Home » Species Summary » Homo sapiens » HARBI1 cDNA ORF clone
Email to GenScript

HARBI1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol HARBI1
Entrez Gene ID 283254
Full Name harbinger transposase derived 1
Synonyms C11orf77
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
XM_011520025 XP_011518327 putative nuclease HARBI1 isoform X1
XM_011520026 XP_011518328 putative nuclease HARBI1 isoform X1
XM_011520027 XP_011518329 putative nuclease HARBI1 isoform X1
XM_011520028 XP_011518330 putative nuclease HARBI1 isoform X1
XM_011520029 XP_011518331 putative nuclease HARBI1 isoform X1
NM_173811 NP_776172 putative nuclease HARBI1

Homo sapiens (human) HARBI1 NP_776172.1
Pan troglodytes (chimpanzee) HARBI1 XP_521904.2
Macaca mulatta (Rhesus monkey) HARBI1 XP_001111962.1
Canis lupus familiaris (dog) HARBI1 XP_005631343.1
Bos taurus (cattle) HARBI1 NP_001069136.1
Mus musculus (house mouse) Harbi1 NP_848839.2
Rattus norvegicus (Norway rat) Harbi1 NP_001107265.2
Gallus gallus (chicken) HARBI1 XP_421117.1
Danio rerio (zebrafish) harbi1 NP_001003734.1
Arabidopsis thaliana (thale cress) AT3G55350 NP_191095.1
Xenopus (Silurana) tropicalis (western clawed frog) LOC100493758 XP_004913441.1


ID Name Evidence
GO:0005634 nucleus IEA
GO:0005737 cytoplasm IEA


ID Name Evidence
GO:0004518 nuclease activity IEA
GO:0046872 metal ion binding IEA

The following HARBI1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HARBI1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu78567 XM_011520025 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu78567 XM_011520026 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu78567 XM_011520027 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu78567 XM_011520028 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu78567 XM_011520029 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
NM_173811 Homo sapiens harbinger transposase derived 1 (HARBI1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu78567
Accession Version XM_011520025.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)690..1232(+)
Position Chain Variation Link
5 5 c, t dbSNP:191845906
19 19 c, t dbSNP:565018957
28 28 g, t dbSNP:546033588
105 105 a, c dbSNP:372076348
120 120 c, t dbSNP:545102921
123 123 c, t dbSNP:142624067
136 136 c, t dbSNP:77282744
147 147 c, t dbSNP:540502683
152 152 -, a dbSNP:368892119
217 217 a, g dbSNP:775330218
232 232 c, t dbSNP:778701567
235 235 c, t dbSNP:757015866
241 241 c, t dbSNP:749250437
253 253 c, t dbSNP:777755222
255 255 a, t dbSNP:574779129
267 267 a, g dbSNP:201911231
276 276 c, t dbSNP:78052875
284 284 a, c dbSNP:752259058
292 292 a, g dbSNP:767098401
293 293 c, t dbSNP:754704432
297 297 c, t dbSNP:753077232
298 298 a, g dbSNP:751231721
301 301 c, g dbSNP:199752792
305 305 c, g dbSNP:544156097
307 307 a, g dbSNP:763369583
308 308 g, t dbSNP:773647701
331 331 a, g dbSNP:375003116
335 335 g, t dbSNP:762158904
353 353 g, t dbSNP:776722319
358 358 c, t dbSNP:768672905
360 360 a, g dbSNP:747272767
362 362 a, g dbSNP:775686124
368 368 a, g dbSNP:575249184
373 373 c, t dbSNP:117030196
375 375 c, t dbSNP:777367207
376 376 a, g dbSNP:139581343
391 391 a, g dbSNP:372565562
393 393 c, t dbSNP:780902440
406 406 g, t dbSNP:539145552
408 408 a, g dbSNP:751319655
411 411 a, g dbSNP:779837091
416 416 g, t dbSNP:757926662
420 420 -, t dbSNP:772932628
429 429 a, g dbSNP:750803133
439 439 a, c dbSNP:765476628
441 441 a, t dbSNP:762405252
444 444 g, t dbSNP:145989752
446 446 -, t dbSNP:747294798
447 447 a, g dbSNP:764226942
464 464 g, t dbSNP:142862456
466 466 g, t dbSNP:760731188
469 469 -, cccaaagtgctgggattacaggcg dbSNP:771717143
473 473 -, t dbSNP:778684067
474 474 a, g dbSNP:759785243
478 478 g, t dbSNP:774584740
487 487 -, a dbSNP:754962032
490 490 c, t dbSNP:772345259
493 493 c, t dbSNP:115211185
494 494 a, g dbSNP:773083925
497 497 c, t dbSNP:766489500
508 508 c, g dbSNP:748132707
510 510 c, t dbSNP:781266899
511 511 a, c, g dbSNP:553116745
512 512 g, t dbSNP:779362941
517 517 c, g dbSNP:758098724
519 519 c, g dbSNP:749994307
523 523 c, t dbSNP:779382512
527 527 g, t dbSNP:536492639
536 536 c, t dbSNP:754400630
541 541 c, t dbSNP:367948574
542 542 a, g dbSNP:763131121
546 546 -, at dbSNP:749360535
546 546 a, g dbSNP:374607995
548 548 a, g dbSNP:577458840
555 555 -, tgt dbSNP:780177490
555 555 c, t dbSNP:371776479
562 562 c, t dbSNP:759855163
568 568 c, t dbSNP:146331633
572 572 c, t dbSNP:769693436
575 575 a, c dbSNP:367932622
582 582 c, g dbSNP:761683338
583 583 c, t dbSNP:776508559
590 590 a, g dbSNP:183446599
614 614 a, t dbSNP:746902117
616 616 a, c, t dbSNP:745401140
628 628 c, t dbSNP:141436294
630 630 a, g dbSNP:745573978
634 634 a, c, g dbSNP:756846129
635 635 a, g dbSNP:749659169
636 636 g, t dbSNP:778073952
637 637 c, t dbSNP:756640162
639 639 c, t dbSNP:148523303
642 642 a, g dbSNP:767679662
644 644 g, t dbSNP:755011918
646 646 a, g dbSNP:751861091
655 655 a, g dbSNP:148294520
663 663 c, g dbSNP:763197607
666 666 a, g dbSNP:143406663
667 667 c, g dbSNP:367552499
675 675 a, g dbSNP:763931346
677 677 c, g, t dbSNP:775259761
680 680 -, g dbSNP:756192790
683 683 a, g dbSNP:771670880
697 697 a, g dbSNP:745384168
709 709 c, g dbSNP:773846623
716 716 c, g dbSNP:770603042
724 724 a, g dbSNP:748893856
740 740 a, c dbSNP:571242324
743 743 c, t dbSNP:373717082
750 750 a, c, t dbSNP:149210113
754 754 a, g dbSNP:755452054
766 766 c, t dbSNP:751591792
782 782 a, g dbSNP:766524874
791 791 a, c dbSNP:138485412
792 792 a, c dbSNP:750650747
800 800 -, g dbSNP:758875912
807 807 a, g dbSNP:764019374
808 808 c, t dbSNP:760542239
812 812 c, t dbSNP:775298236
813 813 a, g dbSNP:746885615
817 817 a, g dbSNP:199580977
828 828 c, t dbSNP:200844501
830 830 c, t dbSNP:147076911
831 831 a, g dbSNP:748982160
834 834 a, t dbSNP:772850336
836 836 c, g dbSNP:559220162
837 837 c, t dbSNP:770206258
839 839 a, g dbSNP:748471285
841 841 a, g dbSNP:141749998
848 848 c, t dbSNP:769072419
861 861 c, g dbSNP:540421345
870 870 c, t dbSNP:147599879
872 872 c, t dbSNP:201216223
873 873 a, g dbSNP:758521139
874 874 c, g dbSNP:750740861
889 889 c, t dbSNP:779291856
895 895 c, t dbSNP:112306737
902 902 a, g dbSNP:376539269
907 907 a, g dbSNP:752467095
913 913 c, t dbSNP:767296960
923 923 c, g dbSNP:569804974
926 926 c, t dbSNP:564645431
941 941 a, t dbSNP:77916215
994 994 g, t dbSNP:527488319
1009 1009 c, g dbSNP:568221882
1012 1012 c, t dbSNP:201053799
1023 1023 c, t dbSNP:376775860
1024 1024 a, g dbSNP:768834410
1035 1035 a, g dbSNP:751559458
1040 1040 a, c, g dbSNP:762806216
1042 1042 c, t dbSNP:749963131
1054 1054 -, c dbSNP:750559477
1059 1059 -, a dbSNP:767808341
1061 1061 c, t dbSNP:774316986
1064 1064 a, g dbSNP:764752529
1070 1070 a, g dbSNP:761419195
1074 1074 c, t dbSNP:201851329
1076 1076 a, c dbSNP:768968034
1077 1077 c, t dbSNP:373268202
1078 1078 a, g dbSNP:149901165
1079 1079 c, t dbSNP:569103656
1109 1109 a, g dbSNP:746329801
1125 1125 a, c dbSNP:774624321
1126 1126 a, c, g dbSNP:749543356
1134 1134 c, t dbSNP:778046623
1135 1135 a, g dbSNP:756237096
1138 1138 c, t dbSNP:746807126
1139 1139 c, t dbSNP:779781353
1140 1140 c, t dbSNP:758350757
1141 1141 a, g dbSNP:750335756
1146 1146 c, t dbSNP:369296929
1147 1147 a, g, t dbSNP:753491100
1156 1156 a, g dbSNP:763820437
1163 1163 c, t dbSNP:760364372
1168 1168 a, g dbSNP:376874771
1169 1169 g, t dbSNP:767973635
1178 1178 a, g dbSNP:760162320
1180 1180 a, t dbSNP:780093447
1189 1189 a, g dbSNP:774919964
1194 1194 a, c, t dbSNP:75201515
1195 1195 c, t dbSNP:773103636
1202 1202 c, t dbSNP:770082532
1204 1204 c, t dbSNP:748317544
1213 1213 c, t dbSNP:779875591
1214 1214 c, t dbSNP:758160529
1216 1216 c, g dbSNP:745873713
1217 1217 c, t dbSNP:778897133
1229 1229 a, c dbSNP:757084968
1233 1233 a, g dbSNP:753419895
1235 1235 c, t dbSNP:763462311
1237 1237 c, t dbSNP:770866746
1239 1239 c, t dbSNP:763967077
1242 1242 c, g dbSNP:752364425
1251 1251 a, g dbSNP:768059419
1268 1268 a, t dbSNP:759963705
1271 1271 a, c, g dbSNP:185640614
1273 1273 g, t dbSNP:373418691
1281 1281 c, t dbSNP:377297419
1283 1283 c, t dbSNP:372811398
1290 1290 c, t dbSNP:369696306
1296 1296 c, g dbSNP:762065869
1298 1298 a, g dbSNP:201752855
1299 1299 a, g dbSNP:771913231
1302 1302 a, g dbSNP:745677263
1305 1305 a, g dbSNP:201248157
1310 1310 c, g, t dbSNP:749157398
1312 1312 a, t dbSNP:777381633
1314 1314 c, t dbSNP:140123366
1321 1321 a, g dbSNP:752452401
1322 1322 a, g dbSNP:35569076
1344 1344 c, t dbSNP:529843288
1345 1345 a, g dbSNP:562293059
1350 1350 c, t dbSNP:766607928
1351 1351 a, c, g dbSNP:371969577
1356 1356 a, g dbSNP:765370645
1362 1362 a, g dbSNP:761869794
1383 1383 c, t dbSNP:776636016
1387 1387 c, g dbSNP:768871024
1393 1393 a, g dbSNP:755986675
1411 1411 c, t dbSNP:202159962
1419 1419 c, t dbSNP:770599417
1427 1427 a, c dbSNP:11038934
1433 1433 c, t dbSNP:556584273
1533 1533 c, g dbSNP:752403768
1570 1570 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520025
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu78567
Accession Version XM_011520026.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)674..1216(+)
Position Chain Variation Link
23 23 g, t dbSNP:140143793
27 27 c, t dbSNP:560889603
28 28 c, t dbSNP:762321504
43 43 -, ga dbSNP:555848238
44 44 -, gaga dbSNP:113299100
45 45 -, ga dbSNP:759709291
46 46 -, ga dbSNP:367729861
47 47 -, ga dbSNP:144543788
89 89 a, c dbSNP:372076348
104 104 c, t dbSNP:545102921
107 107 c, t dbSNP:142624067
120 120 c, t dbSNP:77282744
131 131 c, t dbSNP:540502683
136 136 -, a dbSNP:368892119
201 201 a, g dbSNP:775330218
216 216 c, t dbSNP:778701567
219 219 c, t dbSNP:757015866
225 225 c, t dbSNP:749250437
237 237 c, t dbSNP:777755222
239 239 a, t dbSNP:574779129
251 251 a, g dbSNP:201911231
260 260 c, t dbSNP:78052875
268 268 a, c dbSNP:752259058
276 276 a, g dbSNP:767098401
277 277 c, t dbSNP:754704432
281 281 c, t dbSNP:753077232
282 282 a, g dbSNP:751231721
285 285 c, g dbSNP:199752792
289 289 c, g dbSNP:544156097
291 291 a, g dbSNP:763369583
292 292 g, t dbSNP:773647701
315 315 a, g dbSNP:375003116
319 319 g, t dbSNP:762158904
337 337 g, t dbSNP:776722319
342 342 c, t dbSNP:768672905
344 344 a, g dbSNP:747272767
346 346 a, g dbSNP:775686124
352 352 a, g dbSNP:575249184
357 357 c, t dbSNP:117030196
359 359 c, t dbSNP:777367207
360 360 a, g dbSNP:139581343
375 375 a, g dbSNP:372565562
377 377 c, t dbSNP:780902440
390 390 g, t dbSNP:539145552
392 392 a, g dbSNP:751319655
395 395 a, g dbSNP:779837091
400 400 g, t dbSNP:757926662
404 404 -, t dbSNP:772932628
413 413 a, g dbSNP:750803133
423 423 a, c dbSNP:765476628
425 425 a, t dbSNP:762405252
428 428 g, t dbSNP:145989752
430 430 -, t dbSNP:747294798
431 431 a, g dbSNP:764226942
448 448 g, t dbSNP:142862456
450 450 g, t dbSNP:760731188
453 453 -, cccaaagtgctgggattacaggcg dbSNP:771717143
457 457 -, t dbSNP:778684067
458 458 a, g dbSNP:759785243
462 462 g, t dbSNP:774584740
471 471 -, a dbSNP:754962032
474 474 c, t dbSNP:772345259
477 477 c, t dbSNP:115211185
478 478 a, g dbSNP:773083925
481 481 c, t dbSNP:766489500
492 492 c, g dbSNP:748132707
494 494 c, t dbSNP:781266899
495 495 a, c, g dbSNP:553116745
496 496 g, t dbSNP:779362941
501 501 c, g dbSNP:758098724
503 503 c, g dbSNP:749994307
507 507 c, t dbSNP:779382512
511 511 g, t dbSNP:536492639
520 520 c, t dbSNP:754400630
525 525 c, t dbSNP:367948574
526 526 a, g dbSNP:763131121
530 530 -, at dbSNP:749360535
530 530 a, g dbSNP:374607995
532 532 a, g dbSNP:577458840
539 539 -, tgt dbSNP:780177490
539 539 c, t dbSNP:371776479
546 546 c, t dbSNP:759855163
552 552 c, t dbSNP:146331633
556 556 c, t dbSNP:769693436
559 559 a, c dbSNP:367932622
566 566 c, g dbSNP:761683338
567 567 c, t dbSNP:776508559
574 574 a, g dbSNP:183446599
598 598 a, t dbSNP:746902117
600 600 a, c, t dbSNP:745401140
612 612 c, t dbSNP:141436294
614 614 a, g dbSNP:745573978
618 618 a, c, g dbSNP:756846129
619 619 a, g dbSNP:749659169
620 620 g, t dbSNP:778073952
621 621 c, t dbSNP:756640162
623 623 c, t dbSNP:148523303
626 626 a, g dbSNP:767679662
628 628 g, t dbSNP:755011918
630 630 a, g dbSNP:751861091
639 639 a, g dbSNP:148294520
647 647 c, g dbSNP:763197607
650 650 a, g dbSNP:143406663
651 651 c, g dbSNP:367552499
659 659 a, g dbSNP:763931346
661 661 c, g, t dbSNP:775259761
664 664 -, g dbSNP:756192790
667 667 a, g dbSNP:771670880
681 681 a, g dbSNP:745384168
693 693 c, g dbSNP:773846623
700 700 c, g dbSNP:770603042
708 708 a, g dbSNP:748893856
724 724 a, c dbSNP:571242324
727 727 c, t dbSNP:373717082
734 734 a, c, t dbSNP:149210113
738 738 a, g dbSNP:755452054
750 750 c, t dbSNP:751591792
766 766 a, g dbSNP:766524874
775 775 a, c dbSNP:138485412
776 776 a, c dbSNP:750650747
784 784 -, g dbSNP:758875912
791 791 a, g dbSNP:764019374
792 792 c, t dbSNP:760542239
796 796 c, t dbSNP:775298236
797 797 a, g dbSNP:746885615
801 801 a, g dbSNP:199580977
812 812 c, t dbSNP:200844501
814 814 c, t dbSNP:147076911
815 815 a, g dbSNP:748982160
818 818 a, t dbSNP:772850336
820 820 c, g dbSNP:559220162
821 821 c, t dbSNP:770206258
823 823 a, g dbSNP:748471285
825 825 a, g dbSNP:141749998
832 832 c, t dbSNP:769072419
845 845 c, g dbSNP:540421345
854 854 c, t dbSNP:147599879
856 856 c, t dbSNP:201216223
857 857 a, g dbSNP:758521139
858 858 c, g dbSNP:750740861
873 873 c, t dbSNP:779291856
879 879 c, t dbSNP:112306737
886 886 a, g dbSNP:376539269
891 891 a, g dbSNP:752467095
897 897 c, t dbSNP:767296960
907 907 c, g dbSNP:569804974
910 910 c, t dbSNP:564645431
925 925 a, t dbSNP:77916215
978 978 g, t dbSNP:527488319
993 993 c, g dbSNP:568221882
996 996 c, t dbSNP:201053799
1007 1007 c, t dbSNP:376775860
1008 1008 a, g dbSNP:768834410
1019 1019 a, g dbSNP:751559458
1024 1024 a, c, g dbSNP:762806216
1026 1026 c, t dbSNP:749963131
1038 1038 -, c dbSNP:750559477
1043 1043 -, a dbSNP:767808341
1045 1045 c, t dbSNP:774316986
1048 1048 a, g dbSNP:764752529
1054 1054 a, g dbSNP:761419195
1058 1058 c, t dbSNP:201851329
1060 1060 a, c dbSNP:768968034
1061 1061 c, t dbSNP:373268202
1062 1062 a, g dbSNP:149901165
1063 1063 c, t dbSNP:569103656
1093 1093 a, g dbSNP:746329801
1109 1109 a, c dbSNP:774624321
1110 1110 a, c, g dbSNP:749543356
1118 1118 c, t dbSNP:778046623
1119 1119 a, g dbSNP:756237096
1122 1122 c, t dbSNP:746807126
1123 1123 c, t dbSNP:779781353
1124 1124 c, t dbSNP:758350757
1125 1125 a, g dbSNP:750335756
1130 1130 c, t dbSNP:369296929
1131 1131 a, g, t dbSNP:753491100
1140 1140 a, g dbSNP:763820437
1147 1147 c, t dbSNP:760364372
1152 1152 a, g dbSNP:376874771
1153 1153 g, t dbSNP:767973635
1162 1162 a, g dbSNP:760162320
1164 1164 a, t dbSNP:780093447
1173 1173 a, g dbSNP:774919964
1178 1178 a, c, t dbSNP:75201515
1179 1179 c, t dbSNP:773103636
1186 1186 c, t dbSNP:770082532
1188 1188 c, t dbSNP:748317544
1197 1197 c, t dbSNP:779875591
1198 1198 c, t dbSNP:758160529
1200 1200 c, g dbSNP:745873713
1201 1201 c, t dbSNP:778897133
1213 1213 a, c dbSNP:757084968
1217 1217 a, g dbSNP:753419895
1219 1219 c, t dbSNP:763462311
1221 1221 c, t dbSNP:770866746
1223 1223 c, t dbSNP:763967077
1226 1226 c, g dbSNP:752364425
1235 1235 a, g dbSNP:768059419
1252 1252 a, t dbSNP:759963705
1255 1255 a, c, g dbSNP:185640614
1257 1257 g, t dbSNP:373418691
1265 1265 c, t dbSNP:377297419
1267 1267 c, t dbSNP:372811398
1274 1274 c, t dbSNP:369696306
1280 1280 c, g dbSNP:762065869
1282 1282 a, g dbSNP:201752855
1283 1283 a, g dbSNP:771913231
1286 1286 a, g dbSNP:745677263
1289 1289 a, g dbSNP:201248157
1294 1294 c, g, t dbSNP:749157398
1296 1296 a, t dbSNP:777381633
1298 1298 c, t dbSNP:140123366
1305 1305 a, g dbSNP:752452401
1306 1306 a, g dbSNP:35569076
1328 1328 c, t dbSNP:529843288
1329 1329 a, g dbSNP:562293059
1334 1334 c, t dbSNP:766607928
1335 1335 a, c, g dbSNP:371969577
1340 1340 a, g dbSNP:765370645
1346 1346 a, g dbSNP:761869794
1367 1367 c, t dbSNP:776636016
1371 1371 c, g dbSNP:768871024
1377 1377 a, g dbSNP:755986675
1395 1395 c, t dbSNP:202159962
1403 1403 c, t dbSNP:770599417
1411 1411 a, c dbSNP:11038934
1417 1417 c, t dbSNP:556584273
1517 1517 c, g dbSNP:752403768
1554 1554 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520026
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu78567
Accession Version XM_011520027.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)701..1243(+)
Position Chain Variation Link
8 8 a, g dbSNP:140480224
85 85 a, g dbSNP:147184903
116 116 a, c dbSNP:372076348
131 131 c, t dbSNP:545102921
134 134 c, t dbSNP:142624067
147 147 c, t dbSNP:77282744
158 158 c, t dbSNP:540502683
163 163 -, a dbSNP:368892119
228 228 a, g dbSNP:775330218
243 243 c, t dbSNP:778701567
246 246 c, t dbSNP:757015866
252 252 c, t dbSNP:749250437
264 264 c, t dbSNP:777755222
266 266 a, t dbSNP:574779129
278 278 a, g dbSNP:201911231
287 287 c, t dbSNP:78052875
295 295 a, c dbSNP:752259058
303 303 a, g dbSNP:767098401
304 304 c, t dbSNP:754704432
308 308 c, t dbSNP:753077232
309 309 a, g dbSNP:751231721
312 312 c, g dbSNP:199752792
316 316 c, g dbSNP:544156097
318 318 a, g dbSNP:763369583
319 319 g, t dbSNP:773647701
342 342 a, g dbSNP:375003116
346 346 g, t dbSNP:762158904
364 364 g, t dbSNP:776722319
369 369 c, t dbSNP:768672905
371 371 a, g dbSNP:747272767
373 373 a, g dbSNP:775686124
379 379 a, g dbSNP:575249184
384 384 c, t dbSNP:117030196
386 386 c, t dbSNP:777367207
387 387 a, g dbSNP:139581343
402 402 a, g dbSNP:372565562
404 404 c, t dbSNP:780902440
417 417 g, t dbSNP:539145552
419 419 a, g dbSNP:751319655
422 422 a, g dbSNP:779837091
427 427 g, t dbSNP:757926662
431 431 -, t dbSNP:772932628
440 440 a, g dbSNP:750803133
450 450 a, c dbSNP:765476628
452 452 a, t dbSNP:762405252
455 455 g, t dbSNP:145989752
457 457 -, t dbSNP:747294798
458 458 a, g dbSNP:764226942
475 475 g, t dbSNP:142862456
477 477 g, t dbSNP:760731188
480 480 -, cccaaagtgctgggattacaggcg dbSNP:771717143
484 484 -, t dbSNP:778684067
485 485 a, g dbSNP:759785243
489 489 g, t dbSNP:774584740
498 498 -, a dbSNP:754962032
501 501 c, t dbSNP:772345259
504 504 c, t dbSNP:115211185
505 505 a, g dbSNP:773083925
508 508 c, t dbSNP:766489500
519 519 c, g dbSNP:748132707
521 521 c, t dbSNP:781266899
522 522 a, c, g dbSNP:553116745
523 523 g, t dbSNP:779362941
528 528 c, g dbSNP:758098724
530 530 c, g dbSNP:749994307
534 534 c, t dbSNP:779382512
538 538 g, t dbSNP:536492639
547 547 c, t dbSNP:754400630
552 552 c, t dbSNP:367948574
553 553 a, g dbSNP:763131121
557 557 -, at dbSNP:749360535
557 557 a, g dbSNP:374607995
559 559 a, g dbSNP:577458840
566 566 -, tgt dbSNP:780177490
566 566 c, t dbSNP:371776479
573 573 c, t dbSNP:759855163
579 579 c, t dbSNP:146331633
583 583 c, t dbSNP:769693436
586 586 a, c dbSNP:367932622
593 593 c, g dbSNP:761683338
594 594 c, t dbSNP:776508559
601 601 a, g dbSNP:183446599
625 625 a, t dbSNP:746902117
627 627 a, c, t dbSNP:745401140
639 639 c, t dbSNP:141436294
641 641 a, g dbSNP:745573978
645 645 a, c, g dbSNP:756846129
646 646 a, g dbSNP:749659169
647 647 g, t dbSNP:778073952
648 648 c, t dbSNP:756640162
650 650 c, t dbSNP:148523303
653 653 a, g dbSNP:767679662
655 655 g, t dbSNP:755011918
657 657 a, g dbSNP:751861091
666 666 a, g dbSNP:148294520
674 674 c, g dbSNP:763197607
677 677 a, g dbSNP:143406663
678 678 c, g dbSNP:367552499
686 686 a, g dbSNP:763931346
688 688 c, g, t dbSNP:775259761
691 691 -, g dbSNP:756192790
694 694 a, g dbSNP:771670880
708 708 a, g dbSNP:745384168
720 720 c, g dbSNP:773846623
727 727 c, g dbSNP:770603042
735 735 a, g dbSNP:748893856
751 751 a, c dbSNP:571242324
754 754 c, t dbSNP:373717082
761 761 a, c, t dbSNP:149210113
765 765 a, g dbSNP:755452054
777 777 c, t dbSNP:751591792
793 793 a, g dbSNP:766524874
802 802 a, c dbSNP:138485412
803 803 a, c dbSNP:750650747
811 811 -, g dbSNP:758875912
818 818 a, g dbSNP:764019374
819 819 c, t dbSNP:760542239
823 823 c, t dbSNP:775298236
824 824 a, g dbSNP:746885615
828 828 a, g dbSNP:199580977
839 839 c, t dbSNP:200844501
841 841 c, t dbSNP:147076911
842 842 a, g dbSNP:748982160
845 845 a, t dbSNP:772850336
847 847 c, g dbSNP:559220162
848 848 c, t dbSNP:770206258
850 850 a, g dbSNP:748471285
852 852 a, g dbSNP:141749998
859 859 c, t dbSNP:769072419
872 872 c, g dbSNP:540421345
881 881 c, t dbSNP:147599879
883 883 c, t dbSNP:201216223
884 884 a, g dbSNP:758521139
885 885 c, g dbSNP:750740861
900 900 c, t dbSNP:779291856
906 906 c, t dbSNP:112306737
913 913 a, g dbSNP:376539269
918 918 a, g dbSNP:752467095
924 924 c, t dbSNP:767296960
934 934 c, g dbSNP:569804974
937 937 c, t dbSNP:564645431
952 952 a, t dbSNP:77916215
1005 1005 g, t dbSNP:527488319
1020 1020 c, g dbSNP:568221882
1023 1023 c, t dbSNP:201053799
1034 1034 c, t dbSNP:376775860
1035 1035 a, g dbSNP:768834410
1046 1046 a, g dbSNP:751559458
1051 1051 a, c, g dbSNP:762806216
1053 1053 c, t dbSNP:749963131
1065 1065 -, c dbSNP:750559477
1070 1070 -, a dbSNP:767808341
1072 1072 c, t dbSNP:774316986
1075 1075 a, g dbSNP:764752529
1081 1081 a, g dbSNP:761419195
1085 1085 c, t dbSNP:201851329
1087 1087 a, c dbSNP:768968034
1088 1088 c, t dbSNP:373268202
1089 1089 a, g dbSNP:149901165
1090 1090 c, t dbSNP:569103656
1120 1120 a, g dbSNP:746329801
1136 1136 a, c dbSNP:774624321
1137 1137 a, c, g dbSNP:749543356
1145 1145 c, t dbSNP:778046623
1146 1146 a, g dbSNP:756237096
1149 1149 c, t dbSNP:746807126
1150 1150 c, t dbSNP:779781353
1151 1151 c, t dbSNP:758350757
1152 1152 a, g dbSNP:750335756
1157 1157 c, t dbSNP:369296929
1158 1158 a, g, t dbSNP:753491100
1167 1167 a, g dbSNP:763820437
1174 1174 c, t dbSNP:760364372
1179 1179 a, g dbSNP:376874771
1180 1180 g, t dbSNP:767973635
1189 1189 a, g dbSNP:760162320
1191 1191 a, t dbSNP:780093447
1200 1200 a, g dbSNP:774919964
1205 1205 a, c, t dbSNP:75201515
1206 1206 c, t dbSNP:773103636
1213 1213 c, t dbSNP:770082532
1215 1215 c, t dbSNP:748317544
1224 1224 c, t dbSNP:779875591
1225 1225 c, t dbSNP:758160529
1227 1227 c, g dbSNP:745873713
1228 1228 c, t dbSNP:778897133
1240 1240 a, c dbSNP:757084968
1244 1244 a, g dbSNP:753419895
1246 1246 c, t dbSNP:763462311
1248 1248 c, t dbSNP:770866746
1250 1250 c, t dbSNP:763967077
1253 1253 c, g dbSNP:752364425
1262 1262 a, g dbSNP:768059419
1279 1279 a, t dbSNP:759963705
1282 1282 a, c, g dbSNP:185640614
1284 1284 g, t dbSNP:373418691
1292 1292 c, t dbSNP:377297419
1294 1294 c, t dbSNP:372811398
1301 1301 c, t dbSNP:369696306
1307 1307 c, g dbSNP:762065869
1309 1309 a, g dbSNP:201752855
1310 1310 a, g dbSNP:771913231
1313 1313 a, g dbSNP:745677263
1316 1316 a, g dbSNP:201248157
1321 1321 c, g, t dbSNP:749157398
1323 1323 a, t dbSNP:777381633
1325 1325 c, t dbSNP:140123366
1332 1332 a, g dbSNP:752452401
1333 1333 a, g dbSNP:35569076
1355 1355 c, t dbSNP:529843288
1356 1356 a, g dbSNP:562293059
1361 1361 c, t dbSNP:766607928
1362 1362 a, c, g dbSNP:371969577
1367 1367 a, g dbSNP:765370645
1373 1373 a, g dbSNP:761869794
1394 1394 c, t dbSNP:776636016
1398 1398 c, g dbSNP:768871024
1404 1404 a, g dbSNP:755986675
1422 1422 c, t dbSNP:202159962
1430 1430 c, t dbSNP:770599417
1438 1438 a, c dbSNP:11038934
1444 1444 c, t dbSNP:556584273
1544 1544 c, g dbSNP:752403768
1581 1581 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520027
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu78567
Accession Version XM_011520028.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)919..1461(+)
Position Chain Variation Link
21 21 c, t dbSNP:545619141
38 38 a, c dbSNP:532286710
128 128 c, t dbSNP:560440788
134 134 c, t dbSNP:539847018
155 155 g, t dbSNP:367698316
159 159 a, c dbSNP:574379493
199 199 c, g dbSNP:28365974
201 201 a, g dbSNP:544341630
263 263 g, t dbSNP:576682604
264 264 c, t dbSNP:556773501
292 292 c, t dbSNP:540059893
297 297 a, g dbSNP:183754521
334 334 a, c dbSNP:372076348
349 349 c, t dbSNP:545102921
352 352 c, t dbSNP:142624067
365 365 c, t dbSNP:77282744
376 376 c, t dbSNP:540502683
381 381 -, a dbSNP:368892119
446 446 a, g dbSNP:775330218
461 461 c, t dbSNP:778701567
464 464 c, t dbSNP:757015866
470 470 c, t dbSNP:749250437
482 482 c, t dbSNP:777755222
484 484 a, t dbSNP:574779129
496 496 a, g dbSNP:201911231
505 505 c, t dbSNP:78052875
513 513 a, c dbSNP:752259058
521 521 a, g dbSNP:767098401
522 522 c, t dbSNP:754704432
526 526 c, t dbSNP:753077232
527 527 a, g dbSNP:751231721
530 530 c, g dbSNP:199752792
534 534 c, g dbSNP:544156097
536 536 a, g dbSNP:763369583
537 537 g, t dbSNP:773647701
560 560 a, g dbSNP:375003116
564 564 g, t dbSNP:762158904
582 582 g, t dbSNP:776722319
587 587 c, t dbSNP:768672905
589 589 a, g dbSNP:747272767
591 591 a, g dbSNP:775686124
597 597 a, g dbSNP:575249184
602 602 c, t dbSNP:117030196
604 604 c, t dbSNP:777367207
605 605 a, g dbSNP:139581343
620 620 a, g dbSNP:372565562
622 622 c, t dbSNP:780902440
635 635 g, t dbSNP:539145552
637 637 a, g dbSNP:751319655
640 640 a, g dbSNP:779837091
645 645 g, t dbSNP:757926662
649 649 -, t dbSNP:772932628
658 658 a, g dbSNP:750803133
668 668 a, c dbSNP:765476628
670 670 a, t dbSNP:762405252
673 673 g, t dbSNP:145989752
675 675 -, t dbSNP:747294798
676 676 a, g dbSNP:764226942
693 693 g, t dbSNP:142862456
695 695 g, t dbSNP:760731188
698 698 -, cccaaagtgctgggattacaggcg dbSNP:771717143
702 702 -, t dbSNP:778684067
703 703 a, g dbSNP:759785243
707 707 g, t dbSNP:774584740
716 716 -, a dbSNP:754962032
719 719 c, t dbSNP:772345259
722 722 c, t dbSNP:115211185
723 723 a, g dbSNP:773083925
726 726 c, t dbSNP:766489500
737 737 c, g dbSNP:748132707
739 739 c, t dbSNP:781266899
740 740 a, c, g dbSNP:553116745
741 741 g, t dbSNP:779362941
746 746 c, g dbSNP:758098724
748 748 c, g dbSNP:749994307
752 752 c, t dbSNP:779382512
756 756 g, t dbSNP:536492639
765 765 c, t dbSNP:754400630
770 770 c, t dbSNP:367948574
771 771 a, g dbSNP:763131121
775 775 -, at dbSNP:749360535
775 775 a, g dbSNP:374607995
777 777 a, g dbSNP:577458840
784 784 -, tgt dbSNP:780177490
784 784 c, t dbSNP:371776479
791 791 c, t dbSNP:759855163
797 797 c, t dbSNP:146331633
801 801 c, t dbSNP:769693436
804 804 a, c dbSNP:367932622
811 811 c, g dbSNP:761683338
812 812 c, t dbSNP:776508559
819 819 a, g dbSNP:183446599
843 843 a, t dbSNP:746902117
845 845 a, c, t dbSNP:745401140
857 857 c, t dbSNP:141436294
859 859 a, g dbSNP:745573978
863 863 a, c, g dbSNP:756846129
864 864 a, g dbSNP:749659169
865 865 g, t dbSNP:778073952
866 866 c, t dbSNP:756640162
868 868 c, t dbSNP:148523303
871 871 a, g dbSNP:767679662
873 873 g, t dbSNP:755011918
875 875 a, g dbSNP:751861091
884 884 a, g dbSNP:148294520
892 892 c, g dbSNP:763197607
895 895 a, g dbSNP:143406663
896 896 c, g dbSNP:367552499
904 904 a, g dbSNP:763931346
906 906 c, g, t dbSNP:775259761
909 909 -, g dbSNP:756192790
912 912 a, g dbSNP:771670880
926 926 a, g dbSNP:745384168
938 938 c, g dbSNP:773846623
945 945 c, g dbSNP:770603042
953 953 a, g dbSNP:748893856
969 969 a, c dbSNP:571242324
972 972 c, t dbSNP:373717082
979 979 a, c, t dbSNP:149210113
983 983 a, g dbSNP:755452054
995 995 c, t dbSNP:751591792
1011 1011 a, g dbSNP:766524874
1020 1020 a, c dbSNP:138485412
1021 1021 a, c dbSNP:750650747
1029 1029 -, g dbSNP:758875912
1036 1036 a, g dbSNP:764019374
1037 1037 c, t dbSNP:760542239
1041 1041 c, t dbSNP:775298236
1042 1042 a, g dbSNP:746885615
1046 1046 a, g dbSNP:199580977
1057 1057 c, t dbSNP:200844501
1059 1059 c, t dbSNP:147076911
1060 1060 a, g dbSNP:748982160
1063 1063 a, t dbSNP:772850336
1065 1065 c, g dbSNP:559220162
1066 1066 c, t dbSNP:770206258
1068 1068 a, g dbSNP:748471285
1070 1070 a, g dbSNP:141749998
1077 1077 c, t dbSNP:769072419
1090 1090 c, g dbSNP:540421345
1099 1099 c, t dbSNP:147599879
1101 1101 c, t dbSNP:201216223
1102 1102 a, g dbSNP:758521139
1103 1103 c, g dbSNP:750740861
1118 1118 c, t dbSNP:779291856
1124 1124 c, t dbSNP:112306737
1131 1131 a, g dbSNP:376539269
1136 1136 a, g dbSNP:752467095
1142 1142 c, t dbSNP:767296960
1152 1152 c, g dbSNP:569804974
1155 1155 c, t dbSNP:564645431
1170 1170 a, t dbSNP:77916215
1223 1223 g, t dbSNP:527488319
1238 1238 c, g dbSNP:568221882
1241 1241 c, t dbSNP:201053799
1252 1252 c, t dbSNP:376775860
1253 1253 a, g dbSNP:768834410
1264 1264 a, g dbSNP:751559458
1269 1269 a, c, g dbSNP:762806216
1271 1271 c, t dbSNP:749963131
1283 1283 -, c dbSNP:750559477
1288 1288 -, a dbSNP:767808341
1290 1290 c, t dbSNP:774316986
1293 1293 a, g dbSNP:764752529
1299 1299 a, g dbSNP:761419195
1303 1303 c, t dbSNP:201851329
1305 1305 a, c dbSNP:768968034
1306 1306 c, t dbSNP:373268202
1307 1307 a, g dbSNP:149901165
1308 1308 c, t dbSNP:569103656
1338 1338 a, g dbSNP:746329801
1354 1354 a, c dbSNP:774624321
1355 1355 a, c, g dbSNP:749543356
1363 1363 c, t dbSNP:778046623
1364 1364 a, g dbSNP:756237096
1367 1367 c, t dbSNP:746807126
1368 1368 c, t dbSNP:779781353
1369 1369 c, t dbSNP:758350757
1370 1370 a, g dbSNP:750335756
1375 1375 c, t dbSNP:369296929
1376 1376 a, g, t dbSNP:753491100
1385 1385 a, g dbSNP:763820437
1392 1392 c, t dbSNP:760364372
1397 1397 a, g dbSNP:376874771
1398 1398 g, t dbSNP:767973635
1407 1407 a, g dbSNP:760162320
1409 1409 a, t dbSNP:780093447
1418 1418 a, g dbSNP:774919964
1423 1423 a, c, t dbSNP:75201515
1424 1424 c, t dbSNP:773103636
1431 1431 c, t dbSNP:770082532
1433 1433 c, t dbSNP:748317544
1442 1442 c, t dbSNP:779875591
1443 1443 c, t dbSNP:758160529
1445 1445 c, g dbSNP:745873713
1446 1446 c, t dbSNP:778897133
1458 1458 a, c dbSNP:757084968
1462 1462 a, g dbSNP:753419895
1464 1464 c, t dbSNP:763462311
1466 1466 c, t dbSNP:770866746
1468 1468 c, t dbSNP:763967077
1471 1471 c, g dbSNP:752364425
1480 1480 a, g dbSNP:768059419
1497 1497 a, t dbSNP:759963705
1500 1500 a, c, g dbSNP:185640614
1502 1502 g, t dbSNP:373418691
1510 1510 c, t dbSNP:377297419
1512 1512 c, t dbSNP:372811398
1519 1519 c, t dbSNP:369696306
1525 1525 c, g dbSNP:762065869
1527 1527 a, g dbSNP:201752855
1528 1528 a, g dbSNP:771913231
1531 1531 a, g dbSNP:745677263
1534 1534 a, g dbSNP:201248157
1539 1539 c, g, t dbSNP:749157398
1541 1541 a, t dbSNP:777381633
1543 1543 c, t dbSNP:140123366
1550 1550 a, g dbSNP:752452401
1551 1551 a, g dbSNP:35569076
1573 1573 c, t dbSNP:529843288
1574 1574 a, g dbSNP:562293059
1579 1579 c, t dbSNP:766607928
1580 1580 a, c, g dbSNP:371969577
1585 1585 a, g dbSNP:765370645
1591 1591 a, g dbSNP:761869794
1612 1612 c, t dbSNP:776636016
1616 1616 c, g dbSNP:768871024
1622 1622 a, g dbSNP:755986675
1640 1640 c, t dbSNP:202159962
1648 1648 c, t dbSNP:770599417
1656 1656 a, c dbSNP:11038934
1662 1662 c, t dbSNP:556584273
1762 1762 c, g dbSNP:752403768
1799 1799 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520028
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu78567
Accession Version XM_011520029.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)967..1509(+)
Position Chain Variation Link
18 18 c, g dbSNP:544254279
56 56 c, t dbSNP:191845906
70 70 c, t dbSNP:565018957
79 79 g, t dbSNP:546033588
223 223 c, t dbSNP:117667452
284 284 a, g dbSNP:778313910
291 291 a, g dbSNP:761562312
292 292 a, g dbSNP:187298413
298 298 c, g dbSNP:147847095
300 300 g, t dbSNP:574818805
319 319 c, t dbSNP:144550210
324 324 a, g dbSNP:537887100
353 353 a, g dbSNP:28366000
355 355 -, g dbSNP:745907473
370 370 a, g dbSNP:764581854
382 382 a, c dbSNP:372076348
397 397 c, t dbSNP:545102921
400 400 c, t dbSNP:142624067
413 413 c, t dbSNP:77282744
424 424 c, t dbSNP:540502683
429 429 -, a dbSNP:368892119
494 494 a, g dbSNP:775330218
509 509 c, t dbSNP:778701567
512 512 c, t dbSNP:757015866
518 518 c, t dbSNP:749250437
530 530 c, t dbSNP:777755222
532 532 a, t dbSNP:574779129
544 544 a, g dbSNP:201911231
553 553 c, t dbSNP:78052875
561 561 a, c dbSNP:752259058
569 569 a, g dbSNP:767098401
570 570 c, t dbSNP:754704432
574 574 c, t dbSNP:753077232
575 575 a, g dbSNP:751231721
578 578 c, g dbSNP:199752792
582 582 c, g dbSNP:544156097
584 584 a, g dbSNP:763369583
585 585 g, t dbSNP:773647701
608 608 a, g dbSNP:375003116
612 612 g, t dbSNP:762158904
630 630 g, t dbSNP:776722319
635 635 c, t dbSNP:768672905
637 637 a, g dbSNP:747272767
639 639 a, g dbSNP:775686124
645 645 a, g dbSNP:575249184
650 650 c, t dbSNP:117030196
652 652 c, t dbSNP:777367207
653 653 a, g dbSNP:139581343
668 668 a, g dbSNP:372565562
670 670 c, t dbSNP:780902440
683 683 g, t dbSNP:539145552
685 685 a, g dbSNP:751319655
688 688 a, g dbSNP:779837091
693 693 g, t dbSNP:757926662
697 697 -, t dbSNP:772932628
706 706 a, g dbSNP:750803133
716 716 a, c dbSNP:765476628
718 718 a, t dbSNP:762405252
721 721 g, t dbSNP:145989752
723 723 -, t dbSNP:747294798
724 724 a, g dbSNP:764226942
741 741 g, t dbSNP:142862456
743 743 g, t dbSNP:760731188
746 746 -, cccaaagtgctgggattacaggcg dbSNP:771717143
750 750 -, t dbSNP:778684067
751 751 a, g dbSNP:759785243
755 755 g, t dbSNP:774584740
764 764 -, a dbSNP:754962032
767 767 c, t dbSNP:772345259
770 770 c, t dbSNP:115211185
771 771 a, g dbSNP:773083925
774 774 c, t dbSNP:766489500
785 785 c, g dbSNP:748132707
787 787 c, t dbSNP:781266899
788 788 a, c, g dbSNP:553116745
789 789 g, t dbSNP:779362941
794 794 c, g dbSNP:758098724
796 796 c, g dbSNP:749994307
800 800 c, t dbSNP:779382512
804 804 g, t dbSNP:536492639
813 813 c, t dbSNP:754400630
818 818 c, t dbSNP:367948574
819 819 a, g dbSNP:763131121
823 823 -, at dbSNP:749360535
823 823 a, g dbSNP:374607995
825 825 a, g dbSNP:577458840
832 832 -, tgt dbSNP:780177490
832 832 c, t dbSNP:371776479
839 839 c, t dbSNP:759855163
845 845 c, t dbSNP:146331633
849 849 c, t dbSNP:769693436
852 852 a, c dbSNP:367932622
859 859 c, g dbSNP:761683338
860 860 c, t dbSNP:776508559
867 867 a, g dbSNP:183446599
891 891 a, t dbSNP:746902117
893 893 a, c, t dbSNP:745401140
905 905 c, t dbSNP:141436294
907 907 a, g dbSNP:745573978
911 911 a, c, g dbSNP:756846129
912 912 a, g dbSNP:749659169
913 913 g, t dbSNP:778073952
914 914 c, t dbSNP:756640162
916 916 c, t dbSNP:148523303
919 919 a, g dbSNP:767679662
921 921 g, t dbSNP:755011918
923 923 a, g dbSNP:751861091
932 932 a, g dbSNP:148294520
940 940 c, g dbSNP:763197607
943 943 a, g dbSNP:143406663
944 944 c, g dbSNP:367552499
952 952 a, g dbSNP:763931346
954 954 c, g, t dbSNP:775259761
957 957 -, g dbSNP:756192790
960 960 a, g dbSNP:771670880
974 974 a, g dbSNP:745384168
986 986 c, g dbSNP:773846623
993 993 c, g dbSNP:770603042
1001 1001 a, g dbSNP:748893856
1017 1017 a, c dbSNP:571242324
1020 1020 c, t dbSNP:373717082
1027 1027 a, c, t dbSNP:149210113
1031 1031 a, g dbSNP:755452054
1043 1043 c, t dbSNP:751591792
1059 1059 a, g dbSNP:766524874
1068 1068 a, c dbSNP:138485412
1069 1069 a, c dbSNP:750650747
1077 1077 -, g dbSNP:758875912
1084 1084 a, g dbSNP:764019374
1085 1085 c, t dbSNP:760542239
1089 1089 c, t dbSNP:775298236
1090 1090 a, g dbSNP:746885615
1094 1094 a, g dbSNP:199580977
1105 1105 c, t dbSNP:200844501
1107 1107 c, t dbSNP:147076911
1108 1108 a, g dbSNP:748982160
1111 1111 a, t dbSNP:772850336
1113 1113 c, g dbSNP:559220162
1114 1114 c, t dbSNP:770206258
1116 1116 a, g dbSNP:748471285
1118 1118 a, g dbSNP:141749998
1125 1125 c, t dbSNP:769072419
1138 1138 c, g dbSNP:540421345
1147 1147 c, t dbSNP:147599879
1149 1149 c, t dbSNP:201216223
1150 1150 a, g dbSNP:758521139
1151 1151 c, g dbSNP:750740861
1166 1166 c, t dbSNP:779291856
1172 1172 c, t dbSNP:112306737
1179 1179 a, g dbSNP:376539269
1184 1184 a, g dbSNP:752467095
1190 1190 c, t dbSNP:767296960
1200 1200 c, g dbSNP:569804974
1203 1203 c, t dbSNP:564645431
1218 1218 a, t dbSNP:77916215
1271 1271 g, t dbSNP:527488319
1286 1286 c, g dbSNP:568221882
1289 1289 c, t dbSNP:201053799
1300 1300 c, t dbSNP:376775860
1301 1301 a, g dbSNP:768834410
1312 1312 a, g dbSNP:751559458
1317 1317 a, c, g dbSNP:762806216
1319 1319 c, t dbSNP:749963131
1331 1331 -, c dbSNP:750559477
1336 1336 -, a dbSNP:767808341
1338 1338 c, t dbSNP:774316986
1341 1341 a, g dbSNP:764752529
1347 1347 a, g dbSNP:761419195
1351 1351 c, t dbSNP:201851329
1353 1353 a, c dbSNP:768968034
1354 1354 c, t dbSNP:373268202
1355 1355 a, g dbSNP:149901165
1356 1356 c, t dbSNP:569103656
1386 1386 a, g dbSNP:746329801
1402 1402 a, c dbSNP:774624321
1403 1403 a, c, g dbSNP:749543356
1411 1411 c, t dbSNP:778046623
1412 1412 a, g dbSNP:756237096
1415 1415 c, t dbSNP:746807126
1416 1416 c, t dbSNP:779781353
1417 1417 c, t dbSNP:758350757
1418 1418 a, g dbSNP:750335756
1423 1423 c, t dbSNP:369296929
1424 1424 a, g, t dbSNP:753491100
1433 1433 a, g dbSNP:763820437
1440 1440 c, t dbSNP:760364372
1445 1445 a, g dbSNP:376874771
1446 1446 g, t dbSNP:767973635
1455 1455 a, g dbSNP:760162320
1457 1457 a, t dbSNP:780093447
1466 1466 a, g dbSNP:774919964
1471 1471 a, c, t dbSNP:75201515
1472 1472 c, t dbSNP:773103636
1479 1479 c, t dbSNP:770082532
1481 1481 c, t dbSNP:748317544
1490 1490 c, t dbSNP:779875591
1491 1491 c, t dbSNP:758160529
1493 1493 c, g dbSNP:745873713
1494 1494 c, t dbSNP:778897133
1506 1506 a, c dbSNP:757084968
1510 1510 a, g dbSNP:753419895
1512 1512 c, t dbSNP:763462311
1514 1514 c, t dbSNP:770866746
1516 1516 c, t dbSNP:763967077
1519 1519 c, g dbSNP:752364425
1528 1528 a, g dbSNP:768059419
1545 1545 a, t dbSNP:759963705
1548 1548 a, c, g dbSNP:185640614
1550 1550 g, t dbSNP:373418691
1558 1558 c, t dbSNP:377297419
1560 1560 c, t dbSNP:372811398
1567 1567 c, t dbSNP:369696306
1573 1573 c, g dbSNP:762065869
1575 1575 a, g dbSNP:201752855
1576 1576 a, g dbSNP:771913231
1579 1579 a, g dbSNP:745677263
1582 1582 a, g dbSNP:201248157
1587 1587 c, g, t dbSNP:749157398
1589 1589 a, t dbSNP:777381633
1591 1591 c, t dbSNP:140123366
1598 1598 a, g dbSNP:752452401
1599 1599 a, g dbSNP:35569076
1621 1621 c, t dbSNP:529843288
1622 1622 a, g dbSNP:562293059
1627 1627 c, t dbSNP:766607928
1628 1628 a, c, g dbSNP:371969577
1633 1633 a, g dbSNP:765370645
1639 1639 a, g dbSNP:761869794
1660 1660 c, t dbSNP:776636016
1664 1664 c, g dbSNP:768871024
1670 1670 a, g dbSNP:755986675
1688 1688 c, t dbSNP:202159962
1696 1696 c, t dbSNP:770599417
1704 1704 a, c dbSNP:11038934
1710 1710 c, t dbSNP:556584273
1810 1810 c, g dbSNP:752403768
1847 1847 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520029
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu31772
Accession Version NM_173811.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1050bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK057237.1 and BM768489.1. On Mar 5, 2009 this sequence version replaced gi:31341135. ##Evidence-Data-START## Transcript exon combination :: AK057237.1, BC036925.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)168..170(+)
Misc Feature(2)690..1148(+)
Exon (1)1..104
Gene Synonym:
Exon (2)105..918
Gene Synonym:
Exon (3)919..1522
Gene Synonym:
Position Chain Variation Link
5 5 c, t dbSNP:191845906
19 19 c, t dbSNP:565018957
28 28 g, t dbSNP:546033588
105 105 a, c dbSNP:372076348
120 120 c, t dbSNP:545102921
123 123 c, t dbSNP:142624067
136 136 c, t dbSNP:77282744
147 147 c, t dbSNP:540502683
152 152 -, a dbSNP:368892119
217 217 a, g dbSNP:775330218
232 232 c, t dbSNP:778701567
235 235 c, t dbSNP:757015866
241 241 c, t dbSNP:749250437
253 253 c, t dbSNP:777755222
255 255 a, t dbSNP:574779129
267 267 a, g dbSNP:201911231
276 276 c, t dbSNP:78052875
284 284 a, c dbSNP:752259058
292 292 a, g dbSNP:767098401
293 293 c, t dbSNP:754704432
297 297 c, t dbSNP:753077232
298 298 a, g dbSNP:751231721
301 301 c, g dbSNP:199752792
305 305 c, g dbSNP:544156097
307 307 a, g dbSNP:763369583
308 308 g, t dbSNP:773647701
331 331 a, g dbSNP:375003116
335 335 g, t dbSNP:762158904
353 353 g, t dbSNP:776722319
358 358 c, t dbSNP:768672905
360 360 a, g dbSNP:747272767
362 362 a, g dbSNP:775686124
368 368 a, g dbSNP:575249184
373 373 c, t dbSNP:117030196
375 375 c, t dbSNP:777367207
376 376 a, g dbSNP:139581343
391 391 a, g dbSNP:372565562
393 393 c, t dbSNP:780902440
406 406 g, t dbSNP:539145552
408 408 a, g dbSNP:751319655
411 411 a, g dbSNP:779837091
416 416 g, t dbSNP:757926662
420 420 -, t dbSNP:772932628
429 429 a, g dbSNP:750803133
439 439 a, c dbSNP:765476628
441 441 a, t dbSNP:762405252
444 444 g, t dbSNP:145989752
446 446 -, t dbSNP:747294798
447 447 a, g dbSNP:764226942
464 464 g, t dbSNP:142862456
466 466 g, t dbSNP:760731188
469 469 -, cccaaagtgctgggattacaggcg dbSNP:771717143
473 473 -, t dbSNP:778684067
474 474 a, g dbSNP:759785243
478 478 g, t dbSNP:774584740
487 487 -, a dbSNP:754962032
490 490 c, t dbSNP:772345259
493 493 c, t dbSNP:115211185
494 494 a, g dbSNP:773083925
497 497 c, t dbSNP:766489500
508 508 c, g dbSNP:748132707
510 510 c, t dbSNP:781266899
511 511 a, c, g dbSNP:553116745
512 512 g, t dbSNP:779362941
517 517 c, g dbSNP:758098724
519 519 c, g dbSNP:749994307
523 523 c, t dbSNP:779382512
527 527 g, t dbSNP:536492639
536 536 c, t dbSNP:754400630
541 541 c, t dbSNP:367948574
542 542 a, g dbSNP:763131121
546 546 -, at dbSNP:749360535
546 546 a, g dbSNP:374607995
548 548 a, g dbSNP:577458840
555 555 -, tgt dbSNP:780177490
555 555 c, t dbSNP:371776479
562 562 c, t dbSNP:759855163
568 568 c, t dbSNP:146331633
572 572 c, t dbSNP:769693436
575 575 a, c dbSNP:367932622
582 582 c, g dbSNP:761683338
583 583 c, t dbSNP:776508559
590 590 a, g dbSNP:183446599
614 614 a, t dbSNP:746902117
616 616 a, c, t dbSNP:745401140
628 628 c, t dbSNP:141436294
630 630 a, g dbSNP:745573978
634 634 a, c, g dbSNP:756846129
635 635 a, g dbSNP:749659169
636 636 g, t dbSNP:778073952
637 637 c, t dbSNP:756640162
639 639 c, t dbSNP:148523303
642 642 a, g dbSNP:767679662
644 644 g, t dbSNP:755011918
646 646 a, g dbSNP:751861091
655 655 a, g dbSNP:148294520
663 663 c, g dbSNP:763197607
666 666 a, g dbSNP:143406663
667 667 c, g dbSNP:367552499
675 675 a, g dbSNP:763931346
677 677 c, g, t dbSNP:775259761
680 680 -, g dbSNP:756192790
683 683 a, g dbSNP:771670880
697 697 a, g dbSNP:745384168
709 709 c, g dbSNP:773846623
716 716 c, g dbSNP:770603042
724 724 a, g dbSNP:748893856
740 740 a, c dbSNP:571242324
743 743 c, t dbSNP:373717082
750 750 a, c, t dbSNP:149210113
754 754 a, g dbSNP:755452054
766 766 c, t dbSNP:751591792
782 782 a, g dbSNP:766524874
791 791 a, c dbSNP:138485412
792 792 a, c dbSNP:750650747
800 800 -, g dbSNP:758875912
807 807 a, g dbSNP:764019374
808 808 c, t dbSNP:760542239
812 812 c, t dbSNP:775298236
813 813 a, g dbSNP:746885615
817 817 a, g dbSNP:199580977
828 828 c, t dbSNP:200844501
830 830 c, t dbSNP:147076911
831 831 a, g dbSNP:748982160
834 834 a, t dbSNP:772850336
836 836 c, g dbSNP:559220162
837 837 c, t dbSNP:770206258
839 839 a, g dbSNP:748471285
841 841 a, g dbSNP:141749998
848 848 c, t dbSNP:769072419
861 861 c, g dbSNP:540421345
870 870 c, t dbSNP:147599879
872 872 c, t dbSNP:201216223
873 873 a, g dbSNP:758521139
874 874 c, g dbSNP:750740861
889 889 c, t dbSNP:779291856
895 895 c, t dbSNP:112306737
902 902 a, g dbSNP:376539269
907 907 a, g dbSNP:752467095
913 913 c, t dbSNP:767296960
925 925 c, g dbSNP:568221882
928 928 c, t dbSNP:201053799
939 939 c, t dbSNP:376775860
940 940 a, g dbSNP:768834410
951 951 a, g dbSNP:751559458
956 956 a, c, g dbSNP:762806216
958 958 c, t dbSNP:749963131
970 970 -, c dbSNP:750559477
975 975 -, a dbSNP:767808341
977 977 c, t dbSNP:774316986
980 980 a, g dbSNP:764752529
986 986 a, g dbSNP:761419195
990 990 c, t dbSNP:201851329
992 992 a, c dbSNP:768968034
993 993 c, t dbSNP:373268202
994 994 a, g dbSNP:149901165
995 995 c, t dbSNP:569103656
1025 1025 a, g dbSNP:746329801
1041 1041 a, c dbSNP:774624321
1042 1042 a, c, g dbSNP:749543356
1050 1050 c, t dbSNP:778046623
1051 1051 a, g dbSNP:756237096
1054 1054 c, t dbSNP:746807126
1055 1055 c, t dbSNP:779781353
1056 1056 c, t dbSNP:758350757
1057 1057 a, g dbSNP:750335756
1062 1062 c, t dbSNP:369296929
1063 1063 a, g, t dbSNP:753491100
1072 1072 a, g dbSNP:763820437
1079 1079 c, t dbSNP:760364372
1084 1084 a, g dbSNP:376874771
1085 1085 g, t dbSNP:767973635
1094 1094 a, g dbSNP:760162320
1096 1096 a, t dbSNP:780093447
1105 1105 a, g dbSNP:774919964
1110 1110 a, c, t dbSNP:75201515
1111 1111 c, t dbSNP:773103636
1118 1118 c, t dbSNP:770082532
1120 1120 c, t dbSNP:748317544
1129 1129 c, t dbSNP:779875591
1130 1130 c, t dbSNP:758160529
1132 1132 c, g dbSNP:745873713
1133 1133 c, t dbSNP:778897133
1145 1145 a, c dbSNP:757084968
1149 1149 a, g dbSNP:753419895
1151 1151 c, t dbSNP:763462311
1153 1153 c, t dbSNP:770866746
1155 1155 c, t dbSNP:763967077
1158 1158 c, g dbSNP:752364425
1167 1167 a, g dbSNP:768059419
1184 1184 a, t dbSNP:759963705
1187 1187 a, c, g dbSNP:185640614
1189 1189 g, t dbSNP:373418691
1197 1197 c, t dbSNP:377297419
1199 1199 c, t dbSNP:372811398
1206 1206 c, t dbSNP:369696306
1212 1212 c, g dbSNP:762065869
1214 1214 a, g dbSNP:201752855
1215 1215 a, g dbSNP:771913231
1218 1218 a, g dbSNP:745677263
1221 1221 a, g dbSNP:201248157
1226 1226 c, g, t dbSNP:749157398
1228 1228 a, t dbSNP:777381633
1230 1230 c, t dbSNP:140123366
1237 1237 a, g dbSNP:752452401
1238 1238 a, g dbSNP:35569076
1260 1260 c, t dbSNP:529843288
1261 1261 a, g dbSNP:562293059
1266 1266 c, t dbSNP:766607928
1267 1267 a, c, g dbSNP:371969577
1272 1272 a, g dbSNP:765370645
1278 1278 a, g dbSNP:761869794
1299 1299 c, t dbSNP:776636016
1303 1303 c, g dbSNP:768871024
1309 1309 a, g dbSNP:755986675
1327 1327 c, t dbSNP:202159962
1335 1335 c, t dbSNP:770599417
1343 1343 a, c dbSNP:11038934
1349 1349 c, t dbSNP:556584273
1449 1449 c, g dbSNP:752403768
1486 1486 c, t dbSNP:545753876
1519 1519 a, c dbSNP:542270082

Target ORF information:

RefSeq Version NM_173811
Organism Homo sapiens (human)
Definition Homo sapiens harbinger transposase derived 1 (HARBI1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
