
KRT6C cDNA ORF clone, Homo sapiens (human)

Gene Symbol KRT6C
Entrez Gene ID 286887
Full Name keratin 6C, type II
Synonyms K6E, KRT6E, PPKNEFD
General protein information
Preferred Names
keratin, type II cytoskeletal 6C
keratin, type II cytoskeletal 6C
keratin 6E
keratin K6h
type-II keratin Kb12
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jul 2009]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_173086 NP_775109 keratin, type II cytoskeletal 6C

Homo sapiens (human) KRT6C NP_775109.2
Pan troglodytes (chimpanzee) KRT6B XP_001143262.1


ID Name Evidence
GO:0005882 intermediate filament NAS
GO:0045095 keratin filament IEA


ID Name Evidence
GO:0005198 structural molecule activity NAS


ID Name Evidence
GO:0007010 cytoskeleton organization NAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following KRT6C gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the KRT6C cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu18637 NM_173086 Homo sapiens keratin 6C, type II (KRT6C), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu18637
Accession Version NM_173086.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1695bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product keratin, type II cytoskeletal 6C
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC110639.1 and AC055736.20. This sequence is a reference standard in the RefSeqGene project. On Aug 15, 2007 this sequence version replaced gi:141802000. Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jul 2009]. ##Evidence-Data-START## Transcript exon combination :: BC110639.1, L42611.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2156670 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)52..534(+)
Misc Feature(2)52..54(+)
Misc Feature(3)226..228(+)
Misc Feature(4)532..1473(+)
Misc Feature(5)535..1464(+)
Misc Feature(6)535..642(+)
Misc Feature(7)643..699(+)
Misc Feature(8)700..975(+)
Misc Feature(9)976..1047(+)
Misc Feature(10)1048..1464(+)
Misc Feature(11)1156..>1491(+)
Misc Feature(12)1288..1290(+)
Misc Feature(13)1465..1740(+)
Exon (1)1..588
Gene Synonym:
Exon (2)589..803
Gene Synonym:
Exon (3)804..864
Gene Synonym:
Exon (4)865..960
Gene Synonym:
Exon (5)961..1125
Gene Synonym:
Exon (6)1126..1251
Gene Synonym:
Exon (7)1252..1472
Gene Synonym:
Exon (8)1473..1507
Gene Synonym:
Exon (9)1508..2289
Gene Synonym:
Position Chain Variation Link
1 1 c, t dbSNP:760603221
2 2 a, g dbSNP:369432834
3 3 c, t dbSNP:771530685
10 10 c, g dbSNP:761281263
17 17 c, t dbSNP:773898260
19 19 c, g dbSNP:768283746
21 21 c, t dbSNP:749004398
22 22 a, g dbSNP:377008775
25 25 a, g dbSNP:770063694
28 28 a, g dbSNP:746334240
30 30 c, t dbSNP:781523477
31 31 c, t dbSNP:757893020
33 33 a, c dbSNP:751678221
36 36 a, g dbSNP:146462738
43 43 a, g dbSNP:758628528
45 45 a, g dbSNP:752877742
46 46 a, g dbSNP:766148199
50 50 c, t dbSNP:199806927
51 51 a, g dbSNP:750271235
58 58 a, g dbSNP:549499531
59 59 c, t dbSNP:761794381
74 74 a, g dbSNP:773845266
75 75 a, g dbSNP:768155393
77 77 a, g dbSNP:762605521
78 78 a, c dbSNP:775024476
82 82 a, t dbSNP:769529836
86 86 a, g dbSNP:746200592
88 88 a, c dbSNP:532877580
91 91 c, t dbSNP:563909878
92 92 a, g dbSNP:142765056
93 93 -, ccg dbSNP:760026731
93 93 c, t dbSNP:777943959
94 94 a, c, t dbSNP:138260820
95 95 a, g dbSNP:145690917
98 98 c, g dbSNP:755276539
107 107 c, t dbSNP:371815641
109 109 a, g dbSNP:200613767
110 110 a, g dbSNP:757116227
119 119 c, g dbSNP:751508579
130 130 c, g dbSNP:763542149
132 132 a, c dbSNP:148963047
136 136 c, t dbSNP:775118139
139 139 c, t dbSNP:764788115
140 140 a, c dbSNP:759301755
147 147 c, t dbSNP:777072942
148 148 a, g dbSNP:771438109
154 154 a, g dbSNP:201473468
159 159 c, t dbSNP:773886770
160 160 a, g dbSNP:772675969
165 165 c, t dbSNP:748154462
166 166 c, t dbSNP:541854809
167 167 a, g dbSNP:755148780
168 168 c, t dbSNP:749528731
169 169 c, t dbSNP:780904189
175 175 a, g dbSNP:757064749
195 195 c, t dbSNP:61732611
195 195 c, t dbSNP:74093594
197 197 a, c dbSNP:576537730
205 205 a, g dbSNP:758422394
206 206 a, g dbSNP:752146223
209 209 c, t dbSNP:764811174
223 223 a, c, t dbSNP:776447680
224 224 a, g dbSNP:766809405
228 228 c, t dbSNP:556681459
228 228 -, t dbSNP:33998545
229 229 c, t dbSNP:201833096
231 231 -, a dbSNP:771000394
231 231 a, g, t dbSNP:2885799
231 231 -, g, ta dbSNP:373213028
236 236 a, c, g dbSNP:774226597
237 237 c, t dbSNP:768791816
238 238 c, t dbSNP:749460741
240 240 c, g dbSNP:780282537
241 241 a, g dbSNP:770040188
244 244 g, t dbSNP:746797014
245 245 a, c, g dbSNP:758206263
245 245 -, g dbSNP:773475173
246 246 a, c dbSNP:419374
246 246 -, c dbSNP:769993107
248 248 a, c dbSNP:752696450
252 252 g, t dbSNP:778238378
256 256 a, g dbSNP:754549818
261 261 a, c dbSNP:753439032
270 270 a, g dbSNP:766108223
272 272 -, g dbSNP:748007089
286 286 a, c dbSNP:760460763
291 291 a, c dbSNP:534443870
292 292 a, g dbSNP:750812502
294 294 a, c dbSNP:767927233
299 299 a, g dbSNP:762167438
310 310 a, g dbSNP:411107
310 310 a, g dbSNP:149028472
322 322 g, t dbSNP:768575911
328 328 a, g dbSNP:762985771
333 333 c, t dbSNP:555268910
336 336 c, t dbSNP:770003413
337 337 a, g dbSNP:200653200
349 349 a, g dbSNP:535067470
355 355 a, g dbSNP:771924434
359 359 a, g dbSNP:747996995
364 364 a, g dbSNP:569274386
366 366 a, c, t dbSNP:375539593
367 367 a, g dbSNP:779775753
380 380 a, g dbSNP:394598
384 384 g, t dbSNP:532818119
387 387 c, t dbSNP:767722638
392 392 a, g dbSNP:762264621
411 411 c, t dbSNP:751906990
412 412 c, t dbSNP:764637102
419 419 g, t dbSNP:763521892
432 432 c, t dbSNP:150249318
438 438 c, t dbSNP:769879487
442 442 c, g dbSNP:759709344
444 444 -, t dbSNP:776423843
449 449 a, g dbSNP:776944724
462 462 c, t dbSNP:771098275
465 465 c, t dbSNP:1053684
466 466 a, g dbSNP:570537660
476 476 a, g dbSNP:151117600
483 483 g, t dbSNP:749240789
485 485 c, t dbSNP:779653115
499 499 c, t dbSNP:374571234
504 504 c, t dbSNP:547266639
507 507 c, t dbSNP:527527882
509 509 c, g, t dbSNP:751936560
510 510 c, t dbSNP:764449828
511 511 a, g, t dbSNP:199519828
515 515 a, t dbSNP:765262272
517 517 c, t dbSNP:759580835
518 518 -, a dbSNP:768492005
518 518 a, c dbSNP:776626309
519 519 a, g dbSNP:766612368
520 520 c, g dbSNP:760872674
521 521 a, g dbSNP:774127601
525 525 a, g dbSNP:372187804
526 526 c, t dbSNP:749187914
529 529 a, g dbSNP:775596000
531 531 c, t dbSNP:769888167
532 532 a, g dbSNP:745359746
539 539 a, g dbSNP:780622873
543 543 a, g, t dbSNP:201509598
543 543 -, g dbSNP:544093757
546 546 c, g dbSNP:778067876
554 554 a, c dbSNP:758797717
561 561 -, caa dbSNP:267607474
562 562 a, g dbSNP:368414844
564 564 -, caa dbSNP:587777291
567 567 c, g dbSNP:765710770
582 582 c, t dbSNP:375162025
592 592 c, t dbSNP:760082841
593 593 a, g dbSNP:11608915
595 595 c, g, t dbSNP:747804312
597 597 c, g dbSNP:779188911
601 601 a, g dbSNP:532320680
604 604 c, t dbSNP:749762814
609 609 g, t dbSNP:372097391
610 610 a, g dbSNP:144159607
624 624 a, c dbSNP:756690747
627 627 a, c, g dbSNP:375377584
630 630 a, g dbSNP:757485766
633 633 g, t dbSNP:751855546
637 637 c, g dbSNP:765044729
640 640 c, t dbSNP:371866729
659 659 a, g dbSNP:368049593
662 662 c, t dbSNP:140286012
663 663 c, t dbSNP:760674117
683 683 c, t dbSNP:566830601
684 684 a, c, g dbSNP:147574610
690 690 c, t dbSNP:773905606
691 691 a, g dbSNP:371638126
694 694 a, c, t dbSNP:530167548
696 696 a, g dbSNP:770194571
700 700 a, g dbSNP:746379064
708 708 a, c dbSNP:561088025
712 712 a, t dbSNP:757447165
713 713 g, t dbSNP:145109130
714 714 a, g, t dbSNP:376855829
720 720 g, t dbSNP:753571332
721 721 c, t dbSNP:766201770
722 722 c, t dbSNP:755990156
725 725 a, t dbSNP:750380592
728 728 a, g dbSNP:17099602
729 729 c, t dbSNP:77218649
732 732 c, t dbSNP:773961021
733 733 a, g dbSNP:763636809
735 735 c, g, t dbSNP:425073
736 736 a, g dbSNP:144527967
737 737 a, g dbSNP:746339956
739 739 g, t dbSNP:777249121
742 742 c, t dbSNP:771618302
743 743 a, g, t dbSNP:370835586
746 746 a, g dbSNP:149302952
747 747 c, t dbSNP:395664
748 748 c, t dbSNP:779662593
749 749 a, g, t dbSNP:12298348
750 750 c, t dbSNP:385476
753 753 a, g dbSNP:117030701
754 754 g, t dbSNP:751024661
758 758 c, t dbSNP:533243700
759 759 a, c, g dbSNP:142711454
760 760 a, g dbSNP:765024872
771 771 c, t dbSNP:759961560
780 780 c, t dbSNP:373902514
781 781 a, c dbSNP:138196052
782 782 c, t dbSNP:761250859
784 784 c, g dbSNP:773109867
792 792 a, c dbSNP:772218540
793 793 c, g, t dbSNP:1132951
796 796 a, g dbSNP:779075537
803 803 a, g dbSNP:768914207
805 805 c, t dbSNP:753569487
807 807 c, t dbSNP:371748613
812 812 a, t dbSNP:756467779
816 816 a, t dbSNP:750801495
819 819 c, g dbSNP:768054115
825 825 a, g dbSNP:762293958
826 826 c, t dbSNP:187821450
827 827 a, g dbSNP:200158036
830 830 a, c dbSNP:368019303
844 844 c, g dbSNP:566757491
845 845 a, c dbSNP:769961009
848 848 c, t dbSNP:367775954
856 856 -, ct dbSNP:756902400
867 867 c, t dbSNP:201562541
870 870 a, g dbSNP:758971712
879 879 c, g dbSNP:373232730
887 887 a, g dbSNP:752755881
888 888 c, t dbSNP:765246452
891 891 a, g dbSNP:759759029
892 892 g, t dbSNP:754041908
893 893 c, t dbSNP:371438302
896 896 c, t dbSNP:437616
900 900 g, t dbSNP:761675419
901 901 c, t dbSNP:377674997
902 902 a, g dbSNP:768706973
909 909 a, g, t dbSNP:775007483
910 910 a, g dbSNP:769209318
911 911 c, t dbSNP:559979632
912 912 a, g dbSNP:745492331
914 914 a, g dbSNP:549374125
921 921 c, t dbSNP:145658614
924 924 a, c dbSNP:374128835
927 927 c, t dbSNP:775325576
930 930 a, c, g dbSNP:377509241
933 933 c, g dbSNP:779013615
936 936 c, t dbSNP:754985058
937 937 c, t dbSNP:754002347
939 939 c, t dbSNP:148330805
943 943 a, t dbSNP:430612
945 945 a, g dbSNP:761041689
948 948 c, t dbSNP:751329893
953 953 a, g dbSNP:560818992
954 954 c, t dbSNP:762898698
955 955 a, g dbSNP:775321213
968 968 a, c dbSNP:765083156
970 970 c, t dbSNP:143318086
971 971 a, t dbSNP:776062436
974 974 c, t dbSNP:765896990
975 975 -, g dbSNP:752144640
977 977 a, c dbSNP:375785509
980 980 c, g dbSNP:772823724
997 997 c, t dbSNP:771763910
999 999 -, c dbSNP:766777401
999 999 c, t dbSNP:149194468
1000 1000 a, g dbSNP:556897198
1006 1006 c, g dbSNP:768974382
1008 1008 a, g dbSNP:749811820
1012 1012 a, g dbSNP:780229149
1019 1019 a, t dbSNP:756293332
1020 1020 c, t dbSNP:745983620
1024 1024 c, g, t dbSNP:757555228
1025 1025 a, g dbSNP:147729627
1029 1029 c, t dbSNP:765095803
1032 1032 a, g dbSNP:373512100
1034 1034 a, c dbSNP:147113111
1037 1037 c, t dbSNP:766347302
1039 1039 c, g dbSNP:760159262
1041 1041 c, g, t dbSNP:767075013
1043 1043 a, g dbSNP:761529098
1048 1048 a, t dbSNP:182926030
1050 1050 c, t dbSNP:369806166
1051 1051 a, g dbSNP:372589428
1054 1054 a, g dbSNP:535131158
1057 1057 g, t dbSNP:770471413
1059 1059 c, g dbSNP:745928275
1062 1062 c, g dbSNP:781427881
1063 1063 a, g dbSNP:771002139
1068 1068 a, t dbSNP:575947038
1070 1070 a, t dbSNP:371894953
1071 1071 c, t dbSNP:11540289
1072 1072 a, g dbSNP:201362955
1081 1081 g, t dbSNP:147558225
1085 1085 a, g dbSNP:149881707
1086 1086 a, g dbSNP:756114823
1088 1088 a, g dbSNP:549556558
1089 1089 a, g dbSNP:140162855
1093 1093 a, c, t dbSNP:151169574
1094 1094 a, g dbSNP:199836454
1096 1096 g, t dbSNP:763693914
1104 1104 c, t dbSNP:375268304
1106 1106 a, g dbSNP:763387071
1107 1107 a, g, t dbSNP:142144008
1113 1113 a, g dbSNP:760135381
1116 1116 a, c dbSNP:776526363
1122 1122 a, c, g dbSNP:148664004
1126 1126 c, g, t dbSNP:781165932
1128 1128 c, t dbSNP:371866175
1129 1129 a, g dbSNP:746522586
1135 1135 c, t dbSNP:777152173
1140 1140 a, g dbSNP:146009218
1141 1141 a, g dbSNP:62619943
1151 1151 a, g dbSNP:765022697
1152 1152 c, t dbSNP:367816095
1158 1158 c, g, t dbSNP:201846617
1163 1163 a, g dbSNP:766909003
1164 1164 c, g, t dbSNP:374280857
1165 1165 a, g dbSNP:767603022
1172 1172 a, g dbSNP:761980436
1173 1173 -, c dbSNP:763080178
1178 1178 a, c dbSNP:774520953
1188 1188 c, g dbSNP:768914106
1192 1192 a, g dbSNP:745662026
1202 1202 a, t dbSNP:776355024
1203 1203 c, t dbSNP:144142819
1204 1204 c, t dbSNP:770832964
1205 1205 a, g dbSNP:139430353
1207 1207 a, t dbSNP:146293861
1208 1208 c, t dbSNP:757950585
1209 1209 a, g dbSNP:747710925
1210 1210 a, t dbSNP:778699018
1214 1214 a, t dbSNP:754657324
1218 1218 a, g dbSNP:149351477
1230 1230 g, t dbSNP:371414703
1231 1231 a, t dbSNP:756592237
1232 1232 g, t dbSNP:1132954
1233 1233 a, c, g, t dbSNP:761855542
1234 1234 a, c, g dbSNP:764294487
1239 1239 c, t dbSNP:11540290
1247 1247 a, c dbSNP:776427960
1249 1249 c, t dbSNP:375678173
1254 1254 c, t dbSNP:138764418
1256 1256 c, t dbSNP:761805911
1258 1258 a, t dbSNP:774395651
1259 1259 a, g dbSNP:1132956
1260 1260 c, g dbSNP:764136405
1263 1263 a, g dbSNP:11540291
1264 1264 c, t dbSNP:762353486
1265 1265 a, t dbSNP:775130175
1269 1269 c, t dbSNP:11540292
1275 1275 a, g, t dbSNP:745532394
1283 1283 c, t dbSNP:776931101
1284 1284 g, t dbSNP:771254995
1285 1285 a, g dbSNP:374271495
1290 1290 a, g dbSNP:778131790
1291 1291 c, t dbSNP:759012703
1292 1292 a, g dbSNP:748113564
1300 1300 a, g dbSNP:375295765
1302 1302 a, g dbSNP:779066378
1304 1304 c, t dbSNP:150638909
1305 1305 a, c dbSNP:382367
1306 1306 -, c dbSNP:765452719
1306 1306 c, t dbSNP:766743865
1308 1308 c, t dbSNP:757092016
1312 1312 c, g dbSNP:777631485
1317 1317 c, t dbSNP:751426846
1319 1319 a, c dbSNP:763929970
1322 1322 a, g dbSNP:369450600
1325 1325 a, g dbSNP:762951488
1330 1330 a, c, g dbSNP:542254329
1341 1341 g, t dbSNP:759147517
1342 1342 a, g, t dbSNP:141915659
1346 1346 c, t dbSNP:546062120
1362 1362 a, g dbSNP:3894847
1363 1363 c, g dbSNP:772403772
1364 1364 a, c dbSNP:748713877
1369 1369 a, c dbSNP:778822904
1375 1375 c, t dbSNP:755081735
1376 1376 a, g dbSNP:147097073
1377 1377 a, g dbSNP:780405984
1386 1386 g, t dbSNP:756469136
1387 1387 g, t dbSNP:751243643
1401 1401 a, g dbSNP:112260566
1407 1407 c, t dbSNP:376399948
1421 1421 a, t dbSNP:752710640
1425 1425 c, t dbSNP:554932033
1432 1432 -, atcgccacctaccgcaagctgctggag dbSNP:267607475
1432 1432 a, g dbSNP:759033023
1434 1434 c, t dbSNP:139369420
1435 1435 a, g dbSNP:765950338
1444 1444 c, t dbSNP:754984737
1445 1445 a, g dbSNP:535124810
1447 1447 a, t dbSNP:772522531
1449 1449 a, g dbSNP:569388877
1459 1459 a, g dbSNP:267603518
1460 1460 a, g dbSNP:774895415
1461 1461 c, g, t dbSNP:371806019
1462 1462 a, g dbSNP:587777292
1466 1466 a, c dbSNP:780283244
1470 1470 c, t dbSNP:200127516
1474 1474 c, g, t dbSNP:371468604
1482 1482 c, g, t dbSNP:11170142
1483 1483 a, g dbSNP:143419682
1488 1488 c, t dbSNP:749955459
1489 1489 a, g dbSNP:412533
1495 1495 c, t dbSNP:145485697
1498 1498 -, g dbSNP:761965940
1503 1503 c, t dbSNP:375986162
1504 1504 a, g, t dbSNP:11540298
1507 1507 c, t dbSNP:372653387
1511 1511 c, t dbSNP:201736697
1512 1512 a, g dbSNP:380215
1515 1515 a, g dbSNP:391214
1518 1518 c, g dbSNP:750572343
1525 1525 a, g, t dbSNP:762033210
1536 1536 c, t dbSNP:775304410
1542 1542 c, t dbSNP:371711981
1543 1543 a, g dbSNP:140943956
1544 1544 a, g dbSNP:776408562
1545 1545 g, t dbSNP:570463693
1546 1546 g, t dbSNP:146477504
1547 1547 c, t dbSNP:771049829
1551 1551 c, t dbSNP:410562
1552 1552 a, c, g dbSNP:534029470
1557 1557 c, t dbSNP:139360268
1558 1558 a, g dbSNP:548540602
1559 1559 a, g dbSNP:755279283
1561 1561 a, g dbSNP:754290645
1563 1563 c, t dbSNP:780538370
1568 1568 g, t dbSNP:756613741
1572 1572 c, t dbSNP:146276081
1574 1574 c, t dbSNP:767609102
1592 1592 a, c dbSNP:142242212
1594 1594 g, t dbSNP:751702120
1602 1602 c, t dbSNP:552295842
1608 1608 -, t dbSNP:768458923
1615 1615 a, g, t dbSNP:112885852
1617 1617 c, t dbSNP:770935281
1621 1621 a, g dbSNP:760710357
1631 1631 a, g dbSNP:772808089
1634 1634 c, t dbSNP:771675482
1639 1639 a, t dbSNP:747740278
1652 1652 c, t dbSNP:368905186
1654 1654 a, g dbSNP:768417983
1655 1655 g, t dbSNP:749545344
1660 1660 a, g dbSNP:780413728
1661 1661 c, g dbSNP:71453291
1668 1668 c, t dbSNP:758869829
1672 1672 c, g dbSNP:746408510
1678 1678 a, g dbSNP:149584449
1680 1680 c, t dbSNP:535062636
1681 1681 a, g dbSNP:138405958
1692 1692 c, t dbSNP:764218523
1693 1693 a, c, g dbSNP:753527677
1695 1695 a, c dbSNP:372904532
1697 1697 a, t dbSNP:760585122
1700 1700 a, g dbSNP:773258761
1715 1715 c, g dbSNP:368823424
1719 1719 a, c dbSNP:761220991
1720 1720 a, t dbSNP:773912210
1722 1722 a, c, t dbSNP:374282576
1731 1731 c, g dbSNP:775794801
1732 1732 a, t dbSNP:147501308
1734 1734 c, t dbSNP:201858772
1735 1735 a, c dbSNP:770116265
1737 1737 a, g dbSNP:143211712
1739 1739 a, c, t dbSNP:570733503
1742 1742 a, g dbSNP:746995539
1761 1761 g, t dbSNP:777930324
1762 1762 a, c, g, t dbSNP:372306924
1763 1763 a, c, g dbSNP:377681976
1765 1765 c, t dbSNP:750307415
1767 1767 c, t dbSNP:767287477
1768 1768 c, t dbSNP:368105013
1770 1770 a, c dbSNP:773690608
1778 1778 a, c dbSNP:544475414
1782 1782 c, g dbSNP:762414361
1794 1794 g, t dbSNP:575535775
1799 1799 a, g dbSNP:556085231
1801 1801 c, t dbSNP:545522544
1802 1802 a, g dbSNP:759071269
1806 1806 c, t dbSNP:2568
1819 1819 a, g, t dbSNP:1053796
1822 1822 c, g dbSNP:2567
1828 1828 c, t dbSNP:546586589
1835 1835 c, t dbSNP:773508834
1844 1844 c, g dbSNP:568230729
1853 1853 a, g dbSNP:202166218
1860 1860 a, t dbSNP:554804860
1924 1924 a, g dbSNP:528568594
1972 1972 c, t dbSNP:538094399
1975 1975 a, c dbSNP:583678
1990 1990 a, g dbSNP:779147159
2004 2004 a, c dbSNP:755170569
2027 2027 a, c dbSNP:447151
2037 2037 c, g dbSNP:780101890
2057 2057 a, g dbSNP:757240646
2059 2059 a, c dbSNP:751453698
2064 2064 c, t dbSNP:372790
2073 2073 a, g dbSNP:566940499
2084 2084 c, t dbSNP:752319551
2086 2086 a, g dbSNP:432498
2133 2133 c, t dbSNP:144744556
2145 2145 a, t dbSNP:561100194
2146 2146 a, g dbSNP:759235608
2150 2150 a, g dbSNP:544411391
2165 2165 c, t dbSNP:368004806
2167 2167 c, t dbSNP:776349658
2168 2168 a, g dbSNP:531227920
2172 2172 c, t dbSNP:565488743
2175 2175 a, c dbSNP:545763458
2179 2179 c, t dbSNP:765976074
2185 2185 c, g dbSNP:763537839
2204 2204 a, g dbSNP:576800798
2209 2209 a, t dbSNP:77737438
2227 2227 c, t dbSNP:56879750
2230 2230 g, t dbSNP:575204415
2240 2240 a, c dbSNP:773701707
2257 2257 c, t dbSNP:772355136
2273 2273 a, c dbSNP:574591844

Target ORF information:

RefSeq Version NM_173086
Organism Homo sapiens (human)
Definition Homo sapiens keratin 6C, type II (KRT6C), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Collapse of the keratin filament network through the expression of mutant keratin 6c observed in a case of focal plantar keratoderma
J. Dermatol. 40 (7), 553-557 (2013)
Kubo A, Oura Y, Hirano T, Aoyama Y, Sato S, Nakamura K, Takae Y and Amagai M.


In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine
Proteomics 13 (10-11), 1667-1671 (2013)
Principe S, Jones EE, Kim Y, Sinha A, Nyalwidhe JO, Brooks J, Semmes OJ, Troyer DA, Lance RS, Kislinger T and Drake RR.


Mutations in a keratin 6 isomer (K6c) cause a type of focal palmoplantar keratoderma
J. Invest. Dermatol. 130 (2), 336-338 (2010)
Bowden PE.


Keratin K6c mutations cause focal palmoplantar keratoderma
J. Invest. Dermatol. 130 (2), 425-429 (2010)
Wilson NJ, Messenger AG, Leachman SA, O'Toole EA, Lane EB, McLean WH and Smith FJ.


New consensus nomenclature for mammalian keratins
J. Cell Biol. 174 (2), 169-174 (2006)
Schweizer J, Bowden PE, Coulombe PA, Langbein L, Lane EB, Magin TM, Maltais L, Omary MB, Parry DA, Rogers MA and Wright MW.


The finished DNA sequence of human chromosome 12
Nature 440 (7082), 346-351 (2006)
Scherer SE, Muzny DM, Buhay CJ, Chen R, Cree A, Ding Y, Dugan-Rocha S, Gill R, Gunaratne P, Harris RA, Hawes AC, Hernandez J, Hodgson AV, Hume J, Jackson A, Khan ZM, Kovar-Smith C, Lewis LR, Lozado RJ, Metzker ML, Milosavljevic A, Miner GR, Montgomery KT, Morgan MB, Nazareth LV, Scott G, Sodergren E, Song XZ, Steffen D, Lovering RC, Wheeler DA, Worley KC, Yuan Y, Zhang Z, Adams CQ, Ansari-Lari MA, Ayele M, Brown MJ, Chen G, Chen Z, Clerc-Blankenburg KP, Davis C, Delgado O, Dinh HH, Draper H, Gonzalez-Garay ML, Havlak P, Jackson LR, Jacob LS, Kelly SH, Li L, Li Z, Liu J, Liu W, Lu J, Maheshwari M, Nguyen BV, Okwuonu GO, Pasternak S, Perez LM, Plopper FJ, Santibanez J, Shen H, Tabor PE, Verduzco D, Waldron L, Wang Q, Williams GA, Zhang J, Zhou J, Allen CC, Amin AG, Anyalebechi V, Bailey M, Barbaria JA, Bimage KE, Bryant NP, Burch PE, Burkett CE, Burrell KL, Calderon E, Cardenas V, Carter K, Casias K, Cavazos I, Cavazos SR, Ceasar H, Chacko J, Chan SN, Chavez D, Christopoulos C, Chu J, Cockrell R, Cox CD, Dang M, Dathorne SR, David R, Davis CM, Davy-Carroll L, Deshazo DR, Donlin JE, D'Souza L, Eaves KA, Egan A, Emery-Cohen AJ, Escotto M, Flagg N, Forbes LD, Gabisi AM, Garza M, Hamilton C, Henderson N, Hernandez O, Hines S, Hogues ME, Huang M, Idlebird DG, Johnson R, Jolivet A, Jones S, Kagan R, King LM, Leal B, Lebow H, Lee S, LeVan JM, Lewis LC, London P, Lorensuhewa LM, Loulseged H, Lovett DA, Lucier A, Lucier RL, Ma J, Madu RC, Mapua P, Martindale AD, Martinez E, Massey E, Mawhiney S, Meador MG, Mendez S, Mercado C, Mercado IC, Merritt CE, Miner ZL, Minja E, Mitchell T, Mohabbat F, Mohabbat K, Montgomery B, Moore N, Morris S, Munidasa M, Ngo RN, Nguyen NB, Nickerson E, Nwaokelemeh OO, Nwokenkwo S, Obregon M, Oguh M, Oragunye N, Oviedo RJ, Parish BJ, Parker DN, Parrish J, Parks KL, Paul HA, Payton BA, Perez A, Perrin W, Pickens A, Primus EL, Pu LL, Puazo M, Quiles MM, Quiroz JB, Rabata D, Reeves K, Ruiz SJ, Shao H, Sisson I, Sonaike T, Sorelle RP, Sutton AE, Svatek AF, Svetz LA, Tamerisa KS, Taylor TR, Teague B, Thomas N, Thorn RD, Trejos ZY, Trevino BK, Ukegbu ON, Urban JB, Vasquez LI, Vera VA, Villasana DM, Wang L, Ward-Moore S, Warren JT, Wei X, White F, Williamson AL, Wleczyk R, Wooden HS, Wooden SH, Yen J, Yoon L, Yoon V, Zorrilla SE, Nelson D, Kucherlapati R, Weinstock G and Gibbs RA.


Genes for intermediate filament proteins and the draft sequence of the human genome: novel keratin genes and a surprisingly high number of pseudogenes related to keratin genes 8 and 18
J. Cell. Sci. 114 (PT 14), 2569-2575 (2001)
Hesse M, Magin TM and Weber K.


Phosphorylation of human keratin 8 in vivo at conserved head domain serine 23 and at epidermal growth factor-stimulated tail domain serine 431
J. Biol. Chem. 272 (11), 7556-7564 (1997)
Ku NO and Omary MB.


Cloning and characterization of multiple human genes and cDNAs encoding highly related type II keratin 6 isoforms
J. Biol. Chem. 270 (31), 18581-18592 (1995)
Takahashi K, Paladini RD and Coulombe PA.
