Home » Species Summary » Homo sapiens » SLCO1B3 cDNA ORF clone
Email to GenScript

SLCO1B3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SLCO1B3
Entrez Gene ID 28234
Full Name solute carrier organic anion transporter family, member 1B3
Synonyms HBLRR, LST-2, LST-3TM13, LST3, OATP-8, OATP1B3, OATP8, SLC21A8
General protein information
Preferred Names
solute carrier organic anion transporter family member 1B3
solute carrier organic anion transporter family member 1B3
organic anion transporter 8
organic anion transporter LST-3c
organic anion-transporting polypeptide 8
liver-specific organic anion transporter 2
liver-specific organic anion transporter 3TM13
solute carrier family 21 (organic anion transporter), member 8
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_019844 NP_062818 solute carrier organic anion transporter family member 1B3

hsa04976 Bile secretion
R-HSA-425407 SLC-mediated transmembrane transport
R-HSA-425397 Transport of vitamins, nucleosides, and related molecules
R-HSA-1430728 Metabolism
R-HSA-382551 Transmembrane transport of small molecules
R-HSA-556833 Metabolism of lipids and lipoproteins
R-HSA-879518 Transport of organic anions
R-HSA-159418 Recycling of bile acids and salts
R-HSA-194068 Bile acid and bile salt metabolism

Homo sapiens (human) SLCO1B3 NP_062818.1
Macaca mulatta (Rhesus monkey) SLCO1B3 NP_001028113.1
Canis lupus familiaris (dog) SLCO1B3 NP_001159519.1
Bos taurus (cattle) SLCO1B3 NP_991373.1
Mus musculus (house mouse) Slco1b2 NP_065241.1
Rattus norvegicus (Norway rat) Slco1b2 NP_113838.1


ID Name Evidence
GO:0005737 cytoplasm IDA
GO:0005886 plasma membrane EXP
GO:0005887 integral to plasma membrane TAS
GO:0016323 basolateral plasma membrane IEA


ID Name Evidence
GO:0005215 transporter activity IEA
GO:0008514 organic anion transmembrane transporter activity TAS
GO:0015125 bile acid transmembrane transporter activity EXP


ID Name Evidence
GO:0006811 ion transport IEA
GO:0008206 bile acid metabolic process TAS
GO:0015711 organic anion transport TAS
GO:0015721 bile acid and bile salt transport EXP
GO:0015721 bile acid and bile salt transport TAS
GO:0043252 sodium-independent organic anion transport EXP
GO:0055085 transmembrane transport TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SLCO1B3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SLCO1B3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_019844 Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu21499
Accession Version NM_019844.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2109bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product solute carrier organic anion transporter family member 1B3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BG567966.1, AK055874.1, AC011604.10, AJ251506.1 and BM968322.1. This sequence is a reference standard in the RefSeqGene project. On Feb 9, 2012 this sequence version replaced gi:112421139. Summary: This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK055874.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2145122, SAMEA962335 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)209..211(+)
Misc Feature(2)320..2107(+)
Misc Feature(3)326..385(+)
Misc Feature(4)332..>1528(+)
Misc Feature(5)374..1411(+)
Misc Feature(6)443..505(+)
Misc Feature(7)524..598(+)
Misc Feature(8)746..832(+)
Misc Feature(9)890..952(+)
Misc Feature(10)1007..1081(+)
Misc Feature(11)1235..1300(+)
Misc Feature(12)1361..1432(+)
Misc Feature(13)1445..1516(+)
Misc Feature(14)1604..1765(+)
Misc Feature(15)1853..1921(+)
Misc Feature(16)1949..2026(+)
Misc Feature(17)2129..2182(+)
Exon (1)1..61
Gene Synonym:
Exon (2)62..176
Gene Synonym:
Exon (3)177..325
Gene Synonym:
Exon (4)326..467
Gene Synonym:
Exon (5)468..600
Gene Synonym:
Exon (6)601..722
Gene Synonym:
Exon (7)723..869
Gene Synonym:
Exon (8)870..968
Gene Synonym:
Exon (9)969..1211
Gene Synonym:
Exon (10)1212..1376
Gene Synonym:
Exon (11)1377..1572
Gene Synonym:
Exon (12)1573..1738
Gene Synonym:
Exon (13)1739..1923
Gene Synonym:
Exon (14)1924..1988
Gene Synonym:
Exon (15)1989..2106
Gene Synonym:
Exon (16)2107..3014
Gene Synonym:
Position Chain Variation Link
1 1 a, g dbSNP:59312184
16 16 a, g dbSNP:757011878
33 33 c, t dbSNP:577928092
53 53 a, g dbSNP:537042163
64 64 g, t dbSNP:546754716
72 72 c, t dbSNP:566458025
73 73 a, g dbSNP:532202007
112 112 -, c dbSNP:373018826
128 128 c, t dbSNP:772037746
129 129 a, g dbSNP:551886958
152 152 c, t dbSNP:7305323
180 180 a, g dbSNP:189089836
191 191 a, c dbSNP:777409004
192 192 a, c dbSNP:746996051
195 195 a, g dbSNP:770964385
205 205 c, t dbSNP:781166716
210 210 -, a dbSNP:200104106
213 213 -, tag dbSNP:376671816
214 214 atattcacttggtatctgtagttta, tag dbSNP:71581943
214 214 -, atattcacttggtatctgtagt dbSNP:201656982
214 214 -, atattcacttggtatctg dbSNP:527574443
215 215 a, t dbSNP:745613189
225 225 -, gtatctgt dbSNP:756996645
232 232 c, t dbSNP:770056188
235 235 -, ttta dbSNP:4149158
237 237 a, t dbSNP:201503539
238 238 -, g dbSNP:756233039
238 238 a, g dbSNP:201943559
241 241 a, g dbSNP:775638352
245 245 c, g dbSNP:763219424
248 248 c, g dbSNP:768665889
252 252 a, g dbSNP:61612406
257 257 c, t dbSNP:762336646
267 267 a, c dbSNP:200793002
269 269 a, g dbSNP:750802420
273 273 c, t dbSNP:760883363
279 279 c, t dbSNP:766761846
280 280 a, g dbSNP:752350711
289 289 a, g dbSNP:758051443
292 292 a, c, g dbSNP:376673811
298 298 a, g dbSNP:751076533
303 303 -, t dbSNP:758211177
308 308 c, t dbSNP:369736559
309 309 a, g dbSNP:781205713
310 310 c, t dbSNP:149944473
321 321 g, t dbSNP:377570761
323 323 a, g dbSNP:779872655
324 324 a, c, g dbSNP:563634489
338 338 a, g dbSNP:534630821
340 340 c, t dbSNP:144143469
341 341 c, g dbSNP:748366885
349 349 c, g dbSNP:79042365
352 352 c, g dbSNP:773321155
359 359 a, g dbSNP:747514619
361 361 c, t dbSNP:771433571
368 368 c, t dbSNP:11045565
377 377 a, t dbSNP:759889843
379 379 c, g dbSNP:765688756
380 380 -, att dbSNP:754862840
382 382 c, t dbSNP:578259935
384 384 c, t dbSNP:774202726
389 389 a, g dbSNP:761530247
393 393 c, t dbSNP:767172087
395 395 a, g dbSNP:57325543
396 396 -, t dbSNP:781282589
401 401 c, g dbSNP:749907490
403 403 a, g dbSNP:117554616
404 404 a, g dbSNP:766279496
405 405 c, t dbSNP:773836341
406 406 a, g dbSNP:374761449
412 412 a, g dbSNP:754836324
417 417 c, t dbSNP:778668812
422 422 a, t dbSNP:190960788
428 428 g, t dbSNP:543120401
431 431 a, t dbSNP:151295214
441 441 -, t dbSNP:748195197
444 444 -, aattg dbSNP:558592800
445 445 a, g dbSNP:747066655
450 450 a, g dbSNP:374641951
452 452 a, g dbSNP:368817817
454 454 a, g dbSNP:200473248
455 455 a, g dbSNP:777132805
468 468 g, t dbSNP:368091191
471 471 a, g dbSNP:749607240
473 473 g, t dbSNP:771625535
479 479 g, t dbSNP:772983554
491 491 c, g dbSNP:760232101
496 496 g, t dbSNP:770524098
503 503 a, g dbSNP:776089217
505 505 a, c dbSNP:374616195
516 516 a, g dbSNP:144099822
522 522 c, t dbSNP:371512520
523 523 a, g dbSNP:762672865
530 530 a, g dbSNP:763796201
533 533 c, g dbSNP:751852878
541 541 c, t dbSNP:757386211
542 542 a, t dbSNP:558865397
555 555 c, g dbSNP:750478948
558 558 a, c dbSNP:150007972
559 559 c, t dbSNP:780638920
571 571 a, g dbSNP:544431416
573 573 c, t dbSNP:769123182
575 575 g, t dbSNP:4149117
576 576 a, c dbSNP:145334570
583 583 a, g dbSNP:770452047
585 585 -, t dbSNP:774519432
592 592 c, t dbSNP:776144216
598 598 a, t dbSNP:745326410
599 599 c, t dbSNP:769732111
601 601 c, t dbSNP:536484136
607 607 a, g dbSNP:749274457
610 610 c, t dbSNP:768426477
624 624 -, a dbSNP:776334232
632 632 a, c dbSNP:374152690
634 634 a, g dbSNP:200835380
638 638 a, g dbSNP:369609436
645 645 c, t dbSNP:150039066
649 649 a, g dbSNP:377002062
652 652 -, aa dbSNP:761397886
654 654 g, t dbSNP:369529563
662 662 a, t dbSNP:760957484
668 668 -, ttaa dbSNP:764867994
675 675 a, g, t dbSNP:146623116
680 680 a, g dbSNP:57585902
685 685 -, atc dbSNP:776456205
686 686 -, t dbSNP:762457419
687 687 c, t dbSNP:765608118
688 688 a, g dbSNP:753113192
693 693 a, g dbSNP:77922474
700 700 a, g dbSNP:370334648
708 708 a, c, g dbSNP:745556617
710 710 a, t dbSNP:779559994
712 712 a, g dbSNP:748685876
713 713 a, g dbSNP:768642442
722 722 a, g dbSNP:778780143
725 725 g, t dbSNP:140353351
728 728 g, t dbSNP:754627543
746 746 c, t dbSNP:764685801
749 749 -, at dbSNP:749536779
749 749 a, g dbSNP:752206814
777 777 g, t dbSNP:758425216
778 778 g, t dbSNP:777788484
779 779 c, t dbSNP:555561597
782 782 c, g, t dbSNP:746941097
783 783 a, g dbSNP:180875376
791 791 a, g dbSNP:374117010
792 792 a, g dbSNP:770005051
798 798 a, c dbSNP:775442032
801 801 c, g dbSNP:368572652
804 804 c, t dbSNP:768715673
805 805 a, g dbSNP:766508014
806 806 a, g dbSNP:762283520
812 812 c, t dbSNP:534211468
817 817 a, g dbSNP:773585218
822 822 c, t dbSNP:148029725
825 825 a, c dbSNP:199849487
827 827 a, g dbSNP:147555114
828 828 c, t dbSNP:141703938
833 833 a, g dbSNP:368649517
834 834 a, g dbSNP:751600260
838 838 a, t dbSNP:757192493
839 839 a, g dbSNP:780868097
841 841 a, g dbSNP:745614997
843 843 -, aag dbSNP:779363741
844 844 a, g dbSNP:138661039
849 849 g, t dbSNP:780319483
850 850 a, g dbSNP:749497437
851 851 -, c dbSNP:746200831
860 860 g, t dbSNP:768771131
860 860 -, t dbSNP:772767697
873 873 a, g dbSNP:772462864
883 883 a, c dbSNP:778412645
884 884 a, g dbSNP:747459855
886 886 a, g dbSNP:142673817
888 888 a, g dbSNP:375847286
895 895 g, t dbSNP:762729525
899 899 c, g dbSNP:768361956
904 904 c, t dbSNP:369915589
917 917 c, g, t dbSNP:115227445
921 921 a, g dbSNP:750422279
924 924 a, c dbSNP:760497665
926 926 c, t dbSNP:766191913
927 927 c, t dbSNP:753580891
935 935 a, g dbSNP:755207229
938 938 a, c dbSNP:779041069
940 940 a, g dbSNP:7311358
943 943 c, g, t dbSNP:374015229
953 953 a, g dbSNP:747595430
960 960 g, t dbSNP:771528335
962 962 a, g dbSNP:781710106
963 963 a, g, t dbSNP:746163941
968 968 a, c dbSNP:774107510
970 970 -, c dbSNP:769362248
976 976 a, c dbSNP:763264262
977 977 a, g dbSNP:149427388
981 981 a, t dbSNP:764151105
984 984 c, t dbSNP:751797492
990 990 a, g dbSNP:757482086
995 995 -, ccaaccaag dbSNP:772550329
998 998 c, t dbSNP:767676951
999 999 a, c, g dbSNP:745538500
1000 1000 a, t dbSNP:61736830
1002 1002 c, g dbSNP:749549593
1003 1003 c, g dbSNP:758082554
1004 1004 a, g dbSNP:777348477
1005 1005 c, t dbSNP:746659786
1008 1008 c, g dbSNP:60140950
1010 1010 a, g dbSNP:776095053
1019 1019 c, t dbSNP:745824602
1022 1022 a, g dbSNP:538533710
1027 1027 -, c dbSNP:762699702
1040 1040 c, g dbSNP:769575516
1042 1042 a, g dbSNP:373432026
1060 1060 c, t dbSNP:762718659
1066 1066 -, t dbSNP:765917931
1066 1066 a, g dbSNP:768497503
1067 1067 -, t dbSNP:751405974
1081 1081 a, g dbSNP:555631927
1088 1088 c, t dbSNP:762106680
1094 1094 -, aaac dbSNP:554933268
1097 1097 c, t dbSNP:767730020
1100 1100 -, a dbSNP:767508889
1113 1113 a, c dbSNP:200068079
1114 1114 a, c dbSNP:142873062
1129 1129 g, t dbSNP:766738737
1131 1131 a, g dbSNP:754356216
1133 1133 g, t dbSNP:755365122
1136 1136 c, g dbSNP:779304579
1137 1137 c, t dbSNP:751260776
1142 1142 a, g dbSNP:756852295
1152 1152 a, g, t dbSNP:780708027
1154 1154 a, c dbSNP:769780056
1163 1163 -, ac dbSNP:752635362
1176 1176 c, t dbSNP:371298832
1184 1184 a, g dbSNP:774984457
1185 1185 -, a dbSNP:755946165
1188 1188 a, g dbSNP:768387734
1189 1189 a, g dbSNP:373072758
1190 1190 a, g dbSNP:146565174
1191 1191 a, g dbSNP:772355903
1197 1197 c, g dbSNP:773440798
1198 1198 -, a dbSNP:753817906
1199 1199 -, a dbSNP:777927970
1203 1203 a, g dbSNP:760723958
1204 1204 g, t dbSNP:766475606
1207 1207 a, g dbSNP:754342222
1212 1212 -, t dbSNP:769005039
1213 1213 a, t dbSNP:199532359
1213 1213 -, t dbSNP:772819161
1214 1214 a, t dbSNP:775841876
1222 1222 a, g dbSNP:763362797
1223 1223 a, t dbSNP:764415236
1229 1229 a, g dbSNP:146780296
1234 1234 a, c dbSNP:755746830
1238 1238 c, g, t dbSNP:765840736
1240 1240 c, t dbSNP:140410796
1241 1241 a, g, t dbSNP:779052779
1244 1244 a, g dbSNP:758308277
1247 1247 a, c dbSNP:777688375
1252 1252 c, g dbSNP:747216573
1260 1260 c, t dbSNP:771143376
1272 1272 -, t dbSNP:149063204
1276 1276 a, g dbSNP:776575555
1277 1277 c, t dbSNP:745900922
1279 1279 c, g dbSNP:769846642
1281 1281 a, t dbSNP:776021373
1286 1286 g, t dbSNP:763431961
1291 1291 a, c dbSNP:764468156
1295 1295 c, t dbSNP:774739984
1297 1297 g, t dbSNP:760250617
1299 1299 c, t dbSNP:766000544
1309 1309 c, t dbSNP:150373728
1313 1313 -, a dbSNP:748726828
1315 1315 c, t dbSNP:145036538
1316 1316 a, g dbSNP:764808205
1323 1323 -, aat dbSNP:770673596
1332 1332 -, agcaacagt dbSNP:780624558
1333 1333 a, g dbSNP:149072672
1341 1341 a, g dbSNP:758361118
1342 1342 c, t dbSNP:777458586
1343 1343 a, g, t dbSNP:370237473
1348 1348 a, g dbSNP:375605848
1358 1358 c, t dbSNP:746069778
1360 1360 c, t dbSNP:200150730
1369 1369 c, t dbSNP:769914095
1377 1377 a, g dbSNP:202070259
1385 1385 a, t dbSNP:759291062
1388 1388 a, g dbSNP:372972480
1391 1391 a, c dbSNP:145877520
1395 1395 c, t dbSNP:138702607
1396 1396 a, g, t dbSNP:142709481
1417 1417 a, g dbSNP:761609502
1423 1423 a, c dbSNP:767380897
1427 1427 a, t dbSNP:750153920
1432 1432 -, a dbSNP:775213677
1441 1441 c, t dbSNP:267603412
1447 1447 a, g dbSNP:756345861
1455 1455 c, t dbSNP:780313590
1458 1458 a, g dbSNP:374932005
1459 1459 -, a dbSNP:760695555
1465 1465 c, g dbSNP:754057250
1467 1467 a, g dbSNP:755125439
1472 1472 c, t dbSNP:778837188
1474 1474 -, a dbSNP:763903069
1476 1476 g, t dbSNP:748711438
1477 1477 g, t dbSNP:758791140
1478 1478 c, g, t dbSNP:577433244
1482 1482 a, c, t dbSNP:146940490
1485 1485 a, c, t dbSNP:369045586
1486 1486 a, g dbSNP:577498680
1492 1492 a, g dbSNP:761817241
1493 1493 c, t dbSNP:137901490
1495 1495 c, t dbSNP:773121199
1499 1499 g, t dbSNP:201866779
1503 1503 c, t dbSNP:766131954
1507 1507 a, g dbSNP:754110095
1513 1513 a, g dbSNP:4149143
1515 1515 a, g dbSNP:765389916
1530 1530 a, g, t dbSNP:376788743
1531 1531 c, t dbSNP:369799686
1532 1532 a, g dbSNP:141602442
1544 1544 c, g dbSNP:373665461
1545 1545 c, g, t dbSNP:781670225
1549 1549 c, t dbSNP:147428265
1550 1550 a, g dbSNP:61673910
1554 1554 c, t dbSNP:189943255
1569 1569 a, g dbSNP:771567653
1570 1570 -, g dbSNP:757283245
1572 1572 c, g dbSNP:773176181
1587 1587 c, t dbSNP:770786729
1588 1588 a, g dbSNP:79382866
1605 1605 c, g dbSNP:759306295
1607 1607 -, cttt dbSNP:750689785
1607 1607 c, t dbSNP:61736817
1612 1612 c, t dbSNP:775611499
1614 1614 a, g dbSNP:140093214
1615 1615 c, t dbSNP:764288827
1616 1616 g, t dbSNP:751626701
1619 1619 a, c dbSNP:762425576
1623 1623 c, t dbSNP:768200691
1626 1626 a, g dbSNP:750939881
1628 1628 c, t dbSNP:756476255
1631 1631 a, g dbSNP:780443920
1640 1640 a, g dbSNP:774420889
1641 1641 -, aa dbSNP:758647195
1643 1643 a, g dbSNP:752317541
1655 1655 c, t dbSNP:758007322
1658 1658 -, g dbSNP:780598056
1662 1662 c, g dbSNP:777268338
1663 1663 a, t dbSNP:746455717
1669 1669 a, c dbSNP:545985727
1672 1672 c, t dbSNP:781056623
1674 1674 a, g dbSNP:745782791
1678 1678 a, t dbSNP:769522037
1683 1683 a, g dbSNP:562512647
1685 1685 c, t dbSNP:377513667
1697 1697 c, g dbSNP:768944324
1701 1701 a, c dbSNP:774704176
1702 1702 a, g dbSNP:199802324
1707 1707 a, g dbSNP:762055285
1710 1710 a, g dbSNP:767603938
1721 1721 g, t dbSNP:762021606
1727 1727 a, g dbSNP:750941218
1729 1729 a, g dbSNP:761197805
1734 1734 a, g dbSNP:766687410
1751 1751 -, tg dbSNP:781537819
1755 1755 a, g dbSNP:751258776
1756 1756 c, t dbSNP:374081229
1760 1760 a, g dbSNP:756881404
1761 1761 c, t dbSNP:766964646
1773 1773 g, t dbSNP:749878853
1775 1775 a, c dbSNP:755570054
1777 1777 c, g, t dbSNP:780108531
1792 1792 c, g dbSNP:367949187
1795 1795 a, g dbSNP:371851895
1797 1797 c, t dbSNP:778801571
1798 1798 a, g dbSNP:2053098
1800 1800 a, c dbSNP:559692629
1802 1802 c, t dbSNP:773177256
1805 1805 g, t dbSNP:72559743
1806 1806 g, t dbSNP:747168973
1808 1808 g, t dbSNP:770910184
1809 1809 a, g dbSNP:777161969
1826 1826 a, t dbSNP:760009998
1828 1828 c, t dbSNP:765604189
1829 1829 c, t dbSNP:188500840
1830 1830 a, g, t dbSNP:761374022
1832 1832 a, c dbSNP:750041422
1834 1834 a, g dbSNP:142694767
1839 1839 a, g dbSNP:751785190
1851 1851 a, g dbSNP:150998576
1854 1854 g, t dbSNP:781244162
1854 1854 -, t dbSNP:748895350
1855 1855 c, t dbSNP:77851390
1856 1856 a, c, g dbSNP:536840499
1858 1858 a, g dbSNP:758114390
1860 1860 c, t dbSNP:778122196
1864 1864 a, c dbSNP:747167552
1868 1868 -, ata dbSNP:770351889
1869 1869 c, t dbSNP:771090568
1870 1870 a, g dbSNP:781196802
1873 1873 c, t dbSNP:746402204
1875 1875 -, t dbSNP:540136411
1876 1876 -, tt dbSNP:745540438
1878 1878 -, t dbSNP:78627909
1884 1884 c, g dbSNP:770216729
1886 1886 c, g dbSNP:550694241
1889 1889 a, g dbSNP:144378120
1891 1891 -, agg dbSNP:771669768
1891 1891 a, g dbSNP:763443499
1906 1906 -, tatc dbSNP:775300015
1907 1907 a, t dbSNP:768874170
1911 1911 g, t dbSNP:772969481
1912 1912 a, g dbSNP:201358042
1913 1913 c, t dbSNP:766019973
1920 1920 c, t dbSNP:12299012
1921 1921 g, t dbSNP:759562554
1926 1926 c, t dbSNP:764807968
1935 1935 c, t dbSNP:775545812
1937 1937 a, g dbSNP:762749463
1946 1946 a, g dbSNP:763975880
1952 1952 g, t dbSNP:751243428
1953 1953 c, g dbSNP:76963574
1955 1955 a, g dbSNP:564235948
1961 1961 c, t dbSNP:369136047
1968 1968 c, g dbSNP:756237829
1982 1982 a, g dbSNP:779952599
1983 1983 a, c dbSNP:369584908
1984 1984 a, g dbSNP:749836485
1992 1992 a, g dbSNP:748633316
2003 2003 c, g dbSNP:758882062
2006 2006 -, at dbSNP:758736697
2006 2006 a, g dbSNP:369164160
2010 2010 a, t dbSNP:745546173
2013 2013 g, t dbSNP:769260347
2015 2015 g, t dbSNP:143362002
2020 2020 g, t dbSNP:779626518
2030 2030 a, g dbSNP:748804554
2033 2033 a, c dbSNP:768205361
2035 2035 -, at dbSNP:766686725
2035 2035 a, g dbSNP:774324756
2040 2040 c, t dbSNP:761692269
2045 2045 c, t dbSNP:771888713
2047 2047 a, g dbSNP:550941268
2050 2050 c, g dbSNP:137912239
2051 2051 a, g dbSNP:766569013
2061 2061 a, g dbSNP:754088334
2062 2062 c, t dbSNP:759572122
2068 2068 -, acaa dbSNP:752019947
2070 2070 a, g dbSNP:765336801
2073 2073 c, g dbSNP:753277905
2074 2074 a, g dbSNP:3764006
2089 2089 a, t dbSNP:778282307
2095 2095 c, t dbSNP:551215380
2096 2096 a, g dbSNP:202234562
2098 2098 -, t dbSNP:755293643
2098 2098 a, t dbSNP:143827641
2102 2102 c, t dbSNP:77265855
2104 2104 g, t dbSNP:748950766
2113 2113 c, t dbSNP:763191268
2114 2114 a, t dbSNP:764236010
2115 2115 a, g dbSNP:774744529
2116 2116 a, c dbSNP:200412791
2120 2120 g, t dbSNP:762342274
2122 2122 c, t dbSNP:267603413
2125 2125 a, g dbSNP:767778205
2127 2127 a, c dbSNP:750741931
2129 2129 a, g dbSNP:756425274
2148 2148 a, c dbSNP:764940356
2150 2150 c, t dbSNP:376393874
2151 2151 c, t dbSNP:757955904
2158 2158 a, g dbSNP:370819902
2163 2163 c, t dbSNP:374189599
2165 2165 a, g dbSNP:550497909
2180 2180 a, c dbSNP:556554798
2184 2184 a, c, g, t dbSNP:200774414
2185 2185 g, t dbSNP:561006699
2190 2190 a, c dbSNP:749497062
2205 2205 a, g dbSNP:371574727
2215 2215 a, g dbSNP:774423704
2217 2217 c, t dbSNP:200539697
2218 2218 a, g dbSNP:60571683
2221 2221 c, t dbSNP:773592598
2223 2223 a, g dbSNP:367827357
2227 2227 a, g dbSNP:766711405
2229 2229 a, g dbSNP:371725645
2233 2233 a, g dbSNP:758003128
2237 2237 a, g dbSNP:763595105
2239 2239 a, g, t dbSNP:751019442
2243 2243 a, g dbSNP:267603414
2245 2245 a, g dbSNP:746710534
2247 2247 c, t dbSNP:750296032
2250 2250 a, c dbSNP:566619114
2254 2254 a, t dbSNP:779957534
2265 2265 a, g dbSNP:772110432
2271 2271 g, t dbSNP:768942214
2275 2275 a, g dbSNP:778990288
2276 2276 c, t dbSNP:748331222
2282 2282 a, g dbSNP:377270851
2283 2283 c, t dbSNP:773820352
2286 2286 a, c dbSNP:761123903
2302 2302 c, t dbSNP:771314014
2315 2315 a, c dbSNP:776910888
2316 2316 a, g dbSNP:538452274
2324 2324 -, c dbSNP:72559744
2330 2330 a, g dbSNP:762603384
2331 2331 a, g dbSNP:143038862
2332 2332 a, c dbSNP:751167812
2338 2338 a, t dbSNP:761426618
2346 2346 a, g dbSNP:368439565
2348 2348 c, t dbSNP:754496605
2349 2349 a, t dbSNP:750407454
2352 2352 a, g dbSNP:756051143
2358 2358 c, t dbSNP:372418887
2365 2365 a, t dbSNP:753744600
2370 2370 a, g dbSNP:754816901
2379 2379 g, t dbSNP:779239464
2382 2382 g, t dbSNP:748299846
2384 2384 c, g dbSNP:376969190
2385 2385 g, t dbSNP:777677238
2386 2386 c, g, t dbSNP:747516576
2390 2390 a, c dbSNP:777104935
2400 2400 a, c dbSNP:369766680
2419 2419 c, t dbSNP:538738277
2463 2463 a, g dbSNP:760564389
2468 2468 a, g dbSNP:112861267
2486 2486 c, t dbSNP:766036895
2493 2493 a, g dbSNP:188100388
2495 2495 g, t dbSNP:112931172
2507 2507 c, g dbSNP:552798414
2578 2578 a, g dbSNP:759763921
2622 2622 a, g dbSNP:568909978
2626 2626 c, t dbSNP:537823550
2645 2645 a, g dbSNP:569431797
2668 2668 a, c dbSNP:145346893
2686 2686 c, t dbSNP:575053126
2689 2689 c, g dbSNP:191491660
2697 2697 -, a dbSNP:3834935
2705 2705 -, a dbSNP:397689574
2849 2849 c, t dbSNP:369234665
2859 2859 c, t dbSNP:554075376
2890 2890 a, g dbSNP:758379038
2898 2898 a, t dbSNP:117703648
2912 2912 g, t dbSNP:545934577
2922 2922 a, g dbSNP:147670653
2946 2946 c, t dbSNP:764711410
2960 2960 a, g dbSNP:751963988
2972 2972 a, g dbSNP:555196020
2977 2977 a, g dbSNP:79132805
2992 2992 a, g dbSNP:77957556
3009 3009 a, g dbSNP:377573287

Target ORF information:

RefSeq Version NM_019844
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


OATP1B3 is expressed in pancreatic beta-islet cells and enhances the insulinotropic effect of the sulfonylurea derivative glibenclamide
Diabetes 63 (2), 775-784 (2014)
Meyer Zu Schwabedissen HE, Boettcher K, Steiner T, Schwarz UI, Keiser M, Kroemer HK and Siegmund W.


Role of hypoxia inducible factor-1alpha in the regulation of the cancer-specific variant of organic anion transporting polypeptide 1B3 (OATP1B3), in colon and pancreatic cancer
Biochem. Pharmacol. 86 (6), 816-823 (2013)
Han S, Kim K, Thakkar N, Kim D and Lee W.


Effects of Rifampin, a potent inducer of drug-metabolizing enzymes and an inhibitor of OATP1B1/3 transport, on the single dose pharmacokinetics of anacetrapib
J Clin Pharmacol 53 (7), 746-752 (2013)
Anderson MS, Cote J, Liu Y, Stypinski D, Auger P, Hohnstein A, Rasmussen S, Johnson-Levonas AO and Gutstein DE.


Prognostic value of organic anion transporting polypeptide 1B3 and copper transporter 1 expression in endometrial cancer patients treated with paclitaxel and carboplatin
Biomed. Res. 34 (3), 143-151 (2013)
Ogane N, Yasuda M, Kameda Y, Yokose T, Kato H, Itoh A, Nishino S, Hashimoto Y and Kamoshida S.


Complete OATP1B1 and OATP1B3 deficiency causes human Rotor syndrome by interrupting conjugated bilirubin reuptake into the liver
J. Clin. Invest. 122 (2), 519-528 (2012)
van de Steeg E, Stranecky V, Hartmannova H, Noskova L, Hrebicek M, Wagenaar E, van Esch A, de Waart DR, Oude Elferink RP, Kenworthy KE, Sticova E, al-Edreesi M, Knisely AS, Kmoch S, Jirsa M and Schinkel AH.


Hepatic uptake of cholecystokinin octapeptide by organic anion-transporting polypeptides OATP4 and OATP8 of rat and human liver
Gastroenterology 121 (5), 1185-1190 (2001)
Ismair MG, Stieger B, Cattori V, Hagenbuch B, Fried M, Meier PJ and Kullak-Ublick GA.


LST-2, a human liver-specific organic anion transporter, determines methotrexate sensitivity in gastrointestinal cancers
Gastroenterology 120 (7), 1689-1699 (2001)
Abe T, Unno M, Onogawa T, Tokui T, Kondo TN, Nakagomi R, Adachi H, Fujiwara K, Okabe M, Suzuki T, Nunoki K, Sato E, Kakyo M, Nishio T, Sugita J, Asano N, Tanemoto M, Seki M, Date F, Ono K, Kondo Y, Shiiba K, Suzuki M, Ohtani H, Shimosegawa T, Iinuma K, Nagura H, Ito S and Matsuno S.


Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver
Gastroenterology 120 (2), 525-533 (2001)
Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ and Hagenbuch B.


Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide
J. Biol. Chem. 275 (30), 23161-23168 (2000)
Konig J, Cui Y, Nies AT and Keppler D.


Rotor Syndrome
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Jirsa,M., Knisely,A.S., Schinkel,A. and Kmoch,S.
