Home » Species Summary » Homo sapiens » GNAT2 cDNA ORF clone
Email to GenScript

GNAT2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol GNAT2
Entrez Gene ID 2780
Full Name guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2
Synonyms ACHM4, GNATC
General protein information
Preferred Names
guanine nucleotide-binding protein G(t) subunit alpha-2
guanine nucleotide-binding protein G(t) subunit alpha-2
transducin alpha-2 chain
cone-type transducin alpha subunit
transducin, cone-specific, alpha polypeptide
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Achromatopsia-4 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011541264 XP_011539566 guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
XM_011541265 XP_011539567 guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
XM_011541266 XP_011539568 guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X2
NM_005272 NP_005263 guanine nucleotide-binding protein G(t) subunit alpha-2

hsa04744 Phototransduction
R-HSA-162582 Signal Transduction
R-HSA-388396 GPCR downstream signaling
R-HSA-418594 G alpha (i) signalling events
R-HSA-372790 Signaling by GPCR
R-HSA-111885 Opioid Signalling
R-HSA-3858494 Beta-catenin independent WNT signaling
R-HSA-112043 PLC beta mediated events
R-HSA-195721 Signaling by Wnt
R-HSA-4086398 Ca2+ pathway
R-HSA-202040 G-protein activation
R-HSA-112040 G-protein mediated events
Pathway Interaction Database
cone_pathway Visual signal transduction: Cones

Homo sapiens (human) GNAT2 NP_005263.1
Pan troglodytes (chimpanzee) GNAT2 XP_524787.2
Macaca mulatta (Rhesus monkey) GNAT2 XP_001091580.1
Canis lupus familiaris (dog) GNAT2 XP_547240.2
Bos taurus (cattle) GNAT2 NP_776751.1
Mus musculus (house mouse) Gnat2 NP_032167.1
Rattus norvegicus (Norway rat) Gnat2 NP_001102420.2
Gallus gallus (chicken) GNAT2 NP_990021.1
Danio rerio (zebrafish) gnat2 NP_571944.1
Xenopus (Silurana) tropicalis (western clawed frog) LOC100216126 NP_001135577.1


ID Name Evidence
GO:0001750 photoreceptor outer segment IDA
GO:0001750 photoreceptor outer segment ISS
GO:0001917 photoreceptor inner segment IDA
GO:0005834 heterotrimeric G-protein complex ISS
GO:0005834 heterotrimeric G-protein complex NAS
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane TAS
GO:0031234 extrinsic to internal side of plasma membrane ISS
GO:0042622 photoreceptor outer segment membrane ISS


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0001664 G-protein-coupled receptor binding ISS
GO:0003924 GTPase activity ISS
GO:0003924 GTPase activity TAS
GO:0004871 signal transducer activity ISS
GO:0005525 GTP binding EXP
GO:0005525 GTP binding NAS
GO:0008020 G-protein coupled photoreceptor activity NAS
GO:0019001 guanyl nucleotide binding IEA
GO:0031683 G-protein beta/gamma-subunit complex binding ISS


ID Name Evidence
GO:0001580 detection of chemical stimulus involved in sensory perception of bitter taste ISS
GO:0006184 GTP catabolic process ISS
GO:0006184 GTP catabolic process TAS
GO:0007186 G-protein coupled receptor protein signaling pathway NAS
GO:0007188 G-protein signaling, coupled to cAMP nucleotide second messenger ISS
GO:0007601 visual perception NAS
GO:0007602 phototransduction NAS
GO:0009584 detection of visible light NAS
GO:0009586 rhodopsin mediated phototransduction ISS
GO:0046549 retinal cone cell development IEA
GO:0050896 response to stimulus IEA
GO:0050908 detection of light stimulus involved in visual perception IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following GNAT2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GNAT2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu19578 XM_011541264 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu19578 XM_011541265 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu58007 XM_011541266 PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu19578 NM_005272 Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu19578
Accession Version XM_011541264.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)255..1274(+)
Misc Feature(2)318..1262(+)
Misc Feature(3)336..1196(+)
Misc Feature(4)336..359(+)
Misc Feature(5)339..863(+)
Misc Feature(6)744..770(+)
Misc Feature(7)759..761(+)
Misc Feature(8)762..866(+)
Misc Feature(9)768..866(+)
Misc Feature(10)816..827(+)
Misc Feature(11)819..869(+)
Misc Feature(12)1023..1034(+)
Misc Feature(13)1167..1217(+)
Misc Feature(14)1191..1199(+)
Position Chain Variation Link
80 80 a, g dbSNP:56079255
134 134 c, t dbSNP:546594222
141 141 a, g dbSNP:529621776
162 162 a, g dbSNP:768308560
166 166 -, g dbSNP:34046712
175 175 c, t dbSNP:746796374
176 176 a, g, t dbSNP:373698555
178 178 a, g dbSNP:748227612
181 181 -, ag dbSNP:564936072
187 187 a, g dbSNP:2304355
198 198 a, g dbSNP:755513575
203 203 g, t dbSNP:562449373
204 204 c, g dbSNP:780590839
211 211 c, t dbSNP:756496666
212 212 a, g dbSNP:750796967
221 221 a, g dbSNP:763845288
222 222 c, g dbSNP:762637247
223 223 -, g dbSNP:765367881
226 226 c, g dbSNP:752278435
232 232 c, t dbSNP:199503029
233 233 c, g dbSNP:372507125
249 249 g, t dbSNP:759055694
256 256 c, g dbSNP:776479555
266 266 c, g dbSNP:770886199
269 269 g, t dbSNP:760450896
270 270 a, g dbSNP:772922679
280 280 a, g dbSNP:772291136
295 295 a, g dbSNP:748317500
329 329 a, g dbSNP:779079945
336 336 a, g, t dbSNP:749377354
338 338 c, t dbSNP:767343349
350 350 a, g dbSNP:761577743
356 356 a, g dbSNP:752831057
357 357 a, g dbSNP:146606352
360 360 a, g dbSNP:200725841
363 363 a, g dbSNP:201659866
365 365 c, t dbSNP:146945932
366 366 a, g dbSNP:749334089
372 372 c, t dbSNP:775584517
375 375 a, g dbSNP:770225385
396 396 a, g dbSNP:372515497
420 420 c, g dbSNP:369218401
431 431 g, t dbSNP:577261001
439 439 a, g dbSNP:745918238
453 453 c, t dbSNP:121434585
461 461 c, g, t dbSNP:200316722
464 464 a, g dbSNP:192176115
468 468 a, g dbSNP:747378581
470 470 a, c dbSNP:371604259
472 472 g, t dbSNP:754606257
473 473 c, t dbSNP:576810119
474 474 c, t dbSNP:748928144
475 475 a, c, g dbSNP:140250745
489 489 c, t dbSNP:749934608
498 498 a, g dbSNP:201588334
499 499 a, c dbSNP:757130132
502 502 a, g dbSNP:751377702
511 511 c, g dbSNP:763912191
513 513 a, c dbSNP:762626564
517 517 a, g dbSNP:753011209
520 520 a, c, t dbSNP:146695290
521 521 a, c, g dbSNP:183147259
527 527 c, t dbSNP:752430152
528 528 a, g dbSNP:145002495
532 532 a, g dbSNP:759770362
534 534 c, g dbSNP:753984783
537 537 a, c dbSNP:3738766
541 541 a, g dbSNP:760803840
545 545 c, t dbSNP:773830399
548 548 g, t dbSNP:772456624
551 551 c, t dbSNP:762247888
559 559 c, t dbSNP:775374577
560 560 c, t dbSNP:142976178
567 567 a, g dbSNP:147269835
571 571 c, t dbSNP:780793773
586 586 -, t dbSNP:767424501
587 587 c, t dbSNP:12046787
588 588 a, g dbSNP:41280330
593 593 a, g dbSNP:777831176
602 602 c, g dbSNP:758202508
604 604 g, t dbSNP:752549211
605 605 g, t dbSNP:778799065
614 614 a, g dbSNP:755278059
615 615 g, t dbSNP:754150816
622 622 a, g dbSNP:766682709
630 630 a, g dbSNP:756332145
638 638 c, t dbSNP:536959939
639 639 a, g dbSNP:768086755
645 645 a, g dbSNP:149421007
652 652 a, t dbSNP:774809648
657 657 c, t dbSNP:764484604
668 668 c, t dbSNP:763283639
672 672 a, g dbSNP:776322769
681 681 c, t dbSNP:766033906
683 683 c, t dbSNP:760195431
687 687 a, c dbSNP:772147864
699 699 c, t dbSNP:745308973
713 713 c, t dbSNP:771518962
716 716 g, t dbSNP:747669348
718 718 a, t dbSNP:774485451
721 721 -, acct dbSNP:759522552
728 728 g, t dbSNP:768651686
743 743 c, g dbSNP:749110943
744 744 c, t dbSNP:779949808
745 745 a, g dbSNP:374210835
752 752 -, ag dbSNP:774099409
763 763 c, t dbSNP:746117122
764 764 a, g dbSNP:1799875
766 766 a, g dbSNP:1799940
768 768 a, g dbSNP:201798524
769 769 a, t dbSNP:751633351
772 772 c, t dbSNP:370869387
783 783 c, t dbSNP:758844656
784 784 a, t dbSNP:753083112
788 788 c, t dbSNP:376412882
789 789 a, g dbSNP:759910267
798 798 c, t dbSNP:750089687
827 827 g, t dbSNP:551776784
832 832 a, g dbSNP:777936715
836 836 c, t dbSNP:140231308
837 837 a, c, g dbSNP:267597907
845 845 a, g dbSNP:779352893
848 848 a, g dbSNP:755458273
863 863 c, t dbSNP:534677249
866 866 a, g dbSNP:780429600
890 890 c, t dbSNP:201230566
913 913 c, t dbSNP:751307255
916 916 c, t dbSNP:763825174
919 919 c, t dbSNP:758050645
926 926 a, g dbSNP:752187366
929 929 c, t dbSNP:765099163
932 932 c, t dbSNP:367863835
933 933 a, g dbSNP:140788789
941 941 c, t dbSNP:764762846
942 942 c, t dbSNP:754414120
943 943 a, g dbSNP:142609327
946 946 c, t dbSNP:535592857
947 947 a, g dbSNP:760527034
951 951 a, g dbSNP:147849105
975 975 a, g dbSNP:767751902
979 979 a, g dbSNP:762058433
988 988 a, c dbSNP:774408503
996 996 a, g dbSNP:768833008
997 997 c, t dbSNP:762929495
998 998 a, g dbSNP:776207301
1003 1003 a, c dbSNP:770359260
1014 1014 c, g dbSNP:746250209
1025 1025 a, c dbSNP:781647200
1028 1028 c, g dbSNP:191211731
1033 1033 a, t dbSNP:771880106
1036 1036 a, c, t dbSNP:368906691
1039 1039 -, tt dbSNP:769421063
1043 1043 a, g dbSNP:754570281
1056 1056 a, g dbSNP:753280339
1063 1063 a, c dbSNP:779967692
1082 1082 a, g dbSNP:374829286
1085 1085 c, g dbSNP:750251941
1088 1088 c, t dbSNP:373436662
1089 1089 a, g dbSNP:767343299
1093 1093 a, g dbSNP:200224608
1095 1095 a, g dbSNP:750410966
1099 1099 a, t dbSNP:781094332
1104 1104 c, t dbSNP:757147586
1106 1106 c, t dbSNP:751249807
1110 1110 a, g dbSNP:764393652
1111 1111 -, atg dbSNP:757394970
1112 1112 c, t dbSNP:763038753
1114 1114 c, t dbSNP:200056419
1115 1115 a, c, g dbSNP:765445143
1117 1117 a, g dbSNP:759662860
1132 1132 a, g dbSNP:777330856
1139 1139 c, t dbSNP:766791706
1141 1141 c, t dbSNP:775417913
1146 1146 c, t dbSNP:200883344
1149 1149 a, g dbSNP:200137591
1151 1151 c, t dbSNP:34723289
1155 1155 c, t dbSNP:748981899
1156 1156 a, g dbSNP:368195234
1166 1166 c, t dbSNP:769353273
1179 1179 a, g dbSNP:745377564
1182 1182 a, c dbSNP:781198345
1184 1184 c, g dbSNP:139314029
1203 1203 -, ta dbSNP:563918391
1211 1211 c, t dbSNP:757088776
1213 1213 c, t dbSNP:746845652
1227 1227 g, t dbSNP:777393742
1243 1243 c, t dbSNP:758178456
1249 1249 c, t dbSNP:753014058
1271 1271 c, t dbSNP:765538494
1275 1275 c, t dbSNP:61754627
1290 1290 c, t dbSNP:753902314
1295 1295 c, g dbSNP:766921289
1300 1300 a, g dbSNP:761036874
1303 1303 a, g dbSNP:773740367
1304 1304 c, t dbSNP:767822919
1307 1307 a, g dbSNP:762152575
1310 1310 c, t dbSNP:775190991
1312 1312 a, g dbSNP:769373925
1317 1317 c, g dbSNP:374343837
1320 1320 -, g dbSNP:753947940
1324 1324 a, g dbSNP:775957364
1326 1326 a, g dbSNP:770934894
1329 1329 c, g dbSNP:746956908
1333 1333 c, g dbSNP:116688317
1351 1351 g, t dbSNP:755911126
1372 1372 a, g dbSNP:746251125
1385 1385 a, c dbSNP:572222112
1431 1431 c, t dbSNP:181423531
1472 1472 a, c dbSNP:3022
1473 1473 -, caggccagtagttagaagaccccc dbSNP:373091236
1476 1476 -, tt dbSNP:201011005
1477 1477 -, ccagtagttagaagaccccccagg dbSNP:146671905
1477 1477 c, t dbSNP:200338867
1478 1478 c, t dbSNP:202173106
1500 1500 -, ccagtagttagaagaccccccagg dbSNP:752056016
1563 1563 c, t dbSNP:541898126
1604 1604 c, t dbSNP:779414524
1628 1628 c, g dbSNP:485334
1635 1635 c, g dbSNP:531273973
1640 1640 a, g dbSNP:556511183
1662 1662 c, t dbSNP:539754438
1672 1672 a, g dbSNP:188520894
1674 1674 a, g dbSNP:373017335
1695 1695 c, t dbSNP:554095473
1727 1727 c, t dbSNP:534356392

Target ORF information:

RefSeq Version XM_011541264
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19578
Accession Version XM_011541265.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)178..1197(+)
Misc Feature(2)241..1185(+)
Misc Feature(3)259..1119(+)
Misc Feature(4)259..282(+)
Misc Feature(5)262..786(+)
Misc Feature(6)667..693(+)
Misc Feature(7)682..684(+)
Misc Feature(8)685..789(+)
Misc Feature(9)691..789(+)
Misc Feature(10)739..750(+)
Misc Feature(11)742..792(+)
Misc Feature(12)946..957(+)
Misc Feature(13)1090..1140(+)
Misc Feature(14)1114..1122(+)
Position Chain Variation Link
89 89 -, g dbSNP:34046712
98 98 c, t dbSNP:746796374
99 99 a, g, t dbSNP:373698555
101 101 a, g dbSNP:748227612
104 104 -, ag dbSNP:564936072
110 110 a, g dbSNP:2304355
121 121 a, g dbSNP:755513575
126 126 g, t dbSNP:562449373
127 127 c, g dbSNP:780590839
134 134 c, t dbSNP:756496666
135 135 a, g dbSNP:750796967
144 144 a, g dbSNP:763845288
145 145 c, g dbSNP:762637247
146 146 -, g dbSNP:765367881
149 149 c, g dbSNP:752278435
155 155 c, t dbSNP:199503029
156 156 c, g dbSNP:372507125
172 172 g, t dbSNP:759055694
179 179 c, g dbSNP:776479555
189 189 c, g dbSNP:770886199
192 192 g, t dbSNP:760450896
193 193 a, g dbSNP:772922679
203 203 a, g dbSNP:772291136
218 218 a, g dbSNP:748317500
252 252 a, g dbSNP:779079945
259 259 a, g, t dbSNP:749377354
261 261 c, t dbSNP:767343349
273 273 a, g dbSNP:761577743
279 279 a, g dbSNP:752831057
280 280 a, g dbSNP:146606352
283 283 a, g dbSNP:200725841
286 286 a, g dbSNP:201659866
288 288 c, t dbSNP:146945932
289 289 a, g dbSNP:749334089
295 295 c, t dbSNP:775584517
298 298 a, g dbSNP:770225385
319 319 a, g dbSNP:372515497
343 343 c, g dbSNP:369218401
354 354 g, t dbSNP:577261001
362 362 a, g dbSNP:745918238
376 376 c, t dbSNP:121434585
384 384 c, g, t dbSNP:200316722
387 387 a, g dbSNP:192176115
391 391 a, g dbSNP:747378581
393 393 a, c dbSNP:371604259
395 395 g, t dbSNP:754606257
396 396 c, t dbSNP:576810119
397 397 c, t dbSNP:748928144
398 398 a, c, g dbSNP:140250745
412 412 c, t dbSNP:749934608
421 421 a, g dbSNP:201588334
422 422 a, c dbSNP:757130132
425 425 a, g dbSNP:751377702
434 434 c, g dbSNP:763912191
436 436 a, c dbSNP:762626564
440 440 a, g dbSNP:753011209
443 443 a, c, t dbSNP:146695290
444 444 a, c, g dbSNP:183147259
450 450 c, t dbSNP:752430152
451 451 a, g dbSNP:145002495
455 455 a, g dbSNP:759770362
457 457 c, g dbSNP:753984783
460 460 a, c dbSNP:3738766
464 464 a, g dbSNP:760803840
468 468 c, t dbSNP:773830399
471 471 g, t dbSNP:772456624
474 474 c, t dbSNP:762247888
482 482 c, t dbSNP:775374577
483 483 c, t dbSNP:142976178
490 490 a, g dbSNP:147269835
494 494 c, t dbSNP:780793773
509 509 -, t dbSNP:767424501
510 510 c, t dbSNP:12046787
511 511 a, g dbSNP:41280330
516 516 a, g dbSNP:777831176
525 525 c, g dbSNP:758202508
527 527 g, t dbSNP:752549211
528 528 g, t dbSNP:778799065
537 537 a, g dbSNP:755278059
538 538 g, t dbSNP:754150816
545 545 a, g dbSNP:766682709
553 553 a, g dbSNP:756332145
561 561 c, t dbSNP:536959939
562 562 a, g dbSNP:768086755
568 568 a, g dbSNP:149421007
575 575 a, t dbSNP:774809648
580 580 c, t dbSNP:764484604
591 591 c, t dbSNP:763283639
595 595 a, g dbSNP:776322769
604 604 c, t dbSNP:766033906
606 606 c, t dbSNP:760195431
610 610 a, c dbSNP:772147864
622 622 c, t dbSNP:745308973
636 636 c, t dbSNP:771518962
639 639 g, t dbSNP:747669348
641 641 a, t dbSNP:774485451
644 644 -, acct dbSNP:759522552
651 651 g, t dbSNP:768651686
666 666 c, g dbSNP:749110943
667 667 c, t dbSNP:779949808
668 668 a, g dbSNP:374210835
675 675 -, ag dbSNP:774099409
686 686 c, t dbSNP:746117122
687 687 a, g dbSNP:1799875
689 689 a, g dbSNP:1799940
691 691 a, g dbSNP:201798524
692 692 a, t dbSNP:751633351
695 695 c, t dbSNP:370869387
706 706 c, t dbSNP:758844656
707 707 a, t dbSNP:753083112
711 711 c, t dbSNP:376412882
712 712 a, g dbSNP:759910267
721 721 c, t dbSNP:750089687
750 750 g, t dbSNP:551776784
755 755 a, g dbSNP:777936715
759 759 c, t dbSNP:140231308
760 760 a, c, g dbSNP:267597907
768 768 a, g dbSNP:779352893
771 771 a, g dbSNP:755458273
786 786 c, t dbSNP:534677249
789 789 a, g dbSNP:780429600
813 813 c, t dbSNP:201230566
836 836 c, t dbSNP:751307255
839 839 c, t dbSNP:763825174
842 842 c, t dbSNP:758050645
849 849 a, g dbSNP:752187366
852 852 c, t dbSNP:765099163
855 855 c, t dbSNP:367863835
856 856 a, g dbSNP:140788789
864 864 c, t dbSNP:764762846
865 865 c, t dbSNP:754414120
866 866 a, g dbSNP:142609327
869 869 c, t dbSNP:535592857
870 870 a, g dbSNP:760527034
874 874 a, g dbSNP:147849105
898 898 a, g dbSNP:767751902
902 902 a, g dbSNP:762058433
911 911 a, c dbSNP:774408503
919 919 a, g dbSNP:768833008
920 920 c, t dbSNP:762929495
921 921 a, g dbSNP:776207301
926 926 a, c dbSNP:770359260
937 937 c, g dbSNP:746250209
948 948 a, c dbSNP:781647200
951 951 c, g dbSNP:191211731
956 956 a, t dbSNP:771880106
959 959 a, c, t dbSNP:368906691
962 962 -, tt dbSNP:769421063
966 966 a, g dbSNP:754570281
979 979 a, g dbSNP:753280339
986 986 a, c dbSNP:779967692
1005 1005 a, g dbSNP:374829286
1008 1008 c, g dbSNP:750251941
1011 1011 c, t dbSNP:373436662
1012 1012 a, g dbSNP:767343299
1016 1016 a, g dbSNP:200224608
1018 1018 a, g dbSNP:750410966
1022 1022 a, t dbSNP:781094332
1027 1027 c, t dbSNP:757147586
1029 1029 c, t dbSNP:751249807
1033 1033 a, g dbSNP:764393652
1034 1034 -, atg dbSNP:757394970
1035 1035 c, t dbSNP:763038753
1037 1037 c, t dbSNP:200056419
1038 1038 a, c, g dbSNP:765445143
1040 1040 a, g dbSNP:759662860
1055 1055 a, g dbSNP:777330856
1062 1062 c, t dbSNP:766791706
1064 1064 c, t dbSNP:775417913
1069 1069 c, t dbSNP:200883344
1072 1072 a, g dbSNP:200137591
1074 1074 c, t dbSNP:34723289
1078 1078 c, t dbSNP:748981899
1079 1079 a, g dbSNP:368195234
1089 1089 c, t dbSNP:769353273
1102 1102 a, g dbSNP:745377564
1105 1105 a, c dbSNP:781198345
1107 1107 c, g dbSNP:139314029
1126 1126 -, ta dbSNP:563918391
1134 1134 c, t dbSNP:757088776
1136 1136 c, t dbSNP:746845652
1150 1150 g, t dbSNP:777393742
1166 1166 c, t dbSNP:758178456
1172 1172 c, t dbSNP:753014058
1194 1194 c, t dbSNP:765538494
1198 1198 c, t dbSNP:61754627
1213 1213 c, t dbSNP:753902314
1218 1218 c, g dbSNP:766921289
1223 1223 a, g dbSNP:761036874
1226 1226 a, g dbSNP:773740367
1227 1227 c, t dbSNP:767822919
1230 1230 a, g dbSNP:762152575
1233 1233 c, t dbSNP:775190991
1235 1235 a, g dbSNP:769373925
1240 1240 c, g dbSNP:374343837
1243 1243 -, g dbSNP:753947940
1247 1247 a, g dbSNP:775957364
1249 1249 a, g dbSNP:770934894
1252 1252 c, g dbSNP:746956908
1256 1256 c, g dbSNP:116688317
1274 1274 g, t dbSNP:755911126
1295 1295 a, g dbSNP:746251125
1308 1308 a, c dbSNP:572222112
1354 1354 c, t dbSNP:181423531
1395 1395 a, c dbSNP:3022
1396 1396 -, caggccagtagttagaagaccccc dbSNP:373091236
1399 1399 -, tt dbSNP:201011005
1400 1400 -, ccagtagttagaagaccccccagg dbSNP:146671905
1400 1400 c, t dbSNP:200338867
1401 1401 c, t dbSNP:202173106
1423 1423 -, ccagtagttagaagaccccccagg dbSNP:752056016
1486 1486 c, t dbSNP:541898126
1527 1527 c, t dbSNP:779414524
1551 1551 c, g dbSNP:485334
1558 1558 c, g dbSNP:531273973
1563 1563 a, g dbSNP:556511183
1585 1585 c, t dbSNP:539754438
1595 1595 a, g dbSNP:188520894
1597 1597 a, g dbSNP:373017335
1618 1618 c, t dbSNP:554095473
1650 1650 c, t dbSNP:534356392

Target ORF information:

RefSeq Version XM_011541265
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu58007
Accession Version XM_011541266.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 729bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)255..>938(+)
Misc Feature(2)318..>941(+)
Misc Feature(3)336..827(+)
Misc Feature(4)336..359(+)
Misc Feature(5)339..863(+)
Misc Feature(6)744..770(+)
Misc Feature(7)759..761(+)
Misc Feature(8)762..866(+)
Misc Feature(9)768..866(+)
Misc Feature(10)816..827(+)
Misc Feature(11)819..869(+)
Position Chain Variation Link
80 80 a, g dbSNP:56079255
134 134 c, t dbSNP:546594222
141 141 a, g dbSNP:529621776
162 162 a, g dbSNP:768308560
166 166 -, g dbSNP:34046712
175 175 c, t dbSNP:746796374
176 176 a, g, t dbSNP:373698555
178 178 a, g dbSNP:748227612
181 181 -, ag dbSNP:564936072
187 187 a, g dbSNP:2304355
198 198 a, g dbSNP:755513575
203 203 g, t dbSNP:562449373
204 204 c, g dbSNP:780590839
211 211 c, t dbSNP:756496666
212 212 a, g dbSNP:750796967
221 221 a, g dbSNP:763845288
222 222 c, g dbSNP:762637247
223 223 -, g dbSNP:765367881
226 226 c, g dbSNP:752278435
232 232 c, t dbSNP:199503029
233 233 c, g dbSNP:372507125
249 249 g, t dbSNP:759055694
256 256 c, g dbSNP:776479555
266 266 c, g dbSNP:770886199
269 269 g, t dbSNP:760450896
270 270 a, g dbSNP:772922679
280 280 a, g dbSNP:772291136
295 295 a, g dbSNP:748317500
329 329 a, g dbSNP:779079945
336 336 a, g, t dbSNP:749377354
338 338 c, t dbSNP:767343349
350 350 a, g dbSNP:761577743
356 356 a, g dbSNP:752831057
357 357 a, g dbSNP:146606352
360 360 a, g dbSNP:200725841
363 363 a, g dbSNP:201659866
365 365 c, t dbSNP:146945932
366 366 a, g dbSNP:749334089
372 372 c, t dbSNP:775584517
375 375 a, g dbSNP:770225385
396 396 a, g dbSNP:372515497
420 420 c, g dbSNP:369218401
431 431 g, t dbSNP:577261001
439 439 a, g dbSNP:745918238
453 453 c, t dbSNP:121434585
461 461 c, g, t dbSNP:200316722
464 464 a, g dbSNP:192176115
468 468 a, g dbSNP:747378581
470 470 a, c dbSNP:371604259
472 472 g, t dbSNP:754606257
473 473 c, t dbSNP:576810119
474 474 c, t dbSNP:748928144
475 475 a, c, g dbSNP:140250745
489 489 c, t dbSNP:749934608
498 498 a, g dbSNP:201588334
499 499 a, c dbSNP:757130132
502 502 a, g dbSNP:751377702
511 511 c, g dbSNP:763912191
513 513 a, c dbSNP:762626564
517 517 a, g dbSNP:753011209
520 520 a, c, t dbSNP:146695290
521 521 a, c, g dbSNP:183147259
527 527 c, t dbSNP:752430152
528 528 a, g dbSNP:145002495
532 532 a, g dbSNP:759770362
534 534 c, g dbSNP:753984783
537 537 a, c dbSNP:3738766
541 541 a, g dbSNP:760803840
545 545 c, t dbSNP:773830399
548 548 g, t dbSNP:772456624
551 551 c, t dbSNP:762247888
559 559 c, t dbSNP:775374577
560 560 c, t dbSNP:142976178
567 567 a, g dbSNP:147269835
571 571 c, t dbSNP:780793773
586 586 -, t dbSNP:767424501
587 587 c, t dbSNP:12046787
588 588 a, g dbSNP:41280330
593 593 a, g dbSNP:777831176
602 602 c, g dbSNP:758202508
604 604 g, t dbSNP:752549211
605 605 g, t dbSNP:778799065
614 614 a, g dbSNP:755278059
615 615 g, t dbSNP:754150816
622 622 a, g dbSNP:766682709
630 630 a, g dbSNP:756332145
638 638 c, t dbSNP:536959939
639 639 a, g dbSNP:768086755
645 645 a, g dbSNP:149421007
652 652 a, t dbSNP:774809648
657 657 c, t dbSNP:764484604
668 668 c, t dbSNP:763283639
672 672 a, g dbSNP:776322769
681 681 c, t dbSNP:766033906
683 683 c, t dbSNP:760195431
687 687 a, c dbSNP:772147864
699 699 c, t dbSNP:745308973
713 713 c, t dbSNP:771518962
716 716 g, t dbSNP:747669348
718 718 a, t dbSNP:774485451
721 721 -, acct dbSNP:759522552
728 728 g, t dbSNP:768651686
743 743 c, g dbSNP:749110943
744 744 c, t dbSNP:779949808
745 745 a, g dbSNP:374210835
752 752 -, ag dbSNP:774099409
763 763 c, t dbSNP:746117122
764 764 a, g dbSNP:1799875
766 766 a, g dbSNP:1799940
768 768 a, g dbSNP:201798524
769 769 a, t dbSNP:751633351
772 772 c, t dbSNP:370869387
783 783 c, t dbSNP:758844656
784 784 a, t dbSNP:753083112
788 788 c, t dbSNP:376412882
789 789 a, g dbSNP:759910267
798 798 c, t dbSNP:750089687
827 827 g, t dbSNP:551776784
832 832 a, g dbSNP:777936715
836 836 c, t dbSNP:140231308
837 837 a, c, g dbSNP:267597907
845 845 a, g dbSNP:779352893
848 848 a, g dbSNP:755458273
863 863 c, t dbSNP:534677249
866 866 a, g dbSNP:780429600
890 890 c, t dbSNP:201230566
913 913 c, t dbSNP:751307255
916 916 c, t dbSNP:763825174
919 919 c, t dbSNP:758050645
926 926 a, g dbSNP:752187366
929 929 c, t dbSNP:765099163
932 932 c, t dbSNP:367863835
933 933 a, g dbSNP:140788789
940 940 a, g dbSNP:767751902
944 944 a, g dbSNP:762058433
953 953 a, c dbSNP:774408503
961 961 a, g dbSNP:768833008
962 962 c, t dbSNP:762929495
963 963 a, g dbSNP:776207301
968 968 a, c dbSNP:770359260
979 979 c, g dbSNP:746250209
990 990 a, c dbSNP:781647200
993 993 c, g dbSNP:191211731
998 998 a, t dbSNP:771880106
1001 1001 a, c, t dbSNP:368906691
1004 1004 -, tt dbSNP:769421063
1008 1008 a, g dbSNP:754570281
1021 1021 a, g dbSNP:753280339

Target ORF information:

RefSeq Version XM_011541266
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19578
Accession Version NM_005272.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1065bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product guanine nucleotide-binding protein G(t) subunit alpha-2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL355310.20, AF493909.1 and BC000233.1. This sequence is a reference standard in the RefSeqGene project. On Jun 15, 2006 this sequence version replaced gi:22027523. Summary: Transducin is a 3-subunit guanine nucleotide-binding protein (G protein) which stimulates the coupling of rhodopsin and cGMP-phoshodiesterase during visual impulses. The transducin alpha subunits in rods and cones are encoded by separate genes. This gene encodes the alpha subunit in cones. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC000233.1, AF493909.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148093 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)181..183(+)
Misc Feature(2)250..1269(+)
Misc Feature(3)313..1257(+)
Misc Feature(4)331..1191(+)
Misc Feature(5)331..354(+)
Misc Feature(6)334..858(+)
Misc Feature(7)739..765(+)
Misc Feature(8)754..756(+)
Misc Feature(9)757..861(+)
Misc Feature(10)763..861(+)
Misc Feature(11)811..822(+)
Misc Feature(12)814..864(+)
Misc Feature(13)1018..1029(+)
Misc Feature(14)1162..1212(+)
Misc Feature(15)1186..1194(+)
Exon (1)1..331
Gene Synonym:
Exon (2)332..374
Gene Synonym:
Exon (3)375..516
Gene Synonym:
Exon (4)517..674
Gene Synonym:
Exon (5)675..803
Gene Synonym:
Exon (6)804..933
Gene Synonym:
Exon (7)934..1087
Gene Synonym:
Exon (8)1088..1365
Gene Synonym:
Position Chain Variation Link
75 75 c, t dbSNP:186255282
83 83 a, g dbSNP:532113128
85 85 a, g dbSNP:116819755
111 111 c, t dbSNP:547633476
141 141 c, g dbSNP:527385567
150 150 a, c dbSNP:180838035
161 161 -, g dbSNP:34046712
170 170 c, t dbSNP:746796374
171 171 a, g, t dbSNP:373698555
173 173 a, g dbSNP:748227612
176 176 -, ag dbSNP:564936072
182 182 a, g dbSNP:2304355
193 193 a, g dbSNP:755513575
198 198 g, t dbSNP:562449373
199 199 c, g dbSNP:780590839
206 206 c, t dbSNP:756496666
207 207 a, g dbSNP:750796967
216 216 a, g dbSNP:763845288
217 217 c, g dbSNP:762637247
218 218 -, g dbSNP:765367881
221 221 c, g dbSNP:752278435
227 227 c, t dbSNP:199503029
228 228 c, g dbSNP:372507125
244 244 g, t dbSNP:759055694
251 251 c, g dbSNP:776479555
261 261 c, g dbSNP:770886199
264 264 g, t dbSNP:760450896
265 265 a, g dbSNP:772922679
275 275 a, g dbSNP:772291136
290 290 a, g dbSNP:748317500
324 324 a, g dbSNP:779079945
331 331 a, g, t dbSNP:749377354
333 333 c, t dbSNP:767343349
345 345 a, g dbSNP:761577743
351 351 a, g dbSNP:752831057
352 352 a, g dbSNP:146606352
355 355 a, g dbSNP:200725841
358 358 a, g dbSNP:201659866
360 360 c, t dbSNP:146945932
361 361 a, g dbSNP:749334089
367 367 c, t dbSNP:775584517
370 370 a, g dbSNP:770225385
391 391 a, g dbSNP:372515497
415 415 c, g dbSNP:369218401
426 426 g, t dbSNP:577261001
434 434 a, g dbSNP:745918238
448 448 c, t dbSNP:121434585
456 456 c, g, t dbSNP:200316722
459 459 a, g dbSNP:192176115
463 463 a, g dbSNP:747378581
465 465 a, c dbSNP:371604259
467 467 g, t dbSNP:754606257
468 468 c, t dbSNP:576810119
469 469 c, t dbSNP:748928144
470 470 a, c, g dbSNP:140250745
484 484 c, t dbSNP:749934608
493 493 a, g dbSNP:201588334
494 494 a, c dbSNP:757130132
497 497 a, g dbSNP:751377702
506 506 c, g dbSNP:763912191
508 508 a, c dbSNP:762626564
512 512 a, g dbSNP:753011209
515 515 a, c, t dbSNP:146695290
516 516 a, c, g dbSNP:183147259
522 522 c, t dbSNP:752430152
523 523 a, g dbSNP:145002495
527 527 a, g dbSNP:759770362
529 529 c, g dbSNP:753984783
532 532 a, c dbSNP:3738766
536 536 a, g dbSNP:760803840
540 540 c, t dbSNP:773830399
543 543 g, t dbSNP:772456624
546 546 c, t dbSNP:762247888
554 554 c, t dbSNP:775374577
555 555 c, t dbSNP:142976178
562 562 a, g dbSNP:147269835
566 566 c, t dbSNP:780793773
581 581 -, t dbSNP:767424501
582 582 c, t dbSNP:12046787
583 583 a, g dbSNP:41280330
588 588 a, g dbSNP:777831176
597 597 c, g dbSNP:758202508
599 599 g, t dbSNP:752549211
600 600 g, t dbSNP:778799065
609 609 a, g dbSNP:755278059
610 610 g, t dbSNP:754150816
617 617 a, g dbSNP:766682709
625 625 a, g dbSNP:756332145
633 633 c, t dbSNP:536959939
634 634 a, g dbSNP:768086755
640 640 a, g dbSNP:149421007
647 647 a, t dbSNP:774809648
652 652 c, t dbSNP:764484604
663 663 c, t dbSNP:763283639
667 667 a, g dbSNP:776322769
676 676 c, t dbSNP:766033906
678 678 c, t dbSNP:760195431
682 682 a, c dbSNP:772147864
694 694 c, t dbSNP:745308973
708 708 c, t dbSNP:771518962
711 711 g, t dbSNP:747669348
713 713 a, t dbSNP:774485451
716 716 -, acct dbSNP:759522552
723 723 g, t dbSNP:768651686
738 738 c, g dbSNP:749110943
739 739 c, t dbSNP:779949808
740 740 a, g dbSNP:374210835
747 747 -, ag dbSNP:774099409
758 758 c, t dbSNP:746117122
759 759 a, g dbSNP:1799875
761 761 a, g dbSNP:1799940
763 763 a, g dbSNP:201798524
764 764 a, t dbSNP:751633351
767 767 c, t dbSNP:370869387
778 778 c, t dbSNP:758844656
779 779 a, t dbSNP:753083112
783 783 c, t dbSNP:376412882
784 784 a, g dbSNP:759910267
793 793 c, t dbSNP:750089687
822 822 g, t dbSNP:551776784
827 827 a, g dbSNP:777936715
831 831 c, t dbSNP:140231308
832 832 a, c, g dbSNP:267597907
840 840 a, g dbSNP:779352893
843 843 a, g dbSNP:755458273
858 858 c, t dbSNP:534677249
861 861 a, g dbSNP:780429600
885 885 c, t dbSNP:201230566
908 908 c, t dbSNP:751307255
911 911 c, t dbSNP:763825174
914 914 c, t dbSNP:758050645
921 921 a, g dbSNP:752187366
924 924 c, t dbSNP:765099163
927 927 c, t dbSNP:367863835
928 928 a, g dbSNP:140788789
936 936 c, t dbSNP:764762846
937 937 c, t dbSNP:754414120
938 938 a, g dbSNP:142609327
941 941 c, t dbSNP:535592857
942 942 a, g dbSNP:760527034
946 946 a, g dbSNP:147849105
970 970 a, g dbSNP:767751902
974 974 a, g dbSNP:762058433
983 983 a, c dbSNP:774408503
991 991 a, g dbSNP:768833008
992 992 c, t dbSNP:762929495
993 993 a, g dbSNP:776207301
998 998 a, c dbSNP:770359260
1009 1009 c, g dbSNP:746250209
1020 1020 a, c dbSNP:781647200
1023 1023 c, g dbSNP:191211731
1028 1028 a, t dbSNP:771880106
1031 1031 a, c, t dbSNP:368906691
1034 1034 -, tt dbSNP:769421063
1038 1038 a, g dbSNP:754570281
1051 1051 a, g dbSNP:753280339
1058 1058 a, c dbSNP:779967692
1077 1077 a, g dbSNP:374829286
1080 1080 c, g dbSNP:750251941
1083 1083 c, t dbSNP:373436662
1084 1084 a, g dbSNP:767343299
1088 1088 a, g dbSNP:200224608
1090 1090 a, g dbSNP:750410966
1094 1094 a, t dbSNP:781094332
1099 1099 c, t dbSNP:757147586
1101 1101 c, t dbSNP:751249807
1105 1105 a, g dbSNP:764393652
1106 1106 -, atg dbSNP:757394970
1107 1107 c, t dbSNP:763038753
1109 1109 c, t dbSNP:200056419
1110 1110 a, c, g dbSNP:765445143
1112 1112 a, g dbSNP:759662860
1127 1127 a, g dbSNP:777330856
1134 1134 c, t dbSNP:766791706
1136 1136 c, t dbSNP:775417913
1141 1141 c, t dbSNP:200883344
1144 1144 a, g dbSNP:200137591
1146 1146 c, t dbSNP:34723289
1150 1150 c, t dbSNP:748981899
1151 1151 a, g dbSNP:368195234
1161 1161 c, t dbSNP:769353273
1174 1174 a, g dbSNP:745377564
1177 1177 a, c dbSNP:781198345
1179 1179 c, g dbSNP:139314029
1198 1198 -, ta dbSNP:563918391
1206 1206 c, t dbSNP:757088776
1208 1208 c, t dbSNP:746845652
1222 1222 g, t dbSNP:777393742
1238 1238 c, t dbSNP:758178456
1244 1244 c, t dbSNP:753014058
1266 1266 c, t dbSNP:765538494
1270 1270 c, t dbSNP:61754627
1285 1285 c, t dbSNP:753902314
1290 1290 c, g dbSNP:766921289
1295 1295 a, g dbSNP:761036874
1298 1298 a, g dbSNP:773740367
1299 1299 c, t dbSNP:767822919
1302 1302 a, g dbSNP:762152575
1305 1305 c, t dbSNP:775190991
1307 1307 a, g dbSNP:769373925
1312 1312 c, g dbSNP:374343837
1315 1315 -, g dbSNP:753947940
1319 1319 a, g dbSNP:775957364
1321 1321 a, g dbSNP:770934894
1324 1324 c, g dbSNP:746956908
1328 1328 c, g dbSNP:116688317
1346 1346 g, t dbSNP:755911126

Target ORF information:

RefSeq Version NM_005272
Organism Homo sapiens (human)
Definition Homo sapiens guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 (GNAT2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
