Email to GenScript

HBB hemoglobin, beta [Homo sapiens (human)]

Gene Symbol HBB
Entrez Gene ID 3043
Full Name hemoglobin, beta
Synonyms CD113t-C, beta-globin
General protein information
Preferred Names
hemoglobin subunit beta
hemoglobin subunit beta
beta globin chain
hemoglobin beta chain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Sickle cell anemia, 603903 (3); Thalassemias, beta-, 604131 (3);

The following HBB gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HBB gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu25936 NM_000518 Homo sapiens hemoglobin, beta (HBB), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu25936
Accession Version NM_000518.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 444bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 09-JUN-2015
Organism Homo sapiens (human)
Product hemoglobin subunit beta
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from L48217.1. This sequence is a reference standard in the RefSeqGene project. On Feb 11, 2003 this sequence version replaced gi:13788565. Summary: The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: V00497.1, BU659180.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968832, SAMEA2142586 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)30..32(+)
Misc Feature(2)54..56(+)
Misc Feature(3)54..56(+)
Misc Feature(4)54..56(+)
Misc Feature(5)69..488(+)
Misc Feature(6)75..77(+)
Misc Feature(7)78..80(+)
Misc Feature(8)87..89(+)
Misc Feature(9)141..446(+)
Misc Feature(10)144..476(+)
Misc Feature(11)183..185(+)
Misc Feature(12)201..203(+)
Misc Feature(13)228..230(+)
Misc Feature(14)228..230(+)
Misc Feature(15)249..251(+)
Misc Feature(16)297..299(+)
Misc Feature(17)297..299(+)
Misc Feature(18)312..314(+)
Misc Feature(19)330..332(+)
Misc Feature(20)330..332(+)
Misc Feature(21)330..332(+)
Misc Feature(22)336..338(+)
Misc Feature(23)411..413(+)
Misc Feature(24)441..443(+)
Misc Feature(25)483..485(+)
Exon (1)1..142
Gene Synonym:
Exon (2)143..365
Gene Synonym:
Exon (3)366..626
Gene Synonym:
Position Chain Variation Link
1 1 a, c dbSNP:34305195
10 10 -, t dbSNP:35352549
20 20 a, c, t dbSNP:63750628
22 22 a, g dbSNP:34704828
27 27 a, c dbSNP:762692752
30 30 c, t dbSNP:772919319
33 33 c, g dbSNP:34135787
36 36 a, c dbSNP:193922550
39 39 c, t dbSNP:113115948
40 40 -, aaac dbSNP:34196559
41 41 -, aaca dbSNP:773404685
41 41 a, g dbSNP:747545656
51 51 a, g dbSNP:34563000
52 52 a, c, g, t dbSNP:33941849
53 53 a, c, g, t dbSNP:33930702
54 54 a, g, t dbSNP:33958358
54 54 -, g dbSNP:63750475
55 55 a, c, g, t dbSNP:33949930
57 57 c, t dbSNP:35906307
58 58 atctga, ctgaggtgaagtctgcctgaggagaagt dbSNP:63750407
58 58 -, c dbSNP:63750898
58 58 a, c, g, t dbSNP:33983205
59 59 -, t dbSNP:34058656
59 59 a, c, g, t dbSNP:713040
60 60 a, c, g, t dbSNP:34126315
61 61 a, c, t dbSNP:63750720
63 63 a, c dbSNP:281864509
64 64 a, c dbSNP:63750605
66 66 -, c dbSNP:63750729
66 66 c, g, t dbSNP:33912272
67 67 -, ct dbSNP:34889882
67 67 c, g, t dbSNP:34769005
68 68 -, tg dbSNP:281864519
69 69 at, ga dbSNP:193922552
69 69 a, c, g dbSNP:33930165
70 70 -, a dbSNP:63749819
70 70 a, c, g, t dbSNP:334
72 72 -, gag dbSNP:63750928
72 72 a, c, g dbSNP:34948328
73 73 a, g dbSNP:34387455
74 74 a, g, t dbSNP:138405215
75 75 -, aa dbSNP:35497102
75 75 a, c, g dbSNP:33926764
76 76 a, c, g, t dbSNP:33932981
77 77 -, g dbSNP:35699606
77 77 c, g dbSNP:35198910
79 79 a, c, g dbSNP:33918131
80 80 -, t dbSNP:34548294
81 81 a, g dbSNP:63750717
82 82 a, c, t dbSNP:33947457
83 83 a, c, t dbSNP:35799536
84 84 a, g, t dbSNP:33974228
85 85 a, t dbSNP:35140348
86 86 -, t dbSNP:34856846
90 90 g, t dbSNP:766266418
91 91 a, c dbSNP:35203747
94 94 c, g, t dbSNP:33935445
95 95 -, g dbSNP:35383398
95 95 a, g dbSNP:762782573
96 96 a, c, g, t dbSNP:33946157
96 96 -, t dbSNP:63749960
97 97 a, g dbSNP:63750783
98 98 a, g dbSNP:34716011
99 99 c, g, t dbSNP:63751285
100 100 a, g dbSNP:33962676
101 101 a, c dbSNP:370075492
101 101 -, c dbSNP:35662066
102 102 -, aaggtg dbSNP:63749958
102 102 a, c, g, t dbSNP:33986703
103 103 a, g dbSNP:369865419
104 104 c, g, t dbSNP:36006214
105 105 a, g, t dbSNP:35802118
106 106 g, t dbSNP:35382661
108 108 a, g dbSNP:34866629
109 109 a, g dbSNP:33972047
110 110 a, c, g, t dbSNP:63750840
111 111 a, g, t dbSNP:35890959
112 112 a, g, t dbSNP:33918474
114 114 a, c, g, t dbSNP:33950093
115 115 a, g, t dbSNP:33977536
116 116 g, t dbSNP:373362317
117 117 -, gaagttggtggt dbSNP:281864496
117 117 a, c, g, t dbSNP:33959855
118 118 -, aagttgg dbSNP:281864898
118 118 a, c, g, t dbSNP:33936254
119 119 a, g, t dbSNP:281864513
120 120 -, gtt dbSNP:34160180
120 120 a, g, t dbSNP:33929459
121 121 a, c, g, t dbSNP:33945546
123 123 -, ggt dbSNP:267607294
123 123 c, g dbSNP:33972975
124 124 a, g, t dbSNP:33968721
124 124 cac, g dbSNP:281864899
125 125 a, g, t dbSNP:33951465
126 126 -, ggt dbSNP:63749918
126 126 a, c, g dbSNP:34404985
127 127 a, g dbSNP:35474880
128 128 -, t dbSNP:35619688
128 128 g, t dbSNP:373379910
129 129 -, t dbSNP:35477349
129 129 a, c, g, t dbSNP:33950507
130 130 a, c, g, t dbSNP:33915112
131 131 c, g, t dbSNP:281864581
132 132 a, c, g, t dbSNP:35424040
133 133 a, c, g, t dbSNP:33954632
134 134 -, c dbSNP:35532010
134 134 c, t dbSNP:748296717
135 135 -, c dbSNP:606231218
135 135 a, c, t dbSNP:33958088
135 135 -, c dbSNP:63750655
136 136 a, c, g, t dbSNP:33916412
138 138 a, g dbSNP:33974277
138 138 -, g dbSNP:267607295
139 139 a, g dbSNP:35685286
140 140 a, c, t dbSNP:35578002
141 141 a, c, g dbSNP:35684407
142 142 a, c, g dbSNP:33960103
143 143 -, cgg dbSNP:35348864
143 143 c, g, t dbSNP:1135071
144 144 -, c dbSNP:63749977
144 144 c, g, t dbSNP:33956555
145 145 -, tggtctattttcccacccttaggct dbSNP:773202162
145 145 c, g, t dbSNP:33920173
146 146 g, t dbSNP:778841729
147 147 c, g dbSNP:34314652
148 148 a, c, g, t dbSNP:33948578
149 149 a, g dbSNP:148298007
150 150 -, gtg dbSNP:35699671
150 150 a, g, t dbSNP:1141370
151 151 -, tggtct dbSNP:35389895
152 152 a, g dbSNP:375797635
153 153 c, g, t dbSNP:1141387
154 154 a, c, t dbSNP:1135101
156 156 c, t dbSNP:281864514
157 157 a, t dbSNP:35857380
158 158 a, c, t dbSNP:33982568
158 158 -, c dbSNP:267607297
159 159 a, c, g, t dbSNP:33948615
160 160 a, c, g dbSNP:33993004
162 162 a, c, g, t dbSNP:33994623
162 162 -, t dbSNP:63750532
163 163 a, c, g dbSNP:33991059
163 163 -, g dbSNP:281865474
164 164 -, gacccag dbSNP:63750099
164 164 a, g, t dbSNP:33974936
165 165 a, c dbSNP:34571024
166 166 -, cc dbSNP:267607298
166 166 a, c, t dbSNP:34703513
168 168 a, c, g, t dbSNP:11549407
168 168 -, c dbSNP:267607291
169 169 -, a dbSNP:281864574
169 169 a, g dbSNP:35973315
170 170 c, g dbSNP:34663314
172 172 a, g, t dbSNP:34831026
173 173 -, t dbSNP:36029927
173 173 c, g, t dbSNP:33918778
173 173 -, g dbSNP:63749957
174 174 -, ttct dbSNP:80356821
174 174 -, ttc dbSNP:281864897
175 175 a, c, g, t dbSNP:33926796
176 176 -, cttt dbSNP:281864900
176 176 -, ttct dbSNP:568899878
176 176 -, c dbSNP:35755331
176 176 c, g dbSNP:281864570
177 177 -, ttt dbSNP:41417446
177 177 c, g, t dbSNP:33924146
178 178 c, g, t dbSNP:34378160
179 179 -, g, t dbSNP:33979901
180 180 -, gagtccttt dbSNP:35637840
180 180 a, c, g, t dbSNP:33922842
181 181 a, c, g dbSNP:35262412
183 183 c, t dbSNP:373212989
184 184 c, g dbSNP:34868397
185 185 -, c dbSNP:80356820
186 186 -, t dbSNP:35133315
187 187 a, c, g, t dbSNP:33978338
189 189 a, g dbSNP:34743882
190 190 a, g dbSNP:35303218
192 192 a, c, g, t dbSNP:33932070
193 193 -, a dbSNP:35894115
193 193 a, c, g, t dbSNP:33980484
194 194 c, t dbSNP:754454495
196 196 -, atct dbSNP:35619054
196 196 c, g, t dbSNP:33952850
197 197 a, g dbSNP:750901840
198 198 agct, tccactcctgatgctgtta dbSNP:281864583
199 199 c, g, t dbSNP:33960931
201 201 a, t dbSNP:63750336
202 202 a, c, g dbSNP:34676051
203 203 c, t dbSNP:17850156
204 204 -, c dbSNP:63750128
204 204 c, t dbSNP:281864894
205 205 a, c, g dbSNP:33969727
206 206 c, t dbSNP:762111851
207 207 a, c, g, t dbSNP:33961886
208 208 a, c, g, t dbSNP:33919924
209 209 c, t dbSNP:777114006
210 210 a, g dbSNP:36005841
212 212 -, g dbSNP:35165357
214 214 a, t dbSNP:34037627
215 215 -, a dbSNP:35171933
215 215 c, t dbSNP:760975738
215 215 -, t dbSNP:34960334
217 217 a, t dbSNP:35094013
219 219 -, ggcaaccctaag dbSNP:63751103
219 219 c, g, t dbSNP:33935983
220 220 a, g dbSNP:34439278
221 221 c, t dbSNP:193922551
222 222 a, c, g dbSNP:33988732
223 223 a, c, g dbSNP:34589620
224 224 -, c dbSNP:35395625
224 224 a, c, g, t dbSNP:35278874
226 226 a, c, g dbSNP:33991472
228 228 -, a dbSNP:267607293
228 228 a, g, t dbSNP:33969400
229 229 a, c dbSNP:35537181
230 230 a, c, g, t dbSNP:34621955
231 231 c, g dbSNP:33990253
232 232 a, c, t dbSNP:33931779
234 234 a, c, g, t dbSNP:33995148
235 235 a, t dbSNP:34974709
236 236 c, g, t dbSNP:34446260
237 237 c, g dbSNP:34933455
238 238 a, c, t dbSNP:34151786
239 239 c, t dbSNP:770878031
240 240 a, c, t dbSNP:33922873
241 241 a, c, g dbSNP:33985544
242 242 c, t dbSNP:749118003
243 243 -, g dbSNP:36107977
244 244 a, c, g dbSNP:33922018
246 246 a, c dbSNP:35353749
247 247 a, t dbSNP:33932548
248 248 c, g, t dbSNP:35747961
249 249 a, g dbSNP:34165323
250 250 a, c dbSNP:35939489
251 251 -, a dbSNP:193922553
251 251 a, g, t dbSNP:36092904
252 252 -, gt dbSNP:34282684
252 252 a, g dbSNP:36008922
253 253 -, tg dbSNP:193922554
253 253 a, c, g, t dbSNP:33918343
255 255 c, t dbSNP:33961459
256 256 a, c, t dbSNP:33972593
257 257 c, t dbSNP:112287010
258 258 a, c, g dbSNP:33947415
259 259 -, gctcgg dbSNP:35902963
259 259 a, g dbSNP:34718174
261 261 c, g dbSNP:34409430
262 262 a, c, g, t dbSNP:33946401
264 264 c, t dbSNP:780759163
265 265 c, t dbSNP:34362537
266 266 -, a, t dbSNP:33969853
266 266 c, t dbSNP:754481448
267 267 agtga, t dbSNP:63751218
267 267 -, a dbSNP:606231217
269 269 -, t dbSNP:281864520
269 269 a, t dbSNP:34860414
270 270 a, g, t dbSNP:33945705
271 271 a, g, t dbSNP:33967755
273 273 -, ggcctg dbSNP:63750968
273 273 a, c, g dbSNP:33916541
274 274 a, g, t dbSNP:33976006
275 275 -, c dbSNP:34218908
276 276 -, ctg dbSNP:35452098
277 277 c, g, t dbSNP:33950542
279 279 -, gc dbSNP:281864906
279 279 c, g dbSNP:35286210
280 280 a, c, t dbSNP:33985847
280 280 -, c dbSNP:281864901
282 282 a, c, g, t dbSNP:33991294
282 282 -, c dbSNP:63750504
283 283 -, taaagca dbSNP:775936922
283 283 a, c, g, t dbSNP:33952543
284 284 c, g, t dbSNP:33918483
285 285 -, c dbSNP:281865475
286 286 g, t dbSNP:34870172
288 288 a, c, g, t dbSNP:33990858
289 289 a, g dbSNP:34173382
290 290 c, t dbSNP:764542454
291 291 a, c, g, t dbSNP:63750519
292 292 a, g dbSNP:34240746
293 293 a, c, g, t dbSNP:35890380
294 294 c, g dbSNP:11549406
295 295 a, g, t dbSNP:33936967
296 296 a, c, g dbSNP:145669504
297 297 a, c, g dbSNP:33940051
298 298 a, c, g, t dbSNP:33987903
299 299 c, g, t dbSNP:33991993
300 300 c, g, t dbSNP:33930385
300 300 -, g dbSNP:63751478
301 301 a, g, t dbSNP:1803195
301 301 -, g dbSNP:193922555
303 303 a, g dbSNP:35960772
304 304 a, c, t dbSNP:35914488
305 305 -, c dbSNP:35371965
307 307 c, t dbSNP:35693898
308 308 -, t dbSNP:34831847
309 309 a, c, g dbSNP:33952147
310 310 a, c, t dbSNP:35819837
312 312 -, aca dbSNP:63751171
312 312 a, c dbSNP:35553496
313 313 a, c, t dbSNP:33993568
315 315 c, g dbSNP:34672591
316 316 -, t dbSNP:34477959
316 316 c, g, t dbSNP:33940204
317 317 c, g dbSNP:11549405
318 318 a, c dbSNP:35351128
319 319 -, gt dbSNP:34466953
319 319 a, c, g dbSNP:33917628
321 321 a, g, t dbSNP:33913712
322 322 a, g dbSNP:35068498
323 323 c, g, t dbSNP:35002698
324 324 -, ctgcactgtgacaag dbSNP:34210688
324 324 c, t dbSNP:769583496
325 325 c, g, t dbSNP:33917785
325 325 -, t dbSNP:63751080
327 327 a, c, g, t dbSNP:33924775
328 328 a, c, g dbSNP:33974325
329 329 a, c, g dbSNP:34083951
330 330 c, t dbSNP:33972927
331 331 a, g dbSNP:35548921
333 333 -, tg dbSNP:34533941
333 333 a, c, g, t dbSNP:33959340
334 334 a, g dbSNP:34579351
335 335 -, gagctgcactgtgac dbSNP:63750620
335 335 c, t dbSNP:747900373
336 336 -, gagctgcactgtgac dbSNP:267607292
336 336 a, g dbSNP:33914359
337 337 -, a dbSNP:34937014
337 337 a, t dbSNP:35204496
338 338 c, g, t dbSNP:36038739
339 339 c, g dbSNP:34665886
340 340 c, t dbSNP:36081208
342 342 a, c, t dbSNP:33950993
343 343 -, acg dbSNP:63750837
343 343 a, c, t dbSNP:33951978
344 344 a, c, g, t dbSNP:34515413
345 345 a, g, t dbSNP:33933298
346 346 a, c, g, t dbSNP:33985510
348 348 a, c, g, t dbSNP:33954595
349 349 a, c, g, t dbSNP:33971048
350 350 a, g, t dbSNP:34013622
351 351 cc, tctgagaact dbSNP:63750556
351 351 a, c, g, t dbSNP:34692941
352 352 c, g, t dbSNP:33965000
353 353 c, t dbSNP:768336186
354 354 a, c, g dbSNP:33966487
355 355 a, c, g dbSNP:33937393
356 356 a, c, g, t dbSNP:35209591
357 357 a, c, t dbSNP:33927739
358 358 a, c, g dbSNP:33948057
359 359 a, c, g dbSNP:34227486
360 360 a, g, t dbSNP:33921589
362 362 c, g dbSNP:35067717
363 363 a, g, t dbSNP:34740366
364 364 a, c, g, t dbSNP:33911434
364 364 -, g dbSNP:63750774
365 365 c, g, t dbSNP:33914944
366 366 c, t dbSNP:34022507
367 367 c, t dbSNP:281864582
369 369 -, ctgggcaacgtg dbSNP:281864526
369 369 c, g dbSNP:63750596
370 370 a, c, g, t dbSNP:33941844
371 371 -, g dbSNP:35225141
372 372 -, g dbSNP:606231216
372 372 c, g dbSNP:35017910
373 373 a, g dbSNP:35519485
374 374 c, t dbSNP:193922562
375 375 a, c, g dbSNP:33958637
376 376 -, acgtgctggtct dbSNP:63750040
376 376 a, g, t dbSNP:33958739
377 377 a, c, g, t dbSNP:34933751
378 378 a, c, g, t dbSNP:33969677
378 378 -, g dbSNP:63751201
382 382 c, t dbSNP:35256489
384 384 c, g, t dbSNP:33957964
385 385 c, t dbSNP:35871407
387 387 c, t dbSNP:35849199
388 388 a, g, t dbSNP:33932908
389 389 a, g, t dbSNP:33930977
390 390 a, c, g, t dbSNP:34400584
390 390 -, g dbSNP:281865477
391 391 a, t dbSNP:34484056
393 393 ct, g dbSNP:41443947
393 393 a, c dbSNP:33917394
394 394 c, t dbSNP:36015961
395 395 -, tgtgctg dbSNP:281864527
396 396 c, g dbSNP:34945623
397 397 a, c, t dbSNP:35485099
399 399 -, gtgtgctggccc, tgat dbSNP:63751306
399 399 c, t dbSNP:34049764
400 400 -, gtgtgctggccc dbSNP:267607296
400 400 a, c, g, t dbSNP:33978082
401 401 a, g, t dbSNP:35209776
402 402 a, c, g, t dbSNP:33935527
403 403 a, c, g dbSNP:33935673
404 404 -, c dbSNP:281864528
405 405 g, t dbSNP:63750530
405 405 -, t dbSNP:35781690
406 406 a, c, g, t dbSNP:33928092
408 408 c, g dbSNP:281864584
409 409 a, c, g, t dbSNP:33947020
411 411 a, c, g dbSNP:33924134
412 412 a, t dbSNP:34303736
413 413 -, a dbSNP:34120553
413 413 a, c dbSNP:34726542
414 414 a, c, g, t dbSNP:33946267
415 415 a, c, g, t dbSNP:33987957
417 417 a, c, g, t dbSNP:33971848
418 418 c, t dbSNP:281864495
419 419 a, c, g, t dbSNP:33973589
420 420 -, accccacca dbSNP:281864902
420 420 -, a dbSNP:35238478
421 421 a, c, t dbSNP:33935383
422 422 c, t dbSNP:780307221
423 423 c, t dbSNP:35461710
424 424 a, c, g, t dbSNP:33983276
425 425 -, a dbSNP:281864544
425 425 -, a dbSNP:35323748
426 426 -, ccagtg dbSNP:281864529
426 426 c, g dbSNP:758591462
428 428 -, cca dbSNP:34843844
428 428 -, a dbSNP:34363638
429 429 c, g dbSNP:35658323
430 430 -, 17 bp deleted, tgcaggctgcctatcag dbSNP:63749815
430 430 -, tgcaggctgcctatcag dbSNP:750606223
430 430 a, c, g, t dbSNP:33925391
430 430 -, t dbSNP:63750022
432 432 a, c, g, t dbSNP:33971634
433 433 -, agg dbSNP:34502690
433 433 a, c, g dbSNP:33910569
435 435 ccaca, gctg dbSNP:63750860
435 435 a, c, g dbSNP:34139813
436 436 a, c, t dbSNP:33957286
438 438 a, c, g dbSNP:35939430
439 439 aa, ac, cc dbSNP:369582912
439 439 a, c, t dbSNP:111645889
441 441 g, t dbSNP:35834416
442 442 a, c, g dbSNP:33937535
443 443 a, t dbSNP:281864530
444 444 -, a dbSNP:281864531
444 444 a, c, g dbSNP:33910209
445 445 a, c, g dbSNP:33950778
446 446 -, ga dbSNP:63750320
446 446 c, g dbSNP:34188626
447 447 -, aaagtggtggc dbSNP:281864904
447 447 a, c, g, t dbSNP:33953406
448 448 a, c dbSNP:34398074
449 449 a, c, t dbSNP:33946775
450 450 a, c, g dbSNP:34095019
451 451 c, t dbSNP:35825479
452 452 a, c, g dbSNP:113082294
454 454 gcag, tggctggtgt dbSNP:63751152
454 454 a, c, g, t dbSNP:33966761
456 456 c, g dbSNP:35492035
457 457 a, c, t dbSNP:35669628
459 459 a, c, g, t dbSNP:33984863
460 460 a, c, g dbSNP:33949486
461 461 g, t dbSNP:770567827
462 462 a, g dbSNP:748704616
463 463 -, tggcta dbSNP:34068040
464 464 a, g dbSNP:777218911
465 465 -, gct dbSNP:34359964
465 465 a, c, g dbSNP:33919821
466 466 c, t dbSNP:35594230
468 468 a, g, t dbSNP:33910475
469 469 a, c dbSNP:34407387
470 470 a, c, t dbSNP:34240441
471 471 a, g dbSNP:34980264
472 472 a, c, t dbSNP:33927093
474 474 -, ctg dbSNP:33935780
474 474 -, c dbSNP:63750694
474 474 c, g dbSNP:33970699
475 475 -, tggcccaca dbSNP:34383403
475 475 g, t dbSNP:35854892
477 477 a, c, g dbSNP:33931806
478 478 -, cc dbSNP:281864497
478 478 a, c, t dbSNP:33921821
480 480 a, c, g, t dbSNP:33929415
481 481 -, a dbSNP:63749858
481 481 a, c, g, t dbSNP:33918338
482 482 a, c, g, t dbSNP:36020563
483 483 a, g, t dbSNP:33964352
484 484 -, a dbSNP:63751425
484 484 a, t dbSNP:33996892
485 485 a, c, g, t dbSNP:35020585
486 486 -, ct dbSNP:35660883
486 486 a, c, g, t dbSNP:33949869
487 487 a, g dbSNP:35117167
488 488 a, t dbSNP:35291591
489 489 c, g, t dbSNP:33961444
490 490 -, ca dbSNP:387906543
490 490 a, c, g, t dbSNP:33954264
491 491 -, ac, ta dbSNP:33999427
491 491 a, c, g dbSNP:33985739
495 495 a, g dbSNP:772342393
498 498 c, t dbSNP:372503204
499 499 a, g dbSNP:779043171
500 500 c, g dbSNP:34809925
503 503 c, t dbSNP:757391103
505 505 c, t dbSNP:753836653
508 508 c, t dbSNP:777802495
519 519 c, g dbSNP:755997419
521 521 a, g dbSNP:752593184
528 528 a, g dbSNP:200399660
531 531 c, g dbSNP:369307975
542 542 c, t dbSNP:759337708
544 544 a, g dbSNP:751286983
550 550 a, g dbSNP:537944366
565 565 a, g dbSNP:755824656
568 568 a, g dbSNP:369101035
575 575 a, g dbSNP:745310118
585 585 -, gcatctggattct dbSNP:34171453
585 585 a, g dbSNP:193922549
590 590 c, t dbSNP:34029390
591 591 c, g dbSNP:770911771
602 602 -, aataa dbSNP:35949130
603 603 -, at dbSNP:281864905
604 604 -, taaaa dbSNP:606231219
604 604 a, g dbSNP:35676421
604 604 -, ta dbSNP:63750205
604 604 a, c, t dbSNP:33978907
605 605 -, aa dbSNP:281864532
605 605 a, g dbSNP:63751128
606 606 a, g, t dbSNP:63750954
607 607 a, g dbSNP:33985472
610 610 a, c dbSNP:753171158
623 623 a, t dbSNP:528009939

Target ORF information:

RefSeq Version NM_000518
Organism Homo sapiens (human)
Definition Homo sapiens hemoglobin, beta (HBB), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.