Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

GNAO1 guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O [Homo sapiens (human)]

Gene Symbol GNAO1
Entrez Gene ID 2775
Full Name guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
Synonyms EIEE17, G-ALPHA-o, GNAO
General protein information
Preferred Names
guanine nucleotide-binding protein G(o) subunit alpha
guanine nucleotide-binding protein G(o) subunit alpha
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu13628 NM_138736 Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu13586 NM_020988 Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu58003 XM_011523003 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu13628D
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 13-AUG-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(o) subunit alpha isoform b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA500625.1, AK056008.1, DA529437.1, BC030027.2, AF493895.1, DA115582.1, BX647214.1 and AL512686.1. On Dec 14, 2007 this sequence version replaced gi:41281684. Summary: The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]. Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) is the same length but has a distinct C-terminus, compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CR936770.1, AF493895.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)787..789(+)
Misc Feature(2)937..1953(+)
Misc Feature(3)997..1941(+)
Misc Feature(4)1015..1875(+)
Misc Feature(5)1015..1038(+)
Misc Feature(6)1018..1545(+)
Misc Feature(7)1426..1452(+)
Misc Feature(8)1441..1443(+)
Misc Feature(9)1444..1548(+)
Misc Feature(10)1450..1548(+)
Misc Feature(11)1498..1509(+)
Misc Feature(12)1501..1551(+)
Misc Feature(13)1705..1716(+)
Misc Feature(14)1846..1896(+)
Misc Feature(15)1870..1878(+)
Exon (1)1..1015
Gene Synonym:
Exon (2)1016..1058
Gene Synonym:
Exon (3)1059..1200
Gene Synonym:
Exon (4)1201..1361
Gene Synonym:
Exon (5)1362..1490
Gene Synonym:
Exon (6)1491..1620
Gene Synonym:
Exon (7)1621..1774
Gene Synonym:
Exon (8)1775..6211
Gene Synonym:
Position Chain Variation Link
36 36 a, g dbSNP:372326668
78 78 c, g dbSNP:538486483
113 113 a, t dbSNP:553956941
129 129 c, t dbSNP:572112539
135 135 c, t dbSNP:190973615
276 276 a, g dbSNP:368329897
313 313 c, g dbSNP:554398792
346 346 c, g dbSNP:575681535
387 387 c, t dbSNP:543007245
447 447 g, t dbSNP:564867328
504 504 c, t dbSNP:2443048
743 743 c, g dbSNP:372008796
798 798 c, t dbSNP:559910143
802 802 -, agcc dbSNP:144057495
806 806 -, agcc dbSNP:3833511
811 811 c, t dbSNP:530274427
852 852 a, g dbSNP:755224987
863 863 c, t dbSNP:765531417
866 866 a, g dbSNP:752677340
871 871 g, t dbSNP:376241293
874 874 a, g dbSNP:778082773
876 876 c, t dbSNP:747516640
890 890 a, g dbSNP:757827374
897 897 c, g dbSNP:369237309
924 924 a, g dbSNP:139334934
972 972 a, g dbSNP:182812404
1009 1009 c, t dbSNP:774085068
1014 1014 c, g dbSNP:747565910
1042 1042 a, t dbSNP:763223472
1083 1083 c, t dbSNP:200201305
1092 1092 c, t dbSNP:368113345
1093 1093 a, g dbSNP:557932562
1104 1104 a, c dbSNP:77558236
1110 1110 a, t dbSNP:778169910
1111 1111 a, g dbSNP:371330886
1149 1149 c, t dbSNP:756947463
1153 1153 c, t dbSNP:767115578
1164 1164 c, t dbSNP:201728736
1176 1176 c, t dbSNP:749909537
1183 1183 a, g dbSNP:559674838
1184 1184 a, c, g dbSNP:189990922
1185 1185 a, t dbSNP:199632176
1187 1187 a, t dbSNP:778669032
1206 1206 c, t dbSNP:372103298
1207 1207 a, g dbSNP:375429245
1216 1216 c, g dbSNP:777981381
1218 1218 g, t dbSNP:369490809
1230 1230 a, g dbSNP:61758988
1233 1233 c, t dbSNP:781109351
1245 1245 c, t dbSNP:745985192
1248 1248 c, t dbSNP:770385484
1266 1266 g, t dbSNP:776163992
1283 1283 c, t dbSNP:200539902
1285 1285 c, g, t dbSNP:539662922
1286 1286 a, g dbSNP:200127285
1290 1290 c, g dbSNP:766107260
1294 1294 a, g dbSNP:374115337
1296 1296 c, t dbSNP:556058539
1309 1309 c, g dbSNP:759081912
1311 1311 a, g dbSNP:141057479
1314 1314 a, g dbSNP:369305192
1322 1322 a, g dbSNP:758424351
1325 1325 a, g dbSNP:777414554
1329 1329 c, t dbSNP:751417087
1330 1330 c, t dbSNP:757388426
1347 1347 c, t dbSNP:185369495
1371 1371 c, t dbSNP:144771965
1374 1374 c, t dbSNP:200158326
1377 1377 a, g dbSNP:373209490
1385 1385 c, t dbSNP:760544764
1389 1389 c, g dbSNP:773630438
1392 1392 c, t dbSNP:745503611
1393 1393 a, g dbSNP:375960435
1395 1395 c, g, t dbSNP:774947928
1404 1404 c, g dbSNP:762554588
1409 1409 a, c dbSNP:763888697
1410 1410 c, t dbSNP:1065375
1418 1418 a, g dbSNP:587777055
1431 1431 a, c, t dbSNP:141871181
1440 1440 a, g dbSNP:761449625
1446 1446 g, t dbSNP:767417261
1452 1452 c, t dbSNP:370565559
1455 1455 a, g dbSNP:776321608
1461 1461 c, t dbSNP:756385176
1469 1469 -, cattcaagaacctccacttca dbSNP:587777056
1498 1498 c, g dbSNP:567136805
1503 1503 c, t dbSNP:150641952
1504 1504 a, g dbSNP:587777057
1509 1509 c, g dbSNP:768258979
1527 1527 a, g dbSNP:778453425
1545 1545 c, t dbSNP:747707167
1551 1551 c, t dbSNP:139322464
1553 1553 c, t dbSNP:12721461
1557 1557 a, g dbSNP:189380751
1575 1575 c, t dbSNP:760476691
1578 1578 a, g dbSNP:770769352
1584 1584 c, t dbSNP:546569747
1586 1586 a, g dbSNP:759775512
1605 1605 c, t dbSNP:765429450
1611 1611 c, t dbSNP:752775959
1620 1620 a, g dbSNP:763053362
1624 1624 c, g dbSNP:746569229
1625 1625 a, g dbSNP:757172284
1626 1626 c, t dbSNP:781025484
1632 1632 c, g, t dbSNP:200466903
1633 1633 a, g dbSNP:775322429
1645 1645 c, t dbSNP:749507624
1667 1667 a, g dbSNP:143576848
1670 1670 a, g dbSNP:774390471
1673 1673 c, g dbSNP:754405574
1676 1676 c, t dbSNP:771308763
1685 1685 a, c, t dbSNP:761819608
1686 1686 a, g dbSNP:773592961
1690 1690 a, g dbSNP:202041900
1698 1698 g, t dbSNP:766832783
1700 1700 g, t dbSNP:546024324
1726 1726 a, g dbSNP:754298120
1731 1731 a, g dbSNP:758105660
1745 1745 c, t dbSNP:763864033
1746 1746 a, g dbSNP:116277860
1747 1747 c, g dbSNP:756726041
1750 1750 a, t dbSNP:781128298
1751 1751 c, t dbSNP:750314836
1760 1760 a, t dbSNP:756144448
1767 1767 a, c dbSNP:779793623
1769 1769 a, g dbSNP:749130075
1775 1775 g, t dbSNP:577181880
1777 1777 c, t dbSNP:770271324
1783 1783 a, g dbSNP:201386820
1787 1787 c, t dbSNP:775989534
1790 1790 c, t dbSNP:761341566
1797 1797 c, g, t dbSNP:376160640
1798 1798 a, g dbSNP:539641021
1809 1809 a, c dbSNP:760207948
1813 1813 g, t dbSNP:766236708
1821 1821 c, t dbSNP:375972567
1822 1822 a, g dbSNP:139959591
1824 1824 a, g dbSNP:200899254
1830 1830 a, g dbSNP:537154549
1832 1832 a, g, t dbSNP:758503575
1841 1841 c, t dbSNP:746997510
1844 1844 a, g dbSNP:757426946
1847 1847 a, g dbSNP:781482854
1848 1848 a, g dbSNP:1799917
1864 1864 a, g dbSNP:770465304
1872 1872 c, t dbSNP:373174923
1873 1873 g, t dbSNP:749685192
1875 1875 c, t dbSNP:771582466
1878 1878 a, g dbSNP:372064214
1879 1879 a, g dbSNP:191191827
1884 1884 c, g dbSNP:765859743
1895 1895 a, t dbSNP:776186191
1901 1901 c, t dbSNP:759435322
1906 1906 a, g dbSNP:765246895
1916 1916 c, t dbSNP:200947037
1917 1917 a, g, t dbSNP:374598514
1920 1920 c, t dbSNP:763880143
1927 1927 a, g dbSNP:757621484
1929 1929 c, t dbSNP:199868005
1930 1930 a, g dbSNP:201789251
1942 1942 c, t dbSNP:756529307
1943 1943 a, g dbSNP:780642028
1944 1944 a, g dbSNP:749547459
1949 1949 a, g dbSNP:769077831
1959 1959 c, t dbSNP:375072745
1968 1968 a, g dbSNP:201760326
1970 1970 c, t dbSNP:770606812
1971 1971 a, g dbSNP:776093178
1973 1973 c, g dbSNP:759081818
1979 1979 c, t dbSNP:201216065
1980 1980 a, g dbSNP:114642745
1981 1981 g, t dbSNP:377124402
1986 1986 c, t dbSNP:762860069
1988 1988 c, t dbSNP:763947169
1991 1991 -, cctgcctgg dbSNP:753868720
1994 1994 c, g dbSNP:751440448
2005 2005 c, t dbSNP:180806535
2006 2006 -, c dbSNP:778804983
2006 2006 a, g dbSNP:199960290
2007 2007 -, c dbSNP:757133827
2008 2008 a, c, t dbSNP:116441240
2011 2011 c, g dbSNP:756220426
2012 2012 a, c, g dbSNP:377000660
2013 2013 -, t dbSNP:750161348
2013 2013 c, t dbSNP:755501150
2015 2015 -, c dbSNP:755271722
2029 2029 c, t dbSNP:370576939
2113 2113 c, t dbSNP:530006484
2117 2117 a, c, t dbSNP:542099592
2120 2120 a, g dbSNP:563306458
2127 2127 a, g dbSNP:530391037
2137 2137 a, g dbSNP:552272248
2144 2144 c, t dbSNP:570434745
2152 2152 c, t dbSNP:755472833
2170 2170 c, t dbSNP:528698750
2197 2197 c, t dbSNP:546782368
2206 2206 a, c dbSNP:568463154
2233 2233 a, c dbSNP:115824598
2234 2234 a, g dbSNP:557329583
2256 2256 a, g dbSNP:113228612
2269 2269 c, t dbSNP:569247222
2302 2302 c, t dbSNP:574679469
2304 2304 a, g dbSNP:563749868
2305 2305 a, c dbSNP:529368287
2306 2306 a, g dbSNP:765988582
2331 2331 a, g dbSNP:542085042
2338 2338 c, t dbSNP:563483731
2354 2354 a, g dbSNP:778033213
2358 2358 c, g dbSNP:558259604
2369 2369 a, g dbSNP:749354317
2371 2371 g, t dbSNP:372465687
2372 2372 a, g dbSNP:770937940
2390 2390 c, t dbSNP:575842039
2405 2405 a, g dbSNP:145059173
2431 2431 c, g dbSNP:778967222
2458 2458 a, g dbSNP:745776537
2501 2501 c, t dbSNP:147641303
2502 2502 a, g dbSNP:574646315
2523 2523 g, t dbSNP:114410731
2575 2575 a, g dbSNP:140860027
2586 2586 c, t dbSNP:185971110
2599 2599 c, g dbSNP:545468174
2643 2643 a, g dbSNP:190304690
2651 2651 a, g dbSNP:771924040
2658 2658 a, c, g dbSNP:564248854
2660 2660 c, g dbSNP:2587892
2677 2677 a, g dbSNP:575565080
2694 2694 a, g dbSNP:760454722
2695 2695 c, t dbSNP:768411075
2711 2711 a, g dbSNP:2241953
2715 2715 a, g dbSNP:761564582
2721 2721 c, g dbSNP:564075566
2729 2729 c, t dbSNP:150167061
2730 2730 a, g dbSNP:529410542
2731 2731 a, c dbSNP:551276361
2736 2736 g, t dbSNP:772298932
2756 2756 a, g dbSNP:569427634
2772 2772 c, t dbSNP:764802170
2779 2779 c, t dbSNP:528110875
2790 2790 a, t dbSNP:539855610
2804 2804 a, g dbSNP:73543994
2874 2874 c, g dbSNP:749926763
2938 2938 a, g dbSNP:138571342
2964 2964 c, g dbSNP:546655630
2974 2974 a, g dbSNP:773528668
2982 2982 c, t dbSNP:760069605
2993 2993 c, g dbSNP:561494525
3027 3027 c, t dbSNP:530225146
3065 3065 a, c dbSNP:534298077
3071 3071 -, t dbSNP:143830815
3073 3073 -, c dbSNP:781526720
3078 3078 -, a dbSNP:769984305
3078 3078 a, c dbSNP:2241954
3082 3082 c, g dbSNP:148880261
3125 3125 a, g dbSNP:756525661
3145 3145 a, g dbSNP:535272504
3148 3148 c, t dbSNP:118130439
3149 3149 -, g dbSNP:563435312
3164 3164 g, t dbSNP:531198280
3169 3169 c, t dbSNP:575442344
3172 3172 g, t dbSNP:115409562
3176 3176 a, g dbSNP:563744303
3216 3216 a, g dbSNP:776468763
3246 3246 a, g dbSNP:572462659
3268 3268 a, g dbSNP:143281263
3300 3300 c, t dbSNP:778121186
3329 3329 c, t dbSNP:2241955
3370 3370 c, t dbSNP:765088909
3442 3442 c, t dbSNP:187522088
3443 3443 a, g dbSNP:550879300
3459 3459 a, g dbSNP:757499980
3512 3512 c, t dbSNP:563236483
3515 3515 a, g dbSNP:138890271
3517 3517 a, g dbSNP:752647867
3540 3540 a, c dbSNP:552003909
3544 3544 c, g dbSNP:772042740
3551 3551 cc, gccaaatgcctg dbSNP:386791062
3551 3551 c, g dbSNP:371020372
3551 3551 -, g dbSNP:531006134
3553 3553 -, caaatgcctg dbSNP:148530980
3554 3554 -, aaatgcctg dbSNP:763629773
3571 3571 a, g dbSNP:566889402
3596 3596 a, g dbSNP:114942894
3610 3610 a, g dbSNP:549527302
3661 3661 a, g dbSNP:567748330
3666 3666 c, t dbSNP:751074141
3690 3690 c, g dbSNP:746980962
3700 3700 c, t dbSNP:367929553
3704 3704 a, g dbSNP:556877875
3758 3758 c, t dbSNP:56839779
3799 3799 c, t dbSNP:141953991
3802 3802 a, g dbSNP:557594211
3822 3822 c, g dbSNP:190618249
3823 3823 c, t dbSNP:539817021
3838 3838 a, g dbSNP:113470958
3866 3866 c, t dbSNP:761511606
3869 3869 c, t dbSNP:553493863
3871 3871 a, g dbSNP:3790109
3889 3889 c, t dbSNP:772751643
3892 3892 c, t dbSNP:3790110
3897 3897 c, t dbSNP:7194820
3915 3915 a, g dbSNP:544835850
3933 3933 a, g dbSNP:562942208
3935 3935 g, t dbSNP:533535980
3956 3956 c, t dbSNP:146314635
3964 3964 a, g dbSNP:114469480
3976 3976 c, t dbSNP:557165203
4019 4019 c, t dbSNP:527721489
4022 4022 -, a dbSNP:34096806
4037 4037 c, t dbSNP:13337678
4051 4051 a, g dbSNP:184199853
4058 4058 c, t dbSNP:761172768
4089 4089 g, t dbSNP:537958668
4099 4099 c, t dbSNP:550209695
4132 4132 c, t dbSNP:188703822
4160 4160 g, t dbSNP:764400758
4166 4166 c, t dbSNP:534699528
4170 4170 c, t dbSNP:374404135
4171 4171 c, t dbSNP:367988411
4177 4177 c, t dbSNP:754222717
4179 4179 c, t dbSNP:192766225
4230 4230 a, g dbSNP:533582217
4234 4234 c, t dbSNP:757448509
4243 4243 c, t dbSNP:765417320
4244 4244 a, g dbSNP:750503280
4253 4253 c, t dbSNP:546408976
4254 4254 -, t dbSNP:71149664
4356 4356 g, t dbSNP:780188279
4365 4365 a, g dbSNP:573532606
4381 4381 c, g dbSNP:111620018
4396 4396 a, g dbSNP:543980493
4437 4437 c, t dbSNP:557797394
4438 4438 a, g dbSNP:138224601
4444 4444 c, t dbSNP:539892699
4485 4485 g, t dbSNP:3811362
4510 4510 a, g dbSNP:545603205
4514 4514 c, t dbSNP:560808527
4567 4567 g, t dbSNP:112340240
4570 4570 c, t dbSNP:543300178
4593 4593 a, g dbSNP:184448455
4595 4595 a, g dbSNP:78560610
4602 4602 a, g dbSNP:3811361
4615 4615 a, c dbSNP:571689456
4618 4618 a, g dbSNP:556878324
4624 4624 a, g dbSNP:117436667
4628 4628 c, g dbSNP:770278159
4670 4670 a, g dbSNP:3811360
4693 4693 a, c, g dbSNP:2550299
4776 4776 -, ac dbSNP:762850323
4797 4797 c, t dbSNP:533839078
4817 4817 a, g dbSNP:117968993
4826 4826 c, g dbSNP:2587861
4888 4888 a, g dbSNP:80350187
4985 4985 c, t dbSNP:762223887
5034 5034 a, c dbSNP:150698870
5136 5136 a, g dbSNP:577659699
5137 5137 g, t dbSNP:750545247
5166 5166 a, t dbSNP:545666622
5183 5183 a, g dbSNP:3790111
5187 5187 c, g dbSNP:114174929
5189 5189 a, c dbSNP:766323202
5296 5296 c, t dbSNP:751741303
5297 5297 g, t dbSNP:3790112
5298 5298 c, g dbSNP:561597026
5299 5299 a, g dbSNP:186550374
5326 5326 c, g dbSNP:747938580
5363 5363 c, t dbSNP:543782615
5364 5364 c, t dbSNP:565273923
5365 5365 a, g dbSNP:532466078
5375 5375 a, g dbSNP:547438380
5377 5377 c, t dbSNP:7206796
5378 5378 g, t dbSNP:149834734
5393 5393 c, t dbSNP:549035457
5412 5412 a, g dbSNP:7205545
5426 5426 c, t dbSNP:564015419
5437 5437 c, t dbSNP:537485644
5470 5470 c, g dbSNP:779389916
5480 5480 a, g dbSNP:564713892
5511 5511 -, t dbSNP:34052274
5580 5580 a, g dbSNP:549748454
5613 5613 c, g dbSNP:571112381
5645 5645 a, c, g, t dbSNP:111873654
5645 5645 -, t dbSNP:11297695
5713 5713 c, g dbSNP:758956661
5716 5716 a, g dbSNP:538749385
5717 5717 a, t dbSNP:553870949
5733 5733 a, g dbSNP:371175936
5743 5743 c, t dbSNP:536816768
5781 5781 c, t dbSNP:116075034
5799 5799 c, t dbSNP:11640263
5888 5888 g, t dbSNP:543498434
5899 5899 c, t dbSNP:565283055
5916 5916 c, t dbSNP:576785640
5918 5918 c, t dbSNP:368488621
5945 5945 a, g dbSNP:541142772
5987 5987 a, g dbSNP:191732220
5990 5990 a, g dbSNP:527518817
6002 6002 a, g dbSNP:370643981
6027 6027 a, g dbSNP:113140045
6082 6082 a, g dbSNP:113597396
6150 6150 c, t dbSNP:561076759
6186 6186 a, g dbSNP:776249057

Target ORF information:

RefSeq Version NM_138736
Organism Homo sapiens (human)
Definition Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu13586D
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 14-AUG-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(o) subunit alpha isoform a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA500625.1, AK056008.1, DA529437.1, BC030027.2 and AC009102.10. This sequence is a reference standard in the RefSeqGene project. On Dec 14, 2007 this sequence version replaced gi:10567815. Summary: The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]. Transcript Variant: This variant (1) represents the shorter transcript and encodes isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC030027.2, AK056008.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)787..789(+)
Misc Feature(2)937..1953(+)
Misc Feature(3)997..1941(+)
Misc Feature(4)1015..1875(+)
Misc Feature(5)1015..1038(+)
Misc Feature(6)1018..1545(+)
Misc Feature(7)1336..1338(+)
Misc Feature(8)1426..1452(+)
Misc Feature(9)1432..1434(+)
Misc Feature(10)1441..1443(+)
Misc Feature(11)1444..1548(+)
Misc Feature(12)1450..1548(+)
Misc Feature(13)1498..1509(+)
Misc Feature(14)1501..1551(+)
Misc Feature(15)1705..1716(+)
Misc Feature(16)1846..1896(+)
Misc Feature(17)1870..1878(+)
Misc Feature(18)1948..1950(+)
Exon (1)1..1015
Gene Synonym:
Exon (2)1016..1058
Gene Synonym:
Exon (3)1059..1200
Gene Synonym:
Exon (4)1201..1361
Gene Synonym:
Exon (5)1362..1490
Gene Synonym:
Exon (6)1491..1620
Gene Synonym:
Exon (7)1621..1774
Gene Synonym:
Exon (8)1775..1990
Gene Synonym:
Exon (9)1991..3332
Gene Synonym:
Position Chain Variation Link
36 36 a, g dbSNP:372326668
78 78 c, g dbSNP:538486483
113 113 a, t dbSNP:553956941
129 129 c, t dbSNP:572112539
135 135 c, t dbSNP:190973615
276 276 a, g dbSNP:368329897
313 313 c, g dbSNP:554398792
346 346 c, g dbSNP:575681535
387 387 c, t dbSNP:543007245
447 447 g, t dbSNP:564867328
504 504 c, t dbSNP:2443048
743 743 c, g dbSNP:372008796
798 798 c, t dbSNP:559910143
802 802 -, agcc dbSNP:144057495
806 806 -, agcc dbSNP:3833511
811 811 c, t dbSNP:530274427
852 852 a, g dbSNP:755224987
863 863 c, t dbSNP:765531417
866 866 a, g dbSNP:752677340
871 871 g, t dbSNP:376241293
874 874 a, g dbSNP:778082773
876 876 c, t dbSNP:747516640
890 890 a, g dbSNP:757827374
897 897 c, g dbSNP:369237309
924 924 a, g dbSNP:139334934
972 972 a, g dbSNP:182812404
1009 1009 c, t dbSNP:774085068
1014 1014 c, g dbSNP:747565910
1042 1042 a, t dbSNP:763223472
1083 1083 c, t dbSNP:200201305
1092 1092 c, t dbSNP:368113345
1093 1093 a, g dbSNP:557932562
1104 1104 a, c dbSNP:77558236
1110 1110 a, t dbSNP:778169910
1111 1111 a, g dbSNP:371330886
1149 1149 c, t dbSNP:756947463
1153 1153 c, t dbSNP:767115578
1164 1164 c, t dbSNP:201728736
1176 1176 c, t dbSNP:749909537
1183 1183 a, g dbSNP:559674838
1184 1184 a, c, g dbSNP:189990922
1185 1185 a, t dbSNP:199632176
1187 1187 a, t dbSNP:778669032
1206 1206 c, t dbSNP:372103298
1207 1207 a, g dbSNP:375429245
1216 1216 c, g dbSNP:777981381
1218 1218 g, t dbSNP:369490809
1230 1230 a, g dbSNP:61758988
1233 1233 c, t dbSNP:781109351
1245 1245 c, t dbSNP:745985192
1248 1248 c, t dbSNP:770385484
1266 1266 g, t dbSNP:776163992
1283 1283 c, t dbSNP:200539902
1285 1285 c, g, t dbSNP:539662922
1286 1286 a, g dbSNP:200127285
1290 1290 c, g dbSNP:766107260
1294 1294 a, g dbSNP:374115337
1296 1296 c, t dbSNP:556058539
1309 1309 c, g dbSNP:759081912
1311 1311 a, g dbSNP:141057479
1314 1314 a, g dbSNP:369305192
1322 1322 a, g dbSNP:758424351
1325 1325 a, g dbSNP:777414554
1329 1329 c, t dbSNP:751417087
1330 1330 c, t dbSNP:757388426
1347 1347 c, t dbSNP:185369495
1371 1371 c, t dbSNP:144771965
1374 1374 c, t dbSNP:200158326
1377 1377 a, g dbSNP:373209490
1385 1385 c, t dbSNP:760544764
1389 1389 c, g dbSNP:773630438
1392 1392 c, t dbSNP:745503611
1393 1393 a, g dbSNP:375960435
1395 1395 c, g, t dbSNP:774947928
1404 1404 c, g dbSNP:762554588
1409 1409 a, c dbSNP:763888697
1410 1410 c, t dbSNP:1065375
1418 1418 a, g dbSNP:587777055
1431 1431 a, c, t dbSNP:141871181
1440 1440 a, g dbSNP:761449625
1446 1446 g, t dbSNP:767417261
1452 1452 c, t dbSNP:370565559
1455 1455 a, g dbSNP:776321608
1461 1461 c, t dbSNP:756385176
1469 1469 -, cattcaagaacctccacttca dbSNP:587777056
1498 1498 c, g dbSNP:567136805
1503 1503 c, t dbSNP:150641952
1504 1504 a, g dbSNP:587777057
1509 1509 c, g dbSNP:768258979
1527 1527 a, g dbSNP:778453425
1545 1545 c, t dbSNP:747707167
1551 1551 c, t dbSNP:139322464
1553 1553 c, t dbSNP:12721461
1557 1557 a, g dbSNP:189380751
1575 1575 c, t dbSNP:760476691
1578 1578 a, g dbSNP:770769352
1584 1584 c, t dbSNP:546569747
1586 1586 a, g dbSNP:759775512
1605 1605 c, t dbSNP:765429450
1611 1611 c, t dbSNP:752775959
1620 1620 a, g dbSNP:763053362
1631 1631 a, g dbSNP:760862770
1632 1632 c, t dbSNP:201930720
1641 1641 c, t dbSNP:377336410
1650 1650 c, t dbSNP:755484788
1665 1665 c, t dbSNP:779411534
1680 1680 c, t dbSNP:752997228
1687 1687 c, t dbSNP:112085622
1710 1710 a, g dbSNP:758779535
1722 1722 c, t dbSNP:778172059
1725 1725 c, t dbSNP:199741926
1731 1731 a, g dbSNP:769373113
1733 1733 a, t dbSNP:587777054
1744 1744 c, t dbSNP:779593919
1747 1747 c, t dbSNP:748772075
1762 1762 c, g dbSNP:768674142
1767 1767 a, g dbSNP:145546431
1781 1781 a, g dbSNP:371362351
1784 1784 c, t dbSNP:754547263
1794 1794 c, t dbSNP:148878451
1795 1795 a, g dbSNP:748093621
1800 1800 c, t dbSNP:543764725
1806 1806 c, t dbSNP:773032912
1818 1818 a, g dbSNP:148650019
1821 1821 g, t dbSNP:57295392
1826 1826 a, g dbSNP:771141469
1833 1833 c, t dbSNP:200323041
1884 1884 a, g dbSNP:201638233
1890 1890 c, t dbSNP:116862304
1896 1896 a, g dbSNP:775590327
1905 1905 c, t dbSNP:763429802
1908 1908 c, t dbSNP:375683292
1911 1911 c, t dbSNP:369818930
1914 1914 a, c dbSNP:142102704
1917 1917 c, t dbSNP:765996386
1934 1934 a, t dbSNP:372737966
1965 1965 c, t dbSNP:529756606
1971 1971 c, t dbSNP:753419422
1974 1974 c, g dbSNP:754743560
1975 1975 c, t dbSNP:778531600
1979 1979 a, g dbSNP:747705178
1986 1986 a, g dbSNP:758359442
2022 2022 c, g dbSNP:528654073
2024 2024 c, t dbSNP:763484102
2058 2058 a, g dbSNP:766862113
2099 2099 c, t dbSNP:767846065
2107 2107 c, t dbSNP:751936615
2135 2135 c, t dbSNP:755236839
2139 2139 c, g dbSNP:781537293
2172 2172 a, g dbSNP:750943519
2224 2224 a, g, t dbSNP:546321092
2245 2245 c, t dbSNP:562393182
2253 2253 c, g dbSNP:752872784
2288 2288 a, g dbSNP:780971803
2296 2296 c, t dbSNP:74369951
2300 2300 c, t dbSNP:3753079
2308 2308 c, t dbSNP:749413510
2313 2313 -, g dbSNP:766414470
2337 2337 c, g dbSNP:186226205
2385 2385 g, t dbSNP:533474964
2405 2405 c, t dbSNP:551865805
2434 2434 c, t dbSNP:570576814
2438 2438 c, t dbSNP:149176287
2452 2452 a, g dbSNP:534794873
2486 2486 c, t dbSNP:553031877
2521 2521 a, c dbSNP:568339357
2556 2556 c, t dbSNP:778775755
2572 2572 c, t dbSNP:535318250
2577 2577 a, g dbSNP:556546399
2607 2607 a, g dbSNP:574858035
2618 2618 a, g dbSNP:189853188
2620 2620 c, t dbSNP:368463004
2628 2628 c, t dbSNP:35769162
2655 2655 -, g dbSNP:201938013
2662 2662 -, tt dbSNP:146952822
2662 2662 -, t dbSNP:34175199
2663 2663 -, t dbSNP:778416121
2678 2678 g, t dbSNP:200722801
2725 2725 c, g dbSNP:142356777
2727 2727 c, t dbSNP:775458658
2731 2731 c, t dbSNP:540814826
2785 2785 a, g dbSNP:562294425
2787 2787 c, t dbSNP:746636668
2803 2803 c, t dbSNP:529618659
2815 2815 a, c dbSNP:776274876
2914 2914 -, a dbSNP:753966750
2924 2924 a, t dbSNP:544879456
2929 2929 a, t dbSNP:562888214
2944 2944 a, g dbSNP:533335999
2945 2945 -, a dbSNP:34097380
2955 2955 a, c dbSNP:201058242
3065 3065 c, t dbSNP:761286240
3147 3147 -, cacac dbSNP:147582511
3152 3152 a, g dbSNP:764813379
3158 3158 a, t dbSNP:551933606
3159 3159 -, a dbSNP:540514958
3160 3160 -, a dbSNP:560673887
3160 3160 a, t dbSNP:2617843
3174 3174 a, t dbSNP:112744510
3193 3193 -, a dbSNP:556879234
3200 3200 a, g dbSNP:76497332
3207 3207 a, g dbSNP:151236628
3251 3251 g, t dbSNP:182130070
3252 3252 a, g dbSNP:141557885
3280 3280 -, ctga dbSNP:564060696
3282 3282 -, gact dbSNP:372214441
3283 3283 a, g dbSNP:372454938
3318 3318 a, g dbSNP:34498910

Target ORF information:

RefSeq Version NM_020988
Organism Homo sapiens (human)
Definition Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu58003D
Sequence Information ORF Nucleotide Sequence (Length: 939bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(o) subunit alpha isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010498.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)414..1298(+)
Misc Feature(2)414..1283(+)
Misc Feature(3)465..902(+)
Misc Feature(4)783..809(+)
Misc Feature(5)798..1232(+)
Misc Feature(6)798..800(+)
Misc Feature(7)801..905(+)
Misc Feature(8)807..905(+)
Misc Feature(9)855..866(+)
Misc Feature(10)858..908(+)
Misc Feature(11)1062..1073(+)
Misc Feature(12)1203..1253(+)
Misc Feature(13)1227..1235(+)
Position Chain Variation Link
27 27 a, t dbSNP:763223472
104 104 a, g dbSNP:763690103
111 111 a, g dbSNP:556048824
117 117 a, g dbSNP:776256338
119 119 a, t dbSNP:574208072
133 133 c, g dbSNP:761356133
141 141 c, t dbSNP:764869291
156 156 c, g dbSNP:187549889
157 157 a, g dbSNP:191975535
174 174 a, g dbSNP:760023414
185 185 a, g dbSNP:533513954
190 190 a, g dbSNP:545497233
231 231 c, g dbSNP:767923321
244 244 c, g dbSNP:367730645
250 250 a, g dbSNP:564306896
258 258 a, g dbSNP:753043389
289 289 a, g dbSNP:528302585
322 322 c, t dbSNP:546450335
353 353 c, t dbSNP:777924356
359 359 a, g dbSNP:779849987
440 440 c, t dbSNP:200201305
449 449 c, t dbSNP:368113345
450 450 a, g dbSNP:557932562
461 461 a, c dbSNP:77558236
467 467 a, t dbSNP:778169910
468 468 a, g dbSNP:371330886
506 506 c, t dbSNP:756947463
510 510 c, t dbSNP:767115578
521 521 c, t dbSNP:201728736
533 533 c, t dbSNP:749909537
540 540 a, g dbSNP:559674838
541 541 a, c, g dbSNP:189990922
542 542 a, t dbSNP:199632176
544 544 a, t dbSNP:778669032
563 563 c, t dbSNP:372103298
564 564 a, g dbSNP:375429245
573 573 c, g dbSNP:777981381
575 575 g, t dbSNP:369490809
587 587 a, g dbSNP:61758988
590 590 c, t dbSNP:781109351
602 602 c, t dbSNP:745985192
605 605 c, t dbSNP:770385484
623 623 g, t dbSNP:776163992
640 640 c, t dbSNP:200539902
642 642 c, g, t dbSNP:539662922
643 643 a, g dbSNP:200127285
647 647 c, g dbSNP:766107260
651 651 a, g dbSNP:374115337
653 653 c, t dbSNP:556058539
666 666 c, g dbSNP:759081912
668 668 a, g dbSNP:141057479
671 671 a, g dbSNP:369305192
679 679 a, g dbSNP:758424351
682 682 a, g dbSNP:777414554
686 686 c, t dbSNP:751417087
687 687 c, t dbSNP:757388426
704 704 c, t dbSNP:185369495
728 728 c, t dbSNP:144771965
731 731 c, t dbSNP:200158326
734 734 a, g dbSNP:373209490
742 742 c, t dbSNP:760544764
746 746 c, g dbSNP:773630438
749 749 c, t dbSNP:745503611
750 750 a, g dbSNP:375960435
752 752 c, g, t dbSNP:774947928
761 761 c, g dbSNP:762554588
766 766 a, c dbSNP:763888697
767 767 c, t dbSNP:1065375
775 775 a, g dbSNP:587777055
788 788 a, c, t dbSNP:141871181
797 797 a, g dbSNP:761449625
803 803 g, t dbSNP:767417261
809 809 c, t dbSNP:370565559
812 812 a, g dbSNP:776321608
818 818 c, t dbSNP:756385176
826 826 -, cattcaagaacctccacttca dbSNP:587777056
855 855 c, g dbSNP:567136805
860 860 c, t dbSNP:150641952
861 861 a, g dbSNP:587777057
866 866 c, g dbSNP:768258979
884 884 a, g dbSNP:778453425
902 902 c, t dbSNP:747707167
908 908 c, t dbSNP:139322464
910 910 c, t dbSNP:12721461
914 914 a, g dbSNP:189380751
932 932 c, t dbSNP:760476691
935 935 a, g dbSNP:770769352
941 941 c, t dbSNP:546569747
943 943 a, g dbSNP:759775512
962 962 c, t dbSNP:765429450
968 968 c, t dbSNP:752775959
977 977 a, g dbSNP:763053362
988 988 a, g dbSNP:760862770
989 989 c, t dbSNP:201930720
998 998 c, t dbSNP:377336410
1007 1007 c, t dbSNP:755484788
1022 1022 c, t dbSNP:779411534
1037 1037 c, t dbSNP:752997228
1044 1044 c, t dbSNP:112085622
1067 1067 a, g dbSNP:758779535
1079 1079 c, t dbSNP:778172059
1082 1082 c, t dbSNP:199741926
1088 1088 a, g dbSNP:769373113
1090 1090 a, t dbSNP:587777054
1101 1101 c, t dbSNP:779593919
1104 1104 c, t dbSNP:748772075
1119 1119 c, g dbSNP:768674142
1124 1124 a, g dbSNP:145546431
1138 1138 a, g dbSNP:371362351
1141 1141 c, t dbSNP:754547263
1151 1151 c, t dbSNP:148878451
1152 1152 a, g dbSNP:748093621
1157 1157 c, t dbSNP:543764725
1163 1163 c, t dbSNP:773032912
1175 1175 a, g dbSNP:148650019
1178 1178 g, t dbSNP:57295392
1183 1183 a, g dbSNP:771141469
1190 1190 c, t dbSNP:200323041
1241 1241 a, g dbSNP:201638233
1247 1247 c, t dbSNP:116862304
1253 1253 a, g dbSNP:775590327
1262 1262 c, t dbSNP:763429802
1265 1265 c, t dbSNP:375683292
1268 1268 c, t dbSNP:369818930
1271 1271 a, c dbSNP:142102704
1274 1274 c, t dbSNP:765996386
1291 1291 a, t dbSNP:372737966
1322 1322 c, t dbSNP:529756606
1328 1328 c, t dbSNP:753419422
1331 1331 c, g dbSNP:754743560
1332 1332 c, t dbSNP:778531600
1336 1336 a, g dbSNP:747705178
1343 1343 a, g dbSNP:758359442
1379 1379 c, g dbSNP:528654073
1381 1381 c, t dbSNP:763484102
1415 1415 a, g dbSNP:766862113
1456 1456 c, t dbSNP:767846065
1464 1464 c, t dbSNP:751936615
1492 1492 c, t dbSNP:755236839
1496 1496 c, g dbSNP:781537293
1529 1529 a, g dbSNP:750943519
1581 1581 a, g, t dbSNP:546321092
1602 1602 c, t dbSNP:562393182
1610 1610 c, g dbSNP:752872784
1645 1645 a, g dbSNP:780971803
1653 1653 c, t dbSNP:74369951
1657 1657 c, t dbSNP:3753079
1665 1665 c, t dbSNP:749413510
1670 1670 -, g dbSNP:766414470
1694 1694 c, g dbSNP:186226205
1742 1742 g, t dbSNP:533474964
1762 1762 c, t dbSNP:551865805
1791 1791 c, t dbSNP:570576814
1795 1795 c, t dbSNP:149176287
1809 1809 a, g dbSNP:534794873
1843 1843 c, t dbSNP:553031877
1878 1878 a, c dbSNP:568339357
1913 1913 c, t dbSNP:778775755
1929 1929 c, t dbSNP:535318250
1934 1934 a, g dbSNP:556546399
1964 1964 a, g dbSNP:574858035
1975 1975 a, g dbSNP:189853188
1977 1977 c, t dbSNP:368463004
1985 1985 c, t dbSNP:35769162
2012 2012 -, g dbSNP:201938013
2019 2019 -, tt dbSNP:146952822
2019 2019 -, t dbSNP:34175199
2020 2020 -, t dbSNP:778416121
2035 2035 g, t dbSNP:200722801
2082 2082 c, g dbSNP:142356777
2084 2084 c, t dbSNP:775458658
2088 2088 c, t dbSNP:540814826
2142 2142 a, g dbSNP:562294425
2144 2144 c, t dbSNP:746636668
2160 2160 c, t dbSNP:529618659
2172 2172 a, c dbSNP:776274876
2271 2271 -, a dbSNP:753966750
2281 2281 a, t dbSNP:544879456
2286 2286 a, t dbSNP:562888214
2301 2301 a, g dbSNP:533335999
2302 2302 -, a dbSNP:34097380
2312 2312 a, c dbSNP:201058242
2422 2422 c, t dbSNP:761286240
2504 2504 -, cacac dbSNP:147582511
2509 2509 a, g dbSNP:764813379
2515 2515 a, t dbSNP:551933606
2516 2516 -, a dbSNP:540514958
2517 2517 -, a dbSNP:560673887
2517 2517 a, t dbSNP:2617843
2531 2531 a, t dbSNP:112744510
2550 2550 -, a dbSNP:556879234
2557 2557 a, g dbSNP:76497332
2564 2564 a, g dbSNP:151236628
2608 2608 g, t dbSNP:182130070
2609 2609 a, g dbSNP:141557885
2637 2637 -, ctga dbSNP:564060696
2639 2639 -, gact dbSNP:372214441
2640 2640 a, g dbSNP:372454938
2675 2675 a, g dbSNP:34498910

Target ORF information:

RefSeq Version XM_011523003
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.