Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

GNAT2 guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 [Homo sapiens (human)]

Gene Symbol GNAT2
Entrez Gene ID 2780
Full Name guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Synonyms ACHM4, GNATC
General protein information
Preferred Names
guanine nucleotide-binding protein G(t) subunit alpha-2
guanine nucleotide-binding protein G(t) subunit alpha-2
transducin alpha-2 chain
cone-type transducin alpha subunit
transducin, cone-specific, alpha polypeptide
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Achromatopsia-4 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu19578 XM_011541264 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu19578 XM_011541265 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu58007 XM_011541266 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu19578 NM_005272 Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu19578D
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)255..1274(+)
Misc Feature(2)318..1262(+)
Misc Feature(3)336..1196(+)
Misc Feature(4)336..359(+)
Misc Feature(5)339..863(+)
Misc Feature(6)744..770(+)
Misc Feature(7)759..761(+)
Misc Feature(8)762..866(+)
Misc Feature(9)768..866(+)
Misc Feature(10)816..827(+)
Misc Feature(11)819..869(+)
Misc Feature(12)1023..1034(+)
Misc Feature(13)1167..1217(+)
Misc Feature(14)1191..1199(+)
Position Chain Variation Link
80 80 a, g dbSNP:56079255
134 134 c, t dbSNP:546594222
141 141 a, g dbSNP:529621776
162 162 a, g dbSNP:768308560
166 166 -, g dbSNP:34046712
175 175 c, t dbSNP:746796374
176 176 a, g, t dbSNP:373698555
178 178 a, g dbSNP:748227612
181 181 -, ag dbSNP:564936072
187 187 a, g dbSNP:2304355
198 198 a, g dbSNP:755513575
203 203 g, t dbSNP:562449373
204 204 c, g dbSNP:780590839
211 211 c, t dbSNP:756496666
212 212 a, g dbSNP:750796967
221 221 a, g dbSNP:763845288
222 222 c, g dbSNP:762637247
223 223 -, g dbSNP:765367881
226 226 c, g dbSNP:752278435
232 232 c, t dbSNP:199503029
233 233 c, g dbSNP:372507125
249 249 g, t dbSNP:759055694
256 256 c, g dbSNP:776479555
266 266 c, g dbSNP:770886199
269 269 g, t dbSNP:760450896
270 270 a, g dbSNP:772922679
280 280 a, g dbSNP:772291136
295 295 a, g dbSNP:748317500
329 329 a, g dbSNP:779079945
336 336 a, g, t dbSNP:749377354
338 338 c, t dbSNP:767343349
350 350 a, g dbSNP:761577743
356 356 a, g dbSNP:752831057
357 357 a, g dbSNP:146606352
360 360 a, g dbSNP:200725841
363 363 a, g dbSNP:201659866
365 365 c, t dbSNP:146945932
366 366 a, g dbSNP:749334089
372 372 c, t dbSNP:775584517
375 375 a, g dbSNP:770225385
396 396 a, g dbSNP:372515497
420 420 c, g dbSNP:369218401
431 431 g, t dbSNP:577261001
439 439 a, g dbSNP:745918238
453 453 c, t dbSNP:121434585
461 461 c, g, t dbSNP:200316722
464 464 a, g dbSNP:192176115
468 468 a, g dbSNP:747378581
470 470 a, c dbSNP:371604259
472 472 g, t dbSNP:754606257
473 473 c, t dbSNP:576810119
474 474 c, t dbSNP:748928144
475 475 a, c, g dbSNP:140250745
489 489 c, t dbSNP:749934608
498 498 a, g dbSNP:201588334
499 499 a, c dbSNP:757130132
502 502 a, g dbSNP:751377702
511 511 c, g dbSNP:763912191
513 513 a, c dbSNP:762626564
517 517 a, g dbSNP:753011209
520 520 a, c, t dbSNP:146695290
521 521 a, c, g dbSNP:183147259
527 527 c, t dbSNP:752430152
528 528 a, g dbSNP:145002495
532 532 a, g dbSNP:759770362
534 534 c, g dbSNP:753984783
537 537 a, c dbSNP:3738766
541 541 a, g dbSNP:760803840
545 545 c, t dbSNP:773830399
548 548 g, t dbSNP:772456624
551 551 c, t dbSNP:762247888
559 559 c, t dbSNP:775374577
560 560 c, t dbSNP:142976178
567 567 a, g dbSNP:147269835
571 571 c, t dbSNP:780793773
586 586 -, t dbSNP:767424501
587 587 c, t dbSNP:12046787
588 588 a, g dbSNP:41280330
593 593 a, g dbSNP:777831176
602 602 c, g dbSNP:758202508
604 604 g, t dbSNP:752549211
605 605 g, t dbSNP:778799065
614 614 a, g dbSNP:755278059
615 615 g, t dbSNP:754150816
622 622 a, g dbSNP:766682709
630 630 a, g dbSNP:756332145
638 638 c, t dbSNP:536959939
639 639 a, g dbSNP:768086755
645 645 a, g dbSNP:149421007
652 652 a, t dbSNP:774809648
657 657 c, t dbSNP:764484604
668 668 c, t dbSNP:763283639
672 672 a, g dbSNP:776322769
681 681 c, t dbSNP:766033906
683 683 c, t dbSNP:760195431
687 687 a, c dbSNP:772147864
699 699 c, t dbSNP:745308973
713 713 c, t dbSNP:771518962
716 716 g, t dbSNP:747669348
718 718 a, t dbSNP:774485451
721 721 -, acct dbSNP:759522552
728 728 g, t dbSNP:768651686
743 743 c, g dbSNP:749110943
744 744 c, t dbSNP:779949808
745 745 a, g dbSNP:374210835
752 752 -, ag dbSNP:774099409
763 763 c, t dbSNP:746117122
764 764 a, g dbSNP:1799875
766 766 a, g dbSNP:1799940
768 768 a, g dbSNP:201798524
769 769 a, t dbSNP:751633351
772 772 c, t dbSNP:370869387
783 783 c, t dbSNP:758844656
784 784 a, t dbSNP:753083112
788 788 c, t dbSNP:376412882
789 789 a, g dbSNP:759910267
798 798 c, t dbSNP:750089687
827 827 g, t dbSNP:551776784
832 832 a, g dbSNP:777936715
836 836 c, t dbSNP:140231308
837 837 a, c, g dbSNP:267597907
845 845 a, g dbSNP:779352893
848 848 a, g dbSNP:755458273
863 863 c, t dbSNP:534677249
866 866 a, g dbSNP:780429600
890 890 c, t dbSNP:201230566
913 913 c, t dbSNP:751307255
916 916 c, t dbSNP:763825174
919 919 c, t dbSNP:758050645
926 926 a, g dbSNP:752187366
929 929 c, t dbSNP:765099163
932 932 c, t dbSNP:367863835
933 933 a, g dbSNP:140788789
941 941 c, t dbSNP:764762846
942 942 c, t dbSNP:754414120
943 943 a, g dbSNP:142609327
946 946 c, t dbSNP:535592857
947 947 a, g dbSNP:760527034
951 951 a, g dbSNP:147849105
975 975 a, g dbSNP:767751902
979 979 a, g dbSNP:762058433
988 988 a, c dbSNP:774408503
996 996 a, g dbSNP:768833008
997 997 c, t dbSNP:762929495
998 998 a, g dbSNP:776207301
1003 1003 a, c dbSNP:770359260
1014 1014 c, g dbSNP:746250209
1025 1025 a, c dbSNP:781647200
1028 1028 c, g dbSNP:191211731
1033 1033 a, t dbSNP:771880106
1036 1036 a, c, t dbSNP:368906691
1039 1039 -, tt dbSNP:769421063
1043 1043 a, g dbSNP:754570281
1056 1056 a, g dbSNP:753280339
1063 1063 a, c dbSNP:779967692
1082 1082 a, g dbSNP:374829286
1085 1085 c, g dbSNP:750251941
1088 1088 c, t dbSNP:373436662
1089 1089 a, g dbSNP:767343299
1093 1093 a, g dbSNP:200224608
1095 1095 a, g dbSNP:750410966
1099 1099 a, t dbSNP:781094332
1104 1104 c, t dbSNP:757147586
1106 1106 c, t dbSNP:751249807
1110 1110 a, g dbSNP:764393652
1111 1111 -, atg dbSNP:757394970
1112 1112 c, t dbSNP:763038753
1114 1114 c, t dbSNP:200056419
1115 1115 a, c, g dbSNP:765445143
1117 1117 a, g dbSNP:759662860
1132 1132 a, g dbSNP:777330856
1139 1139 c, t dbSNP:766791706
1141 1141 c, t dbSNP:775417913
1146 1146 c, t dbSNP:200883344
1149 1149 a, g dbSNP:200137591
1151 1151 c, t dbSNP:34723289
1155 1155 c, t dbSNP:748981899
1156 1156 a, g dbSNP:368195234
1166 1166 c, t dbSNP:769353273
1179 1179 a, g dbSNP:745377564
1182 1182 a, c dbSNP:781198345
1184 1184 c, g dbSNP:139314029
1203 1203 -, ta dbSNP:563918391
1211 1211 c, t dbSNP:757088776
1213 1213 c, t dbSNP:746845652
1227 1227 g, t dbSNP:777393742
1243 1243 c, t dbSNP:758178456
1249 1249 c, t dbSNP:753014058
1271 1271 c, t dbSNP:765538494
1275 1275 c, t dbSNP:61754627
1290 1290 c, t dbSNP:753902314
1295 1295 c, g dbSNP:766921289
1300 1300 a, g dbSNP:761036874
1303 1303 a, g dbSNP:773740367
1304 1304 c, t dbSNP:767822919
1307 1307 a, g dbSNP:762152575
1310 1310 c, t dbSNP:775190991
1312 1312 a, g dbSNP:769373925
1317 1317 c, g dbSNP:374343837
1320 1320 -, g dbSNP:753947940
1324 1324 a, g dbSNP:775957364
1326 1326 a, g dbSNP:770934894
1329 1329 c, g dbSNP:746956908
1333 1333 c, g dbSNP:116688317
1351 1351 g, t dbSNP:755911126
1372 1372 a, g dbSNP:746251125
1385 1385 a, c dbSNP:572222112
1431 1431 c, t dbSNP:181423531
1472 1472 a, c dbSNP:3022
1473 1473 -, caggccagtagttagaagaccccc dbSNP:373091236
1476 1476 -, tt dbSNP:201011005
1477 1477 -, ccagtagttagaagaccccccagg dbSNP:146671905
1477 1477 c, t dbSNP:200338867
1478 1478 c, t dbSNP:202173106
1500 1500 -, ccagtagttagaagaccccccagg dbSNP:752056016
1563 1563 c, t dbSNP:541898126
1604 1604 c, t dbSNP:779414524
1628 1628 c, g dbSNP:485334
1635 1635 c, g dbSNP:531273973
1640 1640 a, g dbSNP:556511183
1662 1662 c, t dbSNP:539754438
1672 1672 a, g dbSNP:188520894
1674 1674 a, g dbSNP:373017335
1695 1695 c, t dbSNP:554095473
1727 1727 c, t dbSNP:534356392

Target ORF information:

RefSeq Version XM_011541264
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu19578D
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)178..1197(+)
Misc Feature(2)241..1185(+)
Misc Feature(3)259..1119(+)
Misc Feature(4)259..282(+)
Misc Feature(5)262..786(+)
Misc Feature(6)667..693(+)
Misc Feature(7)682..684(+)
Misc Feature(8)685..789(+)
Misc Feature(9)691..789(+)
Misc Feature(10)739..750(+)
Misc Feature(11)742..792(+)
Misc Feature(12)946..957(+)
Misc Feature(13)1090..1140(+)
Misc Feature(14)1114..1122(+)
Position Chain Variation Link
89 89 -, g dbSNP:34046712
98 98 c, t dbSNP:746796374
99 99 a, g, t dbSNP:373698555
101 101 a, g dbSNP:748227612
104 104 -, ag dbSNP:564936072
110 110 a, g dbSNP:2304355
121 121 a, g dbSNP:755513575
126 126 g, t dbSNP:562449373
127 127 c, g dbSNP:780590839
134 134 c, t dbSNP:756496666
135 135 a, g dbSNP:750796967
144 144 a, g dbSNP:763845288
145 145 c, g dbSNP:762637247
146 146 -, g dbSNP:765367881
149 149 c, g dbSNP:752278435
155 155 c, t dbSNP:199503029
156 156 c, g dbSNP:372507125
172 172 g, t dbSNP:759055694
179 179 c, g dbSNP:776479555
189 189 c, g dbSNP:770886199
192 192 g, t dbSNP:760450896
193 193 a, g dbSNP:772922679
203 203 a, g dbSNP:772291136
218 218 a, g dbSNP:748317500
252 252 a, g dbSNP:779079945
259 259 a, g, t dbSNP:749377354
261 261 c, t dbSNP:767343349
273 273 a, g dbSNP:761577743
279 279 a, g dbSNP:752831057
280 280 a, g dbSNP:146606352
283 283 a, g dbSNP:200725841
286 286 a, g dbSNP:201659866
288 288 c, t dbSNP:146945932
289 289 a, g dbSNP:749334089
295 295 c, t dbSNP:775584517
298 298 a, g dbSNP:770225385
319 319 a, g dbSNP:372515497
343 343 c, g dbSNP:369218401
354 354 g, t dbSNP:577261001
362 362 a, g dbSNP:745918238
376 376 c, t dbSNP:121434585
384 384 c, g, t dbSNP:200316722
387 387 a, g dbSNP:192176115
391 391 a, g dbSNP:747378581
393 393 a, c dbSNP:371604259
395 395 g, t dbSNP:754606257
396 396 c, t dbSNP:576810119
397 397 c, t dbSNP:748928144
398 398 a, c, g dbSNP:140250745
412 412 c, t dbSNP:749934608
421 421 a, g dbSNP:201588334
422 422 a, c dbSNP:757130132
425 425 a, g dbSNP:751377702
434 434 c, g dbSNP:763912191
436 436 a, c dbSNP:762626564
440 440 a, g dbSNP:753011209
443 443 a, c, t dbSNP:146695290
444 444 a, c, g dbSNP:183147259
450 450 c, t dbSNP:752430152
451 451 a, g dbSNP:145002495
455 455 a, g dbSNP:759770362
457 457 c, g dbSNP:753984783
460 460 a, c dbSNP:3738766
464 464 a, g dbSNP:760803840
468 468 c, t dbSNP:773830399
471 471 g, t dbSNP:772456624
474 474 c, t dbSNP:762247888
482 482 c, t dbSNP:775374577
483 483 c, t dbSNP:142976178
490 490 a, g dbSNP:147269835
494 494 c, t dbSNP:780793773
509 509 -, t dbSNP:767424501
510 510 c, t dbSNP:12046787
511 511 a, g dbSNP:41280330
516 516 a, g dbSNP:777831176
525 525 c, g dbSNP:758202508
527 527 g, t dbSNP:752549211
528 528 g, t dbSNP:778799065
537 537 a, g dbSNP:755278059
538 538 g, t dbSNP:754150816
545 545 a, g dbSNP:766682709
553 553 a, g dbSNP:756332145
561 561 c, t dbSNP:536959939
562 562 a, g dbSNP:768086755
568 568 a, g dbSNP:149421007
575 575 a, t dbSNP:774809648
580 580 c, t dbSNP:764484604
591 591 c, t dbSNP:763283639
595 595 a, g dbSNP:776322769
604 604 c, t dbSNP:766033906
606 606 c, t dbSNP:760195431
610 610 a, c dbSNP:772147864
622 622 c, t dbSNP:745308973
636 636 c, t dbSNP:771518962
639 639 g, t dbSNP:747669348
641 641 a, t dbSNP:774485451
644 644 -, acct dbSNP:759522552
651 651 g, t dbSNP:768651686
666 666 c, g dbSNP:749110943
667 667 c, t dbSNP:779949808
668 668 a, g dbSNP:374210835
675 675 -, ag dbSNP:774099409
686 686 c, t dbSNP:746117122
687 687 a, g dbSNP:1799875
689 689 a, g dbSNP:1799940
691 691 a, g dbSNP:201798524
692 692 a, t dbSNP:751633351
695 695 c, t dbSNP:370869387
706 706 c, t dbSNP:758844656
707 707 a, t dbSNP:753083112
711 711 c, t dbSNP:376412882
712 712 a, g dbSNP:759910267
721 721 c, t dbSNP:750089687
750 750 g, t dbSNP:551776784
755 755 a, g dbSNP:777936715
759 759 c, t dbSNP:140231308
760 760 a, c, g dbSNP:267597907
768 768 a, g dbSNP:779352893
771 771 a, g dbSNP:755458273
786 786 c, t dbSNP:534677249
789 789 a, g dbSNP:780429600
813 813 c, t dbSNP:201230566
836 836 c, t dbSNP:751307255
839 839 c, t dbSNP:763825174
842 842 c, t dbSNP:758050645
849 849 a, g dbSNP:752187366
852 852 c, t dbSNP:765099163
855 855 c, t dbSNP:367863835
856 856 a, g dbSNP:140788789
864 864 c, t dbSNP:764762846
865 865 c, t dbSNP:754414120
866 866 a, g dbSNP:142609327
869 869 c, t dbSNP:535592857
870 870 a, g dbSNP:760527034
874 874 a, g dbSNP:147849105
898 898 a, g dbSNP:767751902
902 902 a, g dbSNP:762058433
911 911 a, c dbSNP:774408503
919 919 a, g dbSNP:768833008
920 920 c, t dbSNP:762929495
921 921 a, g dbSNP:776207301
926 926 a, c dbSNP:770359260
937 937 c, g dbSNP:746250209
948 948 a, c dbSNP:781647200
951 951 c, g dbSNP:191211731
956 956 a, t dbSNP:771880106
959 959 a, c, t dbSNP:368906691
962 962 -, tt dbSNP:769421063
966 966 a, g dbSNP:754570281
979 979 a, g dbSNP:753280339
986 986 a, c dbSNP:779967692
1005 1005 a, g dbSNP:374829286
1008 1008 c, g dbSNP:750251941
1011 1011 c, t dbSNP:373436662
1012 1012 a, g dbSNP:767343299
1016 1016 a, g dbSNP:200224608
1018 1018 a, g dbSNP:750410966
1022 1022 a, t dbSNP:781094332
1027 1027 c, t dbSNP:757147586
1029 1029 c, t dbSNP:751249807
1033 1033 a, g dbSNP:764393652
1034 1034 -, atg dbSNP:757394970
1035 1035 c, t dbSNP:763038753
1037 1037 c, t dbSNP:200056419
1038 1038 a, c, g dbSNP:765445143
1040 1040 a, g dbSNP:759662860
1055 1055 a, g dbSNP:777330856
1062 1062 c, t dbSNP:766791706
1064 1064 c, t dbSNP:775417913
1069 1069 c, t dbSNP:200883344
1072 1072 a, g dbSNP:200137591
1074 1074 c, t dbSNP:34723289
1078 1078 c, t dbSNP:748981899
1079 1079 a, g dbSNP:368195234
1089 1089 c, t dbSNP:769353273
1102 1102 a, g dbSNP:745377564
1105 1105 a, c dbSNP:781198345
1107 1107 c, g dbSNP:139314029
1126 1126 -, ta dbSNP:563918391
1134 1134 c, t dbSNP:757088776
1136 1136 c, t dbSNP:746845652
1150 1150 g, t dbSNP:777393742
1166 1166 c, t dbSNP:758178456
1172 1172 c, t dbSNP:753014058
1194 1194 c, t dbSNP:765538494
1198 1198 c, t dbSNP:61754627
1213 1213 c, t dbSNP:753902314
1218 1218 c, g dbSNP:766921289
1223 1223 a, g dbSNP:761036874
1226 1226 a, g dbSNP:773740367
1227 1227 c, t dbSNP:767822919
1230 1230 a, g dbSNP:762152575
1233 1233 c, t dbSNP:775190991
1235 1235 a, g dbSNP:769373925
1240 1240 c, g dbSNP:374343837
1243 1243 -, g dbSNP:753947940
1247 1247 a, g dbSNP:775957364
1249 1249 a, g dbSNP:770934894
1252 1252 c, g dbSNP:746956908
1256 1256 c, g dbSNP:116688317
1274 1274 g, t dbSNP:755911126
1295 1295 a, g dbSNP:746251125
1308 1308 a, c dbSNP:572222112
1354 1354 c, t dbSNP:181423531
1395 1395 a, c dbSNP:3022
1396 1396 -, caggccagtagttagaagaccccc dbSNP:373091236
1399 1399 -, tt dbSNP:201011005
1400 1400 -, ccagtagttagaagaccccccagg dbSNP:146671905
1400 1400 c, t dbSNP:200338867
1401 1401 c, t dbSNP:202173106
1423 1423 -, ccagtagttagaagaccccccagg dbSNP:752056016
1486 1486 c, t dbSNP:541898126
1527 1527 c, t dbSNP:779414524
1551 1551 c, g dbSNP:485334
1558 1558 c, g dbSNP:531273973
1563 1563 a, g dbSNP:556511183
1585 1585 c, t dbSNP:539754438
1595 1595 a, g dbSNP:188520894
1597 1597 a, g dbSNP:373017335
1618 1618 c, t dbSNP:554095473
1650 1650 c, t dbSNP:534356392

Target ORF information:

RefSeq Version XM_011541265
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu58007D
Sequence Information ORF Nucleotide Sequence (Length: 729bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)255..>938(+)
Misc Feature(2)318..>941(+)
Misc Feature(3)336..827(+)
Misc Feature(4)336..359(+)
Misc Feature(5)339..863(+)
Misc Feature(6)744..770(+)
Misc Feature(7)759..761(+)
Misc Feature(8)762..866(+)
Misc Feature(9)768..866(+)
Misc Feature(10)816..827(+)
Misc Feature(11)819..869(+)
Position Chain Variation Link
80 80 a, g dbSNP:56079255
134 134 c, t dbSNP:546594222
141 141 a, g dbSNP:529621776
162 162 a, g dbSNP:768308560
166 166 -, g dbSNP:34046712
175 175 c, t dbSNP:746796374
176 176 a, g, t dbSNP:373698555
178 178 a, g dbSNP:748227612
181 181 -, ag dbSNP:564936072
187 187 a, g dbSNP:2304355
198 198 a, g dbSNP:755513575
203 203 g, t dbSNP:562449373
204 204 c, g dbSNP:780590839
211 211 c, t dbSNP:756496666
212 212 a, g dbSNP:750796967
221 221 a, g dbSNP:763845288
222 222 c, g dbSNP:762637247
223 223 -, g dbSNP:765367881
226 226 c, g dbSNP:752278435
232 232 c, t dbSNP:199503029
233 233 c, g dbSNP:372507125
249 249 g, t dbSNP:759055694
256 256 c, g dbSNP:776479555
266 266 c, g dbSNP:770886199
269 269 g, t dbSNP:760450896
270 270 a, g dbSNP:772922679
280 280 a, g dbSNP:772291136
295 295 a, g dbSNP:748317500
329 329 a, g dbSNP:779079945
336 336 a, g, t dbSNP:749377354
338 338 c, t dbSNP:767343349
350 350 a, g dbSNP:761577743
356 356 a, g dbSNP:752831057
357 357 a, g dbSNP:146606352
360 360 a, g dbSNP:200725841
363 363 a, g dbSNP:201659866
365 365 c, t dbSNP:146945932
366 366 a, g dbSNP:749334089
372 372 c, t dbSNP:775584517
375 375 a, g dbSNP:770225385
396 396 a, g dbSNP:372515497
420 420 c, g dbSNP:369218401
431 431 g, t dbSNP:577261001
439 439 a, g dbSNP:745918238
453 453 c, t dbSNP:121434585
461 461 c, g, t dbSNP:200316722
464 464 a, g dbSNP:192176115
468 468 a, g dbSNP:747378581
470 470 a, c dbSNP:371604259
472 472 g, t dbSNP:754606257
473 473 c, t dbSNP:576810119
474 474 c, t dbSNP:748928144
475 475 a, c, g dbSNP:140250745
489 489 c, t dbSNP:749934608
498 498 a, g dbSNP:201588334
499 499 a, c dbSNP:757130132
502 502 a, g dbSNP:751377702
511 511 c, g dbSNP:763912191
513 513 a, c dbSNP:762626564
517 517 a, g dbSNP:753011209
520 520 a, c, t dbSNP:146695290
521 521 a, c, g dbSNP:183147259
527 527 c, t dbSNP:752430152
528 528 a, g dbSNP:145002495
532 532 a, g dbSNP:759770362
534 534 c, g dbSNP:753984783
537 537 a, c dbSNP:3738766
541 541 a, g dbSNP:760803840
545 545 c, t dbSNP:773830399
548 548 g, t dbSNP:772456624
551 551 c, t dbSNP:762247888
559 559 c, t dbSNP:775374577
560 560 c, t dbSNP:142976178
567 567 a, g dbSNP:147269835
571 571 c, t dbSNP:780793773
586 586 -, t dbSNP:767424501
587 587 c, t dbSNP:12046787
588 588 a, g dbSNP:41280330
593 593 a, g dbSNP:777831176
602 602 c, g dbSNP:758202508
604 604 g, t dbSNP:752549211
605 605 g, t dbSNP:778799065
614 614 a, g dbSNP:755278059
615 615 g, t dbSNP:754150816
622 622 a, g dbSNP:766682709
630 630 a, g dbSNP:756332145
638 638 c, t dbSNP:536959939
639 639 a, g dbSNP:768086755
645 645 a, g dbSNP:149421007
652 652 a, t dbSNP:774809648
657 657 c, t dbSNP:764484604
668 668 c, t dbSNP:763283639
672 672 a, g dbSNP:776322769
681 681 c, t dbSNP:766033906
683 683 c, t dbSNP:760195431
687 687 a, c dbSNP:772147864
699 699 c, t dbSNP:745308973
713 713 c, t dbSNP:771518962
716 716 g, t dbSNP:747669348
718 718 a, t dbSNP:774485451
721 721 -, acct dbSNP:759522552
728 728 g, t dbSNP:768651686
743 743 c, g dbSNP:749110943
744 744 c, t dbSNP:779949808
745 745 a, g dbSNP:374210835
752 752 -, ag dbSNP:774099409
763 763 c, t dbSNP:746117122
764 764 a, g dbSNP:1799875
766 766 a, g dbSNP:1799940
768 768 a, g dbSNP:201798524
769 769 a, t dbSNP:751633351
772 772 c, t dbSNP:370869387
783 783 c, t dbSNP:758844656
784 784 a, t dbSNP:753083112
788 788 c, t dbSNP:376412882
789 789 a, g dbSNP:759910267
798 798 c, t dbSNP:750089687
827 827 g, t dbSNP:551776784
832 832 a, g dbSNP:777936715
836 836 c, t dbSNP:140231308
837 837 a, c, g dbSNP:267597907
845 845 a, g dbSNP:779352893
848 848 a, g dbSNP:755458273
863 863 c, t dbSNP:534677249
866 866 a, g dbSNP:780429600
890 890 c, t dbSNP:201230566
913 913 c, t dbSNP:751307255
916 916 c, t dbSNP:763825174
919 919 c, t dbSNP:758050645
926 926 a, g dbSNP:752187366
929 929 c, t dbSNP:765099163
932 932 c, t dbSNP:367863835
933 933 a, g dbSNP:140788789
940 940 a, g dbSNP:767751902
944 944 a, g dbSNP:762058433
953 953 a, c dbSNP:774408503
961 961 a, g dbSNP:768833008
962 962 c, t dbSNP:762929495
963 963 a, g dbSNP:776207301
968 968 a, c dbSNP:770359260
979 979 c, g dbSNP:746250209
990 990 a, c dbSNP:781647200
993 993 c, g dbSNP:191211731
998 998 a, t dbSNP:771880106
1001 1001 a, c, t dbSNP:368906691
1004 1004 -, tt dbSNP:769421063
1008 1008 a, g dbSNP:754570281
1021 1021 a, g dbSNP:753280339

Target ORF information:

RefSeq Version XM_011541266
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu19578D
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL355310.20, AF493909.1 and BC000233.1. This sequence is a reference standard in the RefSeqGene project. On Jun 15, 2006 this sequence version replaced gi:22027523. Summary: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC000233.1, AF493909.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)181..183(+)
Misc Feature(2)250..1269(+)
Misc Feature(3)313..1257(+)
Misc Feature(4)331..1191(+)
Misc Feature(5)331..354(+)
Misc Feature(6)334..858(+)
Misc Feature(7)739..765(+)
Misc Feature(8)754..756(+)
Misc Feature(9)757..861(+)
Misc Feature(10)763..861(+)
Misc Feature(11)811..822(+)
Misc Feature(12)814..864(+)
Misc Feature(13)1018..1029(+)
Misc Feature(14)1162..1212(+)
Misc Feature(15)1186..1194(+)
Exon (1)1..331
Gene Synonym:
Exon (2)332..374
Gene Synonym:
Exon (3)375..516
Gene Synonym:
Exon (4)517..674
Gene Synonym:
Exon (5)675..803
Gene Synonym:
Exon (6)804..933
Gene Synonym:
Exon (7)934..1087
Gene Synonym:
Exon (8)1088..1365
Gene Synonym:
Position Chain Variation Link
75 75 c, t dbSNP:186255282
83 83 a, g dbSNP:532113128
85 85 a, g dbSNP:116819755
111 111 c, t dbSNP:547633476
141 141 c, g dbSNP:527385567
150 150 a, c dbSNP:180838035
161 161 -, g dbSNP:34046712
170 170 c, t dbSNP:746796374
171 171 a, g, t dbSNP:373698555
173 173 a, g dbSNP:748227612
176 176 -, ag dbSNP:564936072
182 182 a, g dbSNP:2304355
193 193 a, g dbSNP:755513575
198 198 g, t dbSNP:562449373
199 199 c, g dbSNP:780590839
206 206 c, t dbSNP:756496666
207 207 a, g dbSNP:750796967
216 216 a, g dbSNP:763845288
217 217 c, g dbSNP:762637247
218 218 -, g dbSNP:765367881
221 221 c, g dbSNP:752278435
227 227 c, t dbSNP:199503029
228 228 c, g dbSNP:372507125
244 244 g, t dbSNP:759055694
251 251 c, g dbSNP:776479555
261 261 c, g dbSNP:770886199
264 264 g, t dbSNP:760450896
265 265 a, g dbSNP:772922679
275 275 a, g dbSNP:772291136
290 290 a, g dbSNP:748317500
324 324 a, g dbSNP:779079945
331 331 a, g, t dbSNP:749377354
333 333 c, t dbSNP:767343349
345 345 a, g dbSNP:761577743
351 351 a, g dbSNP:752831057
352 352 a, g dbSNP:146606352
355 355 a, g dbSNP:200725841
358 358 a, g dbSNP:201659866
360 360 c, t dbSNP:146945932
361 361 a, g dbSNP:749334089
367 367 c, t dbSNP:775584517
370 370 a, g dbSNP:770225385
391 391 a, g dbSNP:372515497
415 415 c, g dbSNP:369218401
426 426 g, t dbSNP:577261001
434 434 a, g dbSNP:745918238
448 448 c, t dbSNP:121434585
456 456 c, g, t dbSNP:200316722
459 459 a, g dbSNP:192176115
463 463 a, g dbSNP:747378581
465 465 a, c dbSNP:371604259
467 467 g, t dbSNP:754606257
468 468 c, t dbSNP:576810119
469 469 c, t dbSNP:748928144
470 470 a, c, g dbSNP:140250745
484 484 c, t dbSNP:749934608
493 493 a, g dbSNP:201588334
494 494 a, c dbSNP:757130132
497 497 a, g dbSNP:751377702
506 506 c, g dbSNP:763912191
508 508 a, c dbSNP:762626564
512 512 a, g dbSNP:753011209
515 515 a, c, t dbSNP:146695290
516 516 a, c, g dbSNP:183147259
522 522 c, t dbSNP:752430152
523 523 a, g dbSNP:145002495
527 527 a, g dbSNP:759770362
529 529 c, g dbSNP:753984783
532 532 a, c dbSNP:3738766
536 536 a, g dbSNP:760803840
540 540 c, t dbSNP:773830399
543 543 g, t dbSNP:772456624
546 546 c, t dbSNP:762247888
554 554 c, t dbSNP:775374577
555 555 c, t dbSNP:142976178
562 562 a, g dbSNP:147269835
566 566 c, t dbSNP:780793773
581 581 -, t dbSNP:767424501
582 582 c, t dbSNP:12046787
583 583 a, g dbSNP:41280330
588 588 a, g dbSNP:777831176
597 597 c, g dbSNP:758202508
599 599 g, t dbSNP:752549211
600 600 g, t dbSNP:778799065
609 609 a, g dbSNP:755278059
610 610 g, t dbSNP:754150816
617 617 a, g dbSNP:766682709
625 625 a, g dbSNP:756332145
633 633 c, t dbSNP:536959939
634 634 a, g dbSNP:768086755
640 640 a, g dbSNP:149421007
647 647 a, t dbSNP:774809648
652 652 c, t dbSNP:764484604
663 663 c, t dbSNP:763283639
667 667 a, g dbSNP:776322769
676 676 c, t dbSNP:766033906
678 678 c, t dbSNP:760195431
682 682 a, c dbSNP:772147864
694 694 c, t dbSNP:745308973
708 708 c, t dbSNP:771518962
711 711 g, t dbSNP:747669348
713 713 a, t dbSNP:774485451
716 716 -, acct dbSNP:759522552
723 723 g, t dbSNP:768651686
738 738 c, g dbSNP:749110943
739 739 c, t dbSNP:779949808
740 740 a, g dbSNP:374210835
747 747 -, ag dbSNP:774099409
758 758 c, t dbSNP:746117122
759 759 a, g dbSNP:1799875
761 761 a, g dbSNP:1799940
763 763 a, g dbSNP:201798524
764 764 a, t dbSNP:751633351
767 767 c, t dbSNP:370869387
778 778 c, t dbSNP:758844656
779 779 a, t dbSNP:753083112
783 783 c, t dbSNP:376412882
784 784 a, g dbSNP:759910267
793 793 c, t dbSNP:750089687
822 822 g, t dbSNP:551776784
827 827 a, g dbSNP:777936715
831 831 c, t dbSNP:140231308
832 832 a, c, g dbSNP:267597907
840 840 a, g dbSNP:779352893
843 843 a, g dbSNP:755458273
858 858 c, t dbSNP:534677249
861 861 a, g dbSNP:780429600
885 885 c, t dbSNP:201230566
908 908 c, t dbSNP:751307255
911 911 c, t dbSNP:763825174
914 914 c, t dbSNP:758050645
921 921 a, g dbSNP:752187366
924 924 c, t dbSNP:765099163
927 927 c, t dbSNP:367863835
928 928 a, g dbSNP:140788789
936 936 c, t dbSNP:764762846
937 937 c, t dbSNP:754414120
938 938 a, g dbSNP:142609327
941 941 c, t dbSNP:535592857
942 942 a, g dbSNP:760527034
946 946 a, g dbSNP:147849105
970 970 a, g dbSNP:767751902
974 974 a, g dbSNP:762058433
983 983 a, c dbSNP:774408503
991 991 a, g dbSNP:768833008
992 992 c, t dbSNP:762929495
993 993 a, g dbSNP:776207301
998 998 a, c dbSNP:770359260
1009 1009 c, g dbSNP:746250209
1020 1020 a, c dbSNP:781647200
1023 1023 c, g dbSNP:191211731
1028 1028 a, t dbSNP:771880106
1031 1031 a, c, t dbSNP:368906691
1034 1034 -, tt dbSNP:769421063
1038 1038 a, g dbSNP:754570281
1051 1051 a, g dbSNP:753280339
1058 1058 a, c dbSNP:779967692
1077 1077 a, g dbSNP:374829286
1080 1080 c, g dbSNP:750251941
1083 1083 c, t dbSNP:373436662
1084 1084 a, g dbSNP:767343299
1088 1088 a, g dbSNP:200224608
1090 1090 a, g dbSNP:750410966
1094 1094 a, t dbSNP:781094332
1099 1099 c, t dbSNP:757147586
1101 1101 c, t dbSNP:751249807
1105 1105 a, g dbSNP:764393652
1106 1106 -, atg dbSNP:757394970
1107 1107 c, t dbSNP:763038753
1109 1109 c, t dbSNP:200056419
1110 1110 a, c, g dbSNP:765445143
1112 1112 a, g dbSNP:759662860
1127 1127 a, g dbSNP:777330856
1134 1134 c, t dbSNP:766791706
1136 1136 c, t dbSNP:775417913
1141 1141 c, t dbSNP:200883344
1144 1144 a, g dbSNP:200137591
1146 1146 c, t dbSNP:34723289
1150 1150 c, t dbSNP:748981899
1151 1151 a, g dbSNP:368195234
1161 1161 c, t dbSNP:769353273
1174 1174 a, g dbSNP:745377564
1177 1177 a, c dbSNP:781198345
1179 1179 c, g dbSNP:139314029
1198 1198 -, ta dbSNP:563918391
1206 1206 c, t dbSNP:757088776
1208 1208 c, t dbSNP:746845652
1222 1222 g, t dbSNP:777393742
1238 1238 c, t dbSNP:758178456
1244 1244 c, t dbSNP:753014058
1266 1266 c, t dbSNP:765538494
1270 1270 c, t dbSNP:61754627
1285 1285 c, t dbSNP:753902314
1290 1290 c, g dbSNP:766921289
1295 1295 a, g dbSNP:761036874
1298 1298 a, g dbSNP:773740367
1299 1299 c, t dbSNP:767822919
1302 1302 a, g dbSNP:762152575
1305 1305 c, t dbSNP:775190991
1307 1307 a, g dbSNP:769373925
1312 1312 c, g dbSNP:374343837
1315 1315 -, g dbSNP:753947940
1319 1319 a, g dbSNP:775957364
1321 1321 a, g dbSNP:770934894
1324 1324 c, g dbSNP:746956908
1328 1328 c, g dbSNP:116688317
1346 1346 g, t dbSNP:755911126

Target ORF information:

RefSeq Version NM_005272
Organism Homo sapiens (human)
Definition Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.