366
2453 2453 g, t dbSNP:745408546
2455 2455 a, c dbSNP:771586997
2457 2457 g, t dbSNP:375677364
2460 2460 a, g dbSNP:746702454
2461 2461 a, t dbSNP:768226865
2463 2463 a, t dbSNP:776420091
2464 2464 a, t dbSNP:553180312
2474 2474 c, g dbSNP:369926020
2475 2475 c, t dbSNP:773106511
2484 2484 a, c dbSNP:762995357
2489 2489 a, g dbSNP:41271517
2491 2491 c, t dbSNP:751554416
2492 2492 a, g dbSNP:759809991
2506 2506 c, g dbSNP:377376224
2508 2508 g, t dbSNP:370665515
2511 2511 g, t dbSNP:753179633
2515 2515 a, c dbSNP:374426194
2520 2520 a, g dbSNP:756515963
2528 2528 g, t dbSNP:778472143
2529 2529 c, g dbSNP:754389081
2530 2530 a, g dbSNP:367543099
2537 2537 c, t dbSNP:367543100
2538 2538 a, g dbSNP:376617666
2541 2541 g, t dbSNP:746443648
2548 2548 c, t dbSNP:768351409
2556 2556 a, g dbSNP:780822344
2560 2560 c, t dbSNP:562068421
2561 2561 a, g dbSNP:769558772
2565 2565 g, t dbSNP:575849683
2566 2566 a, c, g, t dbSNP:543876809
2568 2568 a, g dbSNP:774504655
2569 2569 a, g dbSNP:759522635
2572 2572 c, g dbSNP:112807868
2577 2577 -, t dbSNP:764614567
2586 2586 a, c dbSNP:532928612
2588 2588 c, t dbSNP:760930472
2598 2598 c, t dbSNP:370641830
2602 2602 a, g dbSNP:754082589
2625 2625 a, g dbSNP:560421413
2630 2630 c, t dbSNP:550458844
2650 2650 c, t dbSNP:549170615
2656 2656 c, t dbSNP:756955507
2672 2672 c, t dbSNP:572218516
2678 2678 a, g dbSNP:553341552
2690 2690 c, t dbSNP:569176649
2694 2694 a, t dbSNP:780931451
2703 2703 c, t dbSNP:538134489
2741 2741 a, t dbSNP:777459622
2749 2749 c, g dbSNP:75779221
2761 2761 a, c dbSNP:113238366
2763 2763 a, g dbSNP:779453406
2794 2794 a, c dbSNP:570803931
2803 2803 g, t dbSNP:79424400
2804 2804 a, t dbSNP:75712790
2813 2813 a, g dbSNP:3737597
2818 2818 a, g dbSNP:201730777
2852 2852 g, t dbSNP:11589636
2858 2858 a, c dbSNP:112303659
2868 2868 a, g dbSNP:553068072
2877 2877 a, g dbSNP:77178075
2896 2896 c, t dbSNP:768518349
2902 2902 c, t dbSNP:201571443
2943 2943 a, g dbSNP:535658789
2957 2957 a, g dbSNP:72762368
2960 2960 a, g dbSNP:575885768
2965 2965 a, g dbSNP:544883020
3067 3067 c, t dbSNP:563952182
3093 3093 a, t dbSNP:140751631
3149 3149 c, t dbSNP:60193126
3167 3167 c, t dbSNP:142965400
3168 3168 c, t dbSNP:150851326
3185 3185 a, g dbSNP:139283763
3193 3193 g, t dbSNP:776771262
3210 3210 c, t dbSNP:200513980
3215 3215 g, t dbSNP:193108907
3237 3237 c, t dbSNP:370318484
3325 3325 a, t dbSNP:78591239
3363 3363 a, g dbSNP:112847297
3371 3371 c, g dbSNP:150006709
3383 3383 g, t dbSNP:370943406
3389 3389 a, c dbSNP:374294770
3402 3402 c, t dbSNP:368214221
3416 3416 c, t dbSNP:113782883
3419 3419 a, g dbSNP:533386833
3420 3420 c, t dbSNP:546545506
3433 3433 -, agta dbSNP:544200764
3434 3434 a, g dbSNP:566636183
3439 3439 a, g dbSNP:535547055
3447 3447 a, g dbSNP:555584352
3453 3453 -, agta dbSNP:562497810
3469 3469 a, g dbSNP:372542602
3477 3477 -, gg dbSNP:569456954
3485 3485 a, g dbSNP:538188732
3496 3496 c, t dbSNP:11578905
3516 3516 c, t dbSNP:750047980
3518 3518 a, g dbSNP:755771881
3526 3526 c, t dbSNP:2776624
3535 3535 g, t dbSNP:61835610
3550 3550 c, g dbSNP:779587583
3568 3568 -, agtt dbSNP:766070569
3569 3569 -, agtt dbSNP:143247781
3571 3571 -, ttag dbSNP:370459377
3619 3619 a, g dbSNP:148449456
3629 3629 c, t dbSNP:144167464
3631 3631 -, gtactcagtaacacagtgca dbSNP:370424413
3636 3636 -, cagtaaca dbSNP:560294314
3641 3641 -, ac dbSNP:72376152
3644 3644 -, ca dbSNP:367798382
3650 3650 a, g dbSNP:549922228
3660 3660 -, ac dbSNP:200410500
3663 3663 -, ca dbSNP:200308759
3676 3676 a, g dbSNP:573827024
3678 3678 -, ac dbSNP:201348679
3693 3693 -, agta dbSNP:71927075
3695 3695 -, taag dbSNP:71162209
3698 3698 -, gg dbSNP:201912660
3698 3698 c, g dbSNP:542722689
3699 3699 a, g dbSNP:562575611
3717 3717 -, ac dbSNP:201249179
3718 3718 c, g dbSNP:748086623
3720 3720 -, ca dbSNP:372550466
3721 3721 a, t dbSNP:185364817
3733 3733 a, g dbSNP:544846938
3735 3735 g, t dbSNP:565186019
3744 3744 a, g dbSNP:527539042
3762 3762 g, t dbSNP:190557668
3769 3769 a, g dbSNP:566527365
3797 3797 -, ac dbSNP:374027856
3800 3800 -, ca dbSNP:369551753
3819 3819 a, g dbSNP:529377920
3846 3846 a, g dbSNP:771817197
3872 3872 c, t dbSNP:112263707
3897 3897 -, ac dbSNP:770887222
3898 3898 c, t dbSNP:746054603
3903 3903 c, g dbSNP:569221075
3905 3905 a, c dbSNP:768539978
3920 3920 a, g dbSNP:116099257
3923 3923 a, g dbSNP:769975229
3927 3927 a, g dbSNP:55900971
3931 3931 g, t dbSNP:199656948
3941 3941 c, t dbSNP:762882603
3943 3943 c, t dbSNP:572096035
3946 3946 a, g dbSNP:571919139
3988 3988 a, g dbSNP:534486682
3991 3991 c, g dbSNP:553831759
3999 3999 a, g dbSNP:573662584
4007 4007 a, g dbSNP:199803540
4018 4018 g, t dbSNP:371753743
4028 4028 a, t dbSNP:9661748
4050 4050 a, g dbSNP:576005479
4063 4063 c, t dbSNP:545195208
4089 4089 a, g dbSNP:146507244
4143 4143 c, t dbSNP:527624134
4148 4148 c, t dbSNP:9729179
4178 4178 c, t dbSNP:568753550
4205 4205 c, t dbSNP:774959446
4210 4210 a, c, g dbSNP:560150721
4240 4240 a, g dbSNP:549081650
4241 4241 a, g dbSNP:41303125
4268 4268 a, c dbSNP:531672147
4281 4281 c, t dbSNP:551991913
4290 4290 c, t dbSNP:41307732
4296 4296 a, g dbSNP:9793915
4319 4319 c, t dbSNP:534530633
4330 4330 c, t dbSNP:201868454
4334 4334 g, t dbSNP:562267206
4336 4336 g, t dbSNP:760373951
4374 4374 c, t dbSNP:200522264
4401 4401 c, t dbSNP:186349418
4418 4418 a, c dbSNP:187957550
4428 4428 g, t dbSNP:201271103
4509 4509 c, t dbSNP:754381371
4520 4520 a, g dbSNP:140824380
4546 4546 a, t dbSNP:778429961
4551 4551 c, t dbSNP:752586377
4562 4562 a, c dbSNP:758368936
4593 4593 c, t dbSNP:536255918
4661 4661 a, g dbSNP:201643607
4702 4702 a, g dbSNP:555843357
4722 4722 c, t dbSNP:576125347
4725 4725 c, g dbSNP:202081292
4750 4750 c, t dbSNP:1411771
4761 4761 c, t dbSNP:549183288
4762 4762 a, g dbSNP:201847001
4774 4774 c, g dbSNP:540795424
4798 4798 c, t dbSNP:370666148
4799 4799 a, t dbSNP:770771528
4889 4889 c, t dbSNP:144565562
4913 4913 a, g dbSNP:9661837
4948 4948 c, t dbSNP:200435335
4963 4963 a, g dbSNP:41303123
4981 4981 a, g dbSNP:531881342
4987 4987 c, t dbSNP:201683942
4995 4995 a, c dbSNP:539267858
5006 5006 c, t dbSNP:565344609
5009 5009 a, g dbSNP:72762370
5019 5019 a, g dbSNP:527908539
5028 5028 a, g dbSNP:202239225
5047 5047 c, t dbSNP:774622472
5065 5065 c, t dbSNP:180865071
5084 5084 a, g dbSNP:369472550
5088 5088 a, g dbSNP:567967401
5110 5110 a, c dbSNP:112775285
5123 5123 c, t dbSNP:151172119
5126 5126 c, t dbSNP:201198022
5142 5142 a, g dbSNP:201925191
5145 5145 a, t dbSNP:772775394
5161 5161 a, t dbSNP:185422574
5169 5169 c, t dbSNP:374570157
5213 5213 a, g dbSNP:569525838
5243 5243 a, g dbSNP:11122396
5254 5254 a, g dbSNP:558248630
5255 5255 c, t dbSNP:571782360
5265 5265 c, t dbSNP:760893287
5287 5287 a, c dbSNP:140238958
5293 5293 c, t dbSNP:766774009
5294 5294 a, g dbSNP:200225551
5301 5301 a, g dbSNP:150323238
5304 5304 a, g dbSNP:372207112
5306 5306 c, t dbSNP:549721033
5307 5307 a, g dbSNP:543349786
5313 5313 c, t dbSNP:562928532
5314 5314 c, t dbSNP:576374582
5333 5333 a, t dbSNP:753396797
5388 5388 c, t dbSNP:138289086
5396 5396 a, g dbSNP:76310864
5471 5471 a, t dbSNP:756718951
5480 5480 c, t dbSNP:143979122
5497 5497 a, g dbSNP:201096400
5502 5502 c, t dbSNP:758315767
5527 5527 c, t dbSNP:114066143
5530 5530 a, g dbSNP:201296840
5534 5534 g, t dbSNP:113563872
5544 5544 a, g dbSNP:41303103
5610 5610 c, t dbSNP:557888907
5640 5640 c, g dbSNP:78843900
5661 5661 a, c dbSNP:756960393
5671 5671 -, gtct dbSNP:139756128
5672 5672 -, ctgt dbSNP:35280852
5674 5674 -, gtct dbSNP:3028413
5675 5675 a, g dbSNP:200157280
5690 5690 a, c dbSNP:781062809
5720 5720 c, t dbSNP:9729647
5727 5727 -, t dbSNP:376027088
5728 5728 g, t dbSNP:79148624
5740 5740 a, c dbSNP:547651969
5754 5754 -, g dbSNP:770131721
5755 5755 -, g dbSNP:36040103
5773 5773 c, t dbSNP:543107020
5827 5827 c, t dbSNP:191369449
5841 5841 c, t dbSNP:139295216
5867 5867 a, c dbSNP:755292122
5868 5868 a, g dbSNP:183575865
5869 5869 a, g dbSNP:143007031
5903 5903 a, g dbSNP:554390562
5911 5911 c, t dbSNP:748298012
5919 5919 a, g dbSNP:186909557
5938 5938 a, c dbSNP:746753920
5940 5940 g, t dbSNP:539468648
5950 5950 c, t dbSNP:144699433
5954 5954 c, g dbSNP:776398272
5966 5966 c, t dbSNP:747585427
5994 5994 g, t dbSNP:77476692
6004 6004 c, t dbSNP:12404162
6005 6005 a, g dbSNP:777106448
6010 6010 c, t dbSNP:545081122
6011 6011 g, t dbSNP:191945184
6036 6036 c, t dbSNP:183285639
6094 6094 a, g dbSNP:367561483
6100 6100 g, t dbSNP:770932610
6126 6126 c, t dbSNP:74392082
6127 6127 a, g dbSNP:187910126
6141 6141 a, t dbSNP:543969899
6160 6160 a, g dbSNP:563832378
6170 6170 g, t dbSNP:980989
6172 6172 c, g dbSNP:775134107
6196 6196 c, t dbSNP:537504727
6227 6227 a, g dbSNP:148085646
6244 6244 -, taa dbSNP:758462442
6281 6281 a, g dbSNP:9308481
6283 6283 -, a dbSNP:34473218
6291 6291 a, t dbSNP:189689658
6297 6297 a, c dbSNP:547866854
6346 6346 a, g dbSNP:374361316
6371 6371 a, t dbSNP:568119027
6372 6372 a, t dbSNP:536855161
6373 6373 a, t dbSNP:557078129
6385 6385 a, c dbSNP:182466393
6389 6389 c, g dbSNP:539740168
6468 6468 a, g dbSNP:751403109
6469 6469 a, t dbSNP:559017190
6486 6486 a, g dbSNP:200923506
6498 6498 c, t dbSNP:541395441
6516 6516 a, g dbSNP:572453705
6531 6531 a, g dbSNP:187175205
6549 6549 c, g dbSNP:200835938
6562 6562 c, t dbSNP:759092023
6574 6574 c, t dbSNP:114459058
6632 6632 c, g dbSNP:553682637
6700 6700 c, t dbSNP:554790239
6730 6730 a, g dbSNP:578243345
6736 6736 -, tacttt dbSNP:545831785
6736 6736 c, t dbSNP:115493305
6744 6744 c, t dbSNP:11803088
6761 6761 g, t dbSNP:563898238
6815 6815 c, t dbSNP:577515620
6819 6819 c, t dbSNP:531313495
6843 6843 -, aaggcat dbSNP:771842030
6853 6853 a, g dbSNP:546066003
6873 6873 c, t dbSNP:192765612
6879 6879 a, g dbSNP:528097801
6891 6891 c, t dbSNP:141906238
6962 6962 c, t dbSNP:16856322
6963 6963 a, g dbSNP:530619101

Target ORF information:

RefSeq Version NM_001012957
Organism Homo sapiens (human)
Definition Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant Lv, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25035
Accession Version NM_001012958.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1110bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product disrupted in schizophrenia 1 protein isoform Es
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ506178.1. Summary: This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (Es) lacks multiple 3' exons but has an alternate 3' exon, as compared to variant L. The resulting isoform (Es, also known as the 'Extremely short' isoform) is much shorter and has a distinct C-terminus, as compared to isoform L. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ506178.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968540, SAMEA2142348 [ECO:0000350] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)54..929(+)
Exon (1)1..120
Gene Synonym:
Exon (2)121..1100
Gene Synonym:
Exon (3)1101..2636
Gene Synonym:
Position Chain Variation Link
41 41 a, g dbSNP:778668737
47 47 a, g, t dbSNP:3738399
54 54 a, g dbSNP:779911990
61 61 a, g dbSNP:746960289
62 62 a, c dbSNP:768655605
67 67 g, t dbSNP:3738400
91 91 -, cgg dbSNP:775477136
91 91 c, g dbSNP:79978593
92 92 c, g dbSNP:761828898
95 95 c, t dbSNP:566458514
105 105 c, g dbSNP:773369045
107 107 a, g dbSNP:367543082
122 122 a, c, g dbSNP:768658770
125 125 a, c dbSNP:142035917
126 126 c, t dbSNP:769854975
127 127 a, g dbSNP:143922209
129 129 a, g dbSNP:763133701
133 133 a, g dbSNP:771251513
136 136 c, t dbSNP:774803245
144 144 a, g dbSNP:371004195
148 148 c, t dbSNP:778380831
149 149 a, c, g, t dbSNP:374290063
153 153 c, t dbSNP:764834743
156 156 c, t dbSNP:368750072
157 157 a, g dbSNP:758045297
162 162 c, t dbSNP:202102981
165 165 c, t dbSNP:137948488
166 166 a, g dbSNP:754659008
174 174 c, t dbSNP:202017627
175 175 a, g dbSNP:559586748
181 181 c, t dbSNP:756229499
189 189 a, g dbSNP:372355962
193 193 a, g dbSNP:749280796
199 199 c, t dbSNP:374600796
207 207 c, t dbSNP:370600083
210 210 g, t dbSNP:774371342
214 214 g, t dbSNP:746258574
216 216 a, c, g dbSNP:367627719
230 230 -, a dbSNP:768678230
238 238 g, t dbSNP:761231571
246 246 a, t dbSNP:764887674
247 247 a, t dbSNP:541596242
248 248 a, c dbSNP:561467531
249 249 c, t dbSNP:147261047
253 253 c, t dbSNP:751110828
261 261 a, g dbSNP:754872907
262 262 g, t dbSNP:767273484
264 264 g, t dbSNP:149444280
272 272 c, t dbSNP:201590659
273 273 a, g dbSNP:777650012
279 279 g, t dbSNP:749391919
280 280 c, t dbSNP:77062350
283 283 a, g dbSNP:757227901
289 289 c, t dbSNP:138332232
290 290 a, g dbSNP:773046625
301 301 c, t dbSNP:76175896
308 308 a, g dbSNP:199501041
314 314 c, g dbSNP:747325439
316 316 c, t dbSNP:769316063
318 318 -, gactc dbSNP:776655587