
MSH6 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MSH6
Entrez Gene ID 2956
Full Name mutS homolog 6
Synonyms GTBP, GTMBP, HNPCC5, HSAP, p160
General protein information
Preferred Names
DNA mismatch repair protein Msh6
DNA mismatch repair protein Msh6
sperm-associated protein
mutS-alpha 160 kDa subunit
G/T mismatch-binding protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, hereditary nonpolyposis, type 5 (3); Endometrial

mRNA and Protein(s)

mRNA Protein Name
NM_001281492 NP_001268421 DNA mismatch repair protein Msh6 isoform 2
XM_011532798 XP_011531100 DNA mismatch repair protein Msh6 isoform X1
XM_011532799 XP_011531101 DNA mismatch repair protein Msh6 isoform X2
XM_011532800 XP_011531102 DNA mismatch repair protein Msh6 isoform X2
XM_005264271 XP_005264328 DNA mismatch repair protein Msh6 isoform X2
NM_001281493 NP_001268422 DNA mismatch repair protein Msh6 isoform 3
NM_001281494 NP_001268423 DNA mismatch repair protein Msh6 isoform 3
NM_000179 NP_000170 DNA mismatch repair protein Msh6 isoform 1

hsa03430 Mismatch repair
hsa05210 Colorectal cancer
hsa05200 Pathways in cancer
hsa_M00295 BRCA1-associated genome surveillance complex (BASC)
R-HSA-5358565 Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha)
R-HSA-73894 DNA Repair
R-HSA-5358508 Mismatch Repair
WP531 Mismatch repair
WP1984 Integrated Breast Cancer Pathway
WP2263 Prostate Cancer
WP2261 Signaling Pathways in Glioblastoma
WP1971 Integrated Cancer pathway
WP2446 RB in Cancer

Homo sapiens (human) MSH6 NP_000170.1
Pan troglodytes (chimpanzee) MSH6 XP_003309101.1
Macaca mulatta (Rhesus monkey) MSH6 XP_001113749.1
Canis lupus familiaris (dog) MSH6 XP_531814.2
Bos taurus (cattle) MSH6 NP_001179666.1
Mus musculus (house mouse) Msh6 NP_034960.1
Rattus norvegicus (Norway rat) LOC100360342 XP_006239796.1
Gallus gallus (chicken) MSH6 XP_419359.3
Danio rerio (zebrafish) msh6 NP_878280.1
Drosophila melanogaster (fruit fly) Msh6 NP_648755.1
Caenorhabditis elegans msh-6 NP_491163.1
Arabidopsis thaliana (thale cress) MSH6 NP_192116.1
Xenopus (Silurana) tropicalis (western clawed frog) msh6 XP_002935421.2


ID Name Evidence
GO:0000228 nuclear chromosome ISS
GO:0000790 nuclear chromatin IEA
GO:0005634 nucleus IEA
GO:0032301 MutSalpha complex IDA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0000287 magnesium ion binding IDA
GO:0000400 four-way junction DNA binding IDA
GO:0003682 chromatin binding IEA
GO:0003684 damaged DNA binding IEA
GO:0003690 double-stranded DNA binding IDA
GO:0005515 protein binding IPI
GO:0005515 protein binding IPI
GO:0005524 ATP binding IDA
GO:0008094 DNA-dependent ATPase activity ISS
GO:0016887 ATPase activity IDA
GO:0030983 mismatched DNA binding IDA
GO:0032137 guanine/thymine mispair binding IDA
GO:0032142 single guanine insertion binding IDA
GO:0032143 single thymine insertion binding IDA
GO:0032357 oxidized purine DNA binding IDA
GO:0032405 MutLalpha complex binding IDA
GO:0042803 protein homodimerization activity IPI
GO:0043531 ADP binding IDA


ID Name Evidence
GO:0000710 meiotic mismatch repair ISS
GO:0006200 ATP catabolic process IDA
GO:0006281 DNA repair IDA
GO:0006298 mismatch repair IDA
GO:0006298 mismatch repair IMP
GO:0007131 reciprocal meiotic recombination ISS
GO:0008340 determination of adult lifespan ISS
GO:0008629 induction of apoptosis by intracellular signals ISS
GO:0008630 DNA damage response, signal transduction resulting in induction of apoptosis ISS
GO:0009411 response to UV ISS
GO:0016446 somatic hypermutation of immunoglobulin genes ISS
GO:0016447 somatic recombination of immunoglobulin gene segments ISS
GO:0043570 maintenance of DNA repeat elements IMP
GO:0045190 isotype switching ISS
GO:0045910 negative regulation of DNA recombination IDA
GO:0051096 positive regulation of helicase activity IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following MSH6 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MSH6 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu27543 NM_001281492 Homo sapiens mutS homolog 6 (MSH6), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 $643.30
OHu58146 XM_011532798 PREDICTED: Homo sapiens mutS homolog 6 (MSH6), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 $643.30
OHu35371 XM_011532799 PREDICTED: Homo sapiens mutS homolog 6 (MSH6), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 $643.30
OHu35371 XM_011532800 PREDICTED: Homo sapiens mutS homolog 6 (MSH6), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 $643.30
OHu35371 XM_005264271 PREDICTED: Homo sapiens mutS homolog 6 (MSH6), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 $643.30
OHu22411 NM_001281493 Homo sapiens mutS homolog 6 (MSH6), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 $559.30
OHu22411 NM_001281494 Homo sapiens mutS homolog 6 (MSH6), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 $559.30
OHu25314 NM_000179 Homo sapiens mutS homolog 6 (MSH6), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 $69.30

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu27543
Accession Version NM_001281492.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3693bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 26-MAY-2014
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh6 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC071594.1 and AK293921.1. Summary: This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]. Transcript Variant: This variant (2) uses an alternate splice site and lacks two exons in the 5' coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK293921.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)15..17(+)
Misc Feature(2)192..194(+)
Misc Feature(3)273..275(+)
Misc Feature(4)279..281(+)
Misc Feature(5)360..362(+)
Misc Feature(6)387..389(+)
Misc Feature(7)981..3770(+)
Misc Feature(8)981..1337(+)
Misc Feature(9)1374..1841(+)
Misc Feature(10)1971..2954(+)
Misc Feature(11)3033..3701(+)
Misc Feature(12)3162..3185(+)
Misc Feature(13)3171..3506(+)
Misc Feature(14)3285..3296(+)
Misc Feature(15)3309..3350(+)
Misc Feature(16)3387..3404(+)
Misc Feature(17)3411..3422(+)
Misc Feature(18)3492..3512(+)
Exon (1)1..389
Gene Synonym:
Exon (2)390..2934
Gene Synonym:
Exon (3)2935..3200
Gene Synonym:
Exon (4)3201..3318
Gene Synonym:
Exon (5)3319..3408
Gene Synonym:
Exon (6)3409..3563
Gene Synonym:
Exon (7)3564..3763
Gene Synonym:
Exon (8)3764..3938
Gene Synonym:
Position Chain Variation Link
35 35 a, g dbSNP:556432240
47 47 c, g dbSNP:577888495
54 54 a, g dbSNP:747206043
56 56 c, t dbSNP:538807235
82 82 a, g dbSNP:553984796
102 102 c, g, t dbSNP:375109921
103 103 c, g dbSNP:755310531
104 104 c, g, t dbSNP:113081858
107 107 c, g, t dbSNP:748339592
115 115 c, g dbSNP:185538282
116 116 c, t dbSNP:747521149
119 119 c, g, t dbSNP:771435695
122 122 a, g dbSNP:748779488
124 124 a, g dbSNP:561326741
127 127 a, g dbSNP:773995995
134 134 c, g dbSNP:761485894
135 135 g, t dbSNP:199913053
136 136 c, t dbSNP:370816858
140 140 a, g dbSNP:760597933
141 141 c, g dbSNP:766407370
142 142 -, ggctgtcg dbSNP:760027265
145 145 c, t dbSNP:565211544
147 147 c, g, t dbSNP:730881822
151 151 g, t dbSNP:374748889
157 157 c, t dbSNP:752887988
162 162 c, t dbSNP:786201042
166 166 c, g dbSNP:532585602
167 167 c, t dbSNP:778036049
168 168 a, c dbSNP:200944853
173 173 g, t dbSNP:757815307
174 174 c, t dbSNP:781670952
176 176 c, t dbSNP:746306598
177 177 a, g dbSNP:41294986
180 180 c, t dbSNP:773861137
182 182 c, g, t dbSNP:786201869
185 185 c, g dbSNP:747802641
186 186 a, c, t dbSNP:587782084
187 187 c, t dbSNP:760603184
188 188 c, g dbSNP:760533525
190 190 a, c, g dbSNP:41294988
195 195 c, t dbSNP:776745497
199 199 c, t dbSNP:759501511
205 205 c, g dbSNP:765459817
209 209 c, t dbSNP:752794296
211 211 a, c, t dbSNP:63750664
214 214 a, g dbSNP:267608025
219 219 a, g dbSNP:730881810
223 223 c, t dbSNP:786201684
225 225 g, t dbSNP:267608026
226 226 c, t dbSNP:35462442
228 228 a, t dbSNP:757622849
233 233 c, g dbSNP:781496151
235 235 c, t dbSNP:750949635
237 237 a, c dbSNP:756589186
239 239 c, g dbSNP:778354962
245 245 c, t dbSNP:370817805
246 246 g, t dbSNP:776859837
247 247 a, g dbSNP:771426932
248 248 a, c, t dbSNP:553046896
249 249 c, g, t dbSNP:730881811
253 253 c, t dbSNP:746624223
254 254 a, c dbSNP:201132087
256 256 c, t dbSNP:776547943
258 258 g, t dbSNP:759589301
259 259 c, t dbSNP:61756469
260 260 c, g, t dbSNP:63750213
261 261 a, g dbSNP:775487116
262 262 c, t dbSNP:763104308
264 264 c, t dbSNP:764009461
266 266 c, t dbSNP:786201700
267 267 a, c, g dbSNP:751838296
268 268 a, c, g dbSNP:1042821
269 269 a, c, g dbSNP:756673077
270 270 c, g dbSNP:754231971
271 271 c, t dbSNP:757957751
272 272 c, g dbSNP:777101467
276 276 c, t dbSNP:34014629
279 279 a, t dbSNP:770678180
280 280 a, c dbSNP:781203386
297 297 a, g, t dbSNP:745642001
298 298 a, c, t dbSNP:775498550
299 299 c, t dbSNP:768803986
300 300 c, t dbSNP:374597395
305 305 c, g dbSNP:762061869
309 309 -, ctgggc dbSNP:767894453
313 313 c, g dbSNP:63751098
321 321 c, g dbSNP:773367009
323 323 -, gggccc dbSNP:786201776
327 327 c, t dbSNP:761033647
330 330 c, t dbSNP:35819209
333 333 -, gc dbSNP:775928689
334 334 c, t dbSNP:572336612
338 338 a, c dbSNP:1042820
339 339 c, t dbSNP:763702846
340 340 a, c dbSNP:587779920
342 342 a, c, g dbSNP:587779921
344 344 g, t dbSNP:786203178
346 346 c, t dbSNP:41294984
349 349 a, c dbSNP:730881812
359 359 a, g dbSNP:757025193
366 366 c, g dbSNP:786201910
375 375 a, g dbSNP:781002816
377 377 a, g dbSNP:786202321
379 379 c, t dbSNP:587780672
381 381 c, t dbSNP:745442468
391 391 c, t dbSNP:201431515
393 393 a, g dbSNP:786204153
403 403 a, c dbSNP:773111311
404 404 a, c, g, t dbSNP:1800937
405 405 a, c, g dbSNP:145959653
406 406 g, t dbSNP:587779946
409 409 c, t dbSNP:765195534
410 410 ag, tt dbSNP:63750471
411 411 -, t dbSNP:267607692
412 412 a, g dbSNP:554012110
413 413 -, t dbSNP:63750955
414 414 a, t dbSNP:587779315
418 418 a, g dbSNP:763060788
421 421 a, c, g dbSNP:764478569
422 422 a, c dbSNP:1800938
423 423 a, g dbSNP:757817018
425 425 a, c, g dbSNP:41557217
427 427 a, g dbSNP:750827951
429 429 a, g dbSNP:374041375
430 430 a, g dbSNP:587779316
437 437 a, t dbSNP:572317219
439 439 a, g dbSNP:587781777
440 440 c, g dbSNP:778236337
441 441 a, g dbSNP:786202905
442 442 a, g, t dbSNP:587779317
444 444 a, g dbSNP:587779947
448 448 a, g dbSNP:587782591
449 449 a, g dbSNP:758120391
456 456 c, t dbSNP:587779318
458 458 a, g dbSNP:777770119
460 460 c, g dbSNP:142949377
464 464 -, t dbSNP:730881826
468 468 c, t dbSNP:63750996
472 472 -, g dbSNP:587779319
475 475 a, c dbSNP:587782510
480 480 a, c, t dbSNP:63750019
481 481 a, g dbSNP:542848931
483 483 a, c dbSNP:769962086
489 489 a, c, t dbSNP:377216828
490 490 a, g dbSNP:370157832
492 492 c, t dbSNP:267608066
494 494 a, g dbSNP:774496371
495 495 a, t dbSNP:762168786
500 500 -, t dbSNP:587779320
501 501 -, t dbSNP:63750733
501 501 a, c dbSNP:767828930
503 503 -, a dbSNP:267608041
504 504 a, c, g, t dbSNP:63749980
504 504 -, c dbSNP:587781691
505 505 a, c, g dbSNP:764870249
508 508 g, t dbSNP:752135996
509 509 a, g dbSNP:63750372
511 511 c, t dbSNP:587781275
513 513 a, g dbSNP:554884560
515 515 a, g dbSNP:587779321
516 516 g, t dbSNP:746623981
517 517 c, g dbSNP:267608048
521 521 c, t dbSNP:757143365
524 524 -, tg dbSNP:267608072
534 534 a, g dbSNP:786202565
536 536 -, tgg dbSNP:766451925
556 556 g, t dbSNP:63749890
566 566 c, t dbSNP:780831590
568 568 c, g dbSNP:587779322
571 571 a, t dbSNP:200898010
575 575 -, gga dbSNP:786203409
576 576 g, t dbSNP:63750552
579 579 a, g dbSNP:587779948
580 580 a, g, t dbSNP:769610487
581 581 a, g dbSNP:775693145
583 583 a, g dbSNP:587779949
584 584 c, t dbSNP:768654339
586 586 c, g dbSNP:774586054
593 593 a, c dbSNP:374486449
596 596 a, c dbSNP:368523339
602 602 c, t dbSNP:767974147
604 604 g, t dbSNP:773445382
605 605 -, ac dbSNP:752540976
607 607 -, ggg, t dbSNP:267608062
608 608 c, g dbSNP:573638836
616 616 g, t dbSNP:63750878
623 623 c, t dbSNP:754307139
628 628 aa, gc dbSNP:267608079
628 628 a, c, g dbSNP:368318845
629 629 a, c dbSNP:267608047
631 631 c, t dbSNP:751309721
637 637 g, t dbSNP:587781389
639 639 c, t dbSNP:756935130
645 645 a, g dbSNP:373958499
646 646 a, g, t dbSNP:267608051
654 654 c, t dbSNP:146816935
655 655 a, g dbSNP:765237563
659 659 g, t dbSNP:755878786
660 660 c, t dbSNP:779858670
661 661 a, c, g, t dbSNP:55760494
667 667 a, c, g dbSNP:587781510
671 671 g, t dbSNP:786201688
680 680 a, g dbSNP:748436287
684 684 a, g dbSNP:370174372
688 688 a, c, g, t dbSNP:544222338
689 689 c, t dbSNP:771288794
691 691 c, t dbSNP:777302246
695 695 a, t dbSNP:730881785
700 700 a, g dbSNP:753373644
703 703 a, g dbSNP:760100983
704 704 c, g dbSNP:150440246
706 706 c, g, t dbSNP:63750491
707 707 c, t dbSNP:761581941
709 709 a, g dbSNP:562487553
710 710 a, g dbSNP:750023646
717 717 a, g dbSNP:532920165
718 718 c, t dbSNP:188252826
719 719 a, c, g dbSNP:375210430
720 720 a, c dbSNP:754879198
721 721 c, t dbSNP:779022657
722 722 c, t dbSNP:575325950
726 726 a, g dbSNP:772126419
730 730 c, t dbSNP:777890307
737 737 a, g dbSNP:193922345
739 739 c, t dbSNP:587779323
740 740 a, t dbSNP:747207959
741 741 a, g dbSNP:730881814
742 742 c, g dbSNP:369568820
746 746 c, g, t dbSNP:138143769
750 750 c, t dbSNP:770408023
751 751 a, c dbSNP:786202848
757 757 a, c dbSNP:776080024
760 760 c, t dbSNP:587781983
765 765 a, c dbSNP:761231126
767 767 c, t dbSNP:767011067
769 769 c, g dbSNP:587782102
777 777 c, g dbSNP:772760681
778 778 c, g dbSNP:587780669
781 781 c, t dbSNP:61753793
784 784 c, g dbSNP:766202031
787 787 c, t dbSNP:753617680
790 790 c, g, t dbSNP:548898238
792 792 c, g dbSNP:730881815
797 797 a, t dbSNP:765166082
799 799 c, g, t dbSNP:567785169
805 805 c, t dbSNP:758432113
806 806 a, c dbSNP:587779202
811 811 c, t dbSNP:587782331
812 812 c, t dbSNP:730881802
813 813 c, t dbSNP:587779911
814 814 a, g dbSNP:730881786
815 815 c, t dbSNP:28903083
816 816 a, g dbSNP:730881787
821 821 -, tggag dbSNP:786202336
823 823 g, t dbSNP:730881788
825 825 a, g dbSNP:587778531
829 829 c, g dbSNP:776170146
830 830 c, t dbSNP:749752524
831 831 a, g dbSNP:771529531
834 834 c, g dbSNP:772747395
836 836 c, g dbSNP:760311819
840 840 a, g dbSNP:145994565
841 841 g, t dbSNP:267608060
843 843 c, t dbSNP:587782651
844 844 a, g dbSNP:63750440
847 847 -, c dbSNP:267608056
847 847 c, t dbSNP:759359754
849 849 a, g dbSNP:764965018
855 855 c, t dbSNP:752628520
856 856 c, g dbSNP:587780558
861 861 a, c dbSNP:201193496
863 863 -, t dbSNP:587779203
868 868 c, t dbSNP:375974046
869 869 -, tt dbSNP:786204252
871 871 c, t dbSNP:587779204
875 875 a, g dbSNP:786203202
882 882 -, aag dbSNP:587781660
884 884 a, g dbSNP:786203929
889 889 a, c, g dbSNP:764150912
891 891 -, aagag dbSNP:777907133
891 891 a, c dbSNP:786202609
892 892 a, c dbSNP:550221570
894 894 a, c dbSNP:781572949
895 895 a, g dbSNP:587779205
897 897 -, agaga dbSNP:267608077
901 901 -, atgag dbSNP:587779206
903 903 a, g dbSNP:142111387
906 906 c, t dbSNP:587779207
909 909 a, c dbSNP:780545039
911 911 a, g dbSNP:749800983
913 913 g, t dbSNP:730881789
915 915 -, agg dbSNP:267608043
915 915 a, c, t dbSNP:781652274
921 921 c, g dbSNP:746532720
924 924 c, g dbSNP:770386388
925 925 -, c dbSNP:34013967
925 925 a, c dbSNP:786201185
926 926 c, t dbSNP:55708305
929 929 a, c, t dbSNP:1042819
930 930 a, g dbSNP:147737737
930 930 -, g dbSNP:753796271
932 932 a, c, t dbSNP:55882234
938 938 a, c, t dbSNP:587779912
940 940 c, g dbSNP:764110569
941 941 a, c, t dbSNP:144961390
946 946 c, t dbSNP:767658494
948 948 c, g dbSNP:2020908
950 950 c, g dbSNP:786202626
951 951 -, ta dbSNP:756896277
951 951 c, t dbSNP:587779913
952 952 -, at dbSNP:63750439
952 952 a, g dbSNP:63750065
953 953 c, t dbSNP:786201269
954 954 g, t dbSNP:780350978
955 955 a, t dbSNP:587779208
956 956 a, g dbSNP:148116863
962 962 a, g dbSNP:536884553
968 968 c, t dbSNP:779504190
971 971 c, g dbSNP:748603803
973 973 a, g dbSNP:768740986
976 976 c, g dbSNP:730881790
985 985 c, t dbSNP:767404845
986 986 g, t dbSNP:786203834
993 993 a, t dbSNP:202219685
995 995 a, g dbSNP:554843104
997 997 a, c dbSNP:587781508
1000 1000 a, g dbSNP:786201049
1003 1003 a, g dbSNP:587779914
1007 1007 a, g dbSNP:769418914
1008 1008 -, t dbSNP:778555956
1016 1016 c, g, t dbSNP:576815110
1017 1017 c, g dbSNP:762814792
1019 1019 a, g dbSNP:63750026
1029 1029 c, g dbSNP:587781657
1031 1031 g, t dbSNP:774457540
1032 1032 c, g dbSNP:768299607
1034 1034 c, g dbSNP:63751452
1035 1035 a, g dbSNP:63749971
1037 1037 a, c dbSNP:786203122
1038 1038 -, t dbSNP:587779209
1044 1044 a, g dbSNP:761822293
1046 1046 a, g dbSNP:767746584
1049 1049 a, g dbSNP:576548582
1050 1050 a, g dbSNP:587779915
1052 1052 -, g dbSNP:587782809
1057 1057 gca, tt dbSNP:267608080
1057 1057 c, g, t dbSNP:750528093
1061 1061 a, t dbSNP:267608055
1066 1066 c, t dbSNP:63751405
1067 1067 g, t dbSNP:786203803
1070 1070 c, t dbSNP:761037236
1078 1078 a, g dbSNP:786202363
1087 1087 c, t dbSNP:587779210
1100 1100 a, t dbSNP:587779211
1101 1101 a, c, t dbSNP:369709529
1102 1102 -, g dbSNP:34248409
1104 1104 c, g dbSNP:779123278
1107 1107 c, t dbSNP:3136333
1108 1108 c, t dbSNP:63750741
1109 1109 a, g dbSNP:786201760
1116 1116 a, g dbSNP:780734507
1120 1120 a, g dbSNP:745391760
1126 1126 a, c dbSNP:200938360
1129 1129 a, g dbSNP:587780538
1131 1131 c, g dbSNP:267608052
1138 1138 c, g dbSNP:587782346
1140 1140 c, g dbSNP:748847338
1148 1148 c, t dbSNP:786202869
1152 1152 a, t dbSNP:201892477
1164 1164 c, t dbSNP:369456858
1165 1165 a, g dbSNP:41295268
1168 1168 a, g dbSNP:748165218
1169 1169 a, t dbSNP:587781408
1175 1175 a, t dbSNP:772123097
1183 1183 -, t dbSNP:63750348
1184 1184 -, tg dbSNP:63750854
1187 1187 c, g dbSNP:61754782
1206 1206 a, c, t dbSNP:63750909
1207 1207 a, g dbSNP:773226008
1208 1208 a, g dbSNP:786202132
1209 1209 c, g dbSNP:786204084
1211 1211 c, g, t dbSNP:35590297
1212 1212 c, g dbSNP:587782706
1214 1214 a, g dbSNP:776633437
1219 1219 c, g, t dbSNP:577713548
1224 1224 a, g dbSNP:776959327
1233 1233 -, atg dbSNP:745312505
1234 1234 c, t dbSNP:759643679
1236 1236 -, atg dbSNP:587782576
1236 1236 a, g dbSNP:61754783
1239 1239 g, t dbSNP:267608046
1241 1241 a, g dbSNP:753042580
1242 1242 g, t dbSNP:758699749
1244 1244 a, g dbSNP:786201736
1245 1245 c, t dbSNP:587779212
1249 1249 a, g dbSNP:764593111
1253 1253 a, g dbSNP:752024609
1255 1255 a, g dbSNP:147136417
1260 1260 a, g dbSNP:786204127
1263 1263 c, t dbSNP:779411998
1267 1267 c, t dbSNP:749012012
1270 1270 c, g dbSNP:63750897
1271 1271 c, t dbSNP:545020313
1280 1280 c, t dbSNP:775497704
1284 1284 a, g dbSNP:747971039
1288 1288 c, t dbSNP:63751005
1290 1290 a, g dbSNP:786203486
1293 1293 a, g dbSNP:773303940
1299 1299 a, g dbSNP:746897461
1309 1309 a, t dbSNP:587779213
1316 1316 c, t dbSNP:786201471
1322 1322 c, t dbSNP:762396230
1323 1323 a, t dbSNP:587779916
1324 1324 c, t dbSNP:149159527
1327 1327 a, g dbSNP:63751009
1328 1328 c, g dbSNP:776567082
1329 1329 a, c dbSNP:759857124
1331 1331 g, t dbSNP:587779214
1334 1334 c, g dbSNP:587779215
1336 1336 a, g dbSNP:765387680
1342 1342 -, t dbSNP:63751090
1343 1343 a, g dbSNP:775618855
1346 1346 a, g dbSNP:763342825
1348 1348 a, g, t dbSNP:786201964
1349 1349 g, t dbSNP:764396869
1352 1352 -, t dbSNP:587779216
1353 1353 a, c dbSNP:201721694
1358 1358 -, t dbSNP:587779217
1361 1361 c, g dbSNP:373726731
1364 1364 -, c dbSNP:63751234
1364 1364 c, g dbSNP:763712971
1366 1366 a, g dbSNP:376476188
1368 1368 -, agta dbSNP:771764652
1368 1368 a, g dbSNP:765983691
1369 1369 a, g dbSNP:587782352
1371 1371 a, g dbSNP:753276270
1373 1373 a, g dbSNP:786203776
1375 1375 a, c dbSNP:728619
1376 1376 ag, tc dbSNP:267608049
1376 1376 g, tc dbSNP:587779218
1376 1376 g, t dbSNP:63750870
1380 1380 a, c, g dbSNP:201996928
1383 1383 a, c, g dbSNP:587779778
1385 1385 c, t dbSNP:777678406
1390 1390 -, aa dbSNP:587779219
1394 1394 -, aaaa dbSNP:267608064
1396 1396 -, aaga dbSNP:63749874
1396 1396 -, aa dbSNP:587781398
1398 1398 -, gag dbSNP:779537048
1398 1398 c, g dbSNP:63751172
1399 1399 -, ag dbSNP:267608076
1399 1399 a, g dbSNP:373554374
1408 1408 a, c, g dbSNP:200447622
1412 1412 c, t dbSNP:781124198
1414 1414 a, g dbSNP:587779917
1418 1418 a, t dbSNP:745937181
1421 1421 c, t dbSNP:769828338
1422 1422 c, t dbSNP:775716798
1423 1423 a, g dbSNP:730881791
1427 1427 a, g dbSNP:146785465
1429 1429 a, g, t dbSNP:63751312
1430 1430 c, t dbSNP:730882130
1431 1431 -, g dbSNP:747426620
1435 1435 c, t dbSNP:587782284
1436 1436 a, g dbSNP:762442338
1438 1438 a, g dbSNP:63750595
1439 1439 c, t dbSNP:63749893
1458 1458 a, g dbSNP:63749973
1459 1459 c, g dbSNP:758990693
1460 1460 a, c dbSNP:764818222
1463 1463 c, g dbSNP:752435825
1464 1464 c, g, t dbSNP:758118126
1467 1467 -, tt dbSNP:587783056
1470 1470 a, g dbSNP:61748081
1473 1473 c, g dbSNP:757006198
1475 1475 g, t dbSNP:781019496
1478 1478 g, t dbSNP:745772518
1482 1482 a, t dbSNP:769914244
1491 1491 c, g, t dbSNP:542838372
1492 1492 a, g dbSNP:376220212
1494 1494 c, t dbSNP:768854566
1501 1501 c, t dbSNP:41295270
1502 1502 a, g, t dbSNP:762089407
1508 1508 g, t dbSNP:201518545
1516 1516 c, t dbSNP:587779220
1517 1517 a, g, t dbSNP:761231891
1519 1519 c, t dbSNP:730881792
1525 1525 a, g dbSNP:786202725
1530 1530 -, c dbSNP:768876235
1531 1531 c, t dbSNP:587782635
1532 1532 c, t dbSNP:267608070
1533 1533 c, t dbSNP:267608045
1534 1534 -, c dbSNP:786202108
1535 1535 a, g dbSNP:752239740
1538 1538 a, g, t dbSNP:56132616
1539 1539 c, g dbSNP:751179784
1542 1542 a, g dbSNP:757029447
1546 1546 -, t dbSNP:267608050
1547 1547 a, g dbSNP:767325893
1548 1548 a, t dbSNP:587779918
1549 1549 -, t dbSNP:267608044
1552 1552 -, a dbSNP:587780670
1555 1555 a, g dbSNP:587779919
1556 1556 a, g dbSNP:786201210
1557 1557 c, g dbSNP:756043669
1567 1567 c, g dbSNP:730881816
1568 1568 -, aaag dbSNP:63750735
1575 1575 a, g dbSNP:780167298
1576 1576 c, g dbSNP:587781616
1581 1581 -, a dbSNP:587779221
1582 1582 c, g dbSNP:786201676
1584 1584 a, g dbSNP:201613780
1589 1589 a, g dbSNP:767064953
1592 1592 a, c, g, t dbSNP:201735525
1597 1597 a, c dbSNP:63750564
1598 1598 a, g dbSNP:779035516
1604 1604 -, c dbSNP:730881825
1606 1606 c, g, t dbSNP:730881793
1609 1609 c, g dbSNP:772363120
1611 1611 a, c dbSNP:773619924
1615 1615 a, g dbSNP:747576518
1619 1619 a, c dbSNP:63751121
1626 1626 a, c dbSNP:587778529
1628 1628 a, t dbSNP:1042817
1629 1629 c, g dbSNP:3136334
1630 1630 a, c, t dbSNP:63750462
1631 1631 -, c dbSNP:71539659
1631 1631 c, t dbSNP:141242295
1632 1632 -, g dbSNP:777159874
1633 1633 g, t dbSNP:763606858
1636 1636 c, t dbSNP:773927995
1637 1637 a, c, t dbSNP:63749886
1640 1640 a, g dbSNP:767285340
1643 1643 c, t dbSNP:750208909
1656 1656 a, g dbSNP:755847154
1657 1657 a, c dbSNP:750800736
1662 1662 -, tt dbSNP:587782638
1663 1663 -, tg dbSNP:267608082
1663 1663 a, t dbSNP:63751097
1676 1676 c, t dbSNP:766310490
1677 1677 a, g dbSNP:143517321
1679 1679 a, c, g dbSNP:368059229
1680 1680 -, gaa dbSNP:762299881
1683 1683 -, gaa dbSNP:786203970
1694 1694 c, g dbSNP:34938432
1697 1697 a, g dbSNP:779019430
1699 1699 a, g dbSNP:201096652
1700 1700 a, g dbSNP:758631207
1708 1708 a, t dbSNP:777799551
1712 1712 c, t dbSNP:747380250
1713 1713 a, g dbSNP:536562413
1714 1714 c, t dbSNP:144823143
1715 1715 g, t dbSNP:746352186
1719 1719 c, g dbSNP:768095444
1721 1721 g, t dbSNP:773910090
1722 1722 -, gtga dbSNP:63751167
1723 1723 c, t dbSNP:761433489
1724 1724 a, g dbSNP:148592158
1725 1725 a, t dbSNP:786203468
1736 1736 a, g dbSNP:372916347
1756 1756 a, g dbSNP:786201952
1757 1757 c, g dbSNP:587778532
1758 1758 c, t dbSNP:587779222
1759 1759 c, t dbSNP:760494271
1761 1761 c, g dbSNP:151086192
1766 1766 c, g dbSNP:766113887
1767 1767 a, g dbSNP:753812859
1768 1768 c, t dbSNP:555209664
1770 1770 a, g dbSNP:63749857
1775 1775 a, g dbSNP:765289515
1779 1779 c, g dbSNP:377356882
1787 1787 a, c, g dbSNP:587779223
1789 1789 a, g dbSNP:143643688
1792 1792 c, g dbSNP:587779224
1794 1794 c, g dbSNP:751778243
1797 1797 c, t dbSNP:757741943
1798 1798 c, t dbSNP:781668793
1802 1802 c, t dbSNP:746448428
1805 1805 c, t dbSNP:770323844
1807 1807 -, ct dbSNP:267608057
1807 1807 c, g, t dbSNP:587779225
1808 1808 c, t dbSNP:755329012
1810 1810 c, t dbSNP:747699430
1812 1812 c, g dbSNP:771445440
1813 1813 -, ct dbSNP:587779226
1814 1814 a, g dbSNP:772874585
1816 1816 c, g dbSNP:63750358
1817 1817 c, t dbSNP:760299985
1819 1819 a, g dbSNP:587779227
1820 1820 c, t dbSNP:770778638
1823 1823 a, t dbSNP:267608068
1824 1824 -, gt dbSNP:63750075
1831 1831 a, c, t dbSNP:730881794
1832 1832 c, t dbSNP:559125434
1833 1833 c, t dbSNP:765224443
1836 1836 a, c dbSNP:752532578
1841 1841 -, a dbSNP:267608083
1842 1842 c, t dbSNP:587779228
1849 1849 c, t dbSNP:587779229
1854 1854 a, c, g dbSNP:63750832
1860 1860 c, t dbSNP:587779230
1865 1865 a, g dbSNP:764244124
1867 1867 c, g, t dbSNP:63751419
1869 1869 a, g dbSNP:751867550
1873 1873 c, g dbSNP:370237509
1879 1879 c, t dbSNP:587779231
1886 1886 a, g dbSNP:781730324
1887 1887 -, t dbSNP:587781650
1889 1889 a, t dbSNP:587779232
1891 1891 c, t dbSNP:750817344
1896 1896 c, t dbSNP:780570825
1897 1897 c, t dbSNP:371414784
1900 1900 a, g dbSNP:730881795
1903 1903 c, g, t dbSNP:730881796
1904 1904 c, t dbSNP:786201606
1906 1906 -, ac dbSNP:786204048
1908 1908 a, g dbSNP:749711246
1909 1909 -, cagt dbSNP:587782275
1909 1909 c, t dbSNP:587782805
1912 1912 -, tcag dbSNP:267608058
1916 1916 c, t dbSNP:771662801
1918 1918 c, t dbSNP:373418713
1921 1921 c, t dbSNP:185531778
1923 1923 a, g dbSNP:537604099
1925 1925 a, t dbSNP:770584242
1927 1927 -, ctggtgctatcttcaccaaag dbSNP:63749941
1927 1927 a, c dbSNP:776198410
1930 1930 c, g dbSNP:759403696
1931 1931 c, t dbSNP:769422122
1933 1933 c, g, t dbSNP:587779922
1935 1935 a, g dbSNP:148898662
1937 1937 c, g dbSNP:63750304
1938 1938 ag, tt dbSNP:63750136
1939 1939 a, t dbSNP:574358605
1941 1941 a, g dbSNP:761930694
1942 1942 a, c, g dbSNP:767861096
1945 1945 a, c, g dbSNP:35552856
1949 1949 a, c, t dbSNP:375610656
1951 1951 a, g dbSNP:587782900
1953 1953 c, t dbSNP:63751442
1956 1956 a, c, t dbSNP:63751127
1957 1957 a, c, g dbSNP:749746725
1962 1962 a, g dbSNP:587780671
1965 1965 a, c dbSNP:786204071
1973 1973 a, g dbSNP:780916013
1981 1981 a, t dbSNP:745483465
1985 1985 c, t dbSNP:769668640
1988 1988 c, g dbSNP:587781739
1989 1989 c, t dbSNP:749308906
1990 1990 -, g dbSNP:773290953
1992 1992 -, g dbSNP:786201050
1995 1995 a, g dbSNP:768731337
1997 1997 g, t dbSNP:556339046
2001 2001 c, t dbSNP:63751305
2003 2003 a, g dbSNP:377722465
2011 2011 a, c dbSNP:730881817
2015 2015 c, t dbSNP:2020913
2018 2018 c, t dbSNP:786202129
2020 2020 -, cta dbSNP:762872662
2022 2022 a, c dbSNP:545057945
2024 2024 a, c, t dbSNP:553076837
2030 2030 a, c, g dbSNP:142246608
2033 2033 c, g, t dbSNP:142172006
2034 2034 c, t dbSNP:56371757
2043 2043 a, g dbSNP:199876321
2044 2044 a, c, g dbSNP:587779233
2051 2051 c, t dbSNP:137946937
2053 2053 a, c, t dbSNP:561198849
2057 2057 c, g, t dbSNP:63750985
2060 2060 g, t dbSNP:768535330
2061 2061 a, t dbSNP:774452933
2062 2062 c, g, t dbSNP:587781462
2064 2064 -, cct dbSNP:63750647
2064 2064 c, g dbSNP:35946687
2065 2065 a, c dbSNP:773162893
2071 2071 a, g dbSNP:587781478
2076 2076 a, c, t dbSNP:63750138
2077 2077 a, g dbSNP:63750725
2081 2081 a, c, t dbSNP:63749895
2085 2085 a, c dbSNP:759915781
2091 2091 a, t dbSNP:267608067
2092 2092 a, g dbSNP:587779234
2101 2101 c, g, t dbSNP:63749899
2103 2103 a, c, t dbSNP:587779235
2108 2108 c, t dbSNP:753238686
2109 2109 a, t dbSNP:373721483
2110 2110 -, gt dbSNP:267608065
2118 2118 c, t dbSNP:773193199
2122 2122 c, t dbSNP:63750637
2124 2124 a, g dbSNP:587778530
2133 2133 c, t dbSNP:749918474
2134 2134 a, g dbSNP:755587950
2135 2135 c, t dbSNP:543201797
2137 2137 c, t dbSNP:587779236
2141 2141 -, tg dbSNP:587779237
2146 2146 c, t dbSNP:202127474
2149 2149 a, g dbSNP:532445704
2151 2151 -, g dbSNP:63751095
2153 2153 c, t dbSNP:754870044
2154 2154 c, g dbSNP:587779238
2160 2160 a, c, g dbSNP:61748083
2161 2161 c, t dbSNP:63750895
2162 2162 c, t dbSNP:267608071
2170 2170 a, g dbSNP:63751450
2174 2174 a, g dbSNP:201460265
2179 2179 c, g dbSNP:372990379
2180 2180 c, t dbSNP:770992427
2181 2181 a, c, g dbSNP:587779923
2186 2186 g, t dbSNP:770208363
2187 2187 -, g dbSNP:63751053
2188 2188 -, tag dbSNP:587779240
2188 2188 -, ttaatgtc dbSNP:766653592
2188 2188 c, t dbSNP:775815297
2190 2190 c, g dbSNP:763248984
2191 2191 a, t dbSNP:764516652
2205 2205 a, c, t dbSNP:377411318
2206 2206 g, t dbSNP:760129709
2214 2214 c, g dbSNP:786203612
2229 2229 a, g dbSNP:267608032
2238 2238 c, g dbSNP:765891603
2243 2243 c, t dbSNP:753585861
2244 2244 a, g dbSNP:587781349
2245 2245 c, t dbSNP:754675891
2253 2253 c, g dbSNP:267608053
2255 2255 c, t dbSNP:778911612
2263 2263 a, g dbSNP:752544046
2265 2265 c, t dbSNP:63751321
2270 2270 c, t dbSNP:758170249
2271 2271 c, t dbSNP:777593472
2273 2273 c, g dbSNP:587779925
2275 2275 c, t dbSNP:770952730
2282 2282 c, t dbSNP:781241667
2286 2286 c, g dbSNP:746143003
2288 2288 g, t dbSNP:772394197
2294 2294 a, g dbSNP:786201873
2297 2297 -, t dbSNP:587779241
2301 2301 a, g dbSNP:775625082
2302 2302 a, g dbSNP:749648487
2309 2309 a, g dbSNP:769018957
2311 2311 a, g dbSNP:63750389
2312 2312 a, c, t dbSNP:374230313
2313 2313 a, g dbSNP:762352116
2316 2316 -, aag dbSNP:751683437
2321 2321 a, g dbSNP:765873566
2323 2323 -, aga dbSNP:587782858
2323 2323 ag, tt dbSNP:587780673
2323 2323 a, t dbSNP:34374438
2324 2324 g, t dbSNP:759048538
2326 2326 -, t dbSNP:760558287
2328 2328 a, t dbSNP:765012437
2331 2331 -, gatt dbSNP:587779243
2331 2331 a, g dbSNP:368437140
2332 2332 a, g dbSNP:758176077
2341 2341 c, t dbSNP:370412074
2342 2342 c, t dbSNP:751515279
2353 2353 a, g dbSNP:587781306
2357 2357 a, c dbSNP:757202837
2359 2359 a, c dbSNP:190075874
2361 2361 a, g dbSNP:745954217
2362 2362 g, t dbSNP:139598980
2365 2365 c, t dbSNP:780280765
2366 2366 a, g dbSNP:749508276
2367 2367 c, t dbSNP:768941857
2376 2376 -, atta dbSNP:63750357
2386 2386 c, t dbSNP:774774596
2390 2390 a, g dbSNP:748663356
2391 2391 a, g dbSNP:730881797
2395 2395 c, g, t dbSNP:2020912
2402 2402 a, c, t dbSNP:371399245
2403 2403 aaaa, g dbSNP:63751408
2410 2410 a, c dbSNP:764816440
2413 2413 c, g dbSNP:561217424
2415 2415 a, t dbSNP:587782593
2418 2418 a, g dbSNP:2020914
2420 2420 c, t dbSNP:786201051
2423 2423 g, t dbSNP:267608069
2426 2426 c, g dbSNP:730881798
2428 2428 a, c dbSNP:377542011
2429 2429 g, t dbSNP:149945495
2430 2430 c, g dbSNP:786202628
2433 2433 a, g dbSNP:756933423
2434 2434 c, tct dbSNP:587779244
2435 2435 c, g, t dbSNP:146006741
2436 2436 -, t dbSNP:63750982
2439 2439 c, g, t dbSNP:370754319
2444 2444 a, g dbSNP:756239543
2446 2446 c, g dbSNP:780081278
2447 2447 a, t dbSNP:749539614
2452 2452 a, g dbSNP:755215367
2456 2456 c, t dbSNP:769668106
2457 2457 a, g dbSNP:748574765
2462 2462 a, t dbSNP:1042816
2463 2463 a, c, t dbSNP:772514245
2464 2464 a, g dbSNP:63749889
2468 2468 c, t dbSNP:778472296
2474 2474 g, t dbSNP:374401174
2475 2475 a, t dbSNP:747486855
2476 2476 a, t dbSNP:587779245
2481 2481 -, gt dbSNP:63750904
2482 2482 c, t dbSNP:201936512
2483 2483 a, g dbSNP:775048480
2486 2486 a, g dbSNP:35389622
2489 2489 c, g dbSNP:768356593
2492 2492 c, t dbSNP:773837927
2493 2493 c, t dbSNP:63751017
2494 2494 a, g, t dbSNP:761622304
2500 2500 a, g dbSNP:750404946
2501 2501 c, t dbSNP:63750056
2504 2504 a, g dbSNP:760602367
2506 2506 a, c dbSNP:766427609
2513 2513 c, g dbSNP:753967199
2515 2515 a, g dbSNP:754948438
2526 2526 c, t dbSNP:587779246
2527 2527 a, g dbSNP:752839086
2527 2527 -, g dbSNP:587779247
2530 2530 -, a dbSNP:267608063
2532 2532 a, t dbSNP:758873844
2537 2537 a, c, g dbSNP:587779248
2538 2538 c, t dbSNP:587781318
2540 2540 -, a dbSNP:763978082
2541 2541 -, a dbSNP:587782277
2542 2542 c, t dbSNP:587779926
2543 2543 a, t dbSNP:771575217
2545 2545 a, c, t dbSNP:781482454
2549 2549 c, g dbSNP:768005323
2557 2557 a, g dbSNP:786203914
2558 2558 a, c dbSNP:774105284
2561 2561 c, t dbSNP:761427866
2570 2570 g, t dbSNP:771925410
2577 2577 c, t dbSNP:63750140
2580 2580 g, t dbSNP:772978164
2585 2585 -, tgc dbSNP:63750025
2587 2587 -, ctg dbSNP:587779249
2587 2587 a, c dbSNP:760406178
2589 2589 g, t dbSNP:143520357
2594 2594 -, aa dbSNP:730881827
2612 2612 c, t dbSNP:571394629
2613 2613 -, ctcctgga dbSNP:63750940
2613 2613 c, t dbSNP:759708484
2617 2617 c, t dbSNP:587781743
2619 2619 a, g dbSNP:753034685
2627 2627 a, g dbSNP:758675720
2633 2633 a, g dbSNP:778079788
2637 2637 c, t dbSNP:751973865
2638 2638 a, g dbSNP:757653982
2639 2639 c, t dbSNP:781734958
2641 2641 a, g dbSNP:746341645
2644 2644 c, g, t dbSNP:587781458
2647 2647 c, t dbSNP:778287080
2648 2648 g, t dbSNP:747856982
2651 2651 c, t dbSNP:771726914
2660 2660 c, t dbSNP:772786755
2665 2665 g, t dbSNP:746839832
2666 2666 c, g dbSNP:150683226
2668 2668 -, at dbSNP:786203924
2668 2668 a, c, g, t dbSNP:63749919
2672 2672 c, g dbSNP:765411990
2682 2682 a, g dbSNP:775407589
2687 2687 c, t dbSNP:139026662
2688 2688 c, t dbSNP:587782386
2689 2689 a, g dbSNP:63751113
2690 2690 c, t dbSNP:764440377
2693 2693 c, g dbSNP:63750111
2694 2694 c, t dbSNP:587781372
2696 2696 a, g dbSNP:751780309
2699 2699 g, t dbSNP:757691799
2702 2702 a, g dbSNP:730881818
2703 2703 a, g dbSNP:730881799
2707 2707 -, c dbSNP:587779250
2708 2708 g, t dbSNP:751006944
2709 2709 a, g dbSNP:538761360
2711 2711 c, g dbSNP:780485157
2712 2712 a, c dbSNP:146359682
2713 2713 a, c dbSNP:587779927
2717 2717 c, g dbSNP:63750942
2720 2720 a, c, t dbSNP:757866392
2721 2721 a, g dbSNP:746631156
2722 2722 c, t dbSNP:587779928
2724 2724 c, t dbSNP:61753795
2725 2725 a, c, g, t dbSNP:115386788
2726 2726 -, c dbSNP:587781659
2726 2726 a, c, t dbSNP:144288981
2728 2728 a, g dbSNP:763146296
2733 2733 c, g dbSNP:764249869
2734 2734 c, t dbSNP:375966384
2736 2736 a, g dbSNP:774755404
2738 2738 -, a dbSNP:587779251
2738 2738 a, g, t dbSNP:761938225
2741 2741 a, g dbSNP:370462886
2742 2742 c, t dbSNP:373622047
2744 2744 c, t dbSNP:367758473
2745 2745 g, t dbSNP:63750258
2746 2746 -, a dbSNP:63749938
2747 2747 a, g dbSNP:754296496
2752 2752 a, g dbSNP:587780674
2754 2754 a, t dbSNP:730881800
2757 2757 a, g dbSNP:777257986
2759 2759 c, t dbSNP:751279827
2762 2762 g, t dbSNP:756868452
2766 2766 a, g dbSNP:587782491
2775 2775 c, t dbSNP:63750563
2776 2776 a, g dbSNP:587782324
2782 2782 a, g dbSNP:587779252
2782 2782 -, g dbSNP:587782862
2783 2783 c, g dbSNP:587779253
2786 2786 c, t dbSNP:587780675
2787 2787 a, g dbSNP:780187287
2788 2788 a, t dbSNP:587781593
2790 2790 -, actat dbSNP:63750369
2791 2791 c, t dbSNP:768925694
2799 2799 -, aagaa dbSNP:587782712
2799 2799 -, aag dbSNP:753885956
2800 2800 a, c dbSNP:200837944
2802 2802 -, aag dbSNP:267608073
2803 2803 -, gtt dbSNP:757275909
2803 2803 a, g dbSNP:774560892
2807 2807 c, g dbSNP:761894928
2809 2809 c, t dbSNP:587779929
2814 2814 -, ct dbSNP:63751407
2815 2815 -, tc dbSNP:587776704
2816 2816 a, c dbSNP:772191770
2824 2824 a, c, g dbSNP:63750287
2825 2825 g, t dbSNP:760972942
2828 2828 a, g dbSNP:766709747
2829 2829 g, t dbSNP:267608059
2832 2832 c, t dbSNP:370505117
2833 2833 a, g dbSNP:372705506
2838 2838 g, t dbSNP:267608054
2843 2843 a, g dbSNP:760019920
2846 2846 a, t dbSNP:786201843
2849 2849 c, g dbSNP:765671474
2854 2854 a, t dbSNP:63750804
2860 2860 g, t dbSNP:751035257
2862 2862 c, g, t dbSNP:587779930
2863 2863 a, c, g dbSNP:181727939
2865 2865 c, t dbSNP:63749999
2866 2866 a, c, g, t dbSNP:730881801
2869 2869 a, t dbSNP:748211741
2873 2873 a, c, g dbSNP:587781673
2875 2875 a, g dbSNP:773357672
2881 2881 -, tt dbSNP:267608042
2899 2899 a, g dbSNP:587779931
2904 2904 c, g, t dbSNP:200492211
2909 2909 a, t dbSNP:771340595
2912 2912 c, t dbSNP:776990271
2913 2913 a, g dbSNP:576269342
2916 2916 a, g dbSNP:765763906
2917 2917 -, ag dbSNP:63750833
2917 2917 a, g dbSNP:587781568
2918 2918 a, g dbSNP:761277966
2921 2921 c, t dbSNP:767021188
2922 2922 a, g, t dbSNP:267608075
2924 2924 c, g, t dbSNP:149605979
2925 2925 a, c, g dbSNP:587779254
2932 2932 c, t dbSNP:778741297
2938 2938 c, t dbSNP:182292083
2939 2939 c, t dbSNP:770547131
2944 2944 -, t dbSNP:63750196
2945 2945 g, t dbSNP:786203197
2952 2952 a, g dbSNP:587782492
2953 2953 c, t dbSNP:369042519
2957 2957 -, ctat dbSNP:267608085
2957 2957 -, c dbSNP:63750714
2957 2957 c, g dbSNP:759260316
2959 2959 a, g dbSNP:372103816
2960 2960 -, ta dbSNP:587781870
2960 2960 c, t dbSNP:199643502
2961 2961 -, ta dbSNP:63749821
2962 2962 c, g dbSNP:730881803
2964 2964 c, g, t dbSNP:63749843
2965 2965 a, c, g dbSNP:398123230
2967 2967 c, g dbSNP:764113705
2968 2968 a, g dbSNP:63750784
2969 2969 g, t dbSNP:267608074
2970 2970 g, t dbSNP:587782194
2971 2971 a, g dbSNP:751475855
2975 2975 c, t dbSNP:534232216
2977 2977 g, t dbSNP:781243845
2979 2979 c, g, t dbSNP:142254875
2980 2980 c, g dbSNP:587779257
2982 2982 a, g dbSNP:730881804
2983 2983 -, t dbSNP:267608090
2988 2988 c, g, t dbSNP:63750617
2989 2989 a, g dbSNP:779617676
2990 2990 c, t dbSNP:786203698
2994 2994 c, g dbSNP:587779932
2995 2995 c, t dbSNP:376452612
2997 2997 a, c dbSNP:587779933
3001 3001 g, t dbSNP:770635149
3003 3003 c, t dbSNP:776291404
3006 3006 c, t dbSNP:186240214
3007 3007 c, t dbSNP:191109849
3009 3009 c, g dbSNP:763844573
3015 3015 -, c, cc dbSNP:748452299
3015 3015 a, t dbSNP:751563328
3016 3016 -, c dbSNP:587782425
3016 3016 -, c dbSNP:770288143
3016 3016 c, g dbSNP:761724581
3017 3017 c, g, t dbSNP:371568610
3018 3018 c, g dbSNP:756108143
3019 3019 a, c, g dbSNP:780345806
3021 3021 -, t dbSNP:587779258
3021 3021 a, c, g, t dbSNP:63750998
3022 3022 a, c, g, t dbSNP:63750753
3023 3023 -, c, cc dbSNP:267608087
3023 3023 -, c dbSNP:267608078
3023 3023 c, g, t dbSNP:370226185
3025 3025 -, t dbSNP:267608091
3025 3025 g, t dbSNP:775248712
3026 3026 c, t dbSNP:35621414
3027 3027 c, t dbSNP:34490141
3029 3029 -, c dbSNP:786203712
3030 3030 -, gagctta dbSNP:587779259
3030 3030 a, g dbSNP:143477948
3035 3035 -, t dbSNP:267608095
3043 3043 c, t dbSNP:774147100
3044 3044 a, t dbSNP:372996269
3045 3045 c, t dbSNP:376243329
3046 3046 a, g dbSNP:63750253
3047 3047 c, t dbSNP:786201168
3049 3049 a, g dbSNP:760861610
3056 3056 c, t dbSNP:766341781
3061 3061 c, g, t dbSNP:63750442
3062 3062 a, c, g dbSNP:540252208
3065 3065 g, t dbSNP:370353868
3066 3066 a, c dbSNP:758782048
3068 3068 a, t dbSNP:2020910
3069 3069 -, t dbSNP:587778533
3073 3073 -, tt dbSNP:267608092
3074 3074 -, t dbSNP:587781924
3074 3074 a, t dbSNP:747441460
3074 3074 -, t dbSNP:267608093
3075 3075 a, g dbSNP:755716475
3081 3081 a, g dbSNP:779415187
3082 3082 -, a dbSNP:63750377
3086 3086 -, t dbSNP:267608088
3090 3090 a, c, t dbSNP:374070511
3092 3092 -, aatg dbSNP:587782562
3096 3096 a, g dbSNP:773955368
3100 3100 c, t dbSNP:41295272
3101 3101 g, t dbSNP:786202044
3103 3103 -, c dbSNP:587779260
3106 3106 c, t dbSNP:747959862
3110 3110 c, t dbSNP:771833309
3111 3111 c, t dbSNP:786202829
3112 3112 g, t dbSNP:773245315
3114 3114 a, g dbSNP:760530339
3116 3116 a, g dbSNP:35642130
3117 3117 g, t dbSNP:267608084
3122 3122 a, g dbSNP:146737457
3123 3123 a, g dbSNP:587781609
3124 3124 a, g dbSNP:776589986
3125 3125 c, g dbSNP:377226210
3129 3129 g, t dbSNP:267608086
3137 3137 c, g dbSNP:765577023
3139 3139 a, c dbSNP:766608409
3143 3143 c, g dbSNP:786202480
3145 3145 a, g, t dbSNP:587779261
3146 3146 c, t dbSNP:544518097
3148 3148 -, gtg dbSNP:587776705
3150 3150 a, g dbSNP:752164796
3155 3155 g, t dbSNP:757716138
3156 3156 c, g dbSNP:781676597
3160 3160 c, t dbSNP:730881805
3161 3161 c, t dbSNP:61748084
3177 3177 a, g dbSNP:63751063
3178 3178 -, g dbSNP:786201052
3178 3178 -, g dbSNP:587781544
3181 3181 a, g dbSNP:63750969
3182 3182 a, g dbSNP:754435507
3187 3187 c, t dbSNP:267608089
3188 3188 a, g dbSNP:747771350
3191 3191 c, t dbSNP:562766087
3192 3192 a, c dbSNP:771925339
3198 3198 c, t dbSNP:63750356
3199 3199 a, c dbSNP:587779262
3201 3201 a, g dbSNP:770054790
3204 3204 a, c, g dbSNP:63750257
3205 3205 c, g dbSNP:763058648
3208 3208 a, t dbSNP:768792513
3210 3210 c, t dbSNP:774584492
3212 3212 a, c dbSNP:762134820
3214 3214 c, g dbSNP:587782625
3218 3218 a, g dbSNP:750998416
3220 3220 c, t dbSNP:761160431
3223 3223 a, c dbSNP:786202842
3226 3226 -, ag dbSNP:757961815
3227 3227 c, g dbSNP:766817979
3231 3231 a, g, t dbSNP:587779264
3232 3232 c, g dbSNP:752212361
3234 3234 c, t dbSNP:63750157
3235 3235 -, gtt dbSNP:587779265
3238 3238 -, a dbSNP:587782111
3239 3239 a, c, t dbSNP:398123231
3240 3240 a, c, g, t dbSNP:376799914
3242 3242 a, c dbSNP:786201385
3243 3243 c, g dbSNP:751190199
3245 3245 c, t dbSNP:757064383
3246 3246 c, g dbSNP:587779266
3247 3247 -, ctg dbSNP:587781271
3247 3247 a, c dbSNP:587779935
3248 3248 g, t dbSNP:781119463
3249 3249 -, ctg dbSNP:63751427
3249 3249 g, t dbSNP:587779267
3250 3250 a, t dbSNP:63750252
3251 3251 -, ctg dbSNP:63750359
3251 3251 a, c, t dbSNP:531674673
3257 3257 c, t dbSNP:780099145
3273 3273 gataga, t dbSNP:63751198
3273 3273 -, ga dbSNP:63751410
3275 3275 -, a, ta dbSNP:63750194
3275 3275 c, t dbSNP:63749834
3276 3276 -, a dbSNP:63751327
3278 3278 -, agtgtttactag dbSNP:63749952
3278 3278 -, agtg dbSNP:267608099
3278 3278 -, ag dbSNP:398123232
3279 3279 -, gtgtttactaga dbSNP:587779268
3279 3279 a, g dbSNP:730881806
3281 3281 -, a dbSNP:63750296
3284 3284 -, gttt dbSNP:267608101
3284 3284 c, t dbSNP:768759155
3286 3286 -, ac dbSNP:730881828
3286 3286 c, g, t dbSNP:369583604
3288 3288 a, c dbSNP:786203968
3291 3291 c, g dbSNP:748398941
3295 3295 a, g dbSNP:772380953
3298 3298 a, c dbSNP:773583312
3299 3299 c, g dbSNP:200120044
3301 3301 c, g dbSNP:766905993
3302 3302 a, c dbSNP:777096746
3303 3303 a, g dbSNP:762406364
3305 3305 c, g dbSNP:267608100
3308 3308 -, aat dbSNP:751279985
3313 3313 c, t dbSNP:751225252
3315 3315 g, t dbSNP:786202777
3319 3319 a, g dbSNP:587781690
3320 3320 -, tgaaagta dbSNP:267608108
3320 3320 g, t dbSNP:756014227
3322 3322 a, g dbSNP:150632241
3325 3325 a, g dbSNP:587779272
3327 3327 -, agta dbSNP:786203331
3327 3327 a, g dbSNP:753778809
3329 3329 a, g dbSNP:754959739
3330 3330 c, t dbSNP:778651272
3333 3333 c, t dbSNP:752857771
3337 3337 -, tgaa dbSNP:773262801
3339 3339 a, g dbSNP:63751328
3343 3343 -, t dbSNP:267608107
3346 3346 c, g dbSNP:758428552
3348 3348 a, c, g dbSNP:75095286
3351 3351 a, g dbSNP:531169741
3353 3353 c, t dbSNP:771340721
3358 3358 c, g dbSNP:773185557
3360 3360 a, g dbSNP:781627838
3362 3362 a, g, t dbSNP:587781482
3363 3363 c, g, t dbSNP:182024561
3365 3365 c, t dbSNP:761458936
3366 3366 a, g dbSNP:369778514
3367 3367 c, t dbSNP:587779273
3369 3369 -, catg dbSNP:267608040
3371 3371 -, tgca dbSNP:587779274
3376 3376 c, t dbSNP:587779275
3379 3379 c, g dbSNP:773068287
3380 3380 a, g dbSNP:786202172
3381 3381 c, g dbSNP:760391254
3383 3383 g, t dbSNP:766075233
3387 3387 c, t dbSNP:753675331
3390 3390 c, g dbSNP:759216143
3393 3393 -, t dbSNP:762783821
3395 3395 -, t dbSNP:587776706
3395 3395 c, t dbSNP:778650240
3397 3397 -, t dbSNP:63750731
3403 3403 a, c dbSNP:63750914
3404 3404 a, g dbSNP:765247025
3407 3407 a, g dbSNP:267608113
3409 3409 g, t dbSNP:770329467
3411 3411 a, g dbSNP:587780677
3412 3412 a, g dbSNP:63749898
3414 3414 a, g dbSNP:776407427
3418 3418 a, c, t dbSNP:63750949
3419 3419 c, t dbSNP:745491567
3420 3420 a, g dbSNP:769427505
3421 3421 -, aaca dbSNP:752404604
3426 3426 g, t dbSNP:775265464
3436 3436 a, c, t dbSNP:63750370
3437 3437 a, g dbSNP:730881820
3441 3441 a, t dbSNP:587779282
3444 3444 c, g dbSNP:587779283
3447 3447 a, c dbSNP:774249402
3448 3448 a, g dbSNP:730881807
3451 3451 c, g, t dbSNP:587782117
3452 3452 -, a dbSNP:730881829
3452 3452 a, t dbSNP:370947877
3453 3453 -, gtt dbSNP:760332863
3456 3456 -, gtt dbSNP:587779284
3456 3456 c, g dbSNP:41295276
3457 3457 a, t dbSNP:786202887
3459 3459 -, aaag dbSNP:267608115
3460 3460 a, c dbSNP:766557450
3461 3461 -, agaa dbSNP:193922343
3462 3462 c, g dbSNP:35717727
3467 3467 c, t dbSNP:545552712
3468 3468 -, aatagcaaatgcagttgttaaagaacttg dbSNP:63750523
3473 3473 a, c, g dbSNP:754289472
3475 3475 c, g dbSNP:755349360
3476 3476 g, t dbSNP:779615974
3478 3478 c, t dbSNP:786203816
3482 3482 a, g dbSNP:786203260
3484 3484 -, gtc dbSNP:587781362
3486 3486 -, cgt dbSNP:63749942
3486 3486 a, c dbSNP:587779285
3487 3487 -, gtacattattttc dbSNP:587779287
3487 3487 -, gta dbSNP:587779286
3487 3487 a, g, t dbSNP:63750119
3489 3489 a, g, t dbSNP:147453999
3491 3491 a, g dbSNP:773807182
3494 3494 -, atta dbSNP:587779288
3501 3501 a, g dbSNP:769360577
3502 3502 c, g dbSNP:786204182
3504 3504 c, g, t dbSNP:63750882
3505 3505 -, t dbSNP:786201084
3511 3511 -, acca dbSNP:587779936
3511 3511 a, g dbSNP:749129928
3514 3514 -, atta dbSNP:754183111
3519 3519 -, a dbSNP:587779289
3519 3519 c, g dbSNP:187491488
3520 3520 -, aga dbSNP:779334383
3520 3520 a, c, t dbSNP:202066386
3521 3521 -, aga dbSNP:757589867
3524 3524 -, aga dbSNP:587779937
3524 3524 a, t dbSNP:375459388
3529 3529 a, c dbSNP:761643896
3530 3530 g, t dbSNP:63751058
3534 3534 c, g, t dbSNP:63750554
3540 3540 a, g dbSNP:63750673
3544 3544 c, t dbSNP:773171352
3546 3546 c, g dbSNP:587779290
3548 3548 a, g dbSNP:760771483
3549 3549 c, t dbSNP:367912290
3550 3550 a, g dbSNP:147852216
3552 3552 c, t dbSNP:786202696
3554 3554 a, g dbSNP:786202051
3555 3555 a, g dbSNP:754469538
3557 3557 a, g dbSNP:786202166
3559 3559 a, t dbSNP:760023025
3561 3561 -, at dbSNP:267608114
3562 3562 c, t dbSNP:148445930
3565 3565 a, c dbSNP:587779293
3566 3566 -, a dbSNP:267608118
3569 3569 c, t dbSNP:747924946
3570 3570 a, g dbSNP:757963162
3571 3571 a, c, t dbSNP:777617756
3573 3573 c, g dbSNP:770929545
3580 3580 a, g dbSNP:201830316
3581 3581 g, t dbSNP:759642651
3582 3582 a, g dbSNP:587779294
3586 3586 -, aatg dbSNP:63750262
3586 3586 a, g dbSNP:150990541
3593 3593 c, t dbSNP:775752224
3594 3594 a, c dbSNP:587782109
3595 3595 c, g, t dbSNP:201191389
3600 3600 c, t dbSNP:63750139
3602 3602 -, ggagact dbSNP:63751319
3606 3606 a, c dbSNP:764507968
3607 3607 -, tat dbSNP:760500213
3609 3609 a, g dbSNP:144714869
3612 3612 -, atta dbSNP:267608128
3613 3613 c, t dbSNP:63750836
3614 3614 a, g, t dbSNP:2229018
3619 3619 c, t dbSNP:754443325
3640 3640 c, g dbSNP:764835191
3641 3641 c, t dbSNP:752369374
3646 3646 c, t dbSNP:758181932
3648 3648 a, c, g dbSNP:575714670
3649 3649 -, aaagcta dbSNP:267608130
3655 3655 a, g dbSNP:786202520
3669 3669 a, g dbSNP:63751064
3670 3670 c, g dbSNP:201060668
3671 3671 a, g dbSNP:757286252
3673 3673 a, g dbSNP:34625968
3674 3674 g, t dbSNP:786202333
3680 3680 -, t dbSNP:587779295
3681 3681 a, c, g dbSNP:730881808
3686 3686 c, t dbSNP:769973928
3689 3689 -, atctccca dbSNP:587779296
3692 3692 -, gaa dbSNP:774984690
3692 3692 c, g dbSNP:267608129
3693 3693 a, g dbSNP:749522534
3695 3695 a, c, g dbSNP:143331529
3697 3697 -, aagt dbSNP:267608127
3698 3698 c, t dbSNP:61753796
3699 3699 -, t dbSNP:760190301
3700 3700 -, tcaaaagggacatagaaaa dbSNP:763673818
3700 3700 c, t dbSNP:762115705
3702 3702 -, tc dbSNP:730881830
3703 3703 -, ttca dbSNP:267608126
3704 3704 a, g dbSNP:768042560
3708 3708 c, g dbSNP:773675555
3710 3710 a, t dbSNP:786202126
3711 3711 c, g dbSNP:759092293
3713 3713 c, g, t dbSNP:764786814
3718 3718 -, aagc dbSNP:267608119
3719 3719 -, tcaaaagggacatagaaaa dbSNP:63750767
3720 3720 -, gcaa dbSNP:267608123
3720 3720 g, t dbSNP:376300764
3721 3721 -, caag dbSNP:267608120
3722 3722 a, g dbSNP:373425206
3723 3723 a, g dbSNP:41295278
3725 3725 a, t dbSNP:267608125
3727 3727 a, t dbSNP:763608368
3731 3731 -, tgagaagatga dbSNP:587779299
3732 3732 c, g dbSNP:540890590
3734 3734 c, g dbSNP:587779938
3736 3736 -, aga dbSNP:587779300
3738 3738 a, c, t dbSNP:587779939
3739 3739 c, t dbSNP:757089977
3740 3740 -, aatc dbSNP:786204180
3740 3740 a, c, g dbSNP:141464646
3741 3741 -, a dbSNP:587782326
3741 3741 a, c dbSNP:756216566
3742 3742 -, tcag dbSNP:751033488
3742 3742 a, g dbSNP:780187989
3745 3745 -, atca dbSNP:786201855
3745 3745 a, g dbSNP:587779940
3746 3746 -, atca dbSNP:267608124
3748 3748 c, t dbSNP:199594809
3749 3749 -, gtca dbSNP:267608121
3750 3750 c, t dbSNP:768944975
3751 3751 g, t dbSNP:774395829
3753 3753 c, t dbSNP:267608094
3754 3754 g, t dbSNP:184131049
3755 3755 a, g dbSNP:772401158
3756 3756 a, t dbSNP:786204160
3762 3762 -, atttc dbSNP:587779301
3762 3762 c, t dbSNP:773763465
3763 3763 a, g dbSNP:267608122
3766 3766 a, c dbSNP:564434147
3767 3767 a, c dbSNP:786204130
3768 3768 a, g dbSNP:771181616
3771 3771 -, tgcc dbSNP:759779793
3773 3773 c, t dbSNP:139825189
3776 3776 c, g dbSNP:61748086
3778 3778 c, g dbSNP:528399386
3784 3784 a, g dbSNP:770359323
3787 3787 c, g dbSNP:774012741
3789 3789 -, caa dbSNP:772655560
3795 3795 a, g dbSNP:747613376
3798 3798 a, g dbSNP:374649126
3801 3801 c, g dbSNP:730881809
3806 3806 a, c dbSNP:786203740
3810 3810 c, g dbSNP:772707858
3816 3816 a, c dbSNP:587782309
3820 3820 g, t dbSNP:56238300
3821 3821 -, ctga dbSNP:775836476
3823 3823 a, c, t dbSNP:267608140
3826 3826 -, gtca dbSNP:267608141
3827 3827 g, t dbSNP:766073664
3830 3830 -, gatt dbSNP:587781301
3830 3830 a, c, g dbSNP:192740549
3831 3831 -, ttga dbSNP:267608142
3833 3833 -, gatt dbSNP:587779311
3834 3834 a, g dbSNP:199739099
3836 3836 -, taag dbSNP:386833407
3836 3836 g, t dbSNP:759392159
3837 3837 -, aatt dbSNP:575068534
3837 3837 a, g, t dbSNP:267608081
3842 3842 -, atagactgactacattggaagctt dbSNP:587781746
3842 3842 -, atta dbSNP:587782547
3843 3843 c, t dbSNP:765098678
3844 3844 -, gact dbSNP:762031413
3845 3845 -, gact dbSNP:765313977
3846 3846 a, g dbSNP:587781604
3847 3847 c, t dbSNP:752809310
3848 3848 -, tgactacat dbSNP:766605075
3848 3848 c, t dbSNP:786203308
3851 3851 c, t dbSNP:758445380
3854 3854 c, t dbSNP:371301277
3855 3855 a, c dbSNP:757778351
3856 3856 c, t dbSNP:757708396
3861 3861 a, g dbSNP:374743162
3864 3864 -, ttgag dbSNP:754683604
3865 3865 -, ttgag dbSNP:751404750
3867 3867 -, agtt dbSNP:781241504
3868 3868 a, g dbSNP:200412142
3869 3869 -, gttga dbSNP:587779200
3871 3871 c, t dbSNP:756712244
3878 3878 -, gaca dbSNP:752652467
3878 3878 c, t dbSNP:568272054
3879 3879 a, c, g dbSNP:184571812
3881 3881 -, a dbSNP:755754032
3881 3881 a, c dbSNP:771683883
3882 3882 a, g dbSNP:368491299
3894 3894 c, t dbSNP:772973603
3896 3896 a, c dbSNP:746634080
3902 3902 a, t dbSNP:551144193
3907 3907 a, g dbSNP:569367018
3923 3923 -, tt dbSNP:587779201
3929 3929 a, t dbSNP:267608143
3930 3930 a, t dbSNP:2020906

Target ORF information:

RefSeq Version NM_001281492
Organism Homo sapiens (human)
Definition Homo sapiens mutS homolog 6 (MSH6), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu58146
Accession Version XM_011532798.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3900bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh6 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)121..444(+)
Misc Feature(2)157..276(+)
Misc Feature(3)1078..3867(+)
Misc Feature(4)1078..1434(+)
Misc Feature(5)1471..1938(+)
Misc Feature(6)2068..3051(+)
Misc Feature(7)3130..3798(+)
Misc Feature(8)3259..3282(+)
Misc Feature(9)3268..3603(+)
Misc Feature(10)3382..3393(+)
Misc Feature(11)3406..3447(+)
Misc Feature(12)3484..3501(+)
Misc Feature(13)3508..3519(+)
Misc Feature(14)3589..3609(+)
Position Chain Variation Link
14 14 c, g dbSNP:62139911
21 21 -, ggcgggg dbSNP:60717693
23 23 -, c dbSNP:3136234
28 28 g, t dbSNP:527428575
32 32 a, g dbSNP:3136235
34 34 a, g dbSNP:3136236
65 65 c, g dbSNP:3136237
84 84 c, g dbSNP:531348092
86 86 g, t dbSNP:367630365
95 95 a, g dbSNP:549751558
106 106 a, c dbSNP:142624180
126 126 c, g, t dbSNP:762818044
135 135 a, g dbSNP:1800932
142 142 g, t dbSNP:786202397
149 149 c, g dbSNP:752680756
156 156 g, t dbSNP:63751258
166 166 c, t dbSNP:758303780
167 167 a, t dbSNP:777900107
180 180 c, t dbSNP:730881823
192 192 c, t dbSNP:786202772
194 194 a, g dbSNP:587779934
203 203 c, t dbSNP:781271765
212 212 a, c dbSNP:746060136
213 213 a, g dbSNP:558590898
217 217 a, g dbSNP:146455343
218 218 c, t dbSNP:775971872
220 220 c, t dbSNP:763593669
221 221 a, g dbSNP:769279475
222 222 c, t dbSNP:587779276
223 223 a, g dbSNP:143036974
225 225 a, c, g dbSNP:774303198
228 228 a, t dbSNP:587782106
229 229 c, g dbSNP:786203479
232 232 a, g dbSNP:372352774
242 242 g, t dbSNP:63750143
243 243 -, t dbSNP:63750374
250 250 c, g dbSNP:765060096
252 252 a, c dbSNP:752488540
253 253 c, g dbSNP:587782101
254 254 a, c dbSNP:587779298
256 256 -, ttttttgatgacag dbSNP:786202193
276 276 a, g dbSNP:758390144
282 282 c, g, t dbSNP:777587467
285 285 a, g dbSNP:63750342
290 290 g, t dbSNP:3211299
299 299 a, t dbSNP:63750525
307 307 c, t dbSNP:587782406
308 308 c, g dbSNP:757311007
326 326 c, g dbSNP:63749873
327 327 -, aaag dbSNP:587779941
330 330 a, g dbSNP:786202690
335 335 c, t dbSNP:587778528
339 339 g, t dbSNP:786203645
342 342 a, g dbSNP:63751030
346 346 a, g dbSNP:776065389
348 348 g, t dbSNP:745399921
349 349 c, t dbSNP:568685193
350 350 a, c, t dbSNP:146469162
353 353 g, t dbSNP:763841886
357 357 c, t dbSNP:587779313
362 362 c, g dbSNP:774162322
364 364 a, g dbSNP:761721805
366 366 c, g dbSNP:767474992
372 372 a, g dbSNP:786201116
374 374 c, t dbSNP:587779942
381 381 -, ag dbSNP:267608037
381 381 a, g dbSNP:779496213
385 385 a, g dbSNP:750327994
391 391 c, t dbSNP:730881813
392 392 a, g dbSNP:786204186
394 394 g, t dbSNP:587781817
399 399 c, t dbSNP:1800935
400 400 a, g dbSNP:569728764
411 411 c, t dbSNP:786203679
412 412 a, g dbSNP:193922344
417 417 c, g, t dbSNP:587779943
424 424 a, t dbSNP:786203597
434 434 a, c, t dbSNP:375757570
436 436 g, t dbSNP:587779944
436 436 -, t dbSNP:587782281
437 437 -, t dbSNP:786201043
442 442 g, t dbSNP:267608038
446 446 g, t dbSNP:78939940
448 448 c, g dbSNP:148517241
455 455 c, t dbSNP:587782315
458 458 a, c dbSNP:63751077
459 459 -, ag dbSNP:730881824
461 461 -, ag dbSNP:587779945
462 462 a, g dbSNP:587779314
464 464 c, g dbSNP:367644746
468 468 a, g dbSNP:536686679
477 477 a, g dbSNP:758635514
481 481 a, g dbSNP:369058374
484 484 g, t dbSNP:747477669
486 486 a, g dbSNP:769312569
488 488 c, t dbSNP:201431515
490 490 a, g dbSNP:786204153
500 500 a, c dbSNP:773111311
501 501 a, c, g, t dbSNP:1800937
502 502 a, c, g dbSNP:145959653
503 503 g, t dbSNP:587779946
506 506 c, t dbSNP:765195534
507 507 ag, tt dbSNP:63750471
508 508 -, t dbSNP:267607692
509 509 a, g dbSNP:554012110
510 510 -, t dbSNP:63750955
511 511 a, t dbSNP:587779315
515 515 a, g dbSNP:763060788
518 518 a, c, g dbSNP:764478569
519 519 a, c dbSNP:1800938
520 520 a, g dbSNP:757817018
522 522 a, c, g dbSNP:41557217
524 524 a, g dbSNP:750827951
526 526 a, g dbSNP:374041375
527 527 a, g dbSNP:587779316
534 534 a, t dbSNP:572317219
536 536 a, g dbSNP:587781777
537 537 c, g dbSNP:778236337
538 538 a, g dbSNP:786202905
539 539 a, g, t dbSNP:587779317
541 541 a, g dbSNP:587779947
545 545 a, g dbSNP:587782591
546 546 a, g dbSNP:758120391
553 553 c, t dbSNP:587779318
555 555 a, g dbSNP:777770119
557 557 c, g dbSNP:142949377
561 561 -, t dbSNP:730881826
565 565 c, t dbSNP:63750996
569 569 -, g dbSNP:587779319
572 572 a, c dbSNP:587782510
577 577 a, c, t dbSNP:63750019
578 578 a, g dbSNP:542848931
580 580 a, c dbSNP:769962086
586 586 a, c, t dbSNP:377216828
587 587 a, g dbSNP:370157832
589 589 c, t dbSNP:267608066
591 591 a, g dbSNP:774496371
592 592 a, t dbSNP:762168786
597 597 -, t dbSNP:587779320
598 598 -, t dbSNP:63750733
598 598 a, c dbSNP:767828930
600 600 -, a dbSNP:267608041
601 601 a, c, g, t dbSNP:63749980
601 601 -, c dbSNP:587781691
602 602 a, c, g dbSNP:764870249
605 605 g, t dbSNP:752135996
606 606 a, g dbSNP:63750372
608 608 c, t dbSNP:587781275
610 610 a, g dbSNP:554884560
612 612 a, g dbSNP:587779321
613 613 g, t dbSNP:746623981
614 614 c, g dbSNP:267608048
618 618 c, t dbSNP:757143365
621 621 -, tg dbSNP:267608072
631 631 a, g dbSNP:786202565
633 633 -, tgg dbSNP:766451925
653 653 g, t dbSNP:63749890
663 663 c, t dbSNP:780831590
665 665 c, g dbSNP:587779322
668 668 a, t dbSNP:200898010
672 672 -, gga dbSNP:786203409
673 673 g, t dbSNP:63750552
676 676 a, g dbSNP:587779948
677 677 a, g, t dbSNP:769610487
678 678 a, g dbSNP:775693145
680 680 a, g dbSNP:587779949
681 681 c, t dbSNP:768654339
683 683 c, g dbSNP:774586054
690 690 a, c dbSNP:374486449
693 693 a, c dbSNP:368523339
699 699 c, t dbSNP:767974147
701 701 g, t dbSNP:773445382
702 702 -, ac dbSNP:752540976
704 704 -, ggg, t dbSNP:267608062
705 705 c, g dbSNP:573638836
713 713 g, t dbSNP:63750878
720 720 c, t dbSNP:754307139
725 725 aa, gc dbSNP:267608079
725 725 a, c, g dbSNP:368318845
726 726 a, c dbSNP:267608047
728 728 c, t dbSNP:751309721
734 734 g, t dbSNP:587781389
736 736 c, t dbSNP:756935130
742 742 a, g dbSNP:373958499
743 743 a, g, t dbSNP:267608051
751 751 c, t dbSNP:146816935
752 752 a, g dbSNP:765237563
756 756 g, t dbSNP:755878786
757 757 c, t dbSNP:779858670
758 758 a, c, g, t dbSNP:55760494
764 764 a, c, g dbSNP:587781510
768 768 g, t dbSNP:786201688
777 777 a, g dbSNP:748436287
781 781 a, g dbSNP:370174372
785 785 a, c, g, t dbSNP:544222338
786 786 c, t dbSNP:771288794
788 788 c, t dbSNP:777302246
792 792 a, t dbSNP:730881785
797 797 a, g dbSNP:753373644
800 800 a, g dbSNP:760100983
801 801 c, g dbSNP:150440246
803 803 c, g, t dbSNP:63750491
804 804 c, t dbSNP:761581941
806 806 a, g dbSNP:562487553
807 807 a, g dbSNP:750023646
814 814 a, g dbSNP:532920165
815 815 c, t dbSNP:188252826
816 816 a, c, g dbSNP:375210430
817 817 a, c dbSNP:754879198
818 818 c, t dbSNP:779022657
819 819 c, t dbSNP:575325950
823 823 a, g dbSNP:772126419
827 827 c, t dbSNP:777890307
834 834 a, g dbSNP:193922345
836 836 c, t dbSNP:587779323
837 837 a, t dbSNP:747207959
838 838 a, g dbSNP:730881814
839 839 c, g dbSNP:369568820
843 843 c, g, t dbSNP:138143769
847 847 c, t dbSNP:770408023
848 848 a, c dbSNP:786202848
854 854 a, c dbSNP:776080024
857 857 c, t dbSNP:587781983
862 862 a, c dbSNP:761231126
864 864 c, t dbSNP:767011067
866 866 c, g dbSNP:587782102
874 874 c, g dbSNP:772760681
875 875 c, g dbSNP:587780669
878 878 c, t dbSNP:61753793
881 881 c, g dbSNP:766202031
884 884 c, t dbSNP:753617680
887 887 c, g, t dbSNP:548898238
889 889 c, g dbSNP:730881815
894 894 a, t dbSNP:765166082
896 896 c, g, t dbSNP:567785169
902 902 c, t dbSNP:758432113
903 903 a, c dbSNP:587779202
908 908 c, t dbSNP:587782331
909 909 c, t dbSNP:730881802
910 910 c, t dbSNP:587779911
911 911 a, g dbSNP:730881786
912 912 c, t dbSNP:28903083
913 913 a, g dbSNP:730881787
918 918 -, tggag dbSNP:786202336
920 920 g, t dbSNP:730881788
922 922 a, g dbSNP:587778531
926 926 c, g dbSNP:776170146
927 927 c, t dbSNP:749752524
928 928 a, g dbSNP:771529531
931 931 c, g dbSNP:772747395
933 933 c, g dbSNP:760311819
937 937 a, g dbSNP:145994565
938 938 g, t dbSNP:267608060
940 940 c, t dbSNP:587782651
941 941 a, g dbSNP:63750440
944 944 -, c dbSNP:267608056
944 944 c, t dbSNP:759359754
946 946 a, g dbSNP:764965018
952 952 c, t dbSNP:752628520
953 953 c, g dbSNP:587780558
958 958 a, c dbSNP:201193496
960 960 -, t dbSNP:587779203
965 965 c, t dbSNP:375974046
966 966 -, tt dbSNP:786204252
968 968 c, t dbSNP:587779204
972 972 a, g dbSNP:786203202
979 979 -, aag dbSNP:587781660
981 981 a, g dbSNP:786203929
986 986 a, c, g dbSNP:764150912
988 988 -, aagag dbSNP:777907133
988 988 a, c dbSNP:786202609
989 989 a, c dbSNP:550221570
991 991 a, c dbSNP:781572949
992 992 a, g dbSNP:587779205
994 994 -, agaga dbSNP:267608077
998 998 -, atgag dbSNP:587779206
1000 1000 a, g dbSNP:142111387
1003 1003 c, t dbSNP:587779207
1006 1006 a, c dbSNP:780545039
1008 1008 a, g dbSNP:749800983
1010 1010 g, t dbSNP:730881789
1012 1012 -, agg dbSNP:267608043
1012 1012 a, c, t dbSNP:781652274
1018 1018 c, g dbSNP:746532720
1021 1021 c, g dbSNP:770386388
1022 1022 -, c dbSNP:34013967
1022 1022 a, c dbSNP:786201185
1023 1023 c, t dbSNP:55708305
1026 1026 a, c, t dbSNP:1042819
1027 1027 a, g dbSNP:147737737
1027 1027 -, g dbSNP:753796271
1029 1029 a, c, t dbSNP:55882234
1035 1035 a, c, t dbSNP:587779912
1037 1037 c, g dbSNP:764110569
1038 1038 a, c, t dbSNP:144961390
1043 1043 c, t dbSNP:767658494
1045 1045 c, g dbSNP:2020908
1047 1047 c, g dbSNP:786202626
1048 1048 -, ta dbSNP:756896277
1048 1048 c, t dbSNP:587779913
1049 1049 -, at dbSNP:63750439
1049 1049 a, g dbSNP:63750065
1050 1050 c, t dbSNP:786201269
1051 1051 g, t dbSNP:780350978
1052 1052 a, t dbSNP:587779208
1053 1053 a, g dbSNP:148116863
1059 1059 a, g dbSNP:536884553
1065 1065 c, t dbSNP:779504190
1068 1068 c, g dbSNP:748603803
1070 1070 a, g dbSNP:768740986
1073 1073 c, g dbSNP:730881790
1082 1082 c, t dbSNP:767404845
1083 1083 g, t dbSNP:786203834
1090 1090 a, t dbSNP:202219685
1092 1092 a, g dbSNP:554843104
1094 1094 a, c dbSNP:587781508
1097 1097 a, g dbSNP:786201049
1100 1100 a, g dbSNP:587779914
1104 1104 a, g dbSNP:769418914
1105 1105 -, t dbSNP:778555956
1113 1113 c, g, t dbSNP:576815110
1114 1114 c, g dbSNP:762814792
1116 1116 a, g dbSNP:63750026
1126 1126 c, g dbSNP:587781657
1128 1128 g, t dbSNP:774457540
1129 1129 c, g dbSNP:768299607
1131 1131 c, g dbSNP:63751452
1132 1132 a, g dbSNP:63749971
1134 1134 a, c dbSNP:786203122
1135 1135 -, t dbSNP:587779209
1141 1141 a, g dbSNP:761822293
1143 1143 a, g dbSNP:767746584
1146 1146 a, g dbSNP:576548582
1147 1147 a, g dbSNP:587779915
1149 1149 -, g dbSNP:587782809
1154 1154 gca, tt dbSNP:267608080
1154 1154 c, g, t dbSNP:750528093
1158 1158 a, t dbSNP:267608055
1163 1163 c, t dbSNP:63751405
1164 1164 g, t dbSNP:786203803
1167 1167 c, t dbSNP:761037236
1175 1175 a, g dbSNP:786202363
1184 1184 c, t dbSNP:587779210
1197 1197 a, t dbSNP:587779211
1198 1198 a, c, t dbSNP:369709529
1199 1199 -, g dbSNP:34248409
1201 1201 c, g dbSNP:779123278
1204 1204 c, t dbSNP:3136333
1205 1205 c, t dbSNP:63750741
1206 1206 a, g dbSNP:786201760
1213 1213 a, g dbSNP:780734507
1217 1217 a, g dbSNP:745391760
1223 1223 a, c dbSNP:200938360
1226 1226 a, g dbSNP:587780538
1228 1228 c, g dbSNP:267608052
1235 1235 c, g dbSNP:587782346
1237 1237 c, g dbSNP:748847338
1245 1245 c, t dbSNP:786202869
1249 1249 a, t dbSNP:201892477
1261 1261 c, t dbSNP:369456858
1262 1262 a, g dbSNP:41295268
1265 1265 a, g dbSNP:748165218
1266 1266 a, t dbSNP:587781408
1272 1272 a, t dbSNP:772123097
1280 1280 -, t dbSNP:63750348
1281 1281 -, tg dbSNP:63750854
1284 1284 c, g dbSNP:61754782
1303 1303 a, c, t dbSNP:63750909
1304 1304 a, g dbSNP:773226008
1305 1305 a, g dbSNP:786202132
1306 1306 c, g dbSNP:786204084
1308 1308 c, g, t dbSNP:35590297
1309 1309 c, g dbSNP:587782706
1311 1311 a, g dbSNP:776633437
1316 1316 c, g, t dbSNP:577713548
1321 1321 a, g dbSNP:776959327
1330 1330 -, atg dbSNP:745312505
1331 1331 c, t dbSNP:759643679
1333 1333 -, atg dbSNP:587782576
1333 1333 a, g dbSNP:61754783
1336 1336 g, t dbSNP:267608046
1338 1338 a, g dbSNP:753042580
1339 1339 g, t dbSNP:758699749
1341 1341 a, g dbSNP:786201736
1342 1342 c, t dbSNP:587779212
1346 1346 a, g dbSNP:764593111
1350 1350 a, g dbSNP:752024609
1352 1352 a, g dbSNP:147136417
1357 1357 a, g dbSNP:786204127
1360 1360 c, t dbSNP:779411998
1364 1364 c, t dbSNP:749012012
1367 1367 c, g dbSNP:63750897
1368 1368 c, t dbSNP:545020313
1377 1377 c, t dbSNP:775497704
1381 1381 a, g dbSNP:747971039
1385 1385 c, t dbSNP:63751005
1387 1387 a, g dbSNP:786203486
1390 1390 a, g dbSNP:773303940
1396 1396 a, g dbSNP:746897461
1406 1406 a, t dbSNP:587779213
1413 1413 c, t dbSNP:786201471
1419 1419 c, t dbSNP:762396230
1420 1420 a, t dbSNP:587779916
1421 1421 c, t dbSNP:149159527
1424 1424 a, g dbSNP:63751009
1425 1425 c, g dbSNP:776567082
1426 1426 a, c dbSNP:759857124
1428 1428 g, t dbSNP:587779214
1431 1431 c, g dbSNP:587779215
1433 1433 a, g dbSNP:765387680
1439 1439 -, t dbSNP:63751090
1440 1440 a, g dbSNP:775618855
1443 1443 a, g dbSNP:763342825
1445 1445 a, g, t dbSNP:786201964
1446 1446 g, t dbSNP:764396869
1449 1449 -, t dbSNP:587779216
1450 1450 a, c dbSNP:201721694
1455 1455 -, t dbSNP:587779217
1458 1458 c, g dbSNP:373726731
1461 1461 -, c dbSNP:63751234
1461 1461 c, g dbSNP:763712971
1463 1463 a, g dbSNP:376476188
1465 1465 -, agta dbSNP:771764652
1465 1465 a, g dbSNP:765983691
1466 1466 a, g dbSNP:587782352
1468 1468 a, g dbSNP:753276270
1470 1470 a, g dbSNP:786203776
1472 1472 a, c dbSNP:728619
1473 1473 ag, tc dbSNP:267608049
1473 1473 g, tc dbSNP:587779218
1473 1473 g, t dbSNP:63750870
1477 1477 a, c, g dbSNP:201996928
1480 1480 a, c, g dbSNP:587779778
1482 1482 c, t dbSNP:777678406
1487 1487 -, aa dbSNP:587779219
1491 1491 -, aaaa dbSNP:267608064
1493 1493 -, aaga dbSNP:63749874
1493 1493 -, aa dbSNP:587781398
1495 1495 -, gag dbSNP:779537048
1495 1495 c, g dbSNP:63751172
1496 1496 -, ag dbSNP:267608076
1496 1496 a, g dbSNP:373554374
1505 1505 a, c, g dbSNP:200447622
1509 1509 c, t dbSNP:781124198
1511 1511 a, g dbSNP:587779917
1515 1515 a, t dbSNP:745937181
1518 1518 c, t dbSNP:769828338
1519 1519 c, t dbSNP:775716798
1520 1520 a, g dbSNP:730881791
1524 1524 a, g dbSNP:146785465
1526 1526 a, g, t dbSNP:63751312
1527 1527 c, t dbSNP:730882130
1528 1528 -, g dbSNP:747426620
1532 1532 c, t dbSNP:587782284
1533 1533 a, g dbSNP:762442338
1535 1535 a, g dbSNP:63750595
1536 1536 c, t dbSNP:63749893
1555 1555 a, g dbSNP:63749973
1556 1556 c, g dbSNP:758990693
1557 1557 a, c dbSNP:764818222
1560 1560 c, g dbSNP:752435825
1561 1561 c, g, t dbSNP:758118126
1564 1564 -, tt dbSNP:587783056
1567 1567 a, g dbSNP:61748081
1570 1570 c, g