Email to GenScript

GRIN2B glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Homo sapiens (human)]

Gene Symbol GRIN2B
Entrez Gene ID 2904
Full Name glutamate receptor, ionotropic, N-methyl D-aspartate 2B
Synonyms EIEE27, GluN2B, MRD6, NMDAR2B, NR2B, hNR3
General protein information
Preferred Names
glutamate receptor ionotropic, NMDA 2B
glutamate receptor ionotropic, NMDA 2B
glutamate receptor subunit epsilon-2
N-methyl-D-aspartate receptor subunit 3
N-methyl D-aspartate receptor subtype 2B
glutamate [NMDA] receptor subunit epsilon-2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:

The following GRIN2B gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the GRIN2B gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26128 XM_011520628 PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu26128 XM_011520629 PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu26128 XM_011520630 PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu46089 XM_005253351 PREDICTED: Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu26128 NM_000834 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26128
Accession Version XM_011520628.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4455bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu26128D_COA.pdf (pdf)
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glutamate receptor ionotropic, NMDA 2B isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009714.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)843..1925(+)
Misc Feature(2)981..1367(+)
Misc Feature(3)1953..3155(+)
Misc Feature(4)2121..>2372(+)
Misc Feature(5)2280..3116(+)
Misc Feature(6)2280..2942(+)
Misc Feature(7)2415..3233(+)
Misc Feature(8)3264..5198(+)
Position Chain Variation Link
9 9 c, g dbSNP:531532950
23 23 c, g dbSNP:567299796
25 25 c, g dbSNP:10400484
88 88 c, t dbSNP:530909736
152 152 c, t dbSNP:569918427
167 167 c, t dbSNP:370113837
191 191 a, c dbSNP:117225756
194 194 c, g, t dbSNP:543436193
223 223 a, g dbSNP:185105928
262 262 c, g dbSNP:375973677
293 293 a, g dbSNP:541692060
340 340 c, g dbSNP:765516432
355 355 g, t dbSNP:144253635
402 402 c, g dbSNP:529314700
403 403 c, t dbSNP:377645156
404 404 a, g dbSNP:535638762
426 426 a, c dbSNP:570383729
440 440 a, c dbSNP:183473904
458 458 c, t dbSNP:560512524
488 488 c, t dbSNP:202228176
528 528 -, tt dbSNP:370171136
529 529 g, t dbSNP:201093712
529 529 -, t dbSNP:374356632
530 530 c, t dbSNP:201168489
538 538 c, t dbSNP:200010007
539 539 -, tt dbSNP:577903176
539 539 -, t dbSNP:548643432
540 540 g, t dbSNP:531449559
566 566 a, t dbSNP:201636181
579 579 g, t dbSNP:200805170
580 580 c, t dbSNP:200889354
581 581 a, g dbSNP:150060270
602 602 c, t dbSNP:200114191
613 613 c, t dbSNP:572180864
640 640 a, t dbSNP:553930487
648 648 a, g dbSNP:201833749
660 660 g, t dbSNP:200642013
667 667 c, t dbSNP:541726295
700 700 a, g dbSNP:199499610
714 714 c, t dbSNP:202050009
729 729 a, g dbSNP:200252995
732 732 a, g dbSNP:12818068
734 734 c, t dbSNP:529805097
735 735 a, g dbSNP:201343005
737 737 c, t dbSNP:200539507
738 738 a, g dbSNP:748524822
741 741 c, t dbSNP:779341730
755 755 c, t dbSNP:202219447
756 756 a, g dbSNP:749839263
760 760 c, t dbSNP:367543147
761 761 a, g dbSNP:34315573
762 762 a, g dbSNP:750494985
764 764 a, g dbSNP:781329026
765 765 a, t dbSNP:757499142
767 767 c, t dbSNP:751673148
771 771 c, t dbSNP:560849226
776 776 c, t dbSNP:762697002
779 779 a, g dbSNP:199904091
782 782 c, g dbSNP:752668123
784 784 g, t dbSNP:765133670
788 788 g, t dbSNP:763162344
791 791 a, g dbSNP:374735893
797 797 c, t dbSNP:145404836
798 798 a, g dbSNP:201094029
806 806 c, t dbSNP:371566007
807 807 a, g dbSNP:79046967
809 809 c, g dbSNP:199858106
818 818 c, t dbSNP:201697070
822 822 a, g dbSNP:79962661
826 826 a, g, t dbSNP:200727145
836 836 a, g dbSNP:200185458
838 838 a, g dbSNP:746004289
839 839 c, t dbSNP:781344452
842 842 a, c dbSNP:374173060
845 845 -, c dbSNP:398122823
845 845 a, c dbSNP:77738206
847 847 g, t dbSNP:777940683
849 849 a, g dbSNP:758234146
850 850 c, t dbSNP:201568626
855 855 a, g dbSNP:775053700
881 881 c, t dbSNP:752472128
882 882 a, g dbSNP:370809599
884 884 c, t dbSNP:200527066
886 886 a, g dbSNP:199526748
888 888 a, g dbSNP:765939021
890 890 a, g dbSNP:201242152
896 896 a, c dbSNP:773043790
908 908 c, t dbSNP:200767968
909 909 a, g dbSNP:763469464
927 927 c, t dbSNP:374626527
931 931 c, t dbSNP:769987851
935 935 a, c, t dbSNP:199707487
936 936 a, g, t dbSNP:150070901
939 939 a, g, t dbSNP:765215838
946 946 a, g dbSNP:759714224
960 960 a, g dbSNP:200342868
967 967 a, g dbSNP:202172484
974 974 a, c, t dbSNP:77299791
987 987 a, g dbSNP:200262227
997 997 a, g dbSNP:778695605
1001 1001 c, t dbSNP:754683623
1005 1005 a, g dbSNP:767249223
1012 1012 c, t dbSNP:753848286
1016 1016 c, t dbSNP:540429850
1021 1021 a, g dbSNP:201966022
1028 1028 a, c dbSNP:147132902
1034 1034 a, g dbSNP:200172066
1035 1035 c, g dbSNP:767346001
1037 1037 a, g dbSNP:202223470
1040 1040 a, g dbSNP:774096413
1052 1052 c, t dbSNP:369191499
1059 1059 c, g dbSNP:759787940
1061 1061 c, g dbSNP:777243423
1064 1064 a, g dbSNP:771324978
1070 1070 a, c, t dbSNP:773282360
1071 1071 a, g dbSNP:772078838
1073 1073 c, t dbSNP:748395100
1088 1088 c, t dbSNP:201079317
1094 1094 a, c, g dbSNP:369700137
1102 1102 c, t dbSNP:199848395
1106 1106 c, g, t dbSNP:377642005
1112 1112 a, c, g dbSNP:7301328
1116 1116 c, t dbSNP:780865592
1127 1127 c, t dbSNP:200608452
1169 1169 c, t dbSNP:745829995
1173 1173 a, c, t dbSNP:756875824
1190 1190 a, g, t dbSNP:200658883
1202 1202 a, g dbSNP:757990033
1211 1211 a, c, t dbSNP:115189840
1218 1218 c, t dbSNP:760989132
1241 1241 c, t dbSNP:750970219
1247 1247 c, t dbSNP:767991427
1249 1249 c, t dbSNP:761939291
1250 1250 a, c dbSNP:36031537
1256 1256 c, t dbSNP:200442058
1259 1259 c, t dbSNP:3026183
1260 1260 a, g dbSNP:201377003
1265 1265 c, g, t dbSNP:200357530
1275 1275 c, t dbSNP:776763916
1292 1292 c, t dbSNP:770984395
1355 1355 c, t dbSNP:746896701
1361 1361 g, t dbSNP:777160522
1364 1364 c, t dbSNP:77918519
1365 1365 a, g dbSNP:747790101
1376 1376 c, t dbSNP:202115787
1394 1394 c, g dbSNP:756521548
1397 1397 g, t dbSNP:201234877
1422 1422 c, t dbSNP:200347469
1425 1425 a, g dbSNP:201672517
1427 1427 a, c, t dbSNP:148254591
1431 1431 a, c, g dbSNP:764105710
1457 1457 c, t dbSNP:763055770
1460 1460 c, t dbSNP:200150365
1463 1463 c, t dbSNP:759323084
1466 1466 c, g, t dbSNP:149526977
1478 1478 c, g, t dbSNP:201554036
1485 1485 a, g dbSNP:201075595
1498 1498 a, g dbSNP:76844445
1501 1501 a, t dbSNP:770792199
1510 1510 c, t dbSNP:748054907
1511 1511 a, g dbSNP:199844735
1517 1517 c, t dbSNP:142203984
1535 1535 a, c dbSNP:747673284
1542 1542 a, g dbSNP:74987973
1543 1543 c, t dbSNP:778595446
1550 1550 a, g dbSNP:200869732
1553 1553 a, g dbSNP:61754644
1558 1558 a, c, t dbSNP:138098032
1559 1559 a, g dbSNP:201732785
1562 1562 g, t dbSNP:757595865
1565 1565 c, g dbSNP:752039877
1566 1566 c, t dbSNP:200551583
1580 1580 a, c dbSNP:199835162
1584 1584 a, g dbSNP:374788517
1586 1586 a, g dbSNP:752814750
1588 1588 c, t dbSNP:267603394
1589 1589 a, g dbSNP:201585449
1597 1597 a, c dbSNP:76180400
1616 1616 a, c, t dbSNP:1124894
1619 1619 c, g dbSNP:140520460
1620 1620 a, c dbSNP:766307196
1641 1641 a, g dbSNP:760488868
1649 1649 c, t dbSNP:74509923
1670 1670 c, g, t dbSNP:199518756
1685 1685 c, t dbSNP:267603393
1689 1689 a, c dbSNP:207472662
1703 1703 c, t dbSNP:201565323
1719 1719 c, g, t dbSNP:773859531
1721 1721 c, g, t dbSNP:200380868
1737 1737 -, c dbSNP:764455396
1744 1744 a, g dbSNP:748965398
1745 1745 c, t dbSNP:779643614
1757 1757 a, g dbSNP:201867439
1758 1758 c, t dbSNP:200820139
1761 1761 c, t dbSNP:745441478
1766 1766 c, t dbSNP:778209882
1769 1769 c, t dbSNP:201228929
1775 1775 c, t dbSNP:748695010
1781 1781 a, g dbSNP:146812769
1783 1783 g, t dbSNP:755159506
1784 1784 a, g dbSNP:753955843
1788 1788 a, g dbSNP:780208180
1807 1807 a, t dbSNP:756363447
1821 1821 a, c dbSNP:750557369
1826 1826 a, g dbSNP:201952040
1833 1833 a, g dbSNP:200983379
1842 1842 a, c dbSNP:761559136
1858 1858 g, t dbSNP:751540918
1870 1870 a, g dbSNP:778479807
1871 1871 a, g dbSNP:200126922
1889 1889 c, t dbSNP:376119514
1893 1893 a, g, t dbSNP:199671864
1895 1895 c, t dbSNP:774861400
1904 1904 a, g dbSNP:767555882
1953 1953 g, t dbSNP:769085176
1955 1955 c, t dbSNP:749839317
1967 1967 c, t dbSNP:145080218
1984 1984 a, g dbSNP:527236034
1991 1991 a, g dbSNP:769959946
1994 1994 c, t dbSNP:542832121
2003 2003 a, g dbSNP:745916894
2015 2015 c, t dbSNP:781540920
2030 2030 c, t dbSNP:757473152
2033 2033 c, t dbSNP:747172511
2034 2034 a, c dbSNP:777564086
2048 2048 c, t dbSNP:758148425
2059 2059 a, g dbSNP:200891750
2062 2062 a, g dbSNP:752720799
2064 2064 a, g dbSNP:765062440
2065 2065 c, t dbSNP:754574095
2066 2066 a, t dbSNP:753284709
2070 2070 a, g dbSNP:543857023
2076 2076 a, t dbSNP:770946018
2084 2084 a, g dbSNP:141031272
2086 2086 a, g dbSNP:777940618
2087 2087 c, t dbSNP:35025065
2088 2088 a, g dbSNP:747880300
2095 2095 c, t dbSNP:201566587
2096 2096 a, g dbSNP:200607718
2102 2102 c, t dbSNP:142935139
2113 2113 a, g dbSNP:397514555
2123 2123 g, t dbSNP:779734725
2127 2127 a, t dbSNP:769522802
2129 2129 a, t dbSNP:755649792
2147 2147 a, g dbSNP:373616165
2162 2162 a, g dbSNP:201215680
2164 2164 a, t dbSNP:202106099
2171 2171 c, g dbSNP:767259659
2185 2185 c, t dbSNP:112992494
2204 2204 c, t dbSNP:763436882
2214 2214 a, g dbSNP:199847566
2225 2225 c, g dbSNP:202139349
2234 2234 a, t dbSNP:3026177
2243 2243 a, g dbSNP:759978746
2267 2267 c, t dbSNP:767577343
2285 2285 c, t dbSNP:369786199
2301 2301 c, t dbSNP:774592932
2306 2306 a, g dbSNP:566776310
2315 2315 c, t dbSNP:148573953
2321 2321 c, t dbSNP:775628661
2365 2365 a, g dbSNP:672601378
2375 2375 a, g dbSNP:199517784
2381 2381 c, t dbSNP:769853132
2404 2404 c, t dbSNP:397514556
2411 2411 c, t dbSNP:1805482
2417 2417 c, t dbSNP:187488896
2423 2423 a, g dbSNP:398122825
2448 2448 a, g dbSNP:758050194
2450 2450 c, t dbSNP:202102041
2456 2456 a, t dbSNP:780419689
2459 2459 c, t dbSNP:201212056
2460 2460 a, g dbSNP:750935831
2472 2472 g, t dbSNP:781710666
2480 2480 a, g dbSNP:757341517
2485 2485 a, g, t dbSNP:199801114
2492 2492 c, t dbSNP:751658687
2502 2502 a, c dbSNP:764017577
2508 2508 g, t dbSNP:762981405
2513 2513 c, t dbSNP:763286576
2514 2514 a, g dbSNP:145021339
2522 2522 c, t dbSNP:775775881
2529 2529 c, g dbSNP:766030730
2532 2532 c, g dbSNP:377354382
2552 2552 c, t dbSNP:1805522
2562 2562 a, g dbSNP:199731184
2565 2565 -, t dbSNP:35464354
2579 2579 c, t dbSNP:367543148
2580 2580 c, t dbSNP:201369489
2590 2590 a, t dbSNP:672601377
2597 2597 c, t dbSNP:147373250
2599 2599 g, t dbSNP:672601376
2600 2600 a, c dbSNP:202226469
2621 2621 c, g dbSNP:201095094
2627 2627 c, t dbSNP:768296067
2636 2636 c, t dbSNP:748829220
2669 2669 a, c dbSNP:767875110
2670 2670 c, t dbSNP:576081334
2717 2717 a, g dbSNP:771157135
2747 2747 c, t dbSNP:200392452
2759 2759 c, t dbSNP:555608912
2763 2763 a, c dbSNP:149279923
2780 2780 a, t dbSNP:773919445
2790 2790 c, t dbSNP:387906636
2801 2801 c, t dbSNP:375843467
2810 2810 c, t dbSNP:748606750
2882 2882 a, g dbSNP:372619985
2891 2891 a, c, t dbSNP:368555085
2894 2894 c, t dbSNP:749565577
2915 2915 a, t dbSNP:780117268
2918 2918 a, g dbSNP:200813905
2939 2939 c, t dbSNP:780990215
2948 2948 a, c, g dbSNP:148185805
2951 2951 a, g dbSNP:777554552
2968 2968 a, g dbSNP:199598983
2972 2972 a, g dbSNP:111888397
2993 2993 a, g dbSNP:757990373
2996 2996 c, g dbSNP:752150199
3029 3029 c, t dbSNP:544300670
3041 3041 c, t dbSNP:759282802
3059 3059 a, g dbSNP:150554184
3065 3065 a, g dbSNP:768033260
3070 3070 a, c dbSNP:762247262
3071 3071 c, g dbSNP:774981179
3077 3077 c, t dbSNP:769039900
3081 3081 g, t dbSNP:763453236
3084 3084 a, c dbSNP:199519747
3095 3095 c, g dbSNP:775448236
3114 3114 a, g dbSNP:759594946
3131 3131 c, g dbSNP:776902375
3135 3135 c, t dbSNP:79163356
3155 3155 c, t dbSNP:370765860
3185 3185 a, g dbSNP:747193565
3188 3188 c, t dbSNP:772903335
3208 3208 g, t dbSNP:771858993
3226 3226 c, t dbSNP:748075089
3227 3227 a, g dbSNP:189384622
3236 3236 g, t dbSNP:201700182
3245 3245 c, t dbSNP:377264345
3251 3251 c, t dbSNP:748803288
3260 3260 c, t dbSNP:3026160
3269 3269 g, t dbSNP:757347591
3276 3276 c, t dbSNP:138088984
3281 3281 a, g dbSNP:750046277
3282 3282 c, t dbSNP:764400458
3307 3307 g, t dbSNP:758762096
3323 3323 c, t dbSNP:753198544
3324 3324 a, g dbSNP:765724909
3325 3325 c, t dbSNP:759966787
3332 3332 c, g dbSNP:776703483
3343 3343 c, g dbSNP:766394505
3354 3354 a, g dbSNP:774303389
3362 3362 c, g dbSNP:768524989
3364 3364 a, g dbSNP:763017766
3374 3374 a, g dbSNP:199710029
3378 3378 a, g dbSNP:201426340
3383 3383 a, g dbSNP:200754384
3390 3390 g, t dbSNP:145602964
3394 3394 c, t dbSNP:770464893
3395 3395 a, t dbSNP:535415512
3398 3398 a, g dbSNP:761708533
3404 3404 c, t dbSNP:755511615
3407 3407 a, c dbSNP:201157664
3408 3408 a, g dbSNP:200256539
3410 3410 c, t dbSNP:1806201
3411 3411 g, t dbSNP:756224637
3431 3431 a, c dbSNP:549839161
3434 3434 a, c, t dbSNP:201445433
3435 3435 a, g dbSNP:537742688
3437 3437 c, t dbSNP:35125534
3441 3441 c, t dbSNP:763003254
3443 3443 a, g dbSNP:775362947
3445 3445 a, g dbSNP:202223088
3446 3446 a, c dbSNP:531269037
3449 3449 a, g dbSNP:145005918
3453 3453 c, t dbSNP:369045170
3457 3457 c, t dbSNP:552036402
3458 3458 a, g dbSNP:199843136
3461 3461 c, t dbSNP:568858172
3476 3476 c, t dbSNP:777288719
3479 3479 g, t dbSNP:769093992
3482 3482 c, t dbSNP:749800143
3500 3500 a, g, t dbSNP:756487785
3503 3503 a, g dbSNP:750801474
3505 3505 a, g dbSNP:781442804
3506 3506 c, t dbSNP:149157688
3521 3521 c, t dbSNP:751637286
3525 3525 c, t dbSNP:764278787
3526 3526 a, g dbSNP:199677214
3536 3536 c, g, t dbSNP:201085200
3537 3537 g, t dbSNP:199941557
3554 3554 a, g dbSNP:77493389
3559 3559 a, g dbSNP:150445188
3562 3562 a, g dbSNP:776323617
3569 3569 c, t dbSNP:369299730
3571 3571 c, t dbSNP:200724001
3572 3572 a, g dbSNP:140573925
3591 3591 c, t dbSNP:201982602
3593 3593 c, t dbSNP:771565713
3601 3601 c, t dbSNP:747714077
3602 3602 a, g dbSNP:547507161
3607 3607 a, g dbSNP:376328340
3612 3612 -, gag dbSNP:781740648
3627 3627 a, g dbSNP:200538130
3653 3653 a, c, g, t dbSNP:199536073
3656 3656 c, t dbSNP:201252525
3659 3659 a, g dbSNP:200696950
3677 3677 c, g dbSNP:147956755
3683 3683 c, t dbSNP:747235156
3684 3684 a, g dbSNP:778202551
3692 3692 -, agatca dbSNP:755495386
3692 3692 a, c dbSNP:758533546
3705 3705 c, t dbSNP:144956856
3706 3706 a, g dbSNP:765183831
3719 3719 c, g dbSNP:202006928
3726 3726 a, g dbSNP:754896277
3735 3735 g, t dbSNP:753613072
3737 3737 c, t dbSNP:766092483
3743 3743 c, t dbSNP:760531029
3746 3746 c, t dbSNP:772837930
3750 3750 a, c, g dbSNP:761281000
3751 3751 g, t dbSNP:773762599
3752 3752 a, g dbSNP:199769470
3758 3758 c, t dbSNP:201439880
3759 3759 a, g dbSNP:746372193
3779 3779 c, t dbSNP:200355836
3782 3782 a, c dbSNP:200210848
3784 3784 c, t dbSNP:202109019
3789 3789 a, t dbSNP:574130239
3793 3793 a, g dbSNP:141109968
3796 3796 a, c dbSNP:771413773
3797 3797 c, t dbSNP:747431551
3802 3802 g, t dbSNP:200265732
3814 3814 c, t dbSNP:778114438
3820 3820 a, t dbSNP:759983003
3822 3822 a, c, g dbSNP:201963596
3827 3827 a, c, t dbSNP:200887288
3842 3842 a, c dbSNP:372040957
3851 3851 c, t dbSNP:778873883
3857 3857 a, c dbSNP:754878801
3860 3860 c, g dbSNP:753715256
3863 3863 c, t dbSNP:147762014
3864 3864 a, g dbSNP:202222002
3866 3866 c, t dbSNP:750257721
3872 3872 c, t dbSNP:767114392
3883 3883 g, t dbSNP:201029083
3884 3884 c, t dbSNP:751021224
3889 3889 a, g dbSNP:199857445
3892 3892 a, g dbSNP:201866998
3902 3902 c, t dbSNP:543452359
3905 3905 c, t dbSNP:776986575
3911 3911 c, g dbSNP:771609944
3913 3913 -, gtct dbSNP:752072372
3915 3915 c, t dbSNP:761084398
3916 3916 -, acat dbSNP:780435456
3916 3916 a, g dbSNP:773737239
3919 3919 -, aacc dbSNP:758734049
3920 3920 c, t dbSNP:772364390
3923 3923 c, t dbSNP:200621414
3926 3926 c, t dbSNP:142071596
3944 3944 c, t dbSNP:768606209
3948 3948 a, g dbSNP:749434579
3965 3965 c, t dbSNP:376935636
3969 3969 a, g dbSNP:374858743
3978 3978 g, t dbSNP:756076031
3983 3983 c, g dbSNP:370532796
4020 4020 c, t dbSNP:780975690
4031 4031 a, g dbSNP:200058641
4041 4041 c, t dbSNP:201477697
4045 4045 c, g dbSNP:751163711
4046 4046 a, g dbSNP:200509787
4052 4052 c, t dbSNP:763445499
4054 4054 a, g dbSNP:377585522
4055 4055 c, g, t dbSNP:544484163
4061 4061 c, t dbSNP:531864935
4062 4062 a, g dbSNP:199799650
4074 4074 c, t dbSNP:139759417
4076 4076 c, t dbSNP:201978018
4081 4081 a, g dbSNP:557670363
4084 4084 c, t dbSNP:766946947
4085 4085 a, g dbSNP:200660626
4089 4089 c, t dbSNP:370908319
4090 4090 a, g, t dbSNP:199514711
4108 4108 g, t dbSNP:774414261
4109 4109 c, t dbSNP:768963436
4111 4111 a, c dbSNP:749285212
4114 4114 g, t dbSNP:773557540
4117 4117 c, g dbSNP:780128559
4118 4118 a, g dbSNP:201565146
4125 4125 a, g dbSNP:267603392
4128 4128 g, t dbSNP:200439105
4129 4129 c, g dbSNP:769658975
4135 4135 a, g, t dbSNP:148625092
4153 4153 a, t dbSNP:756986518
4154 4154 g, t dbSNP:746865690
4159 4159 a, g dbSNP:187979330
4161 4161 a, g dbSNP:200237781
4179 4179 c, t dbSNP:758094582
4202 4202 c, t dbSNP:752200554
4203 4203 a, g dbSNP:764845072
4208 4208 c, t dbSNP:373548904
4210 4210 a, g dbSNP:750952904
4219 4219 a, g dbSNP:143955920
4221 4221 a, g dbSNP:762050994
4230 4230 g, t dbSNP:774809461
4232 4232 c, t dbSNP:202120141
4235 4235 a, g dbSNP:558278094
4236 4236 c, g dbSNP:764171423
4237 4237 a, g dbSNP:201250088
4238 4238 c, t dbSNP:775478008
4239 4239 a, g dbSNP:769857006
4241 4241 c, t dbSNP:746001325
4244 4244 c, t dbSNP:45600931
4245 4245 a, g dbSNP:1042339
4248 4248 a, t dbSNP:202195729
4250 4250 c, g, t dbSNP:183502070
4251 4251 a, g dbSNP:777639067
4260 4260 c, t dbSNP:757924519
4268 4268 c, t dbSNP:747800865
4270 4270 a, g dbSNP:774794141
4274 4274 a, g dbSNP:556194434
4276 4276 c, t dbSNP:748196005
4280 4280 a, c, t dbSNP:1806191
4282 4282 g, t dbSNP:767870767
4292 4292 a, c, g dbSNP:200166566
4295 4295 a, g dbSNP:201568782
4298 4298 a, c, t dbSNP:141886903
4308 4308 a, g dbSNP:367543149
4311 4311 a, g dbSNP:535509676
4317 4317 a, c dbSNP:199852144
4320 4320 a, g dbSNP:267603391
4323 4323 a, g dbSNP:201861590
4334 4334 c, t dbSNP:200884387
4346 4346 c, t dbSNP:199676457
4355 4355 a, c, g dbSNP:772315429
4356 4356 a, g dbSNP:201729758
4367 4367 a, g dbSNP:200551241
4372 4372 a, g dbSNP:748005909
4373 4373 a, g dbSNP:149089581
4376 4376 c, t dbSNP:778678685
4377 4377 a, g dbSNP:768453978
4382 4382 a, c dbSNP:748758244
4387 4387 c, t dbSNP:779628466
4392 4392 c, t dbSNP:199834850
4393 4393 a, g dbSNP:757636470
4394 4394 c, t dbSNP:201405157
4396 4396 c, g dbSNP:748596295
4403 4403 c, t dbSNP:200345385
4406 4406 c, g dbSNP:201983807
4424 4424 a, c dbSNP:199529555
4427 4427 a, g dbSNP:758736358
4429 4429 c, t dbSNP:75670883
4430 4430 a, g dbSNP:201339988
4433 4433 c, g dbSNP:765399152
4436 4436 a, c, g dbSNP:200609066
4448 4448 a, g dbSNP:753797364
4454 4454 c, g dbSNP:766479529
4460 4460 g, t dbSNP:760725802
4463 4463 c, t dbSNP:773179713
4477 4477 c, t dbSNP:772176416
4484 4484 a, g dbSNP:761659003
4493 4493 c, t dbSNP:138771137
4494 4494 a, g dbSNP:768363994
4496 4496 c, t dbSNP:200883120
4497 4497 c, t dbSNP:200186058
4499 4499 c, g dbSNP:748973212
4505 4505 c, t dbSNP:779637139
4514 4514 a, g dbSNP:769331485
4515 4515 a, g dbSNP:150603153
4516 4516 a, c dbSNP:778308238
4523 4523 c, t dbSNP:201872316
4524 4524 c, g dbSNP:200902451
4526 4526 a, g dbSNP:753005699
4542 4542 c, t dbSNP:199935748
4543 4543 c, t dbSNP:201947553
4544 4544 a, g dbSNP:754079938
4545 4545 a, g, t dbSNP:141844705
4552 4552 c, t dbSNP:760777800
4553 4553 a, g, t dbSNP:78765966
4554 4554 c, g dbSNP:201850119
4558 4558 c, t dbSNP:372379846
4559 4559 a, g dbSNP:201906121
4560 4560 -, ggggggg dbSNP:375649732
4561 4561 g, t dbSNP:75642143
4564 4564 a, c dbSNP:531747728
4571 4571 c, g, t dbSNP:200571186
4572 4572 a, g dbSNP:564596433
4573 4573 a, c dbSNP:546457168
4579 4579 -, ccact dbSNP:750605618
4580 4580 c, t dbSNP:376716897
4581 4581 a, g, t dbSNP:372152403
4583 4583 g, t dbSNP:1806200
4584 4584 a, g dbSNP:772502958
4592 4592 c, t dbSNP:201889168
4600 4600 c, g dbSNP:748654662
4601 4601 a, g dbSNP:368885091
4617 4617 a, c dbSNP:755348109
4624 4624 a, g dbSNP:749655702
4625 4625 -, gaa dbSNP:765471479
4629 4629 a, c, t dbSNP:560662030
4631 4631 c, g dbSNP:143736428
4641 4641 c, t dbSNP:45540034
4642 4642 g, t dbSNP:767709649
4645 4645 a, g dbSNP:757478003
4652 4652 c, g, t dbSNP:764172372
4655 4655 c, t dbSNP:762775526
4659 4659 a, g dbSNP:775175973
4664 4664 c, g dbSNP:764888979
4668 4668 a, g dbSNP:374746622
4670 4670 g, t dbSNP:199688138
4679 4679 a, g dbSNP:776337201
4687 4687 a, c dbSNP:201559519
4691 4691 c, t dbSNP:200657400
4692 4692 a, g, t dbSNP:199803550
4697 4697 c, g dbSNP:774808996
4703 4703 a, g dbSNP:141730031
4710 4710 a, c, g dbSNP:200255226
4726 4726 a, g dbSNP:780293991
4727 4727 a, c, g dbSNP:201670483
4738 4738 c, t dbSNP:746083529
4739 4739 a, g dbSNP:200035225
4740 4740 a, g, t dbSNP:200421469
4754 4754 c, t dbSNP:764080484
4755 4755 a, c, g dbSNP:201335987
4758 4758 c, t dbSNP:574536056
4760 4760 a, c dbSNP:758288071
4761 4761 a, c dbSNP:200604023
4763 4763 a, g dbSNP:752473485
4767 4767 a, g dbSNP:371762359
4768 4768 a, c dbSNP:202102183
4777 4777 c, t dbSNP:759438353
4781 4781 c, t dbSNP:776247380
4782 4782 a, g dbSNP:766060662
4784 4784 a, g, t dbSNP:201214704
4786 4786 a, g dbSNP:772733555
4787 4787 a, c dbSNP:769147604
4790 4790 c, g dbSNP:199803412
4795 4795 c, t dbSNP:763372245
4802 4802 -, caa dbSNP:761812510
4807 4807 c, g dbSNP:202144479
4816 4816 c, g dbSNP:776130564
4822 4822 c, g dbSNP:770040831
4823 4823 c, t dbSNP:375217280
4824 4824 c, g dbSNP:781529910
4838 4838 c, t dbSNP:771307465
4844 4844 c, t dbSNP:747033161
4847 4847 c, t dbSNP:112932810
4850 4850 a, c, t dbSNP:200021190
4851 4851 a, g dbSNP:371190262
4853 4853 c, t dbSNP:201732760
4854 4854 a, g dbSNP:754738111
4855 4855 a, g dbSNP:767675317
4858 4858 a, g dbSNP:755797497
4859 4859 c, t dbSNP:146792012
4860 4860 a, g dbSNP:200217700
4874 4874 a, g dbSNP:749867196
4886 4886 c, t dbSNP:766929951
4888 4888 a, g dbSNP:761443441
4894 4894 c, t dbSNP:775838374
4895 4895 a, g dbSNP:201750358
4896 4896 a, c dbSNP:759935381
4904 4904 c, t dbSNP:200783471
4907 4907 c, t dbSNP:777155084
4913 4913 c, t dbSNP:779633781
4925 4925 c, t dbSNP:199529615
4940 4940 c, t dbSNP:201247892
4943 4943 c, t dbSNP:1805247
4949 4949 a, c dbSNP:772027875
4959 4959 g, t dbSNP:748303077
4961 4961 c, t dbSNP:778677489
4964 4964 c, t dbSNP:1805246
4973 4973 c, t dbSNP:372453607
4975 4975 c, t dbSNP:779830552
4976 4976 a, g dbSNP:149655315
4980 4980 c, g dbSNP:750030857
4982 4982 a, g dbSNP:369034274
4986 4986 g, t dbSNP:140744818
4987 4987 c, t dbSNP:751107971
4988 4988 a, g dbSNP:202227485
4990 4990 c, t dbSNP:201463390
4991 4991 a, g dbSNP:150956675
4996 4996 c, g dbSNP:377105285
5000 5000 a, g dbSNP:75988134
5002 5002 c, t dbSNP:200269512
5003 5003 a, g dbSNP:761174489
5009 5009 c, t dbSNP:142577506
5010 5010 c, t dbSNP:773278200
5011 5011 a, g dbSNP:75269586
5016 5016 c, t dbSNP:748128078
5029 5029 a, g dbSNP:774504887
5032 5032 -, c dbSNP:35260946
5033 5033 a, c, g, t dbSNP:146235271
5035 5035 c, t dbSNP:780022796
5042 5042 a, g dbSNP:755880051
5045 5045 c, t dbSNP:745715225
5051 5051 c, t dbSNP:201809938
5057 5057 c, g, t dbSNP:112265127
5058 5058 a, g, t dbSNP:763699668
5061 5061 c, g dbSNP:758042475
5064 5064 g, t dbSNP:754377600
5065 5065 c, t dbSNP:767037011
5066 5066 a, c dbSNP:199570238
5067 5067 c, t dbSNP:773648473
5068 5068 a, c, g, t dbSNP:200903876
5076 5076 a, g dbSNP:768707460
5078 5078 a, g dbSNP:767012121
5086 5086 a, g dbSNP:749417978
5087 5087 c, t dbSNP:766970197
5093 5093 g, t dbSNP:769750472
5097 5097 a, c dbSNP:745597964
5099 5099 g, t dbSNP:781050985
5101 5101 c, t dbSNP:756790727
5103 5103 a, g dbSNP:746663430
5108 5108 c, t dbSNP:777620880
5119 5119 a, g dbSNP:577649736
5123 5123 a, c dbSNP:76294779
5125 5125 a, g dbSNP:757954618
5126 5126 a, g dbSNP:369455429
5129 5129 c, t dbSNP:752290736
5130 5130 c, t dbSNP:780659331
5146 5146 c, g dbSNP:200127692
5150 5150 c, t dbSNP:756658425
5152 5152 a, g dbSNP:202133231
5155 5155 a, g dbSNP:201145829
5156 5156 c, t dbSNP:199819153
5159 5159 a, g dbSNP:202051424
5195 5195 c, t dbSNP:762140684
5200 5200 a, g dbSNP:751758015
5202 5202 c, g dbSNP:764339423
5207 5207 g, t dbSNP:201107419
5213 5213 a, g dbSNP:766688154
5215 5215 a, g dbSNP:372520149
5216 5216 -, ag dbSNP:753929690
5226 5226 -, gggt dbSNP:751398824
5226 5226 a, g dbSNP:200052879
5228 5228 a, g dbSNP:769557169
5231 5231 c, g dbSNP:759518484
5232 5232 a, c, g dbSNP:200820444
5234 5234 -, g dbSNP:760660431
5237 5237 a, g dbSNP:746822162
5242 5242 a, g dbSNP:777531033
5252 5252 c, t dbSNP:771877727
5253 5253 a, g dbSNP:537983876
5254 5254 c, t dbSNP:201467236
5255 5255 a, g dbSNP:200503380
5259 5259 c, t dbSNP:570811791
5260 5260 a, g dbSNP:183243118
5261 5261 a, c dbSNP:765505393
5262 5262 a, g dbSNP:199872486
5263 5263 c, t dbSNP:201744355
5264 5264 a, g dbSNP:200778827
5271 5271 a, g dbSNP:199528895
5280 5280 c, t dbSNP:201438415
5315 5315 g, t dbSNP:200449847
5334 5334 a, c dbSNP:56403126
5342 5342 a, g dbSNP:199745099
5348 5348 c, g dbSNP:527990634
5358 5358 a, g dbSNP:201387951
5366 5366 c, t dbSNP:200153985
5375 5375 c, t dbSNP:143966089
5387 5387 -, tc dbSNP:567424077
5391 5391 -, cct dbSNP:201388414
5395 5395 -, ttcacagttctctccttctt dbSNP:564079045
5399 5399 c, g dbSNP:202231405
5404 5404 c, t dbSNP:201107317
5411 5411 c, t dbSNP:200396502
5412 5412 c, t dbSNP:202020860
5415 5415 a, c dbSNP:200777193
5420 5420 c, t dbSNP:80081965
5421 5421 a, g dbSNP:201562857
5436 5436 a, c, t dbSNP:200812783
5443 5443 a, c dbSNP:199886565
5447 5447 c, g dbSNP:202048045
5456 5456 a, g dbSNP:200871815
5472 5472 g, t dbSNP:199726271
5485 5485 c, g, t dbSNP:201725673
5486 5486 a, g dbSNP:71539419
5494 5494 a, g dbSNP:199764468
5497 5497 a, g dbSNP:201406793
5501 5501 a, t dbSNP:1042340
5506 5506 a, g dbSNP:200267679
5509 5509 a, g dbSNP:199535076
5520 5520 a, g dbSNP:201430685
5537 5537 c, t dbSNP:200549993
5543 5543 c, t dbSNP:78222734
5545 5545 c, t dbSNP:200881236
5550 5550 a, g dbSNP:554459884
5554 5554 a, g dbSNP:191461380
5562 5562 a, g dbSNP:200181498
5567 5567 a, c dbSNP:201873254
5569 5569 a, g dbSNP:1805504
5589 5589 c, t dbSNP:200906752
5593 5593 c, g dbSNP:538329790
5610 5610 g, t dbSNP:890
5614 5614 -, c dbSNP:575474488
5614 5614 c, g dbSNP:202027953
5634 5634 a, g dbSNP:201123684
5641 5641 c, t dbSNP:200193169
5642 5642 a, g dbSNP:201764269
5648 5648 a, g dbSNP:113686798
5650 5650 a, g dbSNP:200589298
5665 5665 a, g dbSNP:747769254
5672 5672 a, g dbSNP:775444437
5682 5682 a, g dbSNP:199873718
5699 5699 a, t dbSNP:201896396
5722 5722 c, t dbSNP:200803793
5727 5727 g, t dbSNP:199718293
5738 5738 c, g dbSNP:201434129
5768 5768 a, c dbSNP:1805503
5782 5782 a, c dbSNP:199719654
5801 5801 a, g dbSNP:201157225
5827 5827 c, g dbSNP:200256111
5831 5831 a, c, g dbSNP:201674701
5837 5837 g, t dbSNP:201058072
5839 5839 a, g dbSNP:751097989
5840 5840 c, t dbSNP:200565873
5846 5846 a, g dbSNP:530443492
5851 5851 c, g dbSNP:202225328
5857 5857 a, t dbSNP:201030932
5863 5863 a, c dbSNP:199859660
5871 5871 c, g dbSNP:202146233
5878 5878 c, t dbSNP:550932645
5879 5879 a, g dbSNP:142851375
5890 5890 g, t dbSNP:186216164
5891 5891 c, t dbSNP:200056664
5892 5892 c, t dbSNP:201727551
5895 5895 a, c dbSNP:1042341
5896 5896 c, t dbSNP:200734307
5897 5897 a, g dbSNP:200187523
5900 5900 a, g dbSNP:201979387
5902 5902 a, c dbSNP:560578704
5929 5929 c, t dbSNP:182949381
5930 5930 a, g dbSNP:199515698
5936 5936 a, g dbSNP:760945186
5940 5940 a, g dbSNP:79894232
5953 5953 a, t dbSNP:200704147
5960 5960 a, g dbSNP:544881826
5976 5976 a, c dbSNP:577229288
5982 5982 a, g dbSNP:199774596
5987 5987 a, g dbSNP:201152057
5988 5988 a, c dbSNP:200227287
5991 5991 a, c dbSNP:202121663
5999 5999 c, g dbSNP:201618637
6009 6009 c, t dbSNP:200360842
6037 6037 c, t dbSNP:201048185
6038 6038 c, t dbSNP:202057424
6047 6047 c, t dbSNP:200894825
6050 6050 a, g dbSNP:200455486
6059 6059 a, g dbSNP:534152421
6061 6061 c, g dbSNP:202130572
6065 6065 g, t dbSNP:201011158
6076 6076 c, t dbSNP:199854667
6092 6092 a, g dbSNP:201863953
6169 6169 c, t dbSNP:201260024
6170 6170 a, g dbSNP:138971426
6173 6173 a, g dbSNP:201483743
6189 6189 a, c, g dbSNP:1805477
6194 6194 a, g dbSNP:754097655
6203 6203 c, g dbSNP:764389795
6215 6215 g, t dbSNP:536936106
6216 6216 g, t dbSNP:199799152
6217 6217 c, t dbSNP:201987269
6226 6226 a, g dbSNP:200663805
6262 6262 g, t dbSNP:199521816
6265 6265 a, g dbSNP:775672315
6275 6275 c, t dbSNP:201335778
6276 6276 a, g dbSNP:200601624
6285 6285 -, c dbSNP:376980193
6317 6317 a, g dbSNP:199746680
6321 6321 g, t dbSNP:201389249
6324 6324 c, t dbSNP:200153893
6342 6342 g, t dbSNP:202138672
6351 6351 a, c dbSNP:201251554
6354 6354 c, t dbSNP:145952835
6355 6355 a, c dbSNP:202195446
6360 6360 a, g dbSNP:200992245
6365 6365 a, g dbSNP:571293410
6380 6380 c, t dbSNP:140845306
6381 6381 a, g dbSNP:189834343
6385 6385 c, t dbSNP:762856760
6401 6401 a, c dbSNP:201497897
6408 6408 c, t dbSNP:200832782
6409 6409 a, g dbSNP:199901170
6414 6414 g, t dbSNP:201877982
6431 6431 c, g dbSNP:151270374
6434 6434 a, g, t dbSNP:199681867
6448 6448 c, t dbSNP:201969859
6471 6471 c, t dbSNP:200565238
6483 6483 c, t dbSNP:199767240
6484 6484 a, g dbSNP:201406699
6492 6492 c, t dbSNP:563447875
6502 6502 a, c dbSNP:200596405
6517 6517 a, c dbSNP:545151893
6522 6522 a, g dbSNP:199539930
6529 6529 a, g dbSNP:201339825
6534 6534 a, g dbSNP:577781000
6546 6546 g, t dbSNP:553230380
6555 6555 a, c dbSNP:1805476
6601 6601 c, t dbSNP:202105346
6612 6612 a, g dbSNP:201489880
6613 6613 a, c dbSNP:774654366
6634 6634 c, t dbSNP:200188772
6638 6638 g, t dbSNP:768362827
6640 6640 c, t dbSNP:185028463
6654 6654 c, t dbSNP:201875516
6655 6655 c, t dbSNP:200914739
6689 6689 c, g dbSNP:200053051
6696 6696 g, t dbSNP:202196852
6713 6713 c, t dbSNP:554999405
6714 6714 c, t dbSNP:200987954
6715 6715 a, g dbSNP:200219720
6735 6735 c, t dbSNP:536253558
6736 6736 c, t dbSNP:569493717
6737 6737 c, t dbSNP:1805502
6758 6758 c, g dbSNP:200589319
6764 6764 a, g dbSNP:532698689
6767 6767 c, t dbSNP:779589810
6770 6770 c, t dbSNP:199869332
6771 6771 a, t dbSNP:182015477
6786 6786 c, g dbSNP:200810158
6789 6789 -, agata, gata dbSNP:556618600
6790 6790 c, t dbSNP:199686930
6792 6792 c, g dbSNP:201564788
6793 6793 a, c dbSNP:200592048
6795 6795 a, g dbSNP:189305190
6813 6813 a, g dbSNP:201161680
6814 6814 a, g dbSNP:528171185
6822 6822 a, g dbSNP:7307302
6842 6842 -, cactt dbSNP:764244058
6859 6859 c, t dbSNP:1805501
6905 6905 a, g dbSNP:754233614
6931 6931 g, t dbSNP:764181580
6934 6934 c, g dbSNP:186973533
6944 6944 a, g dbSNP:370652051
7004 7004 c, t dbSNP:760974287
7006 7006 c, t dbSNP:752912324
7018 7018 a, g dbSNP:767605704
7024 7024 c, t dbSNP:563567627
7047 7047 c, g dbSNP:578158665
7113 7113 c, t dbSNP:565454910
7114 7114 a, g dbSNP:533289798
7117 7117 c, t dbSNP:181493142
7134 7134 a, g dbSNP:3026174
7175 7175 c, g dbSNP:573326793
7180 7180 -, cct dbSNP:751727241
7180 7180 c, t dbSNP:189894777
7195 7195 c, t dbSNP:561376945
7218 7218 a, g dbSNP:542979485
7246 7246 c, t dbSNP:149170679
7249 7249 c, t dbSNP:146533100
7264 7264 g, t dbSNP:746639123
7265 7265 a, g dbSNP:111539119
7306 7306 c, t dbSNP:577966151
7307 7307 a, g dbSNP:112853536
7336 7336 a, c dbSNP:771693841
7365 7365 c, t dbSNP:184633385
7367 7367 c, g dbSNP:566990468
7374 7374 a, g dbSNP:548687723
7412 7412 a, g dbSNP:534299944
7432 7432 a, g dbSNP:12579289
7463 7463 c, t dbSNP:569532117
7499 7499 c, t dbSNP:181182300
7500 7500 a, g dbSNP:779495329
7533 7533 a, g dbSNP:757868944
7538 7538 c, t dbSNP:533072524
7539 7539 a, g dbSNP:139751718
7572 7572 a, g dbSNP:547575140
7586 7586 c, t dbSNP:146891921
7599 7599 g, t dbSNP:561892016
7599 7599 -, t dbSNP:753334043
7608 7608 a, g dbSNP:542738740
7637 7637 -, ttgggctggagggagtggggtggtg dbSNP:748820747
7637 7637 a, t dbSNP:778177452
7644 7644 a, g dbSNP:149818413
7652 7652 a, t dbSNP:188414208
7654 7654 g, t dbSNP:756476525
7656 7656 -, g dbSNP:779582064
7687 7687 -, gttt dbSNP:558876377
7688 7688 c, t dbSNP:572049343
7716 7716 a, g dbSNP:758329863
7738 7738 -, t dbSNP:547126440
7761 7761 c, g dbSNP:545387149
7799 7799 g, t dbSNP:139914188
7818 7818 c, t dbSNP:368774242
7823 7823 c, g dbSNP:553264315
7864 7864 c, t dbSNP:570895688
7878 7878 a, g dbSNP:370986886
7881 7881 a, t dbSNP:534858522
7885 7885 c, t dbSNP:377062556
7886 7886 a, g dbSNP:540896310
7887 7887 c, t dbSNP:573877383
7896 7896 a, g dbSNP:75391947
7900 7900 a, g dbSNP:536740058
7902 7902 c, g dbSNP:765116891
7909 7909 c, g dbSNP:569781596
7912 7912 a, g dbSNP:373066096
7918 7918 a, g dbSNP:551044815
7919 7919 c, g, t dbSNP:74538550
7944 7944 c, g dbSNP:547693212
7987 7987 a, g dbSNP:370064749
8034 8034 a, t dbSNP:529237753
8073 8073 c, t dbSNP:561855043
8079 8079 c, t dbSNP:183744141
8085 8085 c, g dbSNP:750614079
8103 8103 c, t dbSNP:78438886
8120 8120 a, g dbSNP:530860207
8141 8141 a, t dbSNP:116077527
8184 8184 c, t dbSNP:80121100
8193 8193 a, t dbSNP:150673377
8195 8195 c, t dbSNP:192533118
8221 8221 a, g dbSNP:1558766
8240 8240 a, g dbSNP:574038706
8287 8287 a, g dbSNP:760442573
8331 8331 a, g dbSNP:775148871
8340 8340 a, g dbSNP:555680903
8362 8362 a, g dbSNP:1558767
8363 8363 a, g dbSNP:576015413
8409 8409 a, g dbSNP:745331687
8441 8441 c, t dbSNP:774020764
8443 8443 c, g dbSNP:4522263
8458 8458 -, cttt dbSNP:549369390
8508 8508 c, t dbSNP:371934101
8517 8517 g, t dbSNP:539412608
8545 8545 -, gaca dbSNP:776037637
8618 8618 c, t dbSNP:570625072
8626 8626 c, t dbSNP:377029759
8631 8631 c, t dbSNP:3026173
8657 8657 a, g dbSNP:188618666
8709 8709 c, t dbSNP:756489929
8712 8712 a, g dbSNP:553843989
8747 8747 a, t dbSNP:535744944
8759 8759 -, aa dbSNP:547265516
8767 8767 c, t dbSNP:568345460
8784 8784 -, actt, ctt dbSNP:3081895
8787 8787 a, t dbSNP:1805500
8789 8789 -, ctta dbSNP:138204150
8849 8849 c, t dbSNP:185349749
8888 8888 -, a dbSNP:745487154
8892 8892 a, g dbSNP:572102675
8931 8931 a, g dbSNP:764525
8944 8944 c, t dbSNP:531546442
8945 8945 c, t dbSNP:781328544
8946 8946 a, g dbSNP:201395410
8947 8947 -, agat dbSNP:374570300
8952 8952 -, gata dbSNP:138310152
8977 8977 a, g dbSNP:755228121
9003 9003 a, g dbSNP:570022091
9012 9012 a, c dbSNP:751594481
9020 9020 a, g dbSNP:551436522
9075 9075 -, a dbSNP:11284267
9079 9079 a, g dbSNP:533288547
9090 9090 a, c dbSNP:559315815
9101 9101 g, t dbSNP:541075493
9104 9104 a, c dbSNP:192848227
9122 9122 -, c dbSNP:148288637
9133 9133 c, t dbSNP:562415865
9137 9137 -, gag dbSNP:529322821
9185 9185 -, gtt dbSNP:758351916
9187 9187 -, ta dbSNP:367854246
9188 9188 -, at dbSNP:10601109
9189 9189 c, t dbSNP:375999725
9241 9241 a, t dbSNP:543620047
9260 9260 g, t dbSNP:1805499
9266 9266 -, ctggccaca dbSNP:770365312
9276 9276 g, t dbSNP:142540398
9314 9314 c, g, t dbSNP:4627170
9338 9338 c, t dbSNP:139571366
9368 9368 c, t dbSNP:553754360
9374 9374 c, t dbSNP:535450404
9387 9387 a, g dbSNP:147350473
9397 9397 c, t dbSNP:568228288
9405 9405 c, t dbSNP:372795734
9406 9406 a, g dbSNP:760449807
9409 9409 a, g dbSNP:182662015
9413 9413 g, t dbSNP:564799544
9427 9427 a, g dbSNP:570612374
9465 9465 g, t dbSNP:551996396
9478 9478 a, g dbSNP:190077548
9494 9494 -, t dbSNP:5796550
9495 9495 a, t dbSNP:77251898
9509 9509 g, t dbSNP:63287661
9519 9519 -, ttag dbSNP:371436652
9528 9528 -, agtt dbSNP:531380852
9529 9529 -, agtt dbSNP:111878451
9532 9532 -, agtt dbSNP:558727927
9533 9533 c, g dbSNP:565840166
9542 9542 c, g dbSNP:1805237
9568 9568 a, c dbSNP:529304146
9584 9584 a, t dbSNP:562216641
9586 9586 a, c dbSNP:550427372
9592 9592 c, g dbSNP:767229156
9593 9593 c, g dbSNP:367562687
9596 9596 a, c dbSNP:759242015
9601 9601 a, g dbSNP:531953292
9616 9616 a, c, t dbSNP:186825074
9684 9684 a, t dbSNP:774186735
9693 9693 g, t dbSNP:114455726
9702 9702 a, g dbSNP:572128979
9775 9775 c, t dbSNP:770563303
9794 9794 c, t dbSNP:560302899
9810 9810 g, t dbSNP:541815525
9857 9857 g, t dbSNP:753716061
9899 9899 -, g dbSNP:34014459
9919 9919 a, g dbSNP:142724097
9934 9934 -, g dbSNP:35521550
10004 10004 -, t dbSNP:762064602
10059 10059 a, g dbSNP:374769968
10067 10067 c, g dbSNP:773713879
10077 10077 c, t dbSNP:111907901
10078 10078 a, g dbSNP:7294868
10088 10088 a, c dbSNP:138906736
10089 10089 a, g dbSNP:781563598
10140 10140 c, t dbSNP:558285518
10161 10161 c, t dbSNP:371569151
10220 10220 a, g dbSNP:1805498
10246 10246 a, g dbSNP:769044981
10262 10262 c, t dbSNP:747223615
10271 10271 c, t dbSNP:780309484
10282 10282 g, t dbSNP:1805497
10294 10294 c, t dbSNP:555402220
10306 10306 c, t dbSNP:750471742
10317 10317 c, t dbSNP:777724673
10326 10326 a, t dbSNP:182047225
10349 10349 c, t dbSNP:565803277
10452 10452 a, g dbSNP:752730251
10470 10470 -, c dbSNP:770763925
10486 10486 a, g dbSNP:547508681
10534 10534 c, g dbSNP:1805496
10543 10543 -, tctg dbSNP:777464804
10616 10616 c, t dbSNP:759470976
10633 10633 c, t dbSNP:566818885
10650 10650 g, t dbSNP:376412686
10651 10651 g, t dbSNP:3026172
10652 10652 a, t dbSNP:531984602
10654 10654 c, g dbSNP:11832768
10678 10678 g, t dbSNP:74065124
10684 10684 a, g dbSNP:11835673
10701 10701 g, t dbSNP:762460612
10718 10718 c, t dbSNP:772631925
10722 10722 a, t dbSNP:114656875
10763 10763 a, c dbSNP:190919198
10776 10776 a, t dbSNP:187034230
10784 10784 -, ttc dbSNP:201625195
10805 10805 a, g dbSNP:762289490
10833 10833 -, g dbSNP:34781449
10837 10837 a, t dbSNP:75793570
10908 10908 a, c dbSNP:1805495
10941 10941 c, t dbSNP:56291793
10987 10987 c, t dbSNP:201403993
11004 11004 c, t dbSNP:558444154
11018 11018 c, g dbSNP:533711483
11029 11029 c, t dbSNP:368491964
11042 11042 a, g dbSNP:780181598
11045 11045 g, t dbSNP:182055335
11066 11066 a, g dbSNP:12423978
11113 11113 c, t dbSNP:7955681
11148 11148 a, g dbSNP:550107214
11151 11151 c, g dbSNP:778836912
11175 11175 c, t dbSNP:757399023
11185 11185 c, t dbSNP:377249371
11232 11232 a, g dbSNP:537867166
11265 11265 a, g, t dbSNP:771554547
11274 11274 c, t dbSNP:1805475
11285 11285 a, g dbSNP:528668083
11327 11327 a, t dbSNP:34730429
11342 11342 a, g dbSNP:528022578
11347 11347 a, c dbSNP:751407563
11354 11354 c, t dbSNP:766017406
11416 11416 -, tt dbSNP:373196181
11420 11420 c, t dbSNP:567058603
11421 11421 a, g dbSNP:1805494
11423 11423 c, t dbSNP:376081650
11472 11472 c, t dbSNP:150350421
11487 11487 -, taaa dbSNP:750173295
11497 11497 c, g dbSNP:550227950
11529 11529 a, g dbSNP:141276647
11533 11533 a, g dbSNP:75842321
11542 11542 a, g dbSNP:764645453
11545 11545 c, g dbSNP:761367177
11546 11546 -, t dbSNP:778830287
11547 11547 a, g dbSNP:1805493
11583 11583 c, t dbSNP:564567791
11703 11703 a, t dbSNP:533396555
11710 11710 c, t dbSNP:966664
11723 11723 a, g dbSNP:138360835
11732 11732 a, g dbSNP:145635796
11735 11735 -, c dbSNP:34265267
11754 11754 a, c dbSNP:186900794
11771 11771 c, t dbSNP:574840397
11808 11808 c, g dbSNP:556401468
11841 11841 c, g dbSNP:775738411
11846 11846 g, t dbSNP:75446909
11915 11915 a, t dbSNP:527944429
11989 11989 c, t dbSNP:140537072
11994 11994 a, g dbSNP:534496528
12030 12030 a, g dbSNP:774701249
12088 12088 a, g dbSNP:751744563
12100 12100 c, t dbSNP:771121689
12109 12109 c, t dbSNP:181403790
12117 12117 c, t dbSNP:188497050
12132 12132 c, t dbSNP:146872904
12146 12146 a, c, t dbSNP:1805492
12149 12149 c, t dbSNP:370586622
12173 12173 a, g dbSNP:142443685
12192 12192 c, t dbSNP:575968948
12226 12226 g, t dbSNP:532110105
12293 12293 c, t dbSNP:752793000
12294 12294 c, t dbSNP:76191663
12308 12308 g, t dbSNP:539844103
12329 12329 c, t dbSNP:112756670
12345 12345 a, t dbSNP:111739319
12423 12423 g, t dbSNP:777074916
12441 12441 c, t dbSNP:149220077
12468 12468 -, gcaactatctcaaaaacacccgtcct dbSNP:542409153
12468 12468 a, g dbSNP:542778809
12488 12488 a, c dbSNP:183832112
12534 12534 a, t dbSNP:557152111
12538 12538 c, g dbSNP:374134210
12553 12553 c, t dbSNP:544705977
12558 12558 c, t dbSNP:369443969
12622 12622 a, t dbSNP:577458482
12632 12632 c, t dbSNP:576672963
12652 12652 c, g dbSNP:753375792
12760 12760 c, t dbSNP:180740706
12770 12770 a, g dbSNP:567137782
12803 12803 c, t dbSNP:554987832
12809 12809 a, c dbSNP:536982571
12851 12851 c, t dbSNP:76984933
12856 12856 c, t dbSNP:373322904
12880 12880 c, g dbSNP:553789041
12882 12882 -, tctcctt dbSNP:576881155
12906 12906 a, g dbSNP:538344933
12937 12937 c, t dbSNP:370179624
13005 13005 a, c dbSNP:553503603
13050 13050 -, aa dbSNP:781231413
13068 13068 a, g dbSNP:764533972
13117 13117 a, c dbSNP:546152361
13120 13120 a, t dbSNP:147386216
13125 13125 c, t dbSNP:560965420
13126 13126 a, g dbSNP:80217356
13132 13132 a, g dbSNP:185675612
13141 13141 a, c dbSNP:776104017
13172 13172 c, t dbSNP:541988978
13182 13182 a, g dbSNP:73047408
13215 13215 a, c dbSNP:574585366
13224 13224 c, g, t dbSNP:56723744
13264 13264 c, t dbSNP:771285010
13280 13280 a, g dbSNP:565395885
13314 13314 a, c dbSNP:540606572
13331 13331 c, g dbSNP:573134813
13347 13347 a, g dbSNP:75709468
13350 13350 g, t dbSNP:536536046
13351 13351 c, g dbSNP:575940427
13402 13402 a, g dbSNP:144186289
13436 13436 a, t dbSNP:773451080
13448 13448 c, g dbSNP:140262858
13513 13513 c, t dbSNP:771883840
13514 13514 a, g dbSNP:747613456
13603 13603 c, t dbSNP:570980228
13644 13644 g, t dbSNP:193240400
13645 13645 c, t dbSNP:555753521
13662 13662 c, t dbSNP:75149552
13682 13682 c, t dbSNP:746893549
13688 13688 c, t dbSNP:780092354
13689 13689 a, g dbSNP:758067484
13705 13705 a, g dbSNP:117850557
13759 13759 c, g dbSNP:549006329
13802 13802 g, t dbSNP:530667393
13809 13809 c, g dbSNP:778387362
13819 13819 c, g dbSNP:563612317
13829 13829 -, taaac dbSNP:774013683
13861 13861 a, g dbSNP:570017608
13863 13863 a, g dbSNP:188546195
13922 13922 a, g dbSNP:533185619
13973 13973 c, g dbSNP:559617957
14008 14008 a, g dbSNP:73047406
14060 14060 -, ttctaagtgctttgtccttt dbSNP:144187532
14068 14068 g, t dbSNP:184327664
14070 14070 c, t dbSNP:374851990
14108 14108 a, g dbSNP:141761938
14162 14162 c, t dbSNP:191685158
14168 14168 a, g dbSNP:111302972
14291 14291 c, t dbSNP:148062497
14298 14298 c, t dbSNP:538974451
14307 14307 -, tttt dbSNP:764175552
14321 14321 a, g dbSNP:2216212
14363 14363 c, t dbSNP:571062900
14389 14389 c, t dbSNP:537465722
14398 14398 c, g dbSNP:753131375
14400 14400 -, actgtatttcaccacacgctacttccacat dbSNP:527965678
14400 14400 a, g dbSNP:553188819
14412 14412 c, t dbSNP:144542536
14414 14414 a, c dbSNP:759755110
14416 14416 c, t dbSNP:2193149
14471 14471 a, t dbSNP:766662123
14561 14561 g, t dbSNP:555024770
14575 14575 a, c dbSNP:141793976
14602 14602 a, g dbSNP:763249387
14603 14603 c, t dbSNP:569825700
14605 14605 a, c dbSNP:548840395
14643 14643 -, a dbSNP:763390259
14643 14643 a, g dbSNP:186849255
14644 14644 c, t dbSNP:111617481
14647 14647 a, t dbSNP:533301296
14674 14674 a, g dbSNP:565872486
14680 14680 a, g dbSNP:565923929
14700 14700 c, g dbSNP:547660664
14705 14705 c, g dbSNP:528531713
14709 14709 a, t dbSNP:561448801
14748 14748 g, t dbSNP:375262667
14754 14754 c, t dbSNP:542626328
14794 14794 g, t dbSNP:182246620
14811 14811 a, g dbSNP:769994288
14814 14814 a, c dbSNP:374583890
14821 14821 c, g dbSNP:761962287
14848 14848 c, t dbSNP:552362060
14871 14871 a, g dbSNP:752952423
14874 14874 a, c dbSNP:138294539
14893 14893 g, t dbSNP:190659762
14917 14917 a, g dbSNP:187779699
14929 14929 a, g dbSNP:775220800
14943 14943 c, g dbSNP:553102705
14961 14961 c, t dbSNP:79279577
14962 14962 a, g, t dbSNP:573622537
15026 15026 a, g dbSNP:2160517
15069 15069 -, ct dbSNP:765910642
15075 15075 a, t dbSNP:536777638
15076 15076 a, t dbSNP:2160518
15077 15077 a, t dbSNP:557828359
15085 15085 -, a dbSNP:574664432
15124 15124 a, c dbSNP:539742095
15126 15126 g, t dbSNP:565984133
15141 15141 c, t dbSNP:547235899
15195 15195 a, g dbSNP:563860534
15295 15295 c, t dbSNP:550273682
15307 15307 a, g dbSNP:529105960
15323 15323 -, t dbSNP:11389127
15342 15342 c, t dbSNP:568189415
15374 15374 c, t dbSNP:748934830
15386 15386 c, t dbSNP:184037468
15393 15393 c, t dbSNP:74816802
15412 15412 a, g dbSNP:563336188
15424 15424 a, g dbSNP:545002631
15444 15444 g, t dbSNP:755521430
15458 15458 g, t dbSNP:752257121
15459 15459 c, t dbSNP:781513282
15489 15489 c, t dbSNP:370455813
15539 15539 a, g dbSNP:533404613
15562 15562 c, t dbSNP:559638343
15577 15577 a, g dbSNP:754315395
15581 15581 c, g dbSNP:112987388
15586 15586 a, g dbSNP:556251010
15588 15588 a, t dbSNP:555721063
15617 15617 a, g dbSNP:73292159
15628 15628 a, g dbSNP:145725489
15632 15632 a, t dbSNP:557740662
15641 15641 a, c dbSNP:7957488
15664 15664 c, t dbSNP:140617656
15666 15666 g, t dbSNP:765556866
15725 15725 a, c dbSNP:761756320
15738 15738 c, g dbSNP:375080145
15760 15760 a, t dbSNP:138678398
15768 15768 a, g dbSNP:768659745
15774 15774 a, g dbSNP:370787875
15778 15778 c, t dbSNP:568236001
15779 15779 c, t dbSNP:549754117
15800 15800 a, g dbSNP:559931162
15814 15814 c, t dbSNP:537658575
15847 15847 c, g dbSNP:570597744
15848 15848 a, g dbSNP:559551951
15861 15861 a, g dbSNP:774331131
15881 15881 a, g dbSNP:533179718
15902 15902 c, t dbSNP:770709015
15929 15929 a, g dbSNP:10734869
15944 15944 a, g dbSNP:117575009
15968 15968 c, g dbSNP:777348168
15984 15984 -, ta dbSNP:574271438
16037 16037 a, c dbSNP:769507321
16069 16069 a, g dbSNP:529602500
16070 16070 c, t dbSNP:562305380
16090 16090 a, g dbSNP:747569874
16121 16121 c, t dbSNP:543657651
16139 16139 c, t dbSNP:576166888
16153 16153 a, c dbSNP:564186865
16159 16159 c, g dbSNP:150196380
16183 16183 a, g dbSNP:780719659
16185 16185 a, c dbSNP:141093931
16247 16247 a, g dbSNP:74065123
16263 16263 c, t dbSNP:535734779
16267 16267 c, g dbSNP:574645370
16306 16306 c, t dbSNP:377094294
16325 16325 c, g dbSNP:556282126
16342 16342 c, t dbSNP:369879486
16360 16360 a, g dbSNP:752096258
16385 16385 a, g dbSNP:376545965
16412 16412 c, t dbSNP:774204776
16430 16430 g, t dbSNP:373454187
16464 16464 a, g dbSNP:544486810
16472 16472 a, g dbSNP:780769559
16518 16518 c, t dbSNP:574771874
16532 16532 c, t dbSNP:569789345
16549 16549 c, t dbSNP:551440728
16550 16550 a, g dbSNP:151129648
16591 16591 c, t dbSNP:566058241
16603 16603 g, t dbSNP:547521590
16609 16609 a, g dbSNP:558607105
16652 16652 a, g dbSNP:534077199
16723 16723 -, cat dbSNP:770530804
16759 16759 a, g dbSNP:768222949
16762 16762 a, c dbSNP:765519727
16771 16771 a, g dbSNP:10845805
16774 16774 g, t dbSNP:550364678
16784 16784 a, g dbSNP:77479570
16791 16791 c, g dbSNP:142912519
16814 16814 a, g dbSNP:552325138
16823 16823 c, t dbSNP:141788634
16824 16824 a, g dbSNP:147934551
16829 16829 c, g dbSNP:560045617
16838 16838 -, atct dbSNP:760060543
16839 16839 a, t dbSNP:192247282
16850 16850 c, t dbSNP:574639061
16878 16878 c, t dbSNP:556204848
16909 16909 a, g dbSNP:186961142
16923 16923 c, taggtgg dbSNP:386760555
16923 16923 -, taggtg dbSNP:71910806
16923 16923 c, t dbSNP:55865680
16924 16924 -, aggtgg dbSNP:57492574
16929 16929 c, g dbSNP:77583213
16931 16931 -, ggtgga dbSNP:66502737
16931 16931 a, g dbSNP:200662888
16932 16932 c, g dbSNP:199641570
17034 17034 c, t dbSNP:181474102
17051 17051 c, t dbSNP:538862932
17054 17054 c, g, t dbSNP:144277216
17068 17068 c, t dbSNP:566044868
17092 17092 a, g dbSNP:116864007
17100 17100 a, g dbSNP:774206690
17101 17101 c, t dbSNP:766316635
17107 17107 a, g dbSNP:762686809
17122 17122 c, t dbSNP:375503880
17177 17177 c, t dbSNP:11055522
17178 17178 a, g dbSNP:550478532
17184 17184 a, g dbSNP:769514057
17212 17212 a, g dbSNP:117253895
17241 17241 c, t dbSNP:747811585
17295 17295 a, g dbSNP:74065121
17301 17301 a, g dbSNP:140404282
17326 17326 a, c dbSNP:527336199
17344 17344 a, g dbSNP:560004816
17382 17382 a, t dbSNP:541778241
17415 17415 a, t dbSNP:768205000
17453 17453 a, g dbSNP:7978058
17505 17505 c, t dbSNP:780661641
17513 17513 g, t dbSNP:562180837
17531 17531 a, g dbSNP:759007965
17536 17536 c, t dbSNP:765732508
17537 17537 a, g dbSNP:116611820
17540 17540 c, t dbSNP:576777705
17547 17547 c, t dbSNP:534427233
17570 17570 c, t dbSNP:558283520
17571 17571 a, g dbSNP:540047458
17581 17581 a, t dbSNP:746419855
17651 17651 c, g dbSNP:11055521
17655 17655 c, t dbSNP:757621987
17711 17711 c, t dbSNP:754088121
17719 17719 c, t dbSNP:200488937
17745 17745 a, c dbSNP:764226709
17760 17760 c, t dbSNP:190311236
17801 17801 a, g dbSNP:185595574
17813 17813 a, c dbSNP:568352674
17817 17817 a, g dbSNP:756129159
17835 17835 a, g dbSNP:111568757
17853 17853 a, c dbSNP:538493405
17943 17943 c, t dbSNP:571168119
17949 17949 c, g dbSNP:766263262
17989 17989 a, g dbSNP:547889949
18002 18002 a, t dbSNP:117213164
18020 18020 c, t dbSNP:773180296
18032 18032 a, c, g dbSNP:149888888
18043 18043 g, t dbSNP:780562502
18044 18044 a, g dbSNP:547962782
18064 18064 a, c dbSNP:74065120
18142 18142 a, t dbSNP:776275684
18206 18206 c, t dbSNP:562143878
18207 18207 a, g dbSNP:543811612
18214 18214 a, g dbSNP:768220005
18252 18252 c, g dbSNP:17820689
18281 18281 -, tta dbSNP:568222992
18282 18282 g, t dbSNP:775112753
18287 18287 -, a dbSNP:570987586
18287 18287 a, t dbSNP:73045392
18288 18288 a, t dbSNP:74241194
18295 18295 -, t dbSNP:202054218
18300 18300 -, a dbSNP:748045142
18306 18306 c, t dbSNP:572932071
18391 18391 c, t dbSNP:139197333
18392 18392 a, g dbSNP:551720969
18412 18412 a, g dbSNP:181186361
18413 18413 c, t dbSNP:574878973
18451 18451 g, t dbSNP:556556933
18480 18480 c, t dbSNP:532099928
18495 18495 a, g dbSNP:11055520
18543 18543 c, g dbSNP:577583633
18548 18548 a, g dbSNP:559270168
18580 18580 c, t dbSNP:534544874
18591 18591 a, g dbSNP:189322615
18629 18629 a, g dbSNP:61911349
18651 18651 a, c dbSNP:529880707
18661 18661 a, g dbSNP:778001703
18718 18718 a, c dbSNP:11609427
18743 18743 a, t dbSNP:544183824
18766 18766 a, c dbSNP:186057667
18768 18768 a, g dbSNP:141725265
18774 18774 c, g dbSNP:556301137
18792 18792 c, t dbSNP:139898876
18797 18797 g, t dbSNP:370937927
18821 18821 c, t dbSNP:755105302
18848 18848 c, t dbSNP:564569389
18880 18880 g, t dbSNP:750367071
18881 18881 g, t dbSNP:546567216
18906 18906 c, t dbSNP:528431801
18920 18920 a, c dbSNP:560872461
18968 18968 -, tt dbSNP:67636330
18969 18969 -, tt dbSNP:386375667
18979 18979 -, tt, ttt dbSNP:779928394
18979 18979 -, t dbSNP:80116020
18997 18997 -, c dbSNP:35117195
19023 19023 a, g dbSNP:370467491
19044 19044 a, c dbSNP:79571580
19096 19096 c, g, t dbSNP:74065119
19114 19114 a, g dbSNP:182340587
19132 19132 a, g dbSNP:190453919
19146 19146 c, g dbSNP:566566890
19177 19177 -, ggg dbSNP:560558020
19225 19225 c, t dbSNP:577291876
19258 19258 g, t dbSNP:184363403
19267 19267 a, g dbSNP:753610139
19291 19291 c, t dbSNP:764023349
19306 19306 a, g dbSNP:759383716
19339 19339 a, g dbSNP:558951882
19368 19368 a, g dbSNP:142000657
19383 19383 a, g dbSNP:776611851
19412 19412 a, g dbSNP:573487108
19436 19436 a, g dbSNP:143316428
19463 19463 a, c dbSNP:536868754
19487 19487 a, g dbSNP:558808779
19494 19494 -, g dbSNP:398018507
19502 19502 -, g dbSNP:62686762
19516 19516 a, g dbSNP:759122324
19529 19529 a, g dbSNP:568585329
19580 19580 g, t dbSNP:73290091
19644 19644 a, g dbSNP:569914016
19674 19674 c, g dbSNP:771363821
19684 19684 a, g dbSNP:191937124
19711 19711 g, t dbSNP:749625045
19735 19735 a, g dbSNP:779069495
19764 19764 a, g dbSNP:79850958
19821 19821 g, t dbSNP:546577823
19829 19829 a, t dbSNP:528334023
19897 19897 a, g dbSNP:143237371
19966 19966 a, g dbSNP:149570138
19988 19988 -, aaaa dbSNP:71067707
19991 19991 -, aaaa dbSNP:386375666
20001 20001 -, aaaa, atat dbSNP:57206826
20003 20003 a, t dbSNP:12099630
20005 20005 -, t dbSNP:772893138
20006 20006 -, aa dbSNP:201147007
20019 20019 c, t dbSNP:200483172
20021 20021 c, t dbSNP:12579738
20022 20022 a, g dbSNP:112353393
20023 20023 c, t dbSNP:10772691
20030 20030 -, a dbSNP:544430530
20033 20033 -, ta dbSNP:199921868
20033 20033 c, t dbSNP:12817643
20034 20034 -, ta dbSNP:36143459
20036 20036 a, g dbSNP:544710204
20047 20047 c, t dbSNP:7487253
20103 20103 a, g dbSNP:141881935
20118 20118 a, g dbSNP:768784242
20152 20152 a, g dbSNP:781457445
20185 20185 a, t dbSNP:565088025
20215 20215 c, g dbSNP:540634007
20216 20216 a, g dbSNP:147917464
20236 20236 c, t dbSNP:10845804
20255 20255 a, g dbSNP:552431392
20262 20262 a, c dbSNP:575418794
20269 20269 c, t dbSNP:12579716
20333 20333 a, g dbSNP:538299931
20342 20342 a, c dbSNP:12814951
20366 20366 c, t dbSNP:781765331
20370 20370 c, g dbSNP:552659750
20414 20414 g, t dbSNP:140771505
20446 20446 c, t dbSNP:184081292
20497 20497 a, c dbSNP:73045385
20499 20499 g, t dbSNP:549241747
20501 20501 a, g dbSNP:530865215
20517 20517 g, t dbSNP:569864655
20531 20531 a, g dbSNP:548176053
20583 20583 c, t dbSNP:56081113
20598 20598 a, c dbSNP:767292579
20615 20615 c, t dbSNP:532614094
20620 20620 a, c dbSNP:73045383
20639 20639 c, t dbSNP:544363932
20655 20655 a, g dbSNP:773764338
20664 20664 a, g dbSNP:530593903
20683 20683 c, g dbSNP:540237142
20706 20706 c, t dbSNP:192880452
20713 20713 a, g dbSNP:561161186
20761 20761 c, t dbSNP:542905468
20762 20762 -, c dbSNP:778058932
20798 20798 -, ttccccttcatgtttttgg dbSNP:765868372
20814 20814 c, t dbSNP:11055519
20816 20816 a, g dbSNP:565210006
20829 20829 a, g dbSNP:763343842
20900 20900 -, aa dbSNP:201034189
20905 20905 a, c dbSNP:557091160
20906 20906 c, t dbSNP:11055518
20907 20907 c, g dbSNP:150969694
20953 20953 a, c dbSNP:770136668
20975 20975 c, g dbSNP:748513669
20978 20978 a, g dbSNP:553008212
20984 20984 a, g dbSNP:187738648
21008 21008 a, g dbSNP:567243573
21053 21053 a, g dbSNP:17220131
21081 21081 c, t dbSNP:768901737
21087 21087 a, c dbSNP:142497620
21097 21097 a, g dbSNP:747299638
21131 21131 c, g dbSNP:148411533
21148 21148 c, t dbSNP:201924461
21151 21151 g, t dbSNP:201515470
21231 21231 c, t dbSNP:551568688
21290 21290 c, t dbSNP:770888972
21291 21291 a, g dbSNP:760414787
21292 21292 c, t dbSNP:540738793
21347 21347 c, t dbSNP:373162472
21360 21360 c, g dbSNP:145467720
21393 21393 c, t dbSNP:565767427
21399 21399 g, t dbSNP:182833842
21422 21422 a, c dbSNP:771942764
21439 21439 a, g dbSNP:777859945
21489 21489 c, t dbSNP:193099470
21497 21497 c, t dbSNP:561241183
21517 21517 a, t dbSNP:187762551
21553 21553 c, t dbSNP:755916052
21558 21558 g, t dbSNP:183111033
21568 21568 -, aag dbSNP:758544130
21576 21576 a, g dbSNP:143451597
21631 21631 a, g dbSNP:531073866
21632 21632 c, t dbSNP:139977913
21636 21636 c, t dbSNP:780337231
21648 21648 c, t dbSNP:199689129
21671 21671 c, t dbSNP:767237539
21672 21672 c, t dbSNP:190750469
21691 21691 c, t dbSNP:578111795
21699 21699 c, t dbSNP:10845803
21701 21701 c, t dbSNP:12302841
21712 21712 c, t dbSNP:554886245
21734 21734 c, g dbSNP:573658812
21747 21747 g, t dbSNP:781744884
21762 21762 a, c dbSNP:555361614
21773 21773 c, t dbSNP:61911348
21778 21778 a, g dbSNP:369262654
21798 21798 a, g dbSNP:4764009
21816 21816 g, t dbSNP:545289537
21828 21828 a, t dbSNP:765743138
21830 21830 a, c dbSNP:78148247
21840 21840 a, g dbSNP:539388523
21861 21861 -, t dbSNP:35681382
21915 21915 g, t dbSNP:186043226
21940 21940 c, t dbSNP:183202016
21949 21949 g, t dbSNP:762113478
21962 21962 c, t dbSNP:535074822
22035 22035 g, t dbSNP:115152823
22057 22057 a, g dbSNP:776953450
22116 22116 c, t dbSNP:58987510
22122 22122 a, g dbSNP:530789019
22126 22126 a, g dbSNP:563377261
22166 22166 a, g dbSNP:551647634
22179 22179 a, c dbSNP:533501255
22188 22188 a, g dbSNP:10845802
22235 22235 a, g dbSNP:771979240
22237 22237 a, g dbSNP:745976155
22275 22275 c, t dbSNP:541276505
22276 22276 -, gg dbSNP:765674301
22276 22276 a, g dbSNP:7961819
22308 22308 -, taatta dbSNP:755577629
22314 22314 -, a dbSNP:545902321
22322 22322 a, t dbSNP:34292302
22365 22365 c, t dbSNP:748134959
22395 22395 g, t dbSNP:113228582
22402 22402 c, t dbSNP:534755305
22430 22430 c, g dbSNP:753371861
22435 22435 c, t dbSNP:145998014
22441 22441 a, t dbSNP:754858614
22451 22451 g, t dbSNP:557830332
22479 22479 c, g dbSNP:539718703
22520 22520 c, t dbSNP:142613073
22558 22558 c, g dbSNP:191417151
22604 22604 c, g dbSNP:751164025
22635 22635 c, t dbSNP:139756885
22647 22647 c, t dbSNP:185976658
22657 22657 g, t dbSNP:372634929
22671 22671 c, t dbSNP:180705403
22680 22680 a, g dbSNP:150650381
22696 22696 c, t dbSNP:59746447
22729 22729 c, g dbSNP:551486451
22762 22762 c, t dbSNP:533636645
22817 22817 a, t dbSNP:566260864
22829 22829 c, g dbSNP:75792181
22849 22849 a, c dbSNP:529488863
22851 22851 c, t dbSNP:530771125
22908 22908 a, g dbSNP:371936919
22936 22936 a, g dbSNP:749954817
22949 22949 c, t dbSNP:529991657
22950 22950 c, g dbSNP:137933198
23021 23021 a, g dbSNP:141901091
23029 23029 c, t dbSNP:549913922
23030 23030 a, g dbSNP:190442404
23038 23038 a, g dbSNP:777182631
23066 23066 a, g dbSNP:12367391
23071 23071 a, g dbSNP:761107805
23094 23094 a, g dbSNP:572273687
23101 23101 a, c, g dbSNP:11055517
23106 23106 -, ag dbSNP:766940986
23107 23107 a, g dbSNP:55669319
23123 23123 c, t dbSNP:555987177
23135 23135 c, t dbSNP:56297231
23136 23136 a, g dbSNP:368265971
23154 23154 a, g dbSNP:774540713
23171 23171 c, t dbSNP:558100242
23182 23182 c, t dbSNP:539472206
23193 23193 a, g dbSNP:544371662
23210 23210 c, t dbSNP:771184732
23258 23258 -, ca dbSNP:771197295
23268 23268 g, t dbSNP:748083421
23282 23282 a, g dbSNP:116041024
23358 23358 g, t dbSNP:547759899
23380 23380 a, g dbSNP:186134513
23387 23387 c, t dbSNP:568668978
23416 23416 a, g dbSNP:115311842
23422 23422 c, t dbSNP:369655241
23423 23423 a, t dbSNP:181802839
23458 23458 c, t dbSNP:545908632
23462 23462 c, t dbSNP:768265181
23496 23496 c, t dbSNP:189068823
23510 23510 a, t dbSNP:112468872
23524 23524 c, t dbSNP:746831200
23525 23525 a, g dbSNP:184300429
23533 23533 a, g dbSNP:541754507
23534 23534 c, g dbSNP:758096750
23538 23538 c, t dbSNP:574393657
23551 23551 a, g dbSNP:750128996
23563 23563 a, g dbSNP:147036842
23569 23569 g, t dbSNP:544018847
23573 23573 c, t dbSNP:114566975
23591 23591 c, t dbSNP:558679975
23612 23612 a, g dbSNP:557949640
23616 23616 -, t dbSNP:112887487
23631 23631 a, g dbSNP:539956481
23649 23649 a, c dbSNP:572343760
23655 23655 c, g dbSNP:756829936
23668 23668 c, t dbSNP:192795394
23670 23670 a, g dbSNP:536111135
23752 23752 g, t dbSNP:189663382
23763 23763 c, t dbSNP:143273882
23779 23779 a, c dbSNP:184415315
23788 23788 g, t dbSNP:139391044
23804 23804 a, g dbSNP:551974771
23842 23842 c, t dbSNP:527427323
23900 23900 c, t dbSNP:760901435
23901 23901 a, g dbSNP:559848251
23943 23943 a, g dbSNP:753137723
23973 23973 c, g dbSNP:767812839
23996 23996 c, t dbSNP:759809074
24066 24066 -, at dbSNP:71067706
24067 24067 -, ta dbSNP:35602745
24067 24067 c, t dbSNP:111324203
24068 24068 -, ta dbSNP:773764717
24073 24073 a, g dbSNP:547790424
24081 24081 a, t dbSNP:12814570
24095 24095 a, g dbSNP:774771661
24122 24122 a, g dbSNP:529903285
24142 24142 c, t dbSNP:75891524
24143 24143 c, g dbSNP:544129566
24145 24145 a, g dbSNP:763126110
24146 24146 a, c dbSNP:748579021
24171 24171 a, g dbSNP:576946795
24188 24188 c, t dbSNP:565131499
24248 24248 a, g dbSNP:149198563
24249 24249 c, t dbSNP:564896902
24260 24260 -, ggaa dbSNP:377492648
24265 24265 -, gaag dbSNP:139720443
24272 24272 a, g dbSNP:572507879
24279 24279 a, t dbSNP:192623582
24280 24280 c, g dbSNP:553842680
24296 24296 a, c dbSNP:535870035
24297 24297 a, g dbSNP:576649398
24314 24314 c, t dbSNP:776371666
24358 24358 g, t dbSNP:574912464
24360 24360 a, g dbSNP:77700377
24371 24371 a, g dbSNP:61911347
24393 24393 a, g dbSNP:768656866
24469 24469 a, g dbSNP:536275640
24472 24472 a, g dbSNP:538577411
24485 24485 c, t dbSNP:570953875
24516 24516 a, g dbSNP:552740968
24540 24540 c, t dbSNP:754603693
24556 24556 a, c dbSNP:533610980
24588 24588 c, t dbSNP:566576410
24652 24652 a, g dbSNP:753531273
24676 24676 c, g dbSNP:4764008
24705 24705 a, g dbSNP:755679239
24715 24715 a, g dbSNP:529621470
24716 24716 a, g dbSNP:77544927
24742 24742 -, ggt dbSNP:150615489
24757 24757 g, t dbSNP:550452112
24760 24760 a, g dbSNP:73290081
24763 24763 a, g dbSNP:564886162
24811 24811 a, g dbSNP:771917003
24811 24811 -, g dbSNP:11331309
24830 24830 a, g dbSNP:540433952
24846 24846 a, g dbSNP:572417433
24849 24849 c, g dbSNP:767521832
24861 24861 a, g dbSNP:186704772
24924 24924 c, t dbSNP:370984429
24925 24925 a, g dbSNP:761464192
24941 24941 c, t dbSNP:778544291
24976 24976 a, c dbSNP:117210181
24982 24982 a, c dbSNP:377561236
25007 25007 -, gcatg dbSNP:373203735
25015 25015 -, t dbSNP:373526333
25022 25022 -, t dbSNP:147439937
25023 25023 -, t dbSNP:565476102
25023 25023 a, t dbSNP:142130302
25032 25032 a, g dbSNP:73045371
25061 25061 a, g dbSNP:753370055
25095 25095 c, t dbSNP:763831732
25127 25127 c, g dbSNP:73290079
25134 25134 c, g dbSNP:370244514
25152 25152 a, c dbSNP:756614567
25168 25168 c, t dbSNP:558848910
25204 25204 a, g dbSNP:150314026
25234 25234 c, g dbSNP:566981741
25252 25252 a, g dbSNP:77714030
25279 25279 c, t dbSNP:183523148
25342 25342 c, t dbSNP:771072599
25360 25360 c, t dbSNP:568512448
25392 25392 c, t dbSNP:550167853
25397 25397 c, g dbSNP:73045370
25399 25399 a, g dbSNP:192497659
25405 25405 a, g dbSNP:546603950
25428 25428 c, t dbSNP:760043326
25432 25432 c, t dbSNP:528271908
25433 25433 a, g dbSNP:77316868
25480 25480 c, t dbSNP:572173784
25534 25534 a, c dbSNP:766719171
25544 25544 -, aca dbSNP:559891130
25558 25558 a, g dbSNP:542337897
25676 25676 g, t dbSNP:73290077
25682 25682 c, g dbSNP:562829815
25698 25698 a, c dbSNP:773368481
25706 25706 c, t dbSNP:544607638
25727 25727 -, a dbSNP:77642327
25735 25735 -, a dbSNP:144048657
25736 25736 -, a dbSNP:548992059
25787 25787 a, t dbSNP:577437630
25796 25796 g, t dbSNP:7963710
25884 25884 g, t dbSNP:7977373
25889 25889 a, g dbSNP:73045367
25896 25896 a, c dbSNP:7973635
25959 25959 a, g dbSNP:113294179
25973 25973 c, g dbSNP:187681428
25980 25980 a, g dbSNP:377130644
25983 25983 a, g dbSNP:536596548
26037 26037 c, t dbSNP:377026280
26078 26078 c, t dbSNP:745679455
26082 26082 a, c dbSNP:556505724
26097 26097 c, t dbSNP:12822453
26098 26098 a, g dbSNP:571186767
26120 26120 c, t dbSNP:546862732
26184 26184 g, t dbSNP:528419127
26192 26192 a, g dbSNP:567420326
26229 26229 a, g dbSNP:547200328
26296 26296 c, g dbSNP:12367112
26303 26303 c, t dbSNP:112432918
26323 26323 c, t dbSNP:748933497
26324 26324 a, g dbSNP:118151529
26348 26348 a, t dbSNP:755637169
26369 26369 c, t dbSNP:544406149
26374 26374 c, t dbSNP:532523209
26378 26378 c, t dbSNP:143210395
26385 26385 c, t dbSNP:183481665
26395 26395 c, t dbSNP:141114615
26414 26414 c, t dbSNP:561108539
26435 26435 c, t dbSNP:573082770
26453 26453 c, g dbSNP:749968893
26454 26454 g, t dbSNP:368287375
26486 26486 a, g dbSNP:73290076
26514 26514 c, t dbSNP:557000311
26522 26522 c, t dbSNP:116595730
26562 26562 c, t dbSNP:577559898
26572 26572 a, c dbSNP:573582709
26625 26625 g, t dbSNP:191228845
26629 26629 c, t dbSNP:367593711
26638 26638 a, g dbSNP:556641187
26684 26684 a, g dbSNP:750672808
26694 26694 g, t dbSNP:146526536
26714 26714 c, t dbSNP:762851012
26727 26727 c, t dbSNP:142608704
26731 26731 c, t dbSNP:148446487
26762 26762 a, g dbSNP:537219961
26766 26766 c, g dbSNP:72656651
26792 26792 a, g dbSNP:117852052
26839 26839 a, g dbSNP:144560238