
HBA1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol HBA1
Entrez Gene ID 3039
Full Name hemoglobin, alpha 1
Synonyms HBA-T3, HBH
General protein information
Preferred Names
hemoglobin subunit alpha
hemoglobin subunit alpha
alpha-1 globin
alpha one globin
hemoglobin alpha chain
hemoglobin alpha-1 chain
hemoglobin alpha 1 globin chain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Thalassemias, alpha-, 604131 (3); Methemoglobinemias, alpha- (3);

mRNA and Protein(s)

mRNA Protein Name
NM_000558 NP_000549 hemoglobin subunit alpha

hsa05144 Malaria
hsa05143 African trypanosomiasis
R-HSA-5653656 Vesicle-mediated transport
R-HSA-2168880 Scavenging of heme from plasma
R-HSA-1430728 Metabolism
R-HSA-2173782 Binding and Uptake of Ligands by Scavenger Receptors
R-HSA-1480926 O2/CO2 exchange in erythrocytes
R-HSA-1247673 Erythrocytes take up oxygen and release carbon dioxide
R-HSA-1237044 Erythrocytes take up carbon dioxide and release oxygen
WP15 Selenium Pathway

Homo sapiens (human) HBA2 NP_000508.1
Homo sapiens (human) HBA1 NP_000549.1
Macaca mulatta (Rhesus monkey) HBA2 NP_001038189.1
Macaca mulatta (Rhesus monkey) HBA2 XP_001094404.1
Canis lupus familiaris (dog) LOC100855558 NP_001257814.1
Canis lupus familiaris (dog) LOC100855540 NP_001257815.1
Bos taurus (cattle) HBA NP_001070890.2
Bos taurus (cattle) HBA1 XP_003585623.1
Mus musculus (house mouse) Hba-a2 NP_001077424.1
Mus musculus (house mouse) Hba-a1 NP_032244.2
Rattus norvegicus (Norway rat) LOC287167 NP_001013875.1
Gallus gallus (chicken) HBAA NP_001004376.1
Gallus gallus (chicken) LOC100858011 XP_004949966.1
Xenopus (Silurana) tropicalis (western clawed frog) hba1 NP_988860.1

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following HBA1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HBA1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_000558 Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu23534
Accession Version NM_000558.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 429bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 01-APR-2015
Organism Homo sapiens (human)
Product hemoglobin subunit alpha
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from Z84721.1, BC101846.1 and AI064720.1. This sequence is a reference standard in the RefSeqGene project. On Aug 9, 2014 this sequence version replaced gi:14456711. Summary: The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK223392.1, CB994937.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)30..30(+)
Misc Feature(2)70..72(+)
Misc Feature(3)73..492(+)
Misc Feature(4)76..78(+)
Misc Feature(5)88..90(+)
Misc Feature(6)88..90(+)
Misc Feature(7)91..93(+)
Misc Feature(8)100..102(+)
Misc Feature(9)100..102(+)
Misc Feature(10)115..117(+)
Misc Feature(11)115..117(+)
Misc Feature(12)115..117(+)
Misc Feature(13)139..141(+)
Misc Feature(14)139..141(+)
Misc Feature(15)160..492(+)
Misc Feature(16)163..477(+)
Misc Feature(17)172..174(+)
Misc Feature(18)187..189(+)
Misc Feature(19)193..195(+)
Misc Feature(20)214..216(+)
Misc Feature(21)235..237(+)
Misc Feature(22)247..249(+)
Misc Feature(23)250..252(+)
Misc Feature(24)337..339(+)
Misc Feature(25)364..366(+)
Exon (1)1..161
Gene Synonym:
Exon (2)162..366
Gene Synonym:
Exon (3)367..606
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:571582665
22 22 g, t dbSNP:751745556
25 25 c, g, t dbSNP:370305736
26 26 c, g dbSNP:750737757
29 29 a, c dbSNP:553807551
30 30 a, c dbSNP:780511253
34 34 c, t dbSNP:748874265
38 38 c, g dbSNP:754685409
43 43 c, g dbSNP:374054030
51 51 c, t dbSNP:34702814
52 52 c, g dbSNP:571903706
58 58 c, g dbSNP:542596953
61 61 c, t dbSNP:554412411
63 63 c, t dbSNP:367656258
65 65 c, t dbSNP:770601112
67 67 a, g dbSNP:34220980
70 70 g, t dbSNP:281864485
71 71 a, g, t dbSNP:281864802
74 74 g, t dbSNP:36030576
75 75 -, ctg dbSNP:281864548
76 76 c, t dbSNP:281864479
77 77 c, t dbSNP:35850071
82 82 c, g dbSNP:34751764
83 83 a, c dbSNP:34090856
85 85 -, gac dbSNP:281865565
85 85 a, c, g, t dbSNP:33961916
86 86 a, c, g, t dbSNP:33986902
88 88 a, g dbSNP:281864807
90 90 c, g dbSNP:34410516
95 95 a, c, g dbSNP:281860650
96 96 c, g dbSNP:28928885
100 100 a, c, g dbSNP:33938574
102 102 c, g, t dbSNP:281860646
104 104 a, c dbSNP:35615982
106 106 a, c, g dbSNP:35331909
109 109 a, c, t dbSNP:33964317
110 110 a, g, t dbSNP:63750090
110 110 -, g dbSNP:762950292
112 112 c, g, t dbSNP:35816645
113 113 a, g dbSNP:281865560
115 115 a, g dbSNP:41407250
116 116 a, c, t dbSNP:35210126
117 117 c, g, t dbSNP:281860648
121 121 c, g, t dbSNP:34504387
122 122 a, g dbSNP:35993097
125 125 a, c dbSNP:35628685
126 126 -, g dbSNP:770988111
127 127 c, g, t dbSNP:34708054
128 128 -, t dbSNP:281864571
128 128 a, c, g dbSNP:33943087
129 129 a, c dbSNP:281864502
130 130 c, g dbSNP:34324664
131 131 a, c, t dbSNP:11548605
134 134 a, g dbSNP:34608326
135 135 c, t dbSNP:768017043
136 136 a, c, g, t dbSNP:33939620
137 137 a, g, t dbSNP:33939421
138 138 g, t dbSNP:281860684
139 139 c, t dbSNP:34743106
140 140 a, g dbSNP:28928880
141 141 c, t dbSNP:750867079
144 144 g, t dbSNP:761296048
146 146 a, c, t dbSNP:35477770
148 148 a, g dbSNP:34776279
149 149 a, c, g, t dbSNP:33964507
150 150 a, c, g, t dbSNP:41530750
151 151 a, g dbSNP:544436920
152 152 c, t dbSNP:281864500
154 154 c, g dbSNP:63749791
157 157 a, c, g dbSNP:33993166
158 158 a, c, t dbSNP:33946121
161 161 c, g dbSNP:281864580
162 162 c, g, t dbSNP:281860652
164 164 a, t dbSNP:281864566
170 170 g, t dbSNP:35203445
178 178 -, ccc dbSNP:35992350
179 179 c, g, t dbSNP:35776155
180 180 -, gaa dbSNP:34667595
181 181 a, g dbSNP:281864503
182 182 c, t dbSNP:281860683
184 184 -, acc dbSNP:63751150
187 187 a, g dbSNP:34492931
188 188 a, c, t dbSNP:41416747
189 189 c, g dbSNP:28928886
190 190 a, t dbSNP:34890875
191 191 c, g dbSNP:281860622
194 194 a, c dbSNP:281864569
196 196 g, t dbSNP:35511459
199 199 c, g dbSNP:281860643
200 200 c, g, t dbSNP:33978134
202 202 c, g, t dbSNP:33931984
203 203 a, c, g dbSNP:28928883
204 204 c, g dbSNP:281860685
205 205 c, g, t dbSNP:281860631
208 208 a, c, g, t dbSNP:34269448
209 209 a, c, g dbSNP:33944368
212 212 c, t dbSNP:281864480
217 217 c, t dbSNP:281864501
218 218 a, g, t dbSNP:33967561
219 219 a, c, g dbSNP:33966883
220 220 a, c, g dbSNP:33960522
221 221 -, gctctgcccaggt dbSNP:63749935
221 221 a, g dbSNP:35934411
223 223 -, tctgcccaggttaagggccacggc dbSNP:63750122
227 227 a, c dbSNP:34574239
229 229 c, g dbSNP:35317336
230 230 a, g dbSNP:36024711
232 232 c, g dbSNP:34068598
233 233 c, t dbSNP:281864896
235 235 a, g dbSNP:34182019
236 236 a, c, g dbSNP:33949106
237 237 c, g, t dbSNP:281860657
238 238 c, g dbSNP:35252931
239 239 a, g dbSNP:36062788
241 241 c, t dbSNP:35213748
244 244 a, g dbSNP:281864895
245 245 a, g, t dbSNP:28928878
247 247 a, g dbSNP:34259907
249 249 a, c, g, t dbSNP:281860659
250 250 -, aag dbSNP:34353199
250 250 a, g dbSNP:281860686
251 251 a, c dbSNP:41381645
252 252 c, g, t dbSNP:281864775
253 253 -, gtg dbSNP:35672478
255 255 -, g dbSNP:281864545
257 257 a, c dbSNP:34502246
259 259 a, c, g, t dbSNP:33984024
260 260 a, g dbSNP:35873730
263 263 c, t dbSNP:34733452
264 264 a, g dbSNP:772025927
271 271 a, c, g, t dbSNP:34823698
273 273 -, gcgctgaccaac dbSNP:34277525
273 273 a, c, g dbSNP:1060339
277 277 a, g dbSNP:63750275
280 280 a, g dbSNP:281864498
281 281 a, c, g, t dbSNP:3180281
283 283 c, g, t dbSNP:36104787
284 284 a, g dbSNP:35859529
289 289 -, gac dbSNP:759750475
289 289 a, c, g dbSNP:28928875
290 290 a, c, g, t dbSNP:33921047
292 292 a, c, g, t dbSNP:33977363
293 293 a, c, g dbSNP:33991223
296 296 a, c, g, t dbSNP:33969953
299 299 a, c, g dbSNP:34019158
301 301 a, c, g dbSNP:33964623
303 303 -, c dbSNP:767911847
303 303 c, g dbSNP:34440919
304 304 a, g dbSNP:34586189
305 305 c, g dbSNP:387906544
306 306 a, g dbSNP:761086044
308 308 g, t dbSNP:34071856
311 311 c, g dbSNP:34936612
313 313 -, gccctgagc dbSNP:63751491
313 313 a, g dbSNP:63750676
314 314 a, c dbSNP:34879587
316 316 c, t dbSNP:754145030
319 319 a, c, g dbSNP:33926206
321 321 a, c, g dbSNP:33996798
322 322 a, c, g, t dbSNP:33915947
324 324 a, c, g dbSNP:281864578
325 325 c, g dbSNP:281864516
326 326 g, t dbSNP:35548338
328 328 a, c, g, t dbSNP:28928876
329 329 a, c, g dbSNP:33976776
331 331 g, t dbSNP:35239527
332 332 a, c, g, t dbSNP:281864870
334 334 c, t dbSNP:34988734
335 335 a, c, g, t dbSNP:33944813
336 336 a, c, g dbSNP:1061009
337 337 a, g dbSNP:281864481
338 338 a, c, g, t dbSNP:33911106
339 339 c, g, t dbSNP:33914470
340 340 c, t dbSNP:17407508
341 341 c, t dbSNP:34684963
343 343 c, t dbSNP:34868036
344 344 a, c, g, t dbSNP:33991779
347 347 c, g, t dbSNP:34769782
349 349 a, c, g, t dbSNP:34102339
350 350 a, c, g dbSNP:28928879
351 351 c, g dbSNP:34814612
352 352 a, c, g, t dbSNP:33984621
353 353 a, c, g, t dbSNP:33931314
354 354 a, g dbSNP:764831969
355 355 a, c, g dbSNP:281864551
358 358 a, c dbSNP:41322954
362 362 a, t dbSNP:281864483
364 364 a, g dbSNP:34806456
366 366 g, t dbSNP:34273731
375 375 a, c dbSNP:34098449
376 376 c, t dbSNP:28928884
377 377 a, g dbSNP:35329201
379 379 a, t dbSNP:35059618
381 381 c, g dbSNP:281864534
386 386 c, t dbSNP:281864482
390 390 a, g dbSNP:138407823
392 392 a, c dbSNP:756810015
392 392 -, c dbSNP:754313225
393 393 -, c dbSNP:281864535
397 397 a, g dbSNP:34629158
398 398 a, c, t dbSNP:63749948
399 399 -, cgcccacctcccc dbSNP:281864536
400 400 a, g dbSNP:34863047
402 402 c, g dbSNP:750352335
403 403 c, g dbSNP:34830032
404 404 a, g dbSNP:34713708
405 405 a, c dbSNP:281864564
407 407 a, t dbSNP:35654345
409 409 c, g, t dbSNP:34472107
410 410 c, g, t dbSNP:33910377
411 411 c, t dbSNP:749104494
413 413 a, c, t dbSNP:34204059
415 415 a, c, g dbSNP:63749882
416 416 a, c dbSNP:35932809
418 418 -, tca dbSNP:756774032
421 421 a, t dbSNP:371285290
422 422 a, c dbSNP:747020299
424 424 c, t dbSNP:63750751
425 425 c, t dbSNP:63750566
428 428 a, c dbSNP:63749927
430 430 a, g dbSNP:63751008
431 431 c, t dbSNP:775764044
433 433 c, t dbSNP:63750922
436 436 a, c, g, t dbSNP:28928881
445 445 a, c, g, t dbSNP:63750950
446 446 a, c, g, t dbSNP:63750467
447 447 c, g dbSNP:63751204
449 449 a, c dbSNP:63751308
450 450 c, g, t dbSNP:63749865
451 451 -, t dbSNP:764798737
455 455 c, t dbSNP:35993655
458 458 a, c, t dbSNP:63750613
459 459 c, t dbSNP:774082530
460 460 c, t dbSNP:35974739
461 461 c, t dbSNP:36008624
462 462 -, t dbSNP:34021271
462 462 c, t dbSNP:149264789
462 462 -, t dbSNP:281864472
463 463 a, g dbSNP:281864506
464 464 g, t dbSNP:35166834
466 466 a, c dbSNP:55948437
467 467 a, g dbSNP:35082275
468 468 a, c, g dbSNP:56308100
469 469 a, t dbSNP:281864489
470 470 -, c dbSNP:281864473
470 470 c, g, t dbSNP:281864487
472 472 a, g dbSNP:63751237
473 473 a, t dbSNP:35994191
474 474 c, g dbSNP:756921401
475 475 a, c dbSNP:121913127
476 476 c, g, t dbSNP:34635364
478 478 a, c dbSNP:281864477
481 481 c, t dbSNP:34011123
482 482 c, g dbSNP:63749989
483 483 c, g dbSNP:535893942
484 484 -, a dbSNP:281865478
484 484 a, g dbSNP:33973086
485 485 a, c dbSNP:34849179
486 486 -, a dbSNP:63751216
487 487 c, t dbSNP:35723200
490 490 -, cgt dbSNP:121913128
490 490 a, c, g, t dbSNP:33991910
491 491 a, c, g, t dbSNP:33935328
504 504 c, t dbSNP:750023320
506 506 c, t dbSNP:756053083
507 507 a, c, g dbSNP:200499392
514 514 a, g dbSNP:376827361
517 517 -, ctt dbSNP:750079784
523 523 c, g dbSNP:17135334
525 525 c, t dbSNP:778614540
526 526 c, g dbSNP:200097667
528 528 c, t dbSNP:757531184
534 534 c, t dbSNP:3180978
536 536 a, c dbSNP:781242079
537 537 c, t dbSNP:375518794
539 539 c, t dbSNP:770226969
541 541 a, c, t dbSNP:141514155
546 546 -, cct dbSNP:758099572
546 546 c, t dbSNP:769031119
566 566 c, g dbSNP:11864706
574 574 c, g dbSNP:556340454
591 591 a, g dbSNP:281864533
606 606 a, g, t dbSNP:111306104

Target ORF information:

RefSeq Version NM_000558
Organism Homo sapiens (human)
Definition Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Alpha thalassemia allelic frequency in Lebanon
Pediatr Blood Cancer 62 (1), 120-122 (2015)
Farra C, Badra R, Fares F, Muwakkit S, Dbaibo G, Dabbous I, Ashkar H, Mounsef C and Abboud MR.


Experimental basis for a new allosteric model for multisubunit proteins
Proc. Natl. Acad. Sci. U.S.A. 111 (35), 12758-12763 (2014)
Viappiani C, Abbruzzetti S, Ronda L, Bettati S, Henry ER, Mozzarelli A and Eaton WA.


Glycated hemoglobin predicts overall and cardiovascular mortality in non-diabetic hemodialysis patients
Clin. Nephrol. 82 (3), 173-180 (2014)
Ok ES, Asci G, Toz H, Ritz E, Kircelli F, Sever MS, Ozkahya M, Sipahi S, Dheir H, Bozkurt D, Omer Z, Sahin OZ, Ertilav M and Ok E.


The associations of SEA-alpha thalassemia 1, XmnI-Ggamma polymorphism and beta-globin gene mutations with the clinical severity of beta-thalassemia syndrome in northern Thailand
J Med Assoc Thai 97 (3), 300-307 (2014)
Tatu,T., Sritong,W. and Sa-Nguansermsri,T.


Identification and characterization of two novel and differentially expressed isoforms of human alpha2- and alpha1-globin genes
Hemoglobin 36 (5), 421-432 (2012)
Ghassemifar R, Forster L, Qadah T and Finlayson J.


(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Origa,R., Moi,P., Galanello,R. and Cao,A.


Hemoglobin Moabit: alpha 86 (F7) Leu leads to Arg: a new unstable abnormal hemoglobin
Acta Haematol. 61 (3), 121-124 (1979)
Knuth,A., Pribilla,W., Marti,H.R. and Winterhalter,K.H.


Hemoglobin J Rovigo (alpha53 Ala replaced by Asp) in association with beta-thalassemia
Hemoglobin 2 (5), 443-445 (1978)
Moo-Penn,W.F., Jue,D.L. and Baine,R.M.


The nucleotide sequences of the untranslated 5' regions of human alpha- and beta-globin mRNAs
Proc. Natl. Acad. Sci. U.S.A. 74 (11), 5145-5149 (1977)
Chang,J.C., Temple,G.F., Poon,R., Neumann,K.H. and Kan,Y.W.


Haemoglobin G Norfolk alpha 85 (F6) Asp leads to Asn. Structural characterization by sequenator analysis and functional properties of a new variant with high oxygen affinity
FEBS Lett. 50 (2), 163-167 (1975)
Cohen-Solal,M., Manesse,B., Thillet,J. and Rosa,J.
