Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

HARBI1 harbinger transposase derived 1 [Homo sapiens (human)]

Gene Symbol HARBI1
Entrez Gene ID 283254
Full Name harbinger transposase derived 1
Synonyms C11orf77
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu78567 XM_011520025 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu78567 XM_011520026 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu78567 XM_011520027 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu78567 XM_011520028 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu78567 XM_011520029 PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31772 NM_173811 Homo sapiens harbinger transposase derived 1 (HARBI1), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu78567D
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)690..1232(+)
Position Chain Variation Link
5 5 c, t dbSNP:191845906
19 19 c, t dbSNP:565018957
28 28 g, t dbSNP:546033588
105 105 a, c dbSNP:372076348
120 120 c, t dbSNP:545102921
123 123 c, t dbSNP:142624067
136 136 c, t dbSNP:77282744
147 147 c, t dbSNP:540502683
152 152 -, a dbSNP:368892119
217 217 a, g dbSNP:775330218
232 232 c, t dbSNP:778701567
235 235 c, t dbSNP:757015866
241 241 c, t dbSNP:749250437
253 253 c, t dbSNP:777755222
255 255 a, t dbSNP:574779129
267 267 a, g dbSNP:201911231
276 276 c, t dbSNP:78052875
284 284 a, c dbSNP:752259058
292 292 a, g dbSNP:767098401
293 293 c, t dbSNP:754704432
297 297 c, t dbSNP:753077232
298 298 a, g dbSNP:751231721
301 301 c, g dbSNP:199752792
305 305 c, g dbSNP:544156097
307 307 a, g dbSNP:763369583
308 308 g, t dbSNP:773647701
331 331 a, g dbSNP:375003116
335 335 g, t dbSNP:762158904
353 353 g, t dbSNP:776722319
358 358 c, t dbSNP:768672905
360 360 a, g dbSNP:747272767
362 362 a, g dbSNP:775686124
368 368 a, g dbSNP:575249184
373 373 c, t dbSNP:117030196
375 375 c, t dbSNP:777367207
376 376 a, g dbSNP:139581343
391 391 a, g dbSNP:372565562
393 393 c, t dbSNP:780902440
406 406 g, t dbSNP:539145552
408 408 a, g dbSNP:751319655
411 411 a, g dbSNP:779837091
416 416 g, t dbSNP:757926662
420 420 -, t dbSNP:772932628
429 429 a, g dbSNP:750803133
439 439 a, c dbSNP:765476628
441 441 a, t dbSNP:762405252
444 444 g, t dbSNP:145989752
446 446 -, t dbSNP:747294798
447 447 a, g dbSNP:764226942
464 464 g, t dbSNP:142862456
466 466 g, t dbSNP:760731188
469 469 -, cccaaagtgctgggattacaggcg dbSNP:771717143
473 473 -, t dbSNP:778684067
474 474 a, g dbSNP:759785243
478 478 g, t dbSNP:774584740
487 487 -, a dbSNP:754962032
490 490 c, t dbSNP:772345259
493 493 c, t dbSNP:115211185
494 494 a, g dbSNP:773083925
497 497 c, t dbSNP:766489500
508 508 c, g dbSNP:748132707
510 510 c, t dbSNP:781266899
511 511 a, c, g dbSNP:553116745
512 512 g, t dbSNP:779362941
517 517 c, g dbSNP:758098724
519 519 c, g dbSNP:749994307
523 523 c, t dbSNP:779382512
527 527 g, t dbSNP:536492639
536 536 c, t dbSNP:754400630
541 541 c, t dbSNP:367948574
542 542 a, g dbSNP:763131121
546 546 -, at dbSNP:749360535
546 546 a, g dbSNP:374607995
548 548 a, g dbSNP:577458840
555 555 -, tgt dbSNP:780177490
555 555 c, t dbSNP:371776479
562 562 c, t dbSNP:759855163
568 568 c, t dbSNP:146331633
572 572 c, t dbSNP:769693436
575 575 a, c dbSNP:367932622
582 582 c, g dbSNP:761683338
583 583 c, t dbSNP:776508559
590 590 a, g dbSNP:183446599
614 614 a, t dbSNP:746902117
616 616 a, c, t dbSNP:745401140
628 628 c, t dbSNP:141436294
630 630 a, g dbSNP:745573978
634 634 a, c, g dbSNP:756846129
635 635 a, g dbSNP:749659169
636 636 g, t dbSNP:778073952
637 637 c, t dbSNP:756640162
639 639 c, t dbSNP:148523303
642 642 a, g dbSNP:767679662
644 644 g, t dbSNP:755011918
646 646 a, g dbSNP:751861091
655 655 a, g dbSNP:148294520
663 663 c, g dbSNP:763197607
666 666 a, g dbSNP:143406663
667 667 c, g dbSNP:367552499
675 675 a, g dbSNP:763931346
677 677 c, g, t dbSNP:775259761
680 680 -, g dbSNP:756192790
683 683 a, g dbSNP:771670880
697 697 a, g dbSNP:745384168
709 709 c, g dbSNP:773846623
716 716 c, g dbSNP:770603042
724 724 a, g dbSNP:748893856
740 740 a, c dbSNP:571242324
743 743 c, t dbSNP:373717082
750 750 a, c, t dbSNP:149210113
754 754 a, g dbSNP:755452054
766 766 c, t dbSNP:751591792
782 782 a, g dbSNP:766524874
791 791 a, c dbSNP:138485412
792 792 a, c dbSNP:750650747
800 800 -, g dbSNP:758875912
807 807 a, g dbSNP:764019374
808 808 c, t dbSNP:760542239
812 812 c, t dbSNP:775298236
813 813 a, g dbSNP:746885615
817 817 a, g dbSNP:199580977
828 828 c, t dbSNP:200844501
830 830 c, t dbSNP:147076911
831 831 a, g dbSNP:748982160
834 834 a, t dbSNP:772850336
836 836 c, g dbSNP:559220162
837 837 c, t dbSNP:770206258
839 839 a, g dbSNP:748471285
841 841 a, g dbSNP:141749998
848 848 c, t dbSNP:769072419
861 861 c, g dbSNP:540421345
870 870 c, t dbSNP:147599879
872 872 c, t dbSNP:201216223
873 873 a, g dbSNP:758521139
874 874 c, g dbSNP:750740861
889 889 c, t dbSNP:779291856
895 895 c, t dbSNP:112306737
902 902 a, g dbSNP:376539269
907 907 a, g dbSNP:752467095
913 913 c, t dbSNP:767296960
923 923 c, g dbSNP:569804974
926 926 c, t dbSNP:564645431
941 941 a, t dbSNP:77916215
994 994 g, t dbSNP:527488319
1009 1009 c, g dbSNP:568221882
1012 1012 c, t dbSNP:201053799
1023 1023 c, t dbSNP:376775860
1024 1024 a, g dbSNP:768834410
1035 1035 a, g dbSNP:751559458
1040 1040 a, c, g dbSNP:762806216
1042 1042 c, t dbSNP:749963131
1054 1054 -, c dbSNP:750559477
1059 1059 -, a dbSNP:767808341
1061 1061 c, t dbSNP:774316986
1064 1064 a, g dbSNP:764752529
1070 1070 a, g dbSNP:761419195
1074 1074 c, t dbSNP:201851329
1076 1076 a, c dbSNP:768968034
1077 1077 c, t dbSNP:373268202
1078 1078 a, g dbSNP:149901165
1079 1079 c, t dbSNP:569103656
1109 1109 a, g dbSNP:746329801
1125 1125 a, c dbSNP:774624321
1126 1126 a, c, g dbSNP:749543356
1134 1134 c, t dbSNP:778046623
1135 1135 a, g dbSNP:756237096
1138 1138 c, t dbSNP:746807126
1139 1139 c, t dbSNP:779781353
1140 1140 c, t dbSNP:758350757
1141 1141 a, g dbSNP:750335756
1146 1146 c, t dbSNP:369296929
1147 1147 a, g, t dbSNP:753491100
1156 1156 a, g dbSNP:763820437
1163 1163 c, t dbSNP:760364372
1168 1168 a, g dbSNP:376874771
1169 1169 g, t dbSNP:767973635
1178 1178 a, g dbSNP:760162320
1180 1180 a, t dbSNP:780093447
1189 1189 a, g dbSNP:774919964
1194 1194 a, c, t dbSNP:75201515
1195 1195 c, t dbSNP:773103636
1202 1202 c, t dbSNP:770082532
1204 1204 c, t dbSNP:748317544
1213 1213 c, t dbSNP:779875591
1214 1214 c, t dbSNP:758160529
1216 1216 c, g dbSNP:745873713
1217 1217 c, t dbSNP:778897133
1229 1229 a, c dbSNP:757084968
1233 1233 a, g dbSNP:753419895
1235 1235 c, t dbSNP:763462311
1237 1237 c, t dbSNP:770866746
1239 1239 c, t dbSNP:763967077
1242 1242 c, g dbSNP:752364425
1251 1251 a, g dbSNP:768059419
1268 1268 a, t dbSNP:759963705
1271 1271 a, c, g dbSNP:185640614
1273 1273 g, t dbSNP:373418691
1281 1281 c, t dbSNP:377297419
1283 1283 c, t dbSNP:372811398
1290 1290 c, t dbSNP:369696306
1296 1296 c, g dbSNP:762065869
1298 1298 a, g dbSNP:201752855
1299 1299 a, g dbSNP:771913231
1302 1302 a, g dbSNP:745677263
1305 1305 a, g dbSNP:201248157
1310 1310 c, g, t dbSNP:749157398
1312 1312 a, t dbSNP:777381633
1314 1314 c, t dbSNP:140123366
1321 1321 a, g dbSNP:752452401
1322 1322 a, g dbSNP:35569076
1344 1344 c, t dbSNP:529843288
1345 1345 a, g dbSNP:562293059
1350 1350 c, t dbSNP:766607928
1351 1351 a, c, g dbSNP:371969577
1356 1356 a, g dbSNP:765370645
1362 1362 a, g dbSNP:761869794
1383 1383 c, t dbSNP:776636016
1387 1387 c, g dbSNP:768871024
1393 1393 a, g dbSNP:755986675
1411 1411 c, t dbSNP:202159962
1419 1419 c, t dbSNP:770599417
1427 1427 a, c dbSNP:11038934
1433 1433 c, t dbSNP:556584273
1533 1533 c, g dbSNP:752403768
1570 1570 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520025
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu78567D
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)674..1216(+)
Position Chain Variation Link
23 23 g, t dbSNP:140143793
27 27 c, t dbSNP:560889603
28 28 c, t dbSNP:762321504
43 43 -, ga dbSNP:555848238
44 44 -, gaga dbSNP:113299100
45 45 -, ga dbSNP:759709291
46 46 -, ga dbSNP:367729861
47 47 -, ga dbSNP:144543788
89 89 a, c dbSNP:372076348
104 104 c, t dbSNP:545102921
107 107 c, t dbSNP:142624067
120 120 c, t dbSNP:77282744
131 131 c, t dbSNP:540502683
136 136 -, a dbSNP:368892119
201 201 a, g dbSNP:775330218
216 216 c, t dbSNP:778701567
219 219 c, t dbSNP:757015866
225 225 c, t dbSNP:749250437
237 237 c, t dbSNP:777755222
239 239 a, t dbSNP:574779129
251 251 a, g dbSNP:201911231
260 260 c, t dbSNP:78052875
268 268 a, c dbSNP:752259058
276 276 a, g dbSNP:767098401
277 277 c, t dbSNP:754704432
281 281 c, t dbSNP:753077232
282 282 a, g dbSNP:751231721
285 285 c, g dbSNP:199752792
289 289 c, g dbSNP:544156097
291 291 a, g dbSNP:763369583
292 292 g, t dbSNP:773647701
315 315 a, g dbSNP:375003116
319 319 g, t dbSNP:762158904
337 337 g, t dbSNP:776722319
342 342 c, t dbSNP:768672905
344 344 a, g dbSNP:747272767
346 346 a, g dbSNP:775686124
352 352 a, g dbSNP:575249184
357 357 c, t dbSNP:117030196
359 359 c, t dbSNP:777367207
360 360 a, g dbSNP:139581343
375 375 a, g dbSNP:372565562
377 377 c, t dbSNP:780902440
390 390 g, t dbSNP:539145552
392 392 a, g dbSNP:751319655
395 395 a, g dbSNP:779837091
400 400 g, t dbSNP:757926662
404 404 -, t dbSNP:772932628
413 413 a, g dbSNP:750803133
423 423 a, c dbSNP:765476628
425 425 a, t dbSNP:762405252
428 428 g, t dbSNP:145989752
430 430 -, t dbSNP:747294798
431 431 a, g dbSNP:764226942
448 448 g, t dbSNP:142862456
450 450 g, t dbSNP:760731188
453 453 -, cccaaagtgctgggattacaggcg dbSNP:771717143
457 457 -, t dbSNP:778684067
458 458 a, g dbSNP:759785243
462 462 g, t dbSNP:774584740
471 471 -, a dbSNP:754962032
474 474 c, t dbSNP:772345259
477 477 c, t dbSNP:115211185
478 478 a, g dbSNP:773083925
481 481 c, t dbSNP:766489500
492 492 c, g dbSNP:748132707
494 494 c, t dbSNP:781266899
495 495 a, c, g dbSNP:553116745
496 496 g, t dbSNP:779362941
501 501 c, g dbSNP:758098724
503 503 c, g dbSNP:749994307
507 507 c, t dbSNP:779382512
511 511 g, t dbSNP:536492639
520 520 c, t dbSNP:754400630
525 525 c, t dbSNP:367948574
526 526 a, g dbSNP:763131121
530 530 -, at dbSNP:749360535
530 530 a, g dbSNP:374607995
532 532 a, g dbSNP:577458840
539 539 -, tgt dbSNP:780177490
539 539 c, t dbSNP:371776479
546 546 c, t dbSNP:759855163
552 552 c, t dbSNP:146331633
556 556 c, t dbSNP:769693436
559 559 a, c dbSNP:367932622
566 566 c, g dbSNP:761683338
567 567 c, t dbSNP:776508559
574 574 a, g dbSNP:183446599
598 598 a, t dbSNP:746902117
600 600 a, c, t dbSNP:745401140
612 612 c, t dbSNP:141436294
614 614 a, g dbSNP:745573978
618 618 a, c, g dbSNP:756846129
619 619 a, g dbSNP:749659169
620 620 g, t dbSNP:778073952
621 621 c, t dbSNP:756640162
623 623 c, t dbSNP:148523303
626 626 a, g dbSNP:767679662
628 628 g, t dbSNP:755011918
630 630 a, g dbSNP:751861091
639 639 a, g dbSNP:148294520
647 647 c, g dbSNP:763197607
650 650 a, g dbSNP:143406663
651 651 c, g dbSNP:367552499
659 659 a, g dbSNP:763931346
661 661 c, g, t dbSNP:775259761
664 664 -, g dbSNP:756192790
667 667 a, g dbSNP:771670880
681 681 a, g dbSNP:745384168
693 693 c, g dbSNP:773846623
700 700 c, g dbSNP:770603042
708 708 a, g dbSNP:748893856
724 724 a, c dbSNP:571242324
727 727 c, t dbSNP:373717082
734 734 a, c, t dbSNP:149210113
738 738 a, g dbSNP:755452054
750 750 c, t dbSNP:751591792
766 766 a, g dbSNP:766524874
775 775 a, c dbSNP:138485412
776 776 a, c dbSNP:750650747
784 784 -, g dbSNP:758875912
791 791 a, g dbSNP:764019374
792 792 c, t dbSNP:760542239
796 796 c, t dbSNP:775298236
797 797 a, g dbSNP:746885615
801 801 a, g dbSNP:199580977
812 812 c, t dbSNP:200844501
814 814 c, t dbSNP:147076911
815 815 a, g dbSNP:748982160
818 818 a, t dbSNP:772850336
820 820 c, g dbSNP:559220162
821 821 c, t dbSNP:770206258
823 823 a, g dbSNP:748471285
825 825 a, g dbSNP:141749998
832 832 c, t dbSNP:769072419
845 845 c, g dbSNP:540421345
854 854 c, t dbSNP:147599879
856 856 c, t dbSNP:201216223
857 857 a, g dbSNP:758521139
858 858 c, g dbSNP:750740861
873 873 c, t dbSNP:779291856
879 879 c, t dbSNP:112306737
886 886 a, g dbSNP:376539269
891 891 a, g dbSNP:752467095
897 897 c, t dbSNP:767296960
907 907 c, g dbSNP:569804974
910 910 c, t dbSNP:564645431
925 925 a, t dbSNP:77916215
978 978 g, t dbSNP:527488319
993 993 c, g dbSNP:568221882
996 996 c, t dbSNP:201053799
1007 1007 c, t dbSNP:376775860
1008 1008 a, g dbSNP:768834410
1019 1019 a, g dbSNP:751559458
1024 1024 a, c, g dbSNP:762806216
1026 1026 c, t dbSNP:749963131
1038 1038 -, c dbSNP:750559477
1043 1043 -, a dbSNP:767808341
1045 1045 c, t dbSNP:774316986
1048 1048 a, g dbSNP:764752529
1054 1054 a, g dbSNP:761419195
1058 1058 c, t dbSNP:201851329
1060 1060 a, c dbSNP:768968034
1061 1061 c, t dbSNP:373268202
1062 1062 a, g dbSNP:149901165
1063 1063 c, t dbSNP:569103656
1093 1093 a, g dbSNP:746329801
1109 1109 a, c dbSNP:774624321
1110 1110 a, c, g dbSNP:749543356
1118 1118 c, t dbSNP:778046623
1119 1119 a, g dbSNP:756237096
1122 1122 c, t dbSNP:746807126
1123 1123 c, t dbSNP:779781353
1124 1124 c, t dbSNP:758350757
1125 1125 a, g dbSNP:750335756
1130 1130 c, t dbSNP:369296929
1131 1131 a, g, t dbSNP:753491100
1140 1140 a, g dbSNP:763820437
1147 1147 c, t dbSNP:760364372
1152 1152 a, g dbSNP:376874771
1153 1153 g, t dbSNP:767973635
1162 1162 a, g dbSNP:760162320
1164 1164 a, t dbSNP:780093447
1173 1173 a, g dbSNP:774919964
1178 1178 a, c, t dbSNP:75201515
1179 1179 c, t dbSNP:773103636
1186 1186 c, t dbSNP:770082532
1188 1188 c, t dbSNP:748317544
1197 1197 c, t dbSNP:779875591
1198 1198 c, t dbSNP:758160529
1200 1200 c, g dbSNP:745873713
1201 1201 c, t dbSNP:778897133
1213 1213 a, c dbSNP:757084968
1217 1217 a, g dbSNP:753419895
1219 1219 c, t dbSNP:763462311
1221 1221 c, t dbSNP:770866746
1223 1223 c, t dbSNP:763967077
1226 1226 c, g dbSNP:752364425
1235 1235 a, g dbSNP:768059419
1252 1252 a, t dbSNP:759963705
1255 1255 a, c, g dbSNP:185640614
1257 1257 g, t dbSNP:373418691
1265 1265 c, t dbSNP:377297419
1267 1267 c, t dbSNP:372811398
1274 1274 c, t dbSNP:369696306
1280 1280 c, g dbSNP:762065869
1282 1282 a, g dbSNP:201752855
1283 1283 a, g dbSNP:771913231
1286 1286 a, g dbSNP:745677263
1289 1289 a, g dbSNP:201248157
1294 1294 c, g, t dbSNP:749157398
1296 1296 a, t dbSNP:777381633
1298 1298 c, t dbSNP:140123366
1305 1305 a, g dbSNP:752452401
1306 1306 a, g dbSNP:35569076
1328 1328 c, t dbSNP:529843288
1329 1329 a, g dbSNP:562293059
1334 1334 c, t dbSNP:766607928
1335 1335 a, c, g dbSNP:371969577
1340 1340 a, g dbSNP:765370645
1346 1346 a, g dbSNP:761869794
1367 1367 c, t dbSNP:776636016
1371 1371 c, g dbSNP:768871024
1377 1377 a, g dbSNP:755986675
1395 1395 c, t dbSNP:202159962
1403 1403 c, t dbSNP:770599417
1411 1411 a, c dbSNP:11038934
1417 1417 c, t dbSNP:556584273
1517 1517 c, g dbSNP:752403768
1554 1554 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520026
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu78567D
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)701..1243(+)
Position Chain Variation Link
8 8 a, g dbSNP:140480224
85 85 a, g dbSNP:147184903
116 116 a, c dbSNP:372076348
131 131 c, t dbSNP:545102921
134 134 c, t dbSNP:142624067
147 147 c, t dbSNP:77282744
158 158 c, t dbSNP:540502683
163 163 -, a dbSNP:368892119
228 228 a, g dbSNP:775330218
243 243 c, t dbSNP:778701567
246 246 c, t dbSNP:757015866
252 252 c, t dbSNP:749250437
264 264 c, t dbSNP:777755222
266 266 a, t dbSNP:574779129
278 278 a, g dbSNP:201911231
287 287 c, t dbSNP:78052875
295 295 a, c dbSNP:752259058
303 303 a, g dbSNP:767098401
304 304 c, t dbSNP:754704432
308 308 c, t dbSNP:753077232
309 309 a, g dbSNP:751231721
312 312 c, g dbSNP:199752792
316 316 c, g dbSNP:544156097
318 318 a, g dbSNP:763369583
319 319 g, t dbSNP:773647701
342 342 a, g dbSNP:375003116
346 346 g, t dbSNP:762158904
364 364 g, t dbSNP:776722319
369 369 c, t dbSNP:768672905
371 371 a, g dbSNP:747272767
373 373 a, g dbSNP:775686124
379 379 a, g dbSNP:575249184
384 384 c, t dbSNP:117030196
386 386 c, t dbSNP:777367207
387 387 a, g dbSNP:139581343
402 402 a, g dbSNP:372565562
404 404 c, t dbSNP:780902440
417 417 g, t dbSNP:539145552
419 419 a, g dbSNP:751319655
422 422 a, g dbSNP:779837091
427 427 g, t dbSNP:757926662
431 431 -, t dbSNP:772932628
440 440 a, g dbSNP:750803133
450 450 a, c dbSNP:765476628
452 452 a, t dbSNP:762405252
455 455 g, t dbSNP:145989752
457 457 -, t dbSNP:747294798
458 458 a, g dbSNP:764226942
475 475 g, t dbSNP:142862456
477 477 g, t dbSNP:760731188
480 480 -, cccaaagtgctgggattacaggcg dbSNP:771717143
484 484 -, t dbSNP:778684067
485 485 a, g dbSNP:759785243
489 489 g, t dbSNP:774584740
498 498 -, a dbSNP:754962032
501 501 c, t dbSNP:772345259
504 504 c, t dbSNP:115211185
505 505 a, g dbSNP:773083925
508 508 c, t dbSNP:766489500
519 519 c, g dbSNP:748132707
521 521 c, t dbSNP:781266899
522 522 a, c, g dbSNP:553116745
523 523 g, t dbSNP:779362941
528 528 c, g dbSNP:758098724
530 530 c, g dbSNP:749994307
534 534 c, t dbSNP:779382512
538 538 g, t dbSNP:536492639
547 547 c, t dbSNP:754400630
552 552 c, t dbSNP:367948574
553 553 a, g dbSNP:763131121
557 557 -, at dbSNP:749360535
557 557 a, g dbSNP:374607995
559 559 a, g dbSNP:577458840
566 566 -, tgt dbSNP:780177490
566 566 c, t dbSNP:371776479
573 573 c, t dbSNP:759855163
579 579 c, t dbSNP:146331633
583 583 c, t dbSNP:769693436
586 586 a, c dbSNP:367932622
593 593 c, g dbSNP:761683338
594 594 c, t dbSNP:776508559
601 601 a, g dbSNP:183446599
625 625 a, t dbSNP:746902117
627 627 a, c, t dbSNP:745401140
639 639 c, t dbSNP:141436294
641 641 a, g dbSNP:745573978
645 645 a, c, g dbSNP:756846129
646 646 a, g dbSNP:749659169
647 647 g, t dbSNP:778073952
648 648 c, t dbSNP:756640162
650 650 c, t dbSNP:148523303
653 653 a, g dbSNP:767679662
655 655 g, t dbSNP:755011918
657 657 a, g dbSNP:751861091
666 666 a, g dbSNP:148294520
674 674 c, g dbSNP:763197607
677 677 a, g dbSNP:143406663
678 678 c, g dbSNP:367552499
686 686 a, g dbSNP:763931346
688 688 c, g, t dbSNP:775259761
691 691 -, g dbSNP:756192790
694 694 a, g dbSNP:771670880
708 708 a, g dbSNP:745384168
720 720 c, g dbSNP:773846623
727 727 c, g dbSNP:770603042
735 735 a, g dbSNP:748893856
751 751 a, c dbSNP:571242324
754 754 c, t dbSNP:373717082
761 761 a, c, t dbSNP:149210113
765 765 a, g dbSNP:755452054
777 777 c, t dbSNP:751591792
793 793 a, g dbSNP:766524874
802 802 a, c dbSNP:138485412
803 803 a, c dbSNP:750650747
811 811 -, g dbSNP:758875912
818 818 a, g dbSNP:764019374
819 819 c, t dbSNP:760542239
823 823 c, t dbSNP:775298236
824 824 a, g dbSNP:746885615
828 828 a, g dbSNP:199580977
839 839 c, t dbSNP:200844501
841 841 c, t dbSNP:147076911
842 842 a, g dbSNP:748982160
845 845 a, t dbSNP:772850336
847 847 c, g dbSNP:559220162
848 848 c, t dbSNP:770206258
850 850 a, g dbSNP:748471285
852 852 a, g dbSNP:141749998
859 859 c, t dbSNP:769072419
872 872 c, g dbSNP:540421345
881 881 c, t dbSNP:147599879
883 883 c, t dbSNP:201216223
884 884 a, g dbSNP:758521139
885 885 c, g dbSNP:750740861
900 900 c, t dbSNP:779291856
906 906 c, t dbSNP:112306737
913 913 a, g dbSNP:376539269
918 918 a, g dbSNP:752467095
924 924 c, t dbSNP:767296960
934 934 c, g dbSNP:569804974
937 937 c, t dbSNP:564645431
952 952 a, t dbSNP:77916215
1005 1005 g, t dbSNP:527488319
1020 1020 c, g dbSNP:568221882
1023 1023 c, t dbSNP:201053799
1034 1034 c, t dbSNP:376775860
1035 1035 a, g dbSNP:768834410
1046 1046 a, g dbSNP:751559458
1051 1051 a, c, g dbSNP:762806216
1053 1053 c, t dbSNP:749963131
1065 1065 -, c dbSNP:750559477
1070 1070 -, a dbSNP:767808341
1072 1072 c, t dbSNP:774316986
1075 1075 a, g dbSNP:764752529
1081 1081 a, g dbSNP:761419195
1085 1085 c, t dbSNP:201851329
1087 1087 a, c dbSNP:768968034
1088 1088 c, t dbSNP:373268202
1089 1089 a, g dbSNP:149901165
1090 1090 c, t dbSNP:569103656
1120 1120 a, g dbSNP:746329801
1136 1136 a, c dbSNP:774624321
1137 1137 a, c, g dbSNP:749543356
1145 1145 c, t dbSNP:778046623
1146 1146 a, g dbSNP:756237096
1149 1149 c, t dbSNP:746807126
1150 1150 c, t dbSNP:779781353
1151 1151 c, t dbSNP:758350757
1152 1152 a, g dbSNP:750335756
1157 1157 c, t dbSNP:369296929
1158 1158 a, g, t dbSNP:753491100
1167 1167 a, g dbSNP:763820437
1174 1174 c, t dbSNP:760364372
1179 1179 a, g dbSNP:376874771
1180 1180 g, t dbSNP:767973635
1189 1189 a, g dbSNP:760162320
1191 1191 a, t dbSNP:780093447
1200 1200 a, g dbSNP:774919964
1205 1205 a, c, t dbSNP:75201515
1206 1206 c, t dbSNP:773103636
1213 1213 c, t dbSNP:770082532
1215 1215 c, t dbSNP:748317544
1224 1224 c, t dbSNP:779875591
1225 1225 c, t dbSNP:758160529
1227 1227 c, g dbSNP:745873713
1228 1228 c, t dbSNP:778897133
1240 1240 a, c dbSNP:757084968
1244 1244 a, g dbSNP:753419895
1246 1246 c, t dbSNP:763462311
1248 1248 c, t dbSNP:770866746
1250 1250 c, t dbSNP:763967077
1253 1253 c, g dbSNP:752364425
1262 1262 a, g dbSNP:768059419
1279 1279 a, t dbSNP:759963705
1282 1282 a, c, g dbSNP:185640614
1284 1284 g, t dbSNP:373418691
1292 1292 c, t dbSNP:377297419
1294 1294 c, t dbSNP:372811398
1301 1301 c, t dbSNP:369696306
1307 1307 c, g dbSNP:762065869
1309 1309 a, g dbSNP:201752855
1310 1310 a, g dbSNP:771913231
1313 1313 a, g dbSNP:745677263
1316 1316 a, g dbSNP:201248157
1321 1321 c, g, t dbSNP:749157398
1323 1323 a, t dbSNP:777381633
1325 1325 c, t dbSNP:140123366
1332 1332 a, g dbSNP:752452401
1333 1333 a, g dbSNP:35569076
1355 1355 c, t dbSNP:529843288
1356 1356 a, g dbSNP:562293059
1361 1361 c, t dbSNP:766607928
1362 1362 a, c, g dbSNP:371969577
1367 1367 a, g dbSNP:765370645
1373 1373 a, g dbSNP:761869794
1394 1394 c, t dbSNP:776636016
1398 1398 c, g dbSNP:768871024
1404 1404 a, g dbSNP:755986675
1422 1422 c, t dbSNP:202159962
1430 1430 c, t dbSNP:770599417
1438 1438 a, c dbSNP:11038934
1444 1444 c, t dbSNP:556584273
1544 1544 c, g dbSNP:752403768
1581 1581 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520027
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu78567D
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)919..1461(+)
Position Chain Variation Link
21 21 c, t dbSNP:545619141
38 38 a, c dbSNP:532286710
128 128 c, t dbSNP:560440788
134 134 c, t dbSNP:539847018
155 155 g, t dbSNP:367698316
159 159 a, c dbSNP:574379493
199 199 c, g dbSNP:28365974
201 201 a, g dbSNP:544341630
263 263 g, t dbSNP:576682604
264 264 c, t dbSNP:556773501
292 292 c, t dbSNP:540059893
297 297 a, g dbSNP:183754521
334 334 a, c dbSNP:372076348
349 349 c, t dbSNP:545102921
352 352 c, t dbSNP:142624067
365 365 c, t dbSNP:77282744
376 376 c, t dbSNP:540502683
381 381 -, a dbSNP:368892119
446 446 a, g dbSNP:775330218
461 461 c, t dbSNP:778701567
464 464 c, t dbSNP:757015866
470 470 c, t dbSNP:749250437
482 482 c, t dbSNP:777755222
484 484 a, t dbSNP:574779129
496 496 a, g dbSNP:201911231
505 505 c, t dbSNP:78052875
513 513 a, c dbSNP:752259058
521 521 a, g dbSNP:767098401
522 522 c, t dbSNP:754704432
526 526 c, t dbSNP:753077232
527 527 a, g dbSNP:751231721
530 530 c, g dbSNP:199752792
534 534 c, g dbSNP:544156097
536 536 a, g dbSNP:763369583
537 537 g, t dbSNP:773647701
560 560 a, g dbSNP:375003116
564 564 g, t dbSNP:762158904
582 582 g, t dbSNP:776722319
587 587 c, t dbSNP:768672905
589 589 a, g dbSNP:747272767
591 591 a, g dbSNP:775686124
597 597 a, g dbSNP:575249184
602 602 c, t dbSNP:117030196
604 604 c, t dbSNP:777367207
605 605 a, g dbSNP:139581343
620 620 a, g dbSNP:372565562
622 622 c, t dbSNP:780902440
635 635 g, t dbSNP:539145552
637 637 a, g dbSNP:751319655
640 640 a, g dbSNP:779837091
645 645 g, t dbSNP:757926662
649 649 -, t dbSNP:772932628
658 658 a, g dbSNP:750803133
668 668 a, c dbSNP:765476628
670 670 a, t dbSNP:762405252
673 673 g, t dbSNP:145989752
675 675 -, t dbSNP:747294798
676 676 a, g dbSNP:764226942
693 693 g, t dbSNP:142862456
695 695 g, t dbSNP:760731188
698 698 -, cccaaagtgctgggattacaggcg dbSNP:771717143
702 702 -, t dbSNP:778684067
703 703 a, g dbSNP:759785243
707 707 g, t dbSNP:774584740
716 716 -, a dbSNP:754962032
719 719 c, t dbSNP:772345259
722 722 c, t dbSNP:115211185
723 723 a, g dbSNP:773083925
726 726 c, t dbSNP:766489500
737 737 c, g dbSNP:748132707
739 739 c, t dbSNP:781266899
740 740 a, c, g dbSNP:553116745
741 741 g, t dbSNP:779362941
746 746 c, g dbSNP:758098724
748 748 c, g dbSNP:749994307
752 752 c, t dbSNP:779382512
756 756 g, t dbSNP:536492639
765 765 c, t dbSNP:754400630
770 770 c, t dbSNP:367948574
771 771 a, g dbSNP:763131121
775 775 -, at dbSNP:749360535
775 775 a, g dbSNP:374607995
777 777 a, g dbSNP:577458840
784 784 -, tgt dbSNP:780177490
784 784 c, t dbSNP:371776479
791 791 c, t dbSNP:759855163
797 797 c, t dbSNP:146331633
801 801 c, t dbSNP:769693436
804 804 a, c dbSNP:367932622
811 811 c, g dbSNP:761683338
812 812 c, t dbSNP:776508559
819 819 a, g dbSNP:183446599
843 843 a, t dbSNP:746902117
845 845 a, c, t dbSNP:745401140
857 857 c, t dbSNP:141436294
859 859 a, g dbSNP:745573978
863 863 a, c, g dbSNP:756846129
864 864 a, g dbSNP:749659169
865 865 g, t dbSNP:778073952
866 866 c, t dbSNP:756640162
868 868 c, t dbSNP:148523303
871 871 a, g dbSNP:767679662
873 873 g, t dbSNP:755011918
875 875 a, g dbSNP:751861091
884 884 a, g dbSNP:148294520
892 892 c, g dbSNP:763197607
895 895 a, g dbSNP:143406663
896 896 c, g dbSNP:367552499
904 904 a, g dbSNP:763931346
906 906 c, g, t dbSNP:775259761
909 909 -, g dbSNP:756192790
912 912 a, g dbSNP:771670880
926 926 a, g dbSNP:745384168
938 938 c, g dbSNP:773846623
945 945 c, g dbSNP:770603042
953 953 a, g dbSNP:748893856
969 969 a, c dbSNP:571242324
972 972 c, t dbSNP:373717082
979 979 a, c, t dbSNP:149210113
983 983 a, g dbSNP:755452054
995 995 c, t dbSNP:751591792
1011 1011 a, g dbSNP:766524874
1020 1020 a, c dbSNP:138485412
1021 1021 a, c dbSNP:750650747
1029 1029 -, g dbSNP:758875912
1036 1036 a, g dbSNP:764019374
1037 1037 c, t dbSNP:760542239
1041 1041 c, t dbSNP:775298236
1042 1042 a, g dbSNP:746885615
1046 1046 a, g dbSNP:199580977
1057 1057 c, t dbSNP:200844501
1059 1059 c, t dbSNP:147076911
1060 1060 a, g dbSNP:748982160
1063 1063 a, t dbSNP:772850336
1065 1065 c, g dbSNP:559220162
1066 1066 c, t dbSNP:770206258
1068 1068 a, g dbSNP:748471285
1070 1070 a, g dbSNP:141749998
1077 1077 c, t dbSNP:769072419
1090 1090 c, g dbSNP:540421345
1099 1099 c, t dbSNP:147599879
1101 1101 c, t dbSNP:201216223
1102 1102 a, g dbSNP:758521139
1103 1103 c, g dbSNP:750740861
1118 1118 c, t dbSNP:779291856
1124 1124 c, t dbSNP:112306737
1131 1131 a, g dbSNP:376539269
1136 1136 a, g dbSNP:752467095
1142 1142 c, t dbSNP:767296960
1152 1152 c, g dbSNP:569804974
1155 1155 c, t dbSNP:564645431
1170 1170 a, t dbSNP:77916215
1223 1223 g, t dbSNP:527488319
1238 1238 c, g dbSNP:568221882
1241 1241 c, t dbSNP:201053799
1252 1252 c, t dbSNP:376775860
1253 1253 a, g dbSNP:768834410
1264 1264 a, g dbSNP:751559458
1269 1269 a, c, g dbSNP:762806216
1271 1271 c, t dbSNP:749963131
1283 1283 -, c dbSNP:750559477
1288 1288 -, a dbSNP:767808341
1290 1290 c, t dbSNP:774316986
1293 1293 a, g dbSNP:764752529
1299 1299 a, g dbSNP:761419195
1303 1303 c, t dbSNP:201851329
1305 1305 a, c dbSNP:768968034
1306 1306 c, t dbSNP:373268202
1307 1307 a, g dbSNP:149901165
1308 1308 c, t dbSNP:569103656
1338 1338 a, g dbSNP:746329801
1354 1354 a, c dbSNP:774624321
1355 1355 a, c, g dbSNP:749543356
1363 1363 c, t dbSNP:778046623
1364 1364 a, g dbSNP:756237096
1367 1367 c, t dbSNP:746807126
1368 1368 c, t dbSNP:779781353
1369 1369 c, t dbSNP:758350757
1370 1370 a, g dbSNP:750335756
1375 1375 c, t dbSNP:369296929
1376 1376 a, g, t dbSNP:753491100
1385 1385 a, g dbSNP:763820437
1392 1392 c, t dbSNP:760364372
1397 1397 a, g dbSNP:376874771
1398 1398 g, t dbSNP:767973635
1407 1407 a, g dbSNP:760162320
1409 1409 a, t dbSNP:780093447
1418 1418 a, g dbSNP:774919964
1423 1423 a, c, t dbSNP:75201515
1424 1424 c, t dbSNP:773103636
1431 1431 c, t dbSNP:770082532
1433 1433 c, t dbSNP:748317544
1442 1442 c, t dbSNP:779875591
1443 1443 c, t dbSNP:758160529
1445 1445 c, g dbSNP:745873713
1446 1446 c, t dbSNP:778897133
1458 1458 a, c dbSNP:757084968
1462 1462 a, g dbSNP:753419895
1464 1464 c, t dbSNP:763462311
1466 1466 c, t dbSNP:770866746
1468 1468 c, t dbSNP:763967077
1471 1471 c, g dbSNP:752364425
1480 1480 a, g dbSNP:768059419
1497 1497 a, t dbSNP:759963705
1500 1500 a, c, g dbSNP:185640614
1502 1502 g, t dbSNP:373418691
1510 1510 c, t dbSNP:377297419
1512 1512 c, t dbSNP:372811398
1519 1519 c, t dbSNP:369696306
1525 1525 c, g dbSNP:762065869
1527 1527 a, g dbSNP:201752855
1528 1528 a, g dbSNP:771913231
1531 1531 a, g dbSNP:745677263
1534 1534 a, g dbSNP:201248157
1539 1539 c, g, t dbSNP:749157398
1541 1541 a, t dbSNP:777381633
1543 1543 c, t dbSNP:140123366
1550 1550 a, g dbSNP:752452401
1551 1551 a, g dbSNP:35569076
1573 1573 c, t dbSNP:529843288
1574 1574 a, g dbSNP:562293059
1579 1579 c, t dbSNP:766607928
1580 1580 a, c, g dbSNP:371969577
1585 1585 a, g dbSNP:765370645
1591 1591 a, g dbSNP:761869794
1612 1612 c, t dbSNP:776636016
1616 1616 c, g dbSNP:768871024
1622 1622 a, g dbSNP:755986675
1640 1640 c, t dbSNP:202159962
1648 1648 c, t dbSNP:770599417
1656 1656 a, c dbSNP:11038934
1662 1662 c, t dbSNP:556584273
1762 1762 c, g dbSNP:752403768
1799 1799 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520028
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu78567D
Sequence Information ORF Nucleotide Sequence (Length: 1134bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)967..1509(+)
Position Chain Variation Link
18 18 c, g dbSNP:544254279
56 56 c, t dbSNP:191845906
70 70 c, t dbSNP:565018957
79 79 g, t dbSNP:546033588
223 223 c, t dbSNP:117667452
284 284 a, g dbSNP:778313910
291 291 a, g dbSNP:761562312
292 292 a, g dbSNP:187298413
298 298 c, g dbSNP:147847095
300 300 g, t dbSNP:574818805
319 319 c, t dbSNP:144550210
324 324 a, g dbSNP:537887100
353 353 a, g dbSNP:28366000
355 355 -, g dbSNP:745907473
370 370 a, g dbSNP:764581854
382 382 a, c dbSNP:372076348
397 397 c, t dbSNP:545102921
400 400 c, t dbSNP:142624067
413 413 c, t dbSNP:77282744
424 424 c, t dbSNP:540502683
429 429 -, a dbSNP:368892119
494 494 a, g dbSNP:775330218
509 509 c, t dbSNP:778701567
512 512 c, t dbSNP:757015866
518 518 c, t dbSNP:749250437
530 530 c, t dbSNP:777755222
532 532 a, t dbSNP:574779129
544 544 a, g dbSNP:201911231
553 553 c, t dbSNP:78052875
561 561 a, c dbSNP:752259058
569 569 a, g dbSNP:767098401
570 570 c, t dbSNP:754704432
574 574 c, t dbSNP:753077232
575 575 a, g dbSNP:751231721
578 578 c, g dbSNP:199752792
582 582 c, g dbSNP:544156097
584 584 a, g dbSNP:763369583
585 585 g, t dbSNP:773647701
608 608 a, g dbSNP:375003116
612 612 g, t dbSNP:762158904
630 630 g, t dbSNP:776722319
635 635 c, t dbSNP:768672905
637 637 a, g dbSNP:747272767
639 639 a, g dbSNP:775686124
645 645 a, g dbSNP:575249184
650 650 c, t dbSNP:117030196
652 652 c, t dbSNP:777367207
653 653 a, g dbSNP:139581343
668 668 a, g dbSNP:372565562
670 670 c, t dbSNP:780902440
683 683 g, t dbSNP:539145552
685 685 a, g dbSNP:751319655
688 688 a, g dbSNP:779837091
693 693 g, t dbSNP:757926662
697 697 -, t dbSNP:772932628
706 706 a, g dbSNP:750803133
716 716 a, c dbSNP:765476628
718 718 a, t dbSNP:762405252
721 721 g, t dbSNP:145989752
723 723 -, t dbSNP:747294798
724 724 a, g dbSNP:764226942
741 741 g, t dbSNP:142862456
743 743 g, t dbSNP:760731188
746 746 -, cccaaagtgctgggattacaggcg dbSNP:771717143
750 750 -, t dbSNP:778684067
751 751 a, g dbSNP:759785243
755 755 g, t dbSNP:774584740
764 764 -, a dbSNP:754962032
767 767 c, t dbSNP:772345259
770 770 c, t dbSNP:115211185
771 771 a, g dbSNP:773083925
774 774 c, t dbSNP:766489500
785 785 c, g dbSNP:748132707
787 787 c, t dbSNP:781266899
788 788 a, c, g dbSNP:553116745
789 789 g, t dbSNP:779362941
794 794 c, g dbSNP:758098724
796 796 c, g dbSNP:749994307
800 800 c, t dbSNP:779382512
804 804 g, t dbSNP:536492639
813 813 c, t dbSNP:754400630
818 818 c, t dbSNP:367948574
819 819 a, g dbSNP:763131121
823 823 -, at dbSNP:749360535
823 823 a, g dbSNP:374607995
825 825 a, g dbSNP:577458840
832 832 -, tgt dbSNP:780177490
832 832 c, t dbSNP:371776479
839 839 c, t dbSNP:759855163
845 845 c, t dbSNP:146331633
849 849 c, t dbSNP:769693436
852 852 a, c dbSNP:367932622
859 859 c, g dbSNP:761683338
860 860 c, t dbSNP:776508559
867 867 a, g dbSNP:183446599
891 891 a, t dbSNP:746902117
893 893 a, c, t dbSNP:745401140
905 905 c, t dbSNP:141436294
907 907 a, g dbSNP:745573978
911 911 a, c, g dbSNP:756846129
912 912 a, g dbSNP:749659169
913 913 g, t dbSNP:778073952
914 914 c, t dbSNP:756640162
916 916 c, t dbSNP:148523303
919 919 a, g dbSNP:767679662
921 921 g, t dbSNP:755011918
923 923 a, g dbSNP:751861091
932 932 a, g dbSNP:148294520
940 940 c, g dbSNP:763197607
943 943 a, g dbSNP:143406663
944 944 c, g dbSNP:367552499
952 952 a, g dbSNP:763931346
954 954 c, g, t dbSNP:775259761
957 957 -, g dbSNP:756192790
960 960 a, g dbSNP:771670880
974 974 a, g dbSNP:745384168
986 986 c, g dbSNP:773846623
993 993 c, g dbSNP:770603042
1001 1001 a, g dbSNP:748893856
1017 1017 a, c dbSNP:571242324
1020 1020 c, t dbSNP:373717082
1027 1027 a, c, t dbSNP:149210113
1031 1031 a, g dbSNP:755452054
1043 1043 c, t dbSNP:751591792
1059 1059 a, g dbSNP:766524874
1068 1068 a, c dbSNP:138485412
1069 1069 a, c dbSNP:750650747
1077 1077 -, g dbSNP:758875912
1084 1084 a, g dbSNP:764019374
1085 1085 c, t dbSNP:760542239
1089 1089 c, t dbSNP:775298236
1090 1090 a, g dbSNP:746885615
1094 1094 a, g dbSNP:199580977
1105 1105 c, t dbSNP:200844501
1107 1107 c, t dbSNP:147076911
1108 1108 a, g dbSNP:748982160
1111 1111 a, t dbSNP:772850336
1113 1113 c, g dbSNP:559220162
1114 1114 c, t dbSNP:770206258
1116 1116 a, g dbSNP:748471285
1118 1118 a, g dbSNP:141749998
1125 1125 c, t dbSNP:769072419
1138 1138 c, g dbSNP:540421345
1147 1147 c, t dbSNP:147599879
1149 1149 c, t dbSNP:201216223
1150 1150 a, g dbSNP:758521139
1151 1151 c, g dbSNP:750740861
1166 1166 c, t dbSNP:779291856
1172 1172 c, t dbSNP:112306737
1179 1179 a, g dbSNP:376539269
1184 1184 a, g dbSNP:752467095
1190 1190 c, t dbSNP:767296960
1200 1200 c, g dbSNP:569804974
1203 1203 c, t dbSNP:564645431
1218 1218 a, t dbSNP:77916215
1271 1271 g, t dbSNP:527488319
1286 1286 c, g dbSNP:568221882
1289 1289 c, t dbSNP:201053799
1300 1300 c, t dbSNP:376775860
1301 1301 a, g dbSNP:768834410
1312 1312 a, g dbSNP:751559458
1317 1317 a, c, g dbSNP:762806216
1319 1319 c, t dbSNP:749963131
1331 1331 -, c dbSNP:750559477
1336 1336 -, a dbSNP:767808341
1338 1338 c, t dbSNP:774316986
1341 1341 a, g dbSNP:764752529
1347 1347 a, g dbSNP:761419195
1351 1351 c, t dbSNP:201851329
1353 1353 a, c dbSNP:768968034
1354 1354 c, t dbSNP:373268202
1355 1355 a, g dbSNP:149901165
1356 1356 c, t dbSNP:569103656
1386 1386 a, g dbSNP:746329801
1402 1402 a, c dbSNP:774624321
1403 1403 a, c, g dbSNP:749543356
1411 1411 c, t dbSNP:778046623
1412 1412 a, g dbSNP:756237096
1415 1415 c, t dbSNP:746807126
1416 1416 c, t dbSNP:779781353
1417 1417 c, t dbSNP:758350757
1418 1418 a, g dbSNP:750335756
1423 1423 c, t dbSNP:369296929
1424 1424 a, g, t dbSNP:753491100
1433 1433 a, g dbSNP:763820437
1440 1440 c, t dbSNP:760364372
1445 1445 a, g dbSNP:376874771
1446 1446 g, t dbSNP:767973635
1455 1455 a, g dbSNP:760162320
1457 1457 a, t dbSNP:780093447
1466 1466 a, g dbSNP:774919964
1471 1471 a, c, t dbSNP:75201515
1472 1472 c, t dbSNP:773103636
1479 1479 c, t dbSNP:770082532
1481 1481 c, t dbSNP:748317544
1490 1490 c, t dbSNP:779875591
1491 1491 c, t dbSNP:758160529
1493 1493 c, g dbSNP:745873713
1494 1494 c, t dbSNP:778897133
1506 1506 a, c dbSNP:757084968
1510 1510 a, g dbSNP:753419895
1512 1512 c, t dbSNP:763462311
1514 1514 c, t dbSNP:770866746
1516 1516 c, t dbSNP:763967077
1519 1519 c, g dbSNP:752364425
1528 1528 a, g dbSNP:768059419
1545 1545 a, t dbSNP:759963705
1548 1548 a, c, g dbSNP:185640614
1550 1550 g, t dbSNP:373418691
1558 1558 c, t dbSNP:377297419
1560 1560 c, t dbSNP:372811398
1567 1567 c, t dbSNP:369696306
1573 1573 c, g dbSNP:762065869
1575 1575 a, g dbSNP:201752855
1576 1576 a, g dbSNP:771913231
1579 1579 a, g dbSNP:745677263
1582 1582 a, g dbSNP:201248157
1587 1587 c, g, t dbSNP:749157398
1589 1589 a, t dbSNP:777381633
1591 1591 c, t dbSNP:140123366
1598 1598 a, g dbSNP:752452401
1599 1599 a, g dbSNP:35569076
1621 1621 c, t dbSNP:529843288
1622 1622 a, g dbSNP:562293059
1627 1627 c, t dbSNP:766607928
1628 1628 a, c, g dbSNP:371969577
1633 1633 a, g dbSNP:765370645
1639 1639 a, g dbSNP:761869794
1660 1660 c, t dbSNP:776636016
1664 1664 c, g dbSNP:768871024
1670 1670 a, g dbSNP:755986675
1688 1688 c, t dbSNP:202159962
1696 1696 c, t dbSNP:770599417
1704 1704 a, c dbSNP:11038934
1710 1710 c, t dbSNP:556584273
1810 1810 c, g dbSNP:752403768
1847 1847 c, t dbSNP:545753876

Target ORF information:

RefSeq Version XM_011520029
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens harbinger transposase derived 1 (HARBI1), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu31772D
Sequence Information ORF Nucleotide Sequence (Length: 1050bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product putative nuclease HARBI1
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AK057237.1 and BM768489.1. On Mar 5, 2009 this sequence version replaced gi:31341135. ##Evidence-Data-START## Transcript exon combination :: AK057237.1, BC036925.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)168..170(+)
Misc Feature(2)690..1148(+)
Exon (1)1..104
Gene Synonym:
Exon (2)105..918
Gene Synonym:
Exon (3)919..1522
Gene Synonym:
Position Chain Variation Link
5 5 c, t dbSNP:191845906
19 19 c, t dbSNP:565018957
28 28 g, t dbSNP:546033588
105 105 a, c dbSNP:372076348
120 120 c, t dbSNP:545102921
123 123 c, t dbSNP:142624067
136 136 c, t dbSNP:77282744
147 147 c, t dbSNP:540502683
152 152 -, a dbSNP:368892119
217 217 a, g dbSNP:775330218
232 232 c, t dbSNP:778701567
235 235 c, t dbSNP:757015866
241 241 c, t dbSNP:749250437
253 253 c, t dbSNP:777755222
255 255 a, t dbSNP:574779129
267 267 a, g dbSNP:201911231
276 276 c, t dbSNP:78052875
284 284 a, c dbSNP:752259058
292 292 a, g dbSNP:767098401
293 293 c, t dbSNP:754704432
297 297 c, t dbSNP:753077232
298 298 a, g dbSNP:751231721
301 301 c, g dbSNP:199752792
305 305 c, g dbSNP:544156097
307 307 a, g dbSNP:763369583
308 308 g, t dbSNP:773647701
331 331 a, g dbSNP:375003116
335 335 g, t dbSNP:762158904
353 353 g, t dbSNP:776722319
358 358 c, t dbSNP:768672905
360 360 a, g dbSNP:747272767
362 362 a, g dbSNP:775686124
368 368 a, g dbSNP:575249184
373 373 c, t dbSNP:117030196
375 375 c, t dbSNP:777367207
376 376 a, g dbSNP:139581343
391 391 a, g dbSNP:372565562
393 393 c, t dbSNP:780902440
406 406 g, t dbSNP:539145552
408 408 a, g dbSNP:751319655
411 411 a, g dbSNP:779837091
416 416 g, t dbSNP:757926662
420 420 -, t dbSNP:772932628
429 429 a, g dbSNP:750803133
439 439 a, c dbSNP:765476628
441 441 a, t dbSNP:762405252
444 444 g, t dbSNP:145989752
446 446 -, t dbSNP:747294798
447 447 a, g dbSNP:764226942
464 464 g, t dbSNP:142862456
466 466 g, t dbSNP:760731188
469 469 -, cccaaagtgctgggattacaggcg dbSNP:771717143
473 473 -, t dbSNP:778684067
474 474 a, g dbSNP:759785243
478 478 g, t dbSNP:774584740
487 487 -, a dbSNP:754962032
490 490 c, t dbSNP:772345259
493 493 c, t dbSNP:115211185
494 494 a, g dbSNP:773083925
497 497 c, t dbSNP:766489500
508 508 c, g dbSNP:748132707
510 510 c, t dbSNP:781266899
511 511 a, c, g dbSNP:553116745
512 512 g, t dbSNP:779362941
517 517 c, g dbSNP:758098724
519 519 c, g dbSNP:749994307
523 523 c, t dbSNP:779382512
527 527 g, t dbSNP:536492639
536 536 c, t dbSNP:754400630
541 541 c, t dbSNP:367948574
542 542 a, g dbSNP:763131121
546 546 -, at dbSNP:749360535
546 546 a, g dbSNP:374607995
548 548 a, g dbSNP:577458840
555 555 -, tgt dbSNP:780177490
555 555 c, t dbSNP:371776479
562 562 c, t dbSNP:759855163
568 568 c, t dbSNP:146331633
572 572 c, t dbSNP:769693436
575 575 a, c dbSNP:367932622
582 582 c, g dbSNP:761683338
583 583 c, t dbSNP:776508559
590 590 a, g dbSNP:183446599
614 614 a, t dbSNP:746902117
616 616 a, c, t dbSNP:745401140
628 628 c, t dbSNP:141436294
630 630 a, g dbSNP:745573978
634 634 a, c, g dbSNP:756846129
635 635 a, g dbSNP:749659169
636 636 g, t dbSNP:778073952
637 637 c, t dbSNP:756640162
639 639 c, t dbSNP:148523303
642 642 a, g dbSNP:767679662
644 644 g, t dbSNP:755011918
646 646 a, g dbSNP:751861091
655 655 a, g dbSNP:148294520
663 663 c, g dbSNP:763197607
666 666 a, g dbSNP:143406663
667 667 c, g dbSNP:367552499
675 675 a, g dbSNP:763931346
677 677 c, g, t dbSNP:775259761
680 680 -, g dbSNP:756192790
683 683 a, g dbSNP:771670880
697 697 a, g dbSNP:745384168
709 709 c, g dbSNP:773846623
716 716 c, g dbSNP:770603042
724 724 a, g dbSNP:748893856
740 740 a, c dbSNP:571242324
743 743 c, t dbSNP:373717082
750 750 a, c, t dbSNP:149210113
754 754 a, g dbSNP:755452054
766 766 c, t dbSNP:751591792
782 782 a, g dbSNP:766524874
791 791 a, c dbSNP:138485412
792 792 a, c dbSNP:750650747
800 800 -, g dbSNP:758875912
807 807 a, g dbSNP:764019374
808 808 c, t dbSNP:760542239
812 812 c, t dbSNP:775298236
813 813 a, g dbSNP:746885615
817 817 a, g dbSNP:199580977
828 828 c, t dbSNP:200844501
830 830 c, t dbSNP:147076911
831 831 a, g dbSNP:748982160
834 834 a, t dbSNP:772850336
836 836 c, g dbSNP:559220162
837 837 c, t dbSNP:770206258
839 839 a, g dbSNP:748471285
841 841 a, g dbSNP:141749998
848 848 c, t dbSNP:769072419
861 861 c, g dbSNP:540421345
870 870 c, t dbSNP:147599879
872 872 c, t dbSNP:201216223
873 873 a, g dbSNP:758521139
874 874 c, g dbSNP:750740861
889 889 c, t dbSNP:779291856
895 895 c, t dbSNP:112306737
902 902 a, g dbSNP:376539269
907 907 a, g dbSNP:752467095
913 913 c, t dbSNP:767296960
925 925 c, g dbSNP:568221882
928 928 c, t dbSNP:201053799
939 939 c, t dbSNP:376775860
940 940 a, g dbSNP:768834410
951 951 a, g dbSNP:751559458
956 956 a, c, g dbSNP:762806216
958 958 c, t dbSNP:749963131
970 970 -, c dbSNP:750559477
975 975 -, a dbSNP:767808341
977 977 c, t dbSNP:774316986
980 980 a, g dbSNP:764752529
986 986 a, g dbSNP:761419195
990 990 c, t dbSNP:201851329
992 992 a, c dbSNP:768968034
993 993 c, t dbSNP:373268202
994 994 a, g dbSNP:149901165
995 995 c, t dbSNP:569103656
1025 1025 a, g dbSNP:746329801
1041 1041 a, c dbSNP:774624321
1042 1042 a, c, g dbSNP:749543356
1050 1050 c, t dbSNP:778046623
1051 1051 a, g dbSNP:756237096
1054 1054 c, t dbSNP:746807126
1055 1055 c, t dbSNP:779781353
1056 1056 c, t dbSNP:758350757
1057 1057 a, g dbSNP:750335756
1062 1062 c, t dbSNP:369296929
1063 1063 a, g, t dbSNP:753491100
1072 1072 a, g dbSNP:763820437
1079 1079 c, t dbSNP:760364372
1084 1084 a, g dbSNP:376874771
1085 1085 g, t dbSNP:767973635
1094 1094 a, g dbSNP:760162320
1096 1096 a, t dbSNP:780093447
1105 1105 a, g dbSNP:774919964
1110 1110 a, c, t dbSNP:75201515
1111 1111 c, t dbSNP:773103636
1118 1118 c, t dbSNP:770082532
1120 1120 c, t dbSNP:748317544
1129 1129 c, t dbSNP:779875591
1130 1130 c, t dbSNP:758160529
1132 1132 c, g dbSNP:745873713
1133 1133 c, t dbSNP:778897133
1145 1145 a, c dbSNP:757084968
1149 1149 a, g dbSNP:753419895
1151 1151 c, t dbSNP:763462311
1153 1153 c, t dbSNP:770866746
1155 1155 c, t dbSNP:763967077
1158 1158 c, g dbSNP:752364425
1167 1167 a, g dbSNP:768059419
1184 1184 a, t dbSNP:759963705
1187 1187 a, c, g dbSNP:185640614
1189 1189 g, t dbSNP:373418691
1197 1197 c, t dbSNP:377297419
1199 1199 c, t dbSNP:372811398
1206 1206 c, t dbSNP:369696306
1212 1212 c, g dbSNP:762065869
1214 1214 a, g dbSNP:201752855
1215 1215 a, g dbSNP:771913231
1218 1218 a, g dbSNP:745677263
1221 1221 a, g dbSNP:201248157
1226 1226 c, g, t dbSNP:749157398
1228 1228 a, t dbSNP:777381633
1230 1230 c, t dbSNP:140123366
1237 1237 a, g dbSNP:752452401
1238 1238 a, g dbSNP:35569076
1260 1260 c, t dbSNP:529843288
1261 1261 a, g dbSNP:562293059
1266 1266 c, t dbSNP:766607928
1267 1267 a, c, g dbSNP:371969577
1272 1272 a, g dbSNP:765370645
1278 1278 a, g dbSNP:761869794
1299 1299 c, t dbSNP:776636016
1303 1303 c, g dbSNP:768871024
1309 1309 a, g dbSNP:755986675
1327 1327 c, t dbSNP:202159962
1335 1335 c, t dbSNP:770599417
1343 1343 a, c dbSNP:11038934
1349 1349 c, t dbSNP:556584273
1449 1449 c, g dbSNP:752403768
1486 1486 c, t dbSNP:545753876
1519 1519 a, c dbSNP:542270082

Target ORF information:

RefSeq Version NM_173811
Organism Homo sapiens (human)
Definition Homo sapiens harbinger transposase derived 1 (HARBI1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.