
HTT cDNA ORF clone, Homo sapiens (human)

Gene Symbol HTT
Entrez Gene ID 3064
Full Name huntingtin
Synonyms HD, IT15
General protein information
Preferred Names
huntington disease protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range in the number of trinucleotide repeats has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Huntington disease, 143100 (3)

The following HTT gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HTT cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu23699 NM_002111 Homo sapiens huntingtin (HTT), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu23699
Accession Version NM_002111.7 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 9435bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product huntingtin
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL390059.10, L12392.1 and BC014028.2. On Feb 26, 2014 this sequence version replaced gi:90903230. Summary: Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range in the number of trinucleotide repeats has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly except in the CAG repeat region. The reference genome has a repeat region encoding 21 glutamines while the RefSeq has a repeat region (nt 197-265) encoding 23. Neither repeat region is associated with Huntington's Disease. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## regulatory uORF :: PMID: 12466534 ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: L12392.1, AB016794.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)172..172(+)
Misc Feature(2)182..182(+)
Misc Feature(3)192..257(+)
Misc Feature(4)323..355(+)
Misc Feature(5)341..343(+)
Misc Feature(6)368..436(+)
Misc Feature(7)848..850(+)
Misc Feature(8)932..1045(+)
Misc Feature(9)1022..1024(+)
Misc Feature(10)1058..1171(+)
Misc Feature(11)1268..1402(+)
Misc Feature(12)1349..1351(+)
Misc Feature(13)1553..1555(+)
Misc Feature(14)1577..1579(+)
Misc Feature(15)1607..1609(+)
Misc Feature(16)1616..1618(+)
Misc Feature(17)1616..1618(+)
Misc Feature(18)1646..1648(+)
Misc Feature(19)1853..1858(+)
Misc Feature(20)1853..1855(+)
Misc Feature(21)1904..1909(+)
Misc Feature(22)1970..1975(+)
Misc Feature(23)1970..1972(+)
Misc Feature(24)2072..2074(+)
Misc Feature(25)2081..2086(+)
Misc Feature(26)2726..2839(+)
Misc Feature(27)3026..3142(+)
Misc Feature(28)3857..3859(+)
Misc Feature(29)3857..3859(+)
Misc Feature(30)3905..3907(+)
Misc Feature(31)3917..3919(+)
Misc Feature(32)3917..3919(+)
Misc Feature(33)4853..4981(+)
Misc Feature(34)5930..5932(+)
Misc Feature(35)5942..5944(+)
Misc Feature(36)6542..6544(+)
Misc Feature(37)7505..7534(+)
Misc Feature(38)8273..8275(+)
Exon (1)1..585
Gene Synonym:
Exon (2)586..669
Gene Synonym:
Exon (3)670..790
Gene Synonym:
Exon (4)791..850
Gene Synonym:
Exon (5)851..930
Gene Synonym:
Exon (6)931..1069
Gene Synonym:
Exon (7)1070..1211
Gene Synonym:
Exon (8)1212..1390
Gene Synonym:
Exon (9)1391..1595
Gene Synonym:
Exon (10)1596..1643
Gene Synonym:
Exon (11)1644..1724
Gene Synonym:
Exon (12)1725..2065
Gene Synonym:
Exon (13)2066..2189
Gene Synonym:
Exon (14)2190..2308
Gene Synonym:
Exon (15)2309..2420
Gene Synonym:
Exon (16)2421..2558
Gene Synonym:
Exon (17)2559..2717
Gene Synonym:
Exon (18)2718..2815
Gene Synonym:
Exon (19)2816..2955
Gene Synonym:
Exon (20)2956..3019
Gene Synonym:
Exon (21)3020..3120
Gene Synonym:
Exon (22)3121..3267
Gene Synonym:
Exon (23)3268..3388
Gene Synonym:
Exon (24)3389..3465
Gene Synonym:
Exon (25)3466..3617
Gene Synonym:
Exon (26)3618..3820
Gene Synonym:
Exon (27)3821..3947
Gene Synonym:
Exon (28)3948..4075
Gene Synonym:
Exon (29)4076..4186
Gene Synonym:
Exon (30)4187..4264
Gene Synonym:
Exon (31)4265..4488
Gene Synonym:
Exon (32)4489..4567
Gene Synonym:
Exon (33)4568..4729
Gene Synonym:
Exon (34)4730..4785
Gene Synonym:
Exon (35)4786..4934
Gene Synonym:
Exon (36)4935..5071
Gene Synonym:
Exon (37)5072..5188
Gene Synonym:
Exon (38)5189..5311
Gene Synonym:
Exon (39)5312..5547
Gene Synonym:
Exon (40)5548..5690
Gene Synonym:
Exon (41)5691..5898
Gene Synonym:
Exon (42)5899..6040
Gene Synonym:
Exon (43)6041..6220
Gene Synonym:
Exon (44)6221..6397
Gene Synonym:
Exon (45)6398..6474
Gene Synonym:
Exon (46)6475..6613
Gene Synonym:
Exon (47)6614..6736
Gene Synonym:
Exon (48)6737..6950
Gene Synonym:
Exon (49)6951..7096
Gene Synonym:
Exon (50)7097..7274
Gene Synonym:
Exon (51)7275..7376
Gene Synonym:
Exon (52)7377..7564
Gene Synonym:
Exon (53)7565..7691
Gene Synonym:
Exon (54)7692..7792
Gene Synonym:
Exon (55)7793..7947
Gene Synonym:
Exon (56)7948..8087
Gene Synonym:
Exon (57)8088..8170
Gene Synonym:
Exon (58)8171..8301
Gene Synonym:
Exon (59)8302..8431
Gene Synonym:
Exon (60)8432..8587
Gene Synonym:
Exon (61)8588..8778
Gene Synonym:
Exon (62)8779..8893
Gene Synonym:
Exon (63)8894..9107
Gene Synonym:
Exon (64)9108..9213
Gene Synonym:
Exon (65)9214..9376
Gene Synonym:
Exon (66)9377..9537
Gene Synonym:
Exon (67)9538..13652
Gene Synonym:
Position Chain Variation Link
21 21 -, gcgggg dbSNP:113331544
30 30 a, g dbSNP:13132932
66 66 c, g dbSNP:550085802
70 70 g, t dbSNP:368519841
100 100 a, g dbSNP:563367097
103 103 c, t dbSNP:396875
104 104 -, ggccccgcctccgccggcgc dbSNP:558630166
148 148 c, t dbSNP:529080862
149 149 c, g dbSNP:758554007
169 169 a, g dbSNP:13102260
214 214 c, t dbSNP:146151652
221 221 c, g dbSNP:574494284
233 233 a, g dbSNP:201071630
266 266 a, g dbSNP:776247486
283 283 c, t dbSNP:761401391
287 287 a, c, g dbSNP:764754088
299 299 a, g dbSNP:760104459
301 301 c, t dbSNP:767899201
305 305 c, g, t dbSNP:753174534
322 322 c, g dbSNP:764460507
338 338 a, c dbSNP:754144476
374 374 -, cagcagcagcag dbSNP:778928198
374 374 -, cagcagcag dbSNP:757035717
374 374 -, cagcag dbSNP:374076986
374 374 -, cag dbSNP:745813868
377 377 -, cag dbSNP:769119880
377 377 -, aga dbSNP:757968833
388 388 -, caa, gc dbSNP:779781803
391 391 -, gc dbSNP:768407463
391 391 a, g dbSNP:757487802
392 392 -, agcagcagcagcagcagcaga dbSNP:776173565
394 394 -, gcag dbSNP:749598070
395 395 c, t dbSNP:779062371
398 398 -, agcagcagcagcagcagcagcagcagcagcagt dbSNP:771210394
400 400 -, gc dbSNP:774823060
403 403 -, gc dbSNP:760097851
403 403 a, g dbSNP:745920924
406 406 -, gcagcagcagcagcagcag dbSNP:775594517
406 406 -, gc dbSNP:767553699
409 409 -, gcagcagcagcagcagcag dbSNP:764336220
409 409 -, gcagcagcagcagcag dbSNP:760691860
411 411 -, ag dbSNP:754013273
415 415 -, gcagcagcagcagcagcaacag dbSNP:757020569
416 416 -, cagcagcagcagcagcaa dbSNP:765182345
418 418 -, gc dbSNP:750382879
421 421 -, gcagcag dbSNP:779692208
421 421 -, gc dbSNP:751281707
421 421 a, g dbSNP:758426055
424 424 -, gcag dbSNP:754481229
424 424 -, caa, gc dbSNP:780836193
424 424 a, g dbSNP:779821751
424 424 -, g dbSNP:746481543
426 426 a, c dbSNP:587777899
427 427 a, g dbSNP:9993357
427 427 -, g dbSNP:771317442
428 428 -, cagcaa dbSNP:772517171
429 429 -, ag dbSNP:776007201
429 429 a, c dbSNP:746852037
430 430 -, gca dbSNP:71180116
430 430 -, caa, cagcaa dbSNP:760743124
430 430 a, g dbSNP:756955307
432 432 -, aaca dbSNP:776899804
432 432 -, gc dbSNP:765098132
432 432 a, c dbSNP:61792465
433 433 -, acag dbSNP:762009695
433 433 -, g dbSNP:762866595
433 433 a, g dbSNP:473915
434 434 -, cagccgccaccgccgccgccgccgccgccgcctcctcagcttcct dbSNP:750297165
435 435 -, gcc, gccgccgcc dbSNP:751462292
435 435 a, c dbSNP:61792466
436 436 -, gccgccacc dbSNP:766382837
438 438 a, c dbSNP:768457728
440 440 -, cca dbSNP:780629353
441 441 acagccgcca, gcaacagccgccg dbSNP:66568705
441 441 a, c dbSNP:776374599
442 442 a, g dbSNP:76533208
443 443 -, ccg dbSNP:780554003
443 443 -, cc dbSNP:768777435
443 443 a, c dbSNP:747806296
445 445 a, g dbSNP:769382046
447 447 a, c dbSNP:772839428
448 448 a, g dbSNP:762367501
449 449 c, t dbSNP:768111121
450 450 a, c dbSNP:775838708
451 451 a, g dbSNP:761223545
453 453 -, cgccgccgccgcctcctcagcttcctcagccgccgccgcagg dbSNP:776614504
455 455 -, cgccgccgt dbSNP:762076760
456 456 a, c dbSNP:764556863
463 463 g, t dbSNP:9993367
466 466 -, tcctcagcttcctca dbSNP:766331938
466 466 g, t dbSNP:757609182
469 469 -, tcagcttcctca dbSNP:751507033
475 475 g, t dbSNP:603765
477 477 a, c dbSNP:765371096
478 478 a, t dbSNP:750554086
484 484 a, g, t dbSNP:758382723
503 503 c, t dbSNP:751533042
520 520 -, gccgcccccgcc dbSNP:759427040
531 531 a, c dbSNP:375917
588 588 a, g dbSNP:748879296
617 617 c, t dbSNP:770370500
618 618 a, g dbSNP:551783257
629 629 -, tgtc dbSNP:777339658
634 634 g, t dbSNP:144207123
638 638 a, g dbSNP:773112263
640 640 a, c dbSNP:140019482
650 650 -, at dbSNP:753504553
651 651 c, t dbSNP:370488438
667 667 c, t dbSNP:762235107
677 677 c, t dbSNP:745364744
679 679 a, g dbSNP:371965675
685 685 g, t dbSNP:375334095
686 686 c, g dbSNP:762329574
707 707 a, g dbSNP:77742164
712 712 a, g dbSNP:773562747
715 715 g, t dbSNP:763101668
718 718 -, t dbSNP:35934935
727 727 c, t dbSNP:368590997
728 728 a, g dbSNP:766612691
736 736 c, t dbSNP:751707112
737 737 a, g dbSNP:759582713
742 742 c, g dbSNP:372355130
746 746 g, t dbSNP:752654123
766 766 c, t dbSNP:756039631
786 786 c, t dbSNP:763809428
796 796 a, g dbSNP:759707352
797 797 a, g dbSNP:767616959
798 798 a, t dbSNP:775574195
800 800 g, t dbSNP:760587703
803 803 c, t dbSNP:764086232
824 824 c, t dbSNP:190411190
826 826 c, t dbSNP:200331534
838 838 a, g dbSNP:765071978
858 858 c, t dbSNP:751073765
863 863 c, t dbSNP:754491197
872 872 c, t dbSNP:780520733
877 877 c, t dbSNP:370428701
903 903 c, t dbSNP:757694541
905 905 c, t dbSNP:572251238
907 907 c, t dbSNP:184820567
910 910 c, g dbSNP:368339242
916 916 a, g, t dbSNP:771201253
929 929 a, g dbSNP:768810213
931 931 a, g dbSNP:770792045
936 936 a, t dbSNP:773952537
938 938 c, g dbSNP:759240419
941 941 a, c, g dbSNP:767064691
946 946 c, t dbSNP:760155173
954 954 c, t dbSNP:763544334
955 955 a, g dbSNP:750956107
966 966 a, g dbSNP:200499945
968 968 a, g dbSNP:181975967
970 970 a, c dbSNP:766775911
972 972 c, g dbSNP:567202171
975 975 a, g dbSNP:538952960
981 981 c, t dbSNP:374709608
982 982 c, t dbSNP:374267492
1003 1003 c, g dbSNP:781538201
1006 1006 c, g dbSNP:748290007
1012 1012 a, g dbSNP:756287335
1014 1014 c, t dbSNP:186355914
1016 1016 a, g dbSNP:749243291
1028 1028 a, g dbSNP:768084535
1031 1031 g, t dbSNP:770715895
1032 1032 -, t dbSNP:774058909
1035 1035 c, t dbSNP:199585002
1040 1040 g, t dbSNP:201015782
1042 1042 c, g, t dbSNP:771805830
1043 1043 a, c dbSNP:760279546
1044 1044 a, g dbSNP:763596808
1049 1049 a, g, t dbSNP:75790599
1050 1050 c, g dbSNP:766787858
1059 1059 a, g dbSNP:372086384
1075 1075 a, g dbSNP:779011165
1084 1084 c, t dbSNP:750331166
1089 1089 c, t dbSNP:1936033
1090 1090 a, g dbSNP:758270865
1093 1093 a, g dbSNP:779877604
1105 1105 c, t dbSNP:553893046
1109 1109 g, t dbSNP:746800754
1110 1110 c, t dbSNP:372182277
1114 1114 a, c dbSNP:768334951
1118 1118 a, g dbSNP:780688675
1121 1121 c, t dbSNP:747789499
1132 1132 a, g dbSNP:769223491
1133 1133 c, g dbSNP:772714975
1138 1138 a, g dbSNP:759974761
1145 1145 c, g dbSNP:772693748
1146 1146 g, t dbSNP:776065987
1148 1148 a, g dbSNP:761090796
1156 1156 c, t dbSNP:764503464
1157 1157 c, t dbSNP:754035925
1161 1161 a, g dbSNP:762027904
1168 1168 a, g dbSNP:765244606
1172 1172 a, g dbSNP:548352092
1175 1175 c, g dbSNP:758394244
1176 1176 a, g dbSNP:779932711
1177 1177 a, g dbSNP:751408145
1184 1184 c, t dbSNP:754793295
1202 1202 a, g dbSNP:781005553
1204 1204 a, g dbSNP:747763850
1207 1207 c, g dbSNP:1936032
1214 1214 g, t dbSNP:778497037
1217 1217 c, t dbSNP:747531751
1218 1218 c, t dbSNP:769192449
1219 1219 c, t dbSNP:776923517
1220 1220 a, g dbSNP:113106141
1228 1228 a, c, t dbSNP:199509618
1229 1229 a, g dbSNP:763123558
1233 1233 a, t dbSNP:766455633
1234 1234 c, t dbSNP:774359928
1238 1238 c, t dbSNP:759529263
1240 1240 c, t dbSNP:767485420
1242 1242 c, t dbSNP:375799747
1245 1245 c, t dbSNP:755917139
1248 1248 c, t dbSNP:748268128
1251 1251 c, t dbSNP:763755434
1261 1261 c, t dbSNP:370445860
1262 1262 a, g dbSNP:756912473
1264 1264 g, t dbSNP:778623401
1271 1271 a, t dbSNP:745362769
1288 1288 a, g dbSNP:374024704
1291 1291 c, t dbSNP:181961779
1297 1297 a, g dbSNP:755474246
1299 1299 a, t dbSNP:781707187
1300 1300 a, g dbSNP:748551283
1314 1314 a, g dbSNP:770229623
1329 1329 a, g dbSNP:770068718
1336 1336 c, t dbSNP:376129083
1337 1337 a, g dbSNP:773416184
1368 1368 c, t dbSNP:749530107
1372 1372 c, t dbSNP:771132356
1398 1398 a, g dbSNP:749648927
1402 1402 a, g dbSNP:771183477
1404 1404 c, t dbSNP:779086164
1405 1405 a, c, g dbSNP:114476023
1410 1410 a, g dbSNP:775372689
1420 1420 a, g dbSNP:760722683
1425 1425 a, c dbSNP:374501542
1427 1427 a, g dbSNP:776604857
1429 1429 a, c dbSNP:761675140
1436 1436 a, g dbSNP:561336868
1444 1444 c, t dbSNP:765073592
1448 1448 g, t dbSNP:750119892
1451 1451 c, t dbSNP:371255782
1459 1459 g, t dbSNP:766497085
1460 1460 c, t dbSNP:751611137
1479 1479 c, t dbSNP:751024193
1480 1480 a, g dbSNP:756715371
1489 1489 c, t dbSNP:759711755
1502 1502 a, g dbSNP:778221601
1510 1510 c, t dbSNP:1065745
1511 1511 a, g, t dbSNP:372410485
1514 1514 g, t dbSNP:746113648
1516 1516 c, g, t dbSNP:758534189
1525 1525 c, t dbSNP:747028454
1530 1530 a, g dbSNP:768758343
1537 1537 c, g, t dbSNP:374296062
1538 1538 a, g, t dbSNP:769713450
1539 1539 c, t dbSNP:552345404
1544 1544 a, c, g dbSNP:201948833
1556 1556 a, c, g dbSNP:773952851
1560 1560 g, t dbSNP:189018320
1563 1563 a, g dbSNP:754376057
1568 1568 c, t dbSNP:367833914
1569 1569 a, g, t dbSNP:550365309
1575 1575 a, g dbSNP:758686558
1593 1593 c, t dbSNP:201724304
1597 1597 a, t dbSNP:370043648
1598 1598 a, g dbSNP:777550215
1604 1604 g, t dbSNP:749200813
1605 1605 g, t dbSNP:770664572
1606 1606 c, t dbSNP:778704739
1615 1615 c, g dbSNP:745575339
1618 1618 -, aaa dbSNP:763654071
1619 1619 -, tttcttgaaagttt dbSNP:753486541
1633 1633 a, c dbSNP:771706603
1640 1640 a, g dbSNP:775019691
1641 1641 a, g dbSNP:773494415
1650 1650 c, g, t dbSNP:745630316
1652 1652 c, t dbSNP:779703721
1659 1659 a, g dbSNP:746623367
1665 1665 a, t dbSNP:768054595
1666 1666 a, t dbSNP:776146921
1668 1668 a, c dbSNP:376039050
1671 1671 c, g dbSNP:545932099
1692 1692 c, t dbSNP:771466498
1693 1693 a, g dbSNP:372601536
1698 1698 c, t dbSNP:759957822
1699 1699 a, g dbSNP:752111456
1711 1711 c, t dbSNP:775890141
1732 1732 a, g dbSNP:760866717
1746 1746 c, g dbSNP:376114909
1757 1757 c, g dbSNP:148032171
1763 1763 g, t dbSNP:761970709
1770 1770 a, g dbSNP:765256419
1777 1777 c, t dbSNP:536416239
1778 1778 a, g dbSNP:548696125
1783 1783 a, c dbSNP:553963536
1784 1784 c, g dbSNP:766218489
1793 1793 a, g dbSNP:751363615
1796 1796 c, g, t dbSNP:201739761
1797 1797 a, c, g dbSNP:199954376
1813 1813 a, c dbSNP:199926789
1821 1821 a, g dbSNP:777355677
1835 1835 c, t dbSNP:746393388
1842 1842 c, t dbSNP:772695901
1843 1843 a, g dbSNP:201861325
1850 1850 g, t dbSNP:747375128
1851 1851 c, t dbSNP:375880864
1856 1856 a, c, t dbSNP:200974872
1858 1858 a, g dbSNP:2301367
1866 1866 a, g dbSNP:769875151
1874 1874 a, t dbSNP:773265998
1877 1877 a, g dbSNP:762942925
1886 1886 a, c dbSNP:766273928
1892 1892 a, g dbSNP:537369613
1898 1898 a, g dbSNP:759397865
1901 1901 a, g dbSNP:767177058
1903 1903 a, g dbSNP:752403908
1911 1911 c, t dbSNP:755774511
1919 1919 a, t dbSNP:777486232
1931 1931 g, t dbSNP:753396182
1937 1937 a, g dbSNP:141760655
1939 1939 c, t dbSNP:573811022
1940 1940 a, g dbSNP:747431001
1943 1943 c, t dbSNP:781405304
1950 1950 a, t dbSNP:749285754
1956 1956 c, t dbSNP:770954122
1958 1958 a, g dbSNP:781353727
1959 1959 c, t dbSNP:748426123
1974 1974 a, g dbSNP:118005095
1982 1982 a, g, t dbSNP:773318017
1985 1985 c, t dbSNP:770869040
1987 1987 c, g dbSNP:774378512
1999 1999 c, t dbSNP:759324786
2000 2000 a, g dbSNP:767362413
2004 2004 c, g, t dbSNP:752424106
2007 2007 c, g, t dbSNP:267600138
2014 2014 c, t dbSNP:769961683
2015 2015 a, g dbSNP:542758323
2019 2019 a, c dbSNP:753489740
2020 2020 c, t dbSNP:756855367
2024 2024 a, g dbSNP:371803336
2039 2039 a, g dbSNP:752120055
2074 2074 c, t dbSNP:368866386
2075 2075 a, g dbSNP:764859997
2077 2077 c, t dbSNP:749896203
2080 2080 c, t dbSNP:372467345
2094 2094 c, t dbSNP:533978894
2104 2104 c, g dbSNP:753154849
2107 2107 a, t dbSNP:756503480
2110 2110 a, g dbSNP:746081714
2114 2114 c, t dbSNP:778045518
2116 2116 c, g, t dbSNP:749526137
2118 2118 a, g dbSNP:779119462
2127 2127 a, c dbSNP:745908618
2129 2129 -, gag dbSNP:749495049
2134 2134 a, g dbSNP:374816196
2144 2144 a, g dbSNP:553755514
2151 2151 c, t dbSNP:746873345
2153 2153 a, g dbSNP:768582246
2157 2157 a, g dbSNP:776553904
2158 2158 a, g dbSNP:761594212
2163 2163 c, t dbSNP:369429768
2165 2165 a, g dbSNP:576787839
2170 2170 c, t dbSNP:762394050
2171 2171 g, t dbSNP:372989695
2174 2174 a, c dbSNP:753207801
2178 2178 a, g dbSNP:756556553
2187 2187 c, t dbSNP:764504893
2196 2196 a, g dbSNP:151106561
2198 2198 a, c dbSNP:761240567
2204 2204 c, t dbSNP:779746400
2206 2206 c, g, t dbSNP:754280710
2209 2209 a, g dbSNP:374796460
2210 2210 g, t dbSNP:750620492
2212 2212 a, g dbSNP:560199502
2217 2217 a, g dbSNP:532096335
2220 2220 c, t dbSNP:367861014
2227 2227 c, t dbSNP:755012385
2235 2235 a, g dbSNP:781299127
2245 2245 c, g dbSNP:748080028
2246 2246 a, g dbSNP:201938386
2258 2258 a, c dbSNP:562787248
2264 2264 a, g dbSNP:748951866
2265 2265 c, t dbSNP:770570010
2274 2274 a, g dbSNP:773894460
2289 2289 c, t dbSNP:374016128
2290 2290 a, g dbSNP:768310332
2292 2292 c, g dbSNP:776198452
2300 2300 a, g dbSNP:547978890
2301 2301 a, t dbSNP:765574635
2305 2305 c, g dbSNP:750792768
2313 2313 a, g dbSNP:775048382
2315 2315 c, g, t dbSNP:748665877
2316 2316 a, g dbSNP:556061424
2319 2319 c, t dbSNP:763430638
2321 2321 a, g dbSNP:566297413
2327 2327 a, g dbSNP:774720521
2328 2328 a, t dbSNP:759776295
2330 2330 a, g dbSNP:747846880
2332 2332 c, t dbSNP:752818911
2342 2342 a, g dbSNP:756050443
2347 2347 c, t dbSNP:368592461
2349 2349 a, g dbSNP:372358763
2355 2355 c, t dbSNP:769455994
2357 2357 a, g dbSNP:753729045
2359 2359 a, c dbSNP:757077459
2360 2360 c, t dbSNP:778618061
2378 2378 c, t dbSNP:745573312
2379 2379 a, g dbSNP:758062108
2392 2392 c, t dbSNP:200648152
2394 2394 c, t dbSNP:779467594
2395 2395 a, g dbSNP:374740113
2406 2406 c, t dbSNP:775778616
2407 2407 -, agg dbSNP:774664263
2407 2407 -, ag dbSNP:771006148
2407 2407 -, a dbSNP:745583559
2407 2407 a, g dbSNP:368999999
2409 2409 a, g dbSNP:34389685
2415 2415 a, g dbSNP:749745276
2417 2417 a, g dbSNP:771436376
2419 2419 c, t dbSNP:774843202
2424 2424 g, t dbSNP:200178417
2430 2430 c, t dbSNP:768047421
2431 2431 a, g dbSNP:374485750
2435 2435 a, g dbSNP:775817515
2437 2437 a, g dbSNP:760746098
2449 2449 c, t dbSNP:768834935
2451 2451 c, g dbSNP:776683393
2452 2452 c, t dbSNP:761776008
2453 2453 a, g dbSNP:376881312
2460 2460 c, t dbSNP:750309243
2462 2462 c, g dbSNP:762835319
2465 2465 a, g dbSNP:766020850
2467 2467 c, t dbSNP:751237014
2477 2477 a, g dbSNP:370257023
2486 2486 a, g dbSNP:780916812
2488 2488 a, t dbSNP:752225360
2495 2495 c, t dbSNP:757889224
2498 2498 c, t dbSNP:200639978
2501 2501 c, g dbSNP:746323235
2502 2502 c, t dbSNP:772494183
2503 2503 a, g dbSNP:201616388
2526 2526 a, g dbSNP:376441426
2530 2530 a, c dbSNP:780228204
2537 2537 c, g dbSNP:747319957
2547 2547 c, t dbSNP:41264721
2548 2548 a, g dbSNP:370554692
2554 2554 c, t dbSNP:761902548
2559 2559 a, g dbSNP:769875403
2562 2562 a, t dbSNP:773152506
2563 2563 a, g dbSNP:374614171
2565 2565 a, g dbSNP:770742584
2568 2568 a, g dbSNP:774253874
2584 2584 a, g dbSNP:367585953
2588 2588 c, t dbSNP:759427975
2593 2593 c, t dbSNP:554758989
2616 2616 a, g dbSNP:750937938
2625 2625 c, t dbSNP:775289211
2630 2630 a, g, t dbSNP:371462947
2657 2657 a, g dbSNP:753252068
2659 2659 c, t dbSNP:758988560
2660 2660 c, g dbSNP:766813539
2670 2670 c, g dbSNP:752064671
2672 2672 c, t dbSNP:375919976
2673 2673 a, g dbSNP:781477850
2674 2674 c, t dbSNP:748426062
2675 2675 g, t dbSNP:756325495
2676 2676 c, t dbSNP:150027738
2678 2678 c, t dbSNP:749307525
2680 2680 c, t dbSNP:778548023
2681 2681 a, g dbSNP:201760820
2698 2698 c, t dbSNP:745736020
2700 2700 c, g dbSNP:772010595
2703 2703 c, t dbSNP:775415876
2704 2704 g, t dbSNP:760440086
2709 2709 c, t dbSNP:763628687
2710 2710 a, c dbSNP:776295791
2716 2716 a, g dbSNP:761257792
2721 2721 a, g dbSNP:768454643
2725 2725 a, g dbSNP:776151196
2730 2730 a, c dbSNP:776022895
2733 2733 g, t dbSNP:769244324
2736 2736 c, t dbSNP:140979048
2737 2737 a, g dbSNP:760077091
2738 2738 g, t dbSNP:374344267
2742 2742 g, t dbSNP:753154907
2755 2755 a, g dbSNP:760979498
2756 2756 c, t dbSNP:377013397
2757 2757 a, g dbSNP:754023489
2767 2767 a, g dbSNP:756338378
2779 2779 g, t dbSNP:778931192
2781 2781 c, t dbSNP:370174870
2783 2783 g, t dbSNP:780172122
2802 2802 g, t dbSNP:758500664
2805 2805 c, t dbSNP:780168812
2809 2809 c, t dbSNP:746873728
2825 2825 a, g dbSNP:765575039
2826 2826 c, t dbSNP:199977680
2839 2839 c, t dbSNP:201808770
2844 2844 c, g dbSNP:766506689
2848 2848 c, t dbSNP:751507529
2850 2850 c, g dbSNP:754937373
2867 2867 c, t dbSNP:780888891
2875 2875 c, t dbSNP:747953296
2876 2876 a, g dbSNP:370452437
2899 2899 c, t dbSNP:755817126
2901 2901 c, g dbSNP:777435814
2904 2904 a, g dbSNP:191504584
2906 2906 c, t dbSNP:374030445
2912 2912 a, g dbSNP:376122624
2913 2913 g, t dbSNP:773841013
2915 2915 a, g dbSNP:747539489
2923 2923 g, t dbSNP:769180000
2924 2924 c, t dbSNP:573256108
2929 2929 a, g dbSNP:539073497
2936 2936 c, g dbSNP:765627376
2939 2939 g, t dbSNP:773579794
2940 2940 c, t dbSNP:763251849
2951 2951 c, t dbSNP:370786198
2988 2988 a, c dbSNP:192933099
2993 2993 c, g dbSNP:373663711
2996 2996 a, c dbSNP:773706502
2997 2997 a, g dbSNP:763305431
2999 2999 a, g dbSNP:363075
3011 3011 g, t dbSNP:774387724
3020 3020 c, g dbSNP:749684122
3027 3027 a, c, g dbSNP:771354654
3039 3039 a, g dbSNP:759627085
3048 3048 a, g dbSNP:772241091
3053 3053 g, t dbSNP:575417138
3055 3055 c, t dbSNP:368226353
3070 3070 g, t dbSNP:764001870
3080 3080 a, g dbSNP:80100842
3084 3084 c, t dbSNP:376581329
3092 3092 a, c, t dbSNP:761630952
3099 3099 g, t dbSNP:750142357
3103 3103 c, t dbSNP:188101620
3104 3104 a, g dbSNP:369875192
3105 3105 c, t dbSNP:751102910
3107 3107 a, g dbSNP:754479924
3112 3112 a, g dbSNP:374101392
3115 3115 a, g dbSNP:749771960
3125 3125 c, g dbSNP:765962850
3127 3127 c, g dbSNP:751190890
3130 3130 a, g dbSNP:368961206
3133 3133 a, g dbSNP:767086134
3151 3151 a, c dbSNP:754444814
3162 3162 c, g dbSNP:757672786
3167 3167 a, c dbSNP:549028339
3170 3170 g, t dbSNP:372725851
3176 3176 g, t dbSNP:758729035
3178 3178 a, c, t dbSNP:376025717
3179 3179 a, c, g dbSNP:370523524
3186 3186 a, g dbSNP:748186259
3193 3193 a, g dbSNP:373096447
3208 3208 a, g dbSNP:749273603
3211 3211 a, g dbSNP:374861629
3219 3219 c, t dbSNP:766158024
3226 3226 c, g dbSNP:774168210
3228 3228 c, t dbSNP:759239953
3229 3229 a, g, t dbSNP:377400054
3232 3232 c, g dbSNP:371088688
3243 3243 a, g dbSNP:765673009
3244 3244 a, t dbSNP:750870810
3251 3251 a, g, t dbSNP:758715607
3253 3253 a, c, t dbSNP:767738365
3255 3255 a, g dbSNP:781308516
3260 3260 a, g dbSNP:748191542
3261 3261 c, t dbSNP:769845761
3275 3275 a, g dbSNP:755280787
3278 3278 a, g dbSNP:781398411
3280 3280 c, t dbSNP:752925380
3282 3282 a, g dbSNP:756171588
3287 3287 c, g dbSNP:777886128
3303 3303 c, g, t dbSNP:190593027
3305 3305 c, g dbSNP:529896829
3306 3306 a, c dbSNP:368495667
3307 3307 c, t dbSNP:76822705
3308 3308 a, g dbSNP:775032858
3320 3320 a, g dbSNP:760357658
3339 3339 c, t dbSNP:768095485
3342 3342 a, c dbSNP:372185076
3349 3349 a, t dbSNP:566509879
3366 3366 c, t dbSNP:532656548
3369 3369 c, t dbSNP:373299691
3370 3370 a, g dbSNP:763513508
3373 3373 c, t dbSNP:766887224
3376 3376 c, t dbSNP:751999232
3380 3380 a, g dbSNP:759925895
3383 3383 c, t dbSNP:767875953
3394 3394 a, g dbSNP:369197307
3399 3399 g, t dbSNP:754044475
3404 3404 a, g dbSNP:757439222
3411 3411 a, g, t dbSNP:765355875
3421 3421 a, c dbSNP:758410717
3430 3430 c, t dbSNP:527729099
3431 3431 c, t dbSNP:779774557
3433 3433 a, g dbSNP:746837287
3449 3449 g, t dbSNP:200289562
3458 3458 c, t dbSNP:376638534
3473 3473 c, t dbSNP:377475502
3480 3480 a, g dbSNP:777321721
3484 3484 c, t dbSNP:748808337
3488 3488 c, g dbSNP:370372155
3489 3489 a, c, g dbSNP:78958847
3505 3505 c, g dbSNP:747420977
3511 3511 c, t dbSNP:202105394
3512 3512 a, g dbSNP:35892913
3527 3527 a, g dbSNP:41264725
3540 3540 a, t dbSNP:770156701
3547 3547 a, g dbSNP:144035877
3555 3555 c, g dbSNP:372507485
3560 3560 c, t dbSNP:766323111
3563 3563 c, g, t dbSNP:751565846
3566 3566 a, c, g dbSNP:1065746
3571 3571 c, g dbSNP:752476017
3595 3595 g, t dbSNP:1143646
3598 3598 c, g dbSNP:777405862
3601 3601 c, t dbSNP:561719779
3602 3602 a, g dbSNP:756811966
3619 3619 c, t dbSNP:748617301
3621 3621 a, g dbSNP:756595959
3628 3628 c, g dbSNP:777970195
3630 3630 a, g dbSNP:749592234
3631 3631 a, g dbSNP:374733848
3658 3658 a, g dbSNP:774572565
3663 3663 a, c dbSNP:529839694
3666 3666 c, g dbSNP:1065747
3668 3668 a, c dbSNP:371584472
3671 3671 c, t dbSNP:760579913
3672 3672 a, c dbSNP:763913942
3676 3676 a, c dbSNP:376205282
3684 3684 a, g dbSNP:761614790
3694 3694 a, g dbSNP:764804475
3696 3696 a, t dbSNP:750056537
3704 3704 a, g dbSNP:758007776
3717 3717 a, g dbSNP:542613235
3720 3720 c, t dbSNP:753296551
3722 3722 c, g dbSNP:753009860
3725 3725 c, g dbSNP:369374727
3727 3727 a, g dbSNP:778259334
3730 3730 c, t dbSNP:200581635
3739 3739 a, g dbSNP:757573368
3747 3747 a, t dbSNP:767099503
3748 3748 c, t dbSNP:374106761
3754 3754 c, t dbSNP:528411716
3784 3784 c, t dbSNP:377680756
3785 3785 a, g dbSNP:373038776
3792 3792 a, g dbSNP:369912429
3797 3797 a, g dbSNP:768494083
3803 3803 c, g dbSNP:776567768
3811 3811 c, g, t dbSNP:761548179
3812 3812 a, g dbSNP:772789582
3813 3813 c, g dbSNP:762663975
3815 3815 a, g dbSNP:377592444
3822 3822 a, c dbSNP:2530588
3839 3839 a, g dbSNP:3025843
3848 3848 c, g dbSNP:781017733
3849 3849 c, g dbSNP:748098904
3856 3856 a, g dbSNP:145260975
3878 3878 a, g dbSNP:377136871
3888 3888 a, g dbSNP:762754007
3901 3901 a, c dbSNP:770722828
3904 3904 a, g dbSNP:370598749
3908 3908 a, g dbSNP:774079991
3910 3910 a, g dbSNP:759146717
3912 3912 c, t dbSNP:767004706
3913 3913 a, g dbSNP:181975938
3914 3914 c, t dbSNP:762346343
3939 3939 c, g dbSNP:374256421
3941 3941 a, g dbSNP:750769979
3943 3943 g, t dbSNP:758697809
3948 3948 -, ctt dbSNP:753059369
3953 3953 a, g dbSNP:763332436
3964 3964 c, t dbSNP:766711727
3967 3967 c, g dbSNP:751823591
3972 3972 g, t dbSNP:755225220
3991 3991 a, g dbSNP:767551378
3992 3992 g, t dbSNP:752837562
4014 4014 a, g dbSNP:756082346
4022 4022 c, g, t dbSNP:369426776
4027 4027 a, g dbSNP:757165713
4031 4031 a, c dbSNP:188342053
4039 4039 g, t dbSNP:757788948
4063 4063 c, t dbSNP:771738411
4064 4064 a, g dbSNP:376975573
4081 4081 g, t dbSNP:554706707
4082 4082 c, g dbSNP:369972338
4095 4095 a, g dbSNP:373022404
4096 4096 c, t dbSNP:756238747
4101 4101 c, t dbSNP:34315806
4102 4102 a, g dbSNP:753867386
4113 4113 a, g dbSNP:757251653
4116 4116 a, g dbSNP:778905754
4117 4117 a, g dbSNP:370729504
4123 4123 c, t dbSNP:363099
4124 4124 c, t dbSNP:779780620
4125 4125 a, g dbSNP:199529839
4144 4144 c, t dbSNP:544889425
4154 4154 c, t dbSNP:780679517
4179 4179 c, t dbSNP:749852277
4207 4207 a, g dbSNP:534902248
4213 4213 g, t dbSNP:143701263
4224 4224 g, t dbSNP:562588062
4226 4226 a, c dbSNP:772526571
4232 4232 -, g dbSNP:35325925
4238 4238 a, g dbSNP:775713671
4240 4240 a, g dbSNP:374335589
4272 4272 a, g dbSNP:769986597
4274 4274 a, c dbSNP:773156677
4285 4285 c, t dbSNP:763031471
4295 4295 a, g dbSNP:766233086
4300 4300 c, g dbSNP:774233125
4310 4310 g, t dbSNP:759349849
4328 4328 a, g dbSNP:767275777
4335 4335 c, t dbSNP:752386077
4340 4340 a, g dbSNP:755716834
4342 4342 a, c, t dbSNP:763717287
4343 4343 c, g dbSNP:370058955
4350 4350 a, g dbSNP:373541628
4351 4351 a, g dbSNP:747466560
4352 4352 c, t dbSNP:200657357
4353 4353 a, g dbSNP:781689831
4358 4358 a, g dbSNP:748443250
4361 4361 c, t dbSNP:769925892
4370 4370 a, g dbSNP:773417425
4375 4375 a, g dbSNP:749359583
4378 4378 a, g dbSNP:770996085
4385 4385 c, t dbSNP:530203169
4393 4393 c, t dbSNP:368966300
4397 4397 c, t dbSNP:767363684
4401 4401 c, t dbSNP:775248431
4407 4407 c, t dbSNP:760456042
4408 4408 a, g dbSNP:763657521
4413 4413 c, t dbSNP:753489268
4417 4417 c, t dbSNP:756739222
4425 4425 a, c dbSNP:764816184
4429 4429 c, t dbSNP:752180387
4432 4432 c, t dbSNP:755530204
4438 4438 c, t dbSNP:760187406
4441 4441 c, t dbSNP:538068374
4449 4449 a, g dbSNP:756465411
4454 4454 a, g dbSNP:372734580
4464 4464 c, t dbSNP:546814369
4465 4465 a, g dbSNP:771036396
4475 4475 a, c, g dbSNP:3025837
4485 4485 c, t dbSNP:60135671
4486 4486 a, g dbSNP:772006950
4487 4487 a, g dbSNP:775338972
4502 4502 c, t dbSNP:374630949
4506 4506 a, g dbSNP:367600613
4511 4511 a, g dbSNP:761644475
4512 4512 c, t dbSNP:769574411
4519 4519 a, c dbSNP:199658140
4522 4522 a, g dbSNP:762578142
4523 4523 g, t dbSNP:765968177
4538 4538 a, g dbSNP:551881912
4539 4539 c, t dbSNP:761236930
4540 4540 a, g dbSNP:764420910
4547 4547 a, t dbSNP:370382867
4550 4550 a, g dbSNP:757547153
4556 4556 c, t dbSNP:754826573
4557 4557 a, g dbSNP:201053245
4558 4558 g, t dbSNP:750594536
4572 4572 c, g dbSNP:372640158
4573 4573 g, t dbSNP:781216636
4577 4577 a, c dbSNP:375899948
4580 4580 a, t dbSNP:756016368
4589 4589 c, t dbSNP:151199221
4590 4590 a, g dbSNP:777708796
4593 4593 c, t dbSNP:749003535
4594 4594 a, g dbSNP:544081670
4597 4597 c, t dbSNP:773805244
4627 4627 g, t dbSNP:745410877
4632 4632 c, t dbSNP:760144960
4633 4633 a, g dbSNP:771433441
4642 4642 a, g dbSNP:199875867
4644 4644 c, g dbSNP:372479051
4649 4649 c, g dbSNP:770208479
4652 4652 c, t dbSNP:529932015
4657 4657 a, g dbSNP:370860020
4670 4670 a, g dbSNP:199843834
4673 4673 a, t dbSNP:751683630
4680 4680 c, t dbSNP:759714607
4682 4682 c, t dbSNP:767467442
4686 4686 a, t dbSNP:748918563
4687 4687 c, g dbSNP:752750776
4688 4688 g, t dbSNP:756111223
4705 4705 c, t dbSNP:777792526
4727 4727 a, c dbSNP:753687423
4735 4735 c, t dbSNP:377269192
4743 4743 g, t dbSNP:757123370
4747 4747 a, g dbSNP:778540858
4756 4756 a, g dbSNP:750154915
4757 4757 a, t dbSNP:757973318
4759 4759 c, t dbSNP:779617267
4766 4766 a, c dbSNP:746555646
4777 4777 c, t dbSNP:369637161
4781 4781 c, t dbSNP:201715538
4782 4782 a, t dbSNP:749731556
4789 4789 a, g dbSNP:780679434
4799 4799 a, g dbSNP:765822494
4805 4805 c, t dbSNP:757721942
4816 4816 c, t dbSNP:779406995
4834 4834 a, g dbSNP:555724134
4840 4840 c, t dbSNP:772512001
4844 4844 c, t dbSNP:572039089
4848 4848 a, g dbSNP:747202535
4856 4856 a, c, g dbSNP:768923708
4877 4877 a, g dbSNP:761892994
4887 4887 a, g dbSNP:374828999
4894 4894 c, t dbSNP:773155101
4899 4899 a, g dbSNP:534610900
4905 4905 c, t dbSNP:766132068
4907 4907 g, t dbSNP:751283431
4908 4908 c, t dbSNP:377474866
4924 4924 c, t dbSNP:767143652
4925 4925 a, g dbSNP:547835549
4928 4928 a, g dbSNP:370489589
4929 4929 c, t dbSNP:752156281
4936 4936 c, t dbSNP:769831958
4940 4940 c, g dbSNP:777899356
4941 4941 c, t dbSNP:749310222
4960 4960 c, g dbSNP:116293982
4963 4963 c, t dbSNP:774235259
4964 4964 a, g dbSNP:770827394
4966 4966 c, t dbSNP:774192417
4967 4967 c, t dbSNP:771873458
4971 4971 a, t dbSNP:775042917
4972 4972 c, t dbSNP:372366590
4974 4974 c, t dbSNP:374644521
4975 4975 a, g dbSNP:571189591
4986 4986 c, t dbSNP:363129
5030 5030 a, g dbSNP:761339971
5048 5048 c, t dbSNP:767022920
5050 5050 a, g dbSNP:560525346
5051 5051 a, g dbSNP:755338707
5074 5074 a, g dbSNP:764325457
5075 5075 c, t dbSNP:754034503
5087 5087 a, g dbSNP:745531676
5099 5099 a, c dbSNP:778957160
5101 5101 a, g dbSNP:377681939
5125 5125 c, t dbSNP:758368404
5126 5126 a, g dbSNP:535922193
5134 5134 a, g dbSNP:779787029
5136 5136 g, t dbSNP:746851644
5140 5140 g, t dbSNP:768521111
5149 5149 c, g dbSNP:776464028
5156 5156 c, g dbSNP:747798867
5167 5167 c, g dbSNP:769488066
5195 5195 a, c dbSNP:761162561
5196 5196 c, t dbSNP:769065079
5197 5197 c, t dbSNP:776990415
5210 5210 a, g dbSNP:762097336
5213 5213 c, t dbSNP:765473338
5220 5220 g, t dbSNP:750561652
5224 5224 a, c dbSNP:763141300
5240 5240 a, g dbSNP:776784564
5253 5253 c, g dbSNP:766366088
5254 5254 c, t dbSNP:751572784
5259 5259 g, t dbSNP:754981618
5262 5262 g, t dbSNP:781211490
5266 5266 a, c, g dbSNP:752574723
5273 5273 a, t dbSNP:574979338
5276 5276 c, t dbSNP:748865736
5282 5282 c, t dbSNP:201149918
5283 5283 a, g dbSNP:778270890
5286 5286 a, g dbSNP:745321328
5290 5290 g, t dbSNP:769153414
5293 5293 c, t dbSNP:199866794
5294 5294 a, g dbSNP:748839698
5313 5313 c, t dbSNP:368118407
5314 5314 a, g dbSNP:749602044
5317 5317 c, t dbSNP:367607468
5321 5321 a, g dbSNP:774669216
5324 5324 a, g dbSNP:759741560
5325 5325 a, c, t dbSNP:201729743
5332 5332 a, g dbSNP:760512155
5333 5333 c, t dbSNP:375932093
5343 5343 c, t dbSNP:753577443
5344 5344 a, g dbSNP:757034900
5350 5350 c, t dbSNP:764818789
5353 5353 a, g dbSNP:750054956
5364 5364 a, g dbSNP:34781439
5366 5366 g, t dbSNP:757943781
5371 5371 g, t dbSNP:778433118
5384 5384 a, g dbSNP:558314003
5385 5385 a, c dbSNP:369275219
5394 5394 c, t dbSNP:372272991
5398 5398 c, t dbSNP:756584702
5401 5401 c, t dbSNP:778305991
5405 5405 c, t dbSNP:534626654
5406 5406 a, g dbSNP:771308830
5421 5421 c, g, t dbSNP:774757519
5429 5429 c, t dbSNP:772331780
5430 5430 c, t dbSNP:775722498
5431 5431 a, g dbSNP:760738948
5444 5444 c, t dbSNP:150003356
5459 5459 a, g dbSNP:776580135
5467 5467 a, g dbSNP:761560295
5468 5468 a, g dbSNP:764984504
5470 5470 c, t dbSNP:750141650
5473 5473 g, t dbSNP:762607326
5481 5481 a, c dbSNP:363125
5486 5486 a, g dbSNP:751063803
5487 5487 c, t dbSNP:374347047
5488 5488 a, g dbSNP:748999283
5497 5497 a, c dbSNP:754341933
5502 5502 a, g dbSNP:554453838
5503 5503 c, t dbSNP:779412302
5507 5507 a, g dbSNP:746173777
5516 5516 a, g dbSNP:772424546
5518 5518 a, g dbSNP:780702151
5519 5519 a, c dbSNP:780381130
5527 5527 g, t dbSNP:747079499
5528 5528 c, t dbSNP:768757254
5533 5533 a, g dbSNP:377275039
5546 5546 a, t dbSNP:776471892
5552 5552 c, g dbSNP:759217635
5554 5554 a, g dbSNP:201380622
5556 5556 a, t dbSNP:61731805
5558 5558 c, g dbSNP:775066827
5563 5563 c, g, t dbSNP:374357492
5573 5573 c, g dbSNP:368601624
5579 5579 a, g dbSNP:140357956
5582 5582 a, g dbSNP:775447952
5585 5585 a, g dbSNP:758872041
5597 5597 a, c dbSNP:766761435
5602 5602 a, g dbSNP:767041300
5616 5616 g, t dbSNP:751785967
5637 5637 a, g dbSNP:755233398
5647 5647 a, g dbSNP:781232530
5651 5651 a, g dbSNP:748248224
5653 5653 c, t dbSNP:756162173
5660 5660 c, t dbSNP:182113414
5662 5662 a, c, g dbSNP:371791011
5667 5667 c, g dbSNP:774205436
5672 5672 a, t dbSNP:745587725
5674 5674 c, g dbSNP:771791509
5677 5677 c, t dbSNP:200557996
5693 5693 a, g dbSNP:371907257
5710 5710 a, g dbSNP:376884113
5714 5714 c, g dbSNP:201422844
5721 5721 c, g dbSNP:775324194
5725 5725 c, g dbSNP:368226123
5726 5726 a, c dbSNP:768339882
5729 5729 c, t dbSNP:776295296
5731 5731 a, c dbSNP:761366688
5732 5732 c, t dbSNP:771490920
5733 5733 a, g dbSNP:774697439
5736 5736 a, g dbSNP:759983703
5745 5745 a, g dbSNP:767765978
5746 5746 -, gggg dbSNP:149906530
5746 5746 c, t dbSNP:752971037
5749 5749 c, t dbSNP:760896983
5757 5757 a, t dbSNP:764230987
5764 5764 c, g dbSNP:201878423
5776 5776 c, g dbSNP:757238419
5783 5783 a, c, t dbSNP:201058625
5784 5784 a, g dbSNP:758282669
5789 5789 c, t dbSNP:779984163
5807 5807 -, c dbSNP:34673947
5812 5812 c, g dbSNP:746742974
5818 5818 a, c, g dbSNP:768427619
5821 5821 a, g dbSNP:567423277
5822 5822 c, t dbSNP:542532871
5824 5824 a, g dbSNP:774987386
5840 5840 c, t dbSNP:759944153
5845 5845 a, g dbSNP:772569799
5846 5846 c, g dbSNP:775833457
5857 5857 c, t dbSNP:760984580
5865 5865 a, t dbSNP:764327117
5869 5869 c, g dbSNP:558887183
5894 5894 a, c dbSNP:761996912
5895 5895 c, t dbSNP:377136202
5900 5900 a, c dbSNP:767405087
5906 5906 a, c dbSNP:752477452
5913 5913 c, g dbSNP:755723185
5920 5920 -, aa dbSNP:758440091
5925 5925 c, t dbSNP:570452073
5935 5935 c, t dbSNP:373095544
5938 5938 c, g dbSNP:377417767
5941 5941 a, g dbSNP:756742109
5951 5951 c, g dbSNP:780583078
5956 5956 a, g dbSNP:747514141
5970 5970 c, t dbSNP:769069422
5976 5976 a, g dbSNP:200824667
5978 5978 c, t dbSNP:748480586
5980 5980 c, t dbSNP:769942416
5986 5986 a, g dbSNP:199576985
5989 5989 c, t dbSNP:370970140
5991 5991 a, g dbSNP:766561678
6017 6017 c, t dbSNP:774487403
6020 6020 a, g dbSNP:368615371
6040 6040 c, t dbSNP:759556699
6060 6060 c, g dbSNP:760430500
6062 6062 a, g dbSNP:763949259
6072 6072 c, t dbSNP:753549693
6073 6073 a, g dbSNP:761470964
6081 6081 c, t dbSNP:573638413
6082 6082 a, t dbSNP:370378706
6100 6100 a, t dbSNP:757855800
6118 6118 c, t dbSNP:374956035
6125 6125 c, t dbSNP:753243984
6128 6128 a, g dbSNP:756492388
6140 6140 a, c dbSNP:367944462
6146 6146 a, g dbSNP:749595078
6148 6148 c, t dbSNP:746695006
6149 6149 a, g dbSNP:201639415
6155 6155 c, t dbSNP:202046922
6160 6160 c, t dbSNP:552576817
6163 6163 c, t dbSNP:772163663
6168 6168 c, t dbSNP:775360501
6172 6172 c, t dbSNP:201305332
6173 6173 a, g dbSNP:768422636
6176 6176 c, t dbSNP:776416220
6178 6178 g, t dbSNP:761558966
6187 6187 a, g dbSNP:368505061
6191 6191 a, g dbSNP:372193344
6201 6201 -, gtt dbSNP:754758751
6201 6201 a, g dbSNP:762436871
6218 6218 a, g dbSNP:765899661
6220 6220 g, t dbSNP:750974070
6221 6221 c, t dbSNP:769547244
6222 6222 c, t dbSNP:772907348
6227 6227 a, g dbSNP:762679059
6229 6229 a, c, g dbSNP:765879624
6240 6240 c, t dbSNP:758918879
6245 6245 c, g dbSNP:764742757
6247 6247 a, g dbSNP:754361449
6251 6251 c, t dbSNP:757766529
6253 6253 a, g dbSNP:765688336
6259 6259 a, g dbSNP:201094471
6262 6262 c, g dbSNP:200125263
6270 6270 c, g dbSNP:780100750
6274 6274 a, g, t dbSNP:199609576
6276 6276 c, t dbSNP:781149163
6277 6277 a, g dbSNP:369232462
6281 6281 a, g dbSNP:769661115
6291 6291 c, t dbSNP:772994297
6292 6292 a, g dbSNP:748994859
6305 6305 a, t dbSNP:770636484
6319 6319 c, t dbSNP:200077637
6326 6326 c, t dbSNP:759121416
6327 6327 a, g dbSNP:201159417
6338 6338 c, t dbSNP:777338986
6339 6339 a, g dbSNP:762427543
6340 6340 c, t dbSNP:765774656
6341 6341 a, g dbSNP:770148024
6346 6346 c, t dbSNP:750833956
6347 6347 a, g dbSNP:773337081
6353 6353 a, c dbSNP:766675683
6354 6354 c, t dbSNP:751702059
6362 6362 c, t dbSNP:566885635
6363 6363 a, g dbSNP:781260492
6365 6365 c, t dbSNP:752705093
6366 6366 a, g dbSNP:756076211
6374 6374 a, c dbSNP:777519710
6377 6377 a, c dbSNP:749152360
6380 6380 c, t dbSNP:770599158
6389 6389 a, g dbSNP:778690669
6392 6392 g, t dbSNP:745497814
6399 6399 a, g dbSNP:771886064
6404 6404 a, g dbSNP:779808322
6407 6407 a, g dbSNP:746567137
6408 6408 c, t dbSNP:540936636
6418 6418 a, g dbSNP:773838355
6419 6419 a, g dbSNP:763357755
6423 6423 a, c dbSNP:771401044
6424 6424 a, g dbSNP:774607695
6427 6427 a, g dbSNP:759844408
6432 6432 a, g dbSNP:767772416
6437 6437 a, g, t dbSNP:775655404
6439 6439 c, g dbSNP:764064594
6445 6445 a, g dbSNP:753901147
6449 6449 c, g dbSNP:757148417
6460 6460 c, t dbSNP:560448798
6461 6461 a, g dbSNP:181217572
6467 6467 a, c, g, t dbSNP:758246791
6468 6468 c, t dbSNP:754576220
6470 6470 c, g dbSNP:371382571
6484 6484 c, g dbSNP:372362247
6485 6485 c, t dbSNP:199941479
6502 6502 c, t dbSNP:772506886
6504 6504 c, g dbSNP:775839735
6509 6509 c, t dbSNP:746044552
6510 6510 a, g dbSNP:532273033
6518 6518 a, g dbSNP:776893762
6522 6522 c, t dbSNP:761840066
6529 6529 c, t dbSNP:769990148
6535 6535 c, t dbSNP:773342860
6542 6542 c, t dbSNP:201646519
6543 6543 c, g dbSNP:766377135
6544 6544 c, t dbSNP:751420110
6546 6546 c, t dbSNP:759352766
6553 6553 -, tct dbSNP:530688555
6563 6563 c, g, t dbSNP:767115582
6564 6564 a, c, g, t dbSNP:201104173
6565 6565 a, g dbSNP:772294950
6571 6571 c, t dbSNP:758938678
6572 6572 a, g dbSNP:780493120
6575 6575 c, g dbSNP:747386152
6581 6581 c, g dbSNP:755852002
6582 6582 a, g dbSNP:769037290
6583 6583 c, t dbSNP:200512822
6589 6589 a, g dbSNP:748388922
6590 6590 c, t dbSNP:770085166
6607 6607 a, g dbSNP:773432608
6609 6609 a, g dbSNP:763076617
6622 6622 c, t dbSNP:770725503
6632 6632 a, g dbSNP:771129823
6639 6639 -, c dbSNP:766507377
6640 6640 c, t dbSNP:774209836
6643 6643 a, g dbSNP:181520026
6658 6658 a, g dbSNP:771834113
6659 6659 a, g, t dbSNP:1143648
6670 6670 c, g dbSNP:760416403
6673 6673 a, g dbSNP:763787387
6677 6677 a, g dbSNP:776239024
6695 6695 c, t dbSNP:761383449
6696 6696 a, g dbSNP:764790738
6702 6702 c, t dbSNP:369908356
6719 6719 a, g dbSNP:755514662
6729 6729 a, t dbSNP:767872810
6733 6733 a, c dbSNP:753152305
6735 6735 c, t dbSNP:756514259
6736 6736 g, t dbSNP:547119123
6739 6739 a, g dbSNP:55934900
6747 6747 c, t dbSNP:746940073
6751 6751 c, t dbSNP:768523603
6778 6778 a, g dbSNP:780971448
6796 6796 c, t dbSNP:140124504
6819 6819 a, c dbSNP:769511265
6820 6820 a, g dbSNP:772707532
6821 6821 g, t dbSNP:377147282
6827 6827 c, t dbSNP:770333490
6828 6828 a, g dbSNP:773939943
6835 6835 a, g dbSNP:761264421
6837 6837 c, t dbSNP:764652801
6846 6846 a, g, t dbSNP:541980046
6854 6854 a, g dbSNP:765539295
6857 6857 a, g dbSNP:750610285
6858 6858 c, t dbSNP:758567290
6865 6865 a, g dbSNP:780122035
6878 6878 g, t dbSNP:751572306
6884 6884 c, g, t dbSNP:112260178
6885 6885 a, t dbSNP:573353052
6889 6889 a, c dbSNP:747976060
6896 6896 a, c dbSNP:769470860
6898 6898 c, t dbSNP:777538746
6899 6899 a, g dbSNP:200008242
6901 6901 a, g dbSNP:770546575
6908 6908 a, g dbSNP:202240444
6912 6912 a, g dbSNP:759064953
6913 6913 a, g dbSNP:362336
6915 6915 a, c, t dbSNP:777249004
6916 6916 a, g dbSNP:531260079
6918 6918 a, c, t dbSNP:750741890
6919 6919 a, g dbSNP:766552044
6929 6929 a, g dbSNP:751664120
6939 6939 a, g dbSNP:755031506
6944 6944 c, g dbSNP:781170352
6945 6945 g, t dbSNP:558864739
6946 6946 a, g dbSNP:144090436
6949 6949 c, t dbSNP:777430803
6961 6961 a, g dbSNP:753624287
6962 6962 c, g dbSNP:367623835
6964 6964 g, t dbSNP:372618829
6969 6969 a, g dbSNP:745503160
6977 6977 c, t dbSNP:565501560
6978 6978 c, t dbSNP:779434937
6979 6979 c, t dbSNP:746491906
6990 6990 a, g, t dbSNP:375059996
6991 6991 a, g dbSNP:367979379
6995 6995 c, t dbSNP:771269259
7010 7010 a, g dbSNP:371843250
7018 7018 c, t dbSNP:376984622
7027 7027 g, t dbSNP:767682471
7032 7032 a, g dbSNP:575976301
7036 7036 g, t dbSNP:760785933
7040 7040 c, t dbSNP:763976827
7042 7042 c, t dbSNP:753807442
7047 7047 c, t dbSNP:757177988
7054 7054 c, g dbSNP:765139100
7067 7067 a, g dbSNP:750176644
7073 7073 a, c dbSNP:758159208
7078 7078 c, t dbSNP:369632008
7079 7079 a, c, g dbSNP:374360323
7081 7081 c, g dbSNP:377203393
7100 7100 c, g dbSNP:746271452
7105 7105 c, t dbSNP:772479641
7117 7117 c, g dbSNP:780197718
7119 7119 a, g dbSNP:202236016
7123 7123 a, g dbSNP:768696167
7132 7132 a, g dbSNP:370817761
7135 7135 a, g dbSNP:761939030
7144 7144 a, t dbSNP:769904496
7147 7147 c, t dbSNP:780305834
7152 7152 c, t dbSNP:762725028
7155 7155 a, g dbSNP:766207653
7159 7159 a, g dbSNP:773948229
7178 7178 c, g dbSNP:759260622
7186 7186 c, g, t dbSNP:767023984
7195 7195 c, g, t dbSNP:755589211
7202 7202 a, g dbSNP:750914925
7213 7213 c, t dbSNP:561152154
7221 7221 c, t dbSNP:780472484
7231 7231 c, t dbSNP:761834017
7234 7234 c, t dbSNP:573397591
7239 7239 c, t dbSNP:781546405
7247 7247 c, t dbSNP:362331
7248 7248 a, g dbSNP:200129223
7254 7254 g, t dbSNP:769992264
7257 7257 a, c dbSNP:773344648
7263 7263 c, t dbSNP:749249752
7264 7264 c, t dbSNP:770731933
7273 7273 c, t dbSNP:376635317
7276 7276 c, t dbSNP:745743494
7284 7284 a, c, t dbSNP:200857448
7298 7298 c, t dbSNP:368077431
7299 7299 a, t dbSNP:768259490
7301 7301 c, g dbSNP:570781020
7306 7306 a, t dbSNP:760418260
7315 7315 a, g dbSNP:761208465
7322 7322 a, g dbSNP:766953690
7323 7323 a, g dbSNP:752009224
7332 7332 a, g dbSNP:186882443
7340 7340 a, g dbSNP:779665648
7341 7341 a, g dbSNP:768010459
7342 7342 -, gag dbSNP:756822711
7343 7343 -, gag dbSNP:373205907
7343 7343 a, g dbSNP:753067572
7345 7345 a, g dbSNP:756424250
7351 7351 a, g dbSNP:191063722
7357 7357 a, g dbSNP:753987794
7358 7358 a, g dbSNP:576032337
7362 7362 a, t dbSNP:778966552
7371 7371 c, t dbSNP:745804607
7375 7375 c, g dbSNP:771929252
7377 7377 a, c, g dbSNP:778861697
7384 7384 a, g dbSNP:3025818
7389 7389 c, t dbSNP:375725257
7403 7403 a, g dbSNP:779944962
7413 7413 a, c dbSNP:746847868
7416 7416 a, g dbSNP:768439193
7421 7421 a, g dbSNP:780960711
7438 7438 a, g dbSNP:377176195
7446 7446 c, t dbSNP:769425323
7449 7449 c, t dbSNP:772617635
7468 7468 c, t dbSNP:748782669
7469 7469 a, g dbSNP:772741144
7470 7470 a, g dbSNP:369049561
7471 7471 c, t dbSNP:372758637
7477 7477 a, g, t dbSNP:375913560
7478 7478 g, t dbSNP:761971184
7479 7479 c, t dbSNP:765452818
7480 7480 a, g dbSNP:750553624
7488 7488 c, t dbSNP:200455891
7489 7489 a, g dbSNP:528326466
7490 7490 c, t dbSNP:751489752
7496 7496 c, g dbSNP:754889042
7498 7498 a, c dbSNP:2857790
7501 7501 c, g dbSNP:747924353
7505 7505 a, t dbSNP:202160733
7508 7508 a, g dbSNP:777446689
7511 7511 a, g dbSNP:748870495
7512 7512 g, t dbSNP:770551177
7514 7514 a, g dbSNP:773939887
7517 7517 c, t dbSNP:747521327
7518 7518 c, t dbSNP:769165722
7523 7523 c, t dbSNP:753623269
7531 7531 c, t dbSNP:376323222
7541 7541 a, g dbSNP:762215546
7548 7548 c, t dbSNP:765419397
7551 7551 a, g dbSNP:773420009
7553 7553 a, g dbSNP:763081868
7558 7558 c, t dbSNP:766463619
7564 7564 a, g dbSNP:751576262
7565 7565 a, g dbSNP:759626383
7567 7567 a, g dbSNP:767418451
7590 7590 a, c dbSNP:752663732
7592 7592 a, c, g dbSNP:760471052
7594 7594 a, g dbSNP:372202628
7594 7594 -, g dbSNP:775038833
7607 7607 a, g dbSNP:756992290
7613 7613 a, g dbSNP:778687026
7614 7614 c, t dbSNP:749941312
7617 7617 g, t dbSNP:757923132
7619 7619 c, g dbSNP:781609227
7623 7623 a, c dbSNP:375455350
7624 7624 a, g dbSNP:770222548
7629 7629 c, t dbSNP:778145890
7630 7630 c, t dbSNP:368380145
7638 7638 g, t dbSNP:771179201
7642 7642 c, t dbSNP:774547356
7654 7654 a, t dbSNP:201702168
7660 7660 c, t dbSNP:772204110
7676 7676 c, t dbSNP:775364274
7677 7677 a, g dbSNP:760695672
7683 7683 a, g dbSNP:76653888
7684 7684 c, t dbSNP:362321
7686 7686 a, c dbSNP:753734355
7687 7687 a, g dbSNP:563272056
7701 7701 a, g dbSNP:754476374
7703 7703 c, t dbSNP:764639811
7705 7705 c, t dbSNP:754353670
7707 7707 c, g dbSNP:757692224
7708 7708 c, t dbSNP:779365771
7732 7732 c, t dbSNP:746168301
7751 7751 a, g dbSNP:758696363
7752 7752 c, t dbSNP:780107075
7753 7753 a, g dbSNP:747153637
7754 7754 c, t dbSNP:3025816
7759 7759 c, t dbSNP:768844030
7762 7762 c, t dbSNP:776796688
7766 7766 a, g, t dbSNP:369228257
7767 7767 c, t dbSNP:372850510
7773 7773 -, agg dbSNP:748480576
7795 7795 a, g dbSNP:749162170
7796 7796 a, g dbSNP:770642083
7804 7804 a, g dbSNP:774063279
7814 7814 a, g, t dbSNP:759214847
7819 7819 c, t dbSNP:190850312
7820 7820 a, c, g dbSNP:371399733
7828 7828 c, t dbSNP:182132217
7829 7829 a, g dbSNP:763459712
7850 7850 c, g dbSNP:3025814
7857 7857 c, g dbSNP:766658916
7860 7860 c, t dbSNP:751934871
7865 7865 a, t dbSNP:374835537
7866 7866 c, t dbSNP:781546220
7867 7867 a, t dbSNP:752867307
7876 7876 a, g dbSNP:560138731
7879 7879 c, t dbSNP:777847310
7880 7880 a, g dbSNP:200676186
7886 7886 a, c dbSNP:749184636
7888 7888 a, t dbSNP:770859402
7892 7892 a, g dbSNP:377400749
7904 7904 a, g dbSNP:771412041
7916 7916 c, t dbSNP:771751572
7930 7930 a, g dbSNP:775119502
7934 7934 a, g dbSNP:760290505
7939 7939 c, t dbSNP:371891121
7965 7965 a, g dbSNP:372373805
7970 7970 a, g dbSNP:551417937
7976 7976 c, g dbSNP:753903766
7981 7981 c, t dbSNP:757323967
7982 7982 a, g dbSNP:765217251
7989 7989 a, g dbSNP:374647004
7993 7993 a, g dbSNP:138489139
8002 8002 a, g dbSNP:76647298
8003 8003 a, g dbSNP:746771740
8006 8006 a, g dbSNP:757798585
8011 8011 a, g dbSNP:529061571
8012 8012 a, g dbSNP:780869000
8030 8030 a, g dbSNP:548796695
8048 8048 a, g dbSNP:769420203
8050 8050 a, g dbSNP:772777605
8077 8077 a, g dbSNP:779366537
8080 8080 c, t dbSNP:772655035
8100 8100 a, g dbSNP:751506825
8104 8104 a, c, t dbSNP:369560571
8105 8105 a, g dbSNP:752505044
8119 8119 a, g dbSNP:362273
8125 8125 c, g dbSNP:377408760
8129 8129 c, g dbSNP:753459134
8131 8131 c, t dbSNP:570565498
8134 8134 a, g dbSNP:778219960
8136 8136 a, g dbSNP:369751042
8149 8149 c, t dbSNP:768994882
8156 8156 a, t dbSNP:546630669
8164 8164 c, t dbSNP:200527929
8171 8171 a, g dbSNP:749997356
8172 8172 g, t dbSNP:200196119
8174 8174 g, t dbSNP:768077382
8175 8175 c, g dbSNP:753203879
8176 8176 c, t dbSNP:756552303
8177 8177 a, c dbSNP:778129310
8186 8186 a, g dbSNP:749588679
8198 8198 a, g dbSNP:757552793
8199 8199 a, g dbSNP:778992599
8200 8200 c, g, t dbSNP:181007475
8210 8210 a, c dbSNP:201944095
8211 8211 c, t dbSNP:772284652
8228 8228 c, t dbSNP:775654872
8231 8231 g, t dbSNP:746965554
8233 8233 c, t dbSNP:768674350
8240 8240 -, gag dbSNP:149109767
8242 8242 a, g dbSNP:112304717
8246 8246 a, g dbSNP:776528909
8251 8251 a, g dbSNP:761488896
8254 8254 c, t dbSNP:368741323
8255 8255 a, g dbSNP:371268694
8257 8257 a, c, t dbSNP:375957195
8258 8258 a, g dbSNP:555039658
8259 8259 a, c dbSNP:751016951
8260 8260 c, g dbSNP:201422922
8262 8262 c, t dbSNP:764566369
8264 8264 g, t dbSNP:754290508
8266 8266 a, g dbSNP:757560613
8267 8267 c, g dbSNP:779272117
8271 8271 c, t dbSNP:750624963
8272 8272 a, g dbSNP:372104948
8281 8281 c, t dbSNP:559860075
8282 8282 a, t dbSNP:747053633
8283 8283 c, t dbSNP:375426084
8284 8284 a, g dbSNP:369624996
8298 8298 c, t dbSNP:199968967
8303 8303 a, c dbSNP:759790420
8309 8309 c, t dbSNP:765523847
8310 8310 a, g dbSNP:377091390
8313 8313 c, g dbSNP:781263790
8318 8318 a, g dbSNP:748046438
8324 8324 a, g dbSNP:756025741
8329 8329 c, t dbSNP:777456513
8332 8332 c, g dbSNP:749063835
8337 8337 c, t dbSNP:202216456
8338 8338 a, g dbSNP:34600449
8354 8354 c, t dbSNP:543863774
8360 8360 a, g dbSNP:771496853
8363 8363 c, t dbSNP:547238016
8364 8364 a, g dbSNP:762259129
8376 8376 c, t dbSNP:201229449
8377 8377 a, g dbSNP:773759943
8380 8380 c, t dbSNP:763395432
8387 8387 a, c, g dbSNP:766772445
8398 8398 c, t dbSNP:755190138
8399 8399 c, t dbSNP:767514232
8401 8401 a, g dbSNP:752778082
8403 8403 a, c dbSNP:756042424
8405 8405 a, g dbSNP:777757236
8413 8413 c, t dbSNP:749152562
8431 8431 c, t dbSNP:570616330
8437 8437 a, g dbSNP:536877956
8440 8440 c, g dbSNP:142891110
8458 8458 c, g dbSNP:771522225
8461 8461 c, g dbSNP:573475907
8462 8462 c, t dbSNP:759918609
8463 8463 a, g dbSNP:772253061
8470 8470 a, g dbSNP:368082453
8476 8476 a, g dbSNP:760754151
8479 8479 a, g dbSNP:2276881
8486 8486 a, g dbSNP:753876343
8490 8490 c, t dbSNP:575650724
8491 8491 a, g dbSNP:765137747
8497 8497 a, c dbSNP:201467885
8505 8505 a, g dbSNP:758207233
8512 8512 a, g dbSNP:779645826
8520 8520 c, t dbSNP:368605366
8524 8524 a, g dbSNP:200586785
8527 8527 c, t dbSNP:754534599
8536 8536 a, c dbSNP:573478599
8537 8537 a, g, t dbSNP:772607321
8539 8539 c, t dbSNP:754217156
8546 8546 c, t dbSNP:371640265
8566 8566 a, g dbSNP:746298590
8575 8575 c, t dbSNP:2229985
8576 8576 a, g dbSNP:367721569
8592 8592 a, c dbSNP:777093310
8597 8597 a, g dbSNP:746413928
8599 8599 a, g dbSNP:758795089
8601 8601 c, t dbSNP:780508928
8602 8602 a, g dbSNP:529410176
8606 8606 c, t dbSNP:768926204
8615 8615 c, t dbSNP:776830464
8616 8616 a, g dbSNP:377150821
8623 8623 a, g dbSNP:769875409
8632 8632 a, g dbSNP:369914566
8645 8645 c, t dbSNP:762976117
8651 8651 c, t dbSNP:766192291
8654 8654 a, g dbSNP:774248073
8657 8657 a, g dbSNP:759389018
8660 8660 a, g dbSNP:767357865
8665 8665 a, g dbSNP:752413525
8674 8674 c, t dbSNP:751199242
8675 8675 a, g dbSNP:763694703
8677 8677 c, t dbSNP:200390355
8678 8678 a, g, t dbSNP:362272
8685 8685 a, g dbSNP:747442285
8686 8686 c, t dbSNP:755338518
8690 8690 c, t dbSNP:369204399
8698 8698 c, t dbSNP:568235946
8710 8710 c, t dbSNP:769866904
8720 8720 a, g dbSNP:773378444
8733 8733 c, t dbSNP:749301391
8734 8734 a, c, g dbSNP:71608259
8741 8741 a, g dbSNP:774148552
8742 8742 a, g dbSNP:759491382
8743 8743 c, t dbSNP:375922907
8744 8744 a, g dbSNP:775389427
8745 8745 a, t dbSNP:760448114
8768 8768 a, g dbSNP:763632808
8776 8776 c, g dbSNP:753446427
8778 8778 a, g dbSNP:761226991
8782 8782 c, t dbSNP:748218633
8783 8783 c, g dbSNP:761469680
8788 8788 c, g dbSNP:764673669
8800 8800 c, g dbSNP:749895401
8806 8806 c, t dbSNP:760075328
8807 8807 a, g, t dbSNP:561465219
8817 8817 c, t dbSNP:756427393
8822 8822 a, g dbSNP:778130333
8825 8825 a, g dbSNP:754033524
8829 8829 c, t dbSNP:757464347
8830 8830 a, g dbSNP:771017431
8842 8842 a, c, t dbSNP:201724113
8853 8853 c, t dbSNP:780136059
8860 8860 c, t dbSNP:759383537
8861 8861 a, g dbSNP:768350905
8867 8867 c, t dbSNP:200296674
8868 8868 c, t dbSNP:144891713
8869 8869 a, g dbSNP:567166179
8885 8885 a, g dbSNP:772754195
8887 8887 a, g dbSNP:762432503
8911 8911 c, g dbSNP:369997039
8913 8913 c, t dbSNP:773875214
8916 8916 a, c, g, t dbSNP:573732436
8917 8917 a, g dbSNP:536481227
8921 8921 -, gag dbSNP:779017861
8923 8923 a, g dbSNP:762263931
8956 8956 c, t dbSNP:765631428
8977 8977 c, g, t dbSNP:750689484
8978 8978 c, t dbSNP:199535935
8985 8985 c, g dbSNP:374836871
8994 8994 a, t dbSNP:754920090
8995 8995 a, c dbSNP:781175874
9000 9000 a, g, t dbSNP:574794357
9008 9008 a, g, t dbSNP:369089042
9010 9010 a, c dbSNP:770543485
9015 9015 c, t dbSNP:201699939
9016 9016 a, g dbSNP:372861328
9026 9026 c, t dbSNP:544982357
9033 9033 c, t dbSNP:777200446
9035 9035 a, g dbSNP:564865166
9038 9038 a, g dbSNP:770307765
9045 9045 a, g dbSNP:773669890
9046 9046 c, t dbSNP:575359386
9047 9047 a, g dbSNP:376136833
9051 9051 a, c dbSNP:751648728
9058 9058 a, g, t dbSNP:369845532
9063 9063 a, g dbSNP:752690276
9065 9065 g, t dbSNP:755994326
9073 9073 a, g, t dbSNP:373215539
9085 9085 a, g dbSNP:756964836
9095 9095 -, gcatgtacacaggtga dbSNP:749913072
9101 9101 c, t dbSNP:561076268
9108 9108 a, g dbSNP:774527769
9114 9114 a, g dbSNP:368288911
9124 9124 c, t dbSNP:772164992
9126 9126 c, t dbSNP:775608493
9127 9127 a, g dbSNP:760743587
9142 9142 a, c dbSNP:764098014
9152 9152 a, g dbSNP:776564462
9155 9155 g, t dbSNP:3025807
9160 9160 c, t dbSNP:372373063
9161 9161 a, g, t dbSNP:765112409
9163 9163 c, t dbSNP:374391779
9165 9165 a, g dbSNP:766116072
9166 9166 c, t dbSNP:751180863
9167 9167 a, g dbSNP:754540863
9179 9179 a, g dbSNP:780787893
9183 9183 c, t dbSNP:368828515
9185 9185 a, g dbSNP:757662771
9192 9192 a, g dbSNP:779386355
9208 9208 c, t dbSNP:746208638
9212 9212 a, c dbSNP:772408727
9223 9223 a, c dbSNP:768838354
9224 9224 a, g dbSNP:781300228
9227 9227 c, t dbSNP:200392606
9234 9234 a, g dbSNP:769833432
9277 9277 c, t dbSNP:374515950
9278 9278 a, g dbSNP:762886284
9283 9283 c, t dbSNP:535329892
9288 9288 c, t dbSNP:377344161
9289 9289 a, g dbSNP:759301022
9316 9316 c, t dbSNP:767267961
9317 9317 a, g dbSNP:752320329
9336 9336 a, t dbSNP:760109312
9339 9339 a, c dbSNP:763602564
9352 9352 a, g dbSNP:141927489
9364 9364 a, c, t dbSNP:373377741
9368 9368 a, g dbSNP:377159286
9394 9394 c, t dbSNP:751985106
9397 9397 c, t dbSNP:755338053
9400 9400 c, t dbSNP:374574494
9401 9401 a, g dbSNP:368718954
9409 9409 a, g dbSNP:201784554
9412 9412 c, g dbSNP:777754726
9413 9413 a, g dbSNP:749355880
9414 9414 c, g, t dbSNP:757320279
9419 9419 c, t dbSNP:745742415
9422 9422 a, g dbSNP:771786621
9424 9424 c, t dbSNP:775319069
9438 9438 a, c dbSNP:746684809
9466 9466 a, g dbSNP:371266914
9467 9467 a, g dbSNP:530536695
9469 9469 c, t dbSNP:776065368
9471 9471 c, t dbSNP:761305733
9480 9480 c, t dbSNP:375081737
9481 9481 a, g dbSNP:774849534
9497 9497 c, t dbSNP:759983194
9499 9499 c, t dbSNP:2229987
9500 9500 c, t dbSNP:753074331
9508 9508 c, t dbSNP:756339121
9510 9510 c, t dbSNP:764361253
9511 9511 a, g dbSNP:754048582
9517 9517 c, g dbSNP:371718523
9520 9520 c, t dbSNP:779087653
9529 9529 c, t dbSNP:745832191
9530 9530 a, g, t dbSNP:201076881
9531 9531 c, t dbSNP:746808887
9532 9532 a, g dbSNP:532740914
9535 9535 a, g dbSNP:369633799
9538 9538 c, t dbSNP:563636870
9541 9541 c, t dbSNP:376179430
9548 9548 a, g dbSNP:573525160
9553 9553 c, t dbSNP:754813242
9561 9561 c, t dbSNP:780912358
9584 9584 a, g dbSNP:747824755
9596 9596 -, tg dbSNP:771383526
9598 9598 -, tt dbSNP:774841506
9599 9599 c, t dbSNP:542631628
9604 9604 c, t dbSNP:370604707
9606 9606 c, t dbSNP:748815950
9610 9610 a, t dbSNP:772726436
9613 9613 c, t dbSNP:372911161
9625 9625 a, c dbSNP:377287477
9628 9628 c, g dbSNP:776079306
9632 9632 a, g dbSNP:559444471
9633 9633 a, t dbSNP:528205593
9642 9642 a, t dbSNP:777105838
9643 9643 a, c dbSNP:762179809
9647 9647 c, t dbSNP:370674094
9648 9648 g, t dbSNP:374376603
9658 9658 c, t dbSNP:763102180
9664 9664 c, t dbSNP:766308856
9670 9670 c, t dbSNP:751535347
9685 9685 c, t dbSNP:200112468
9690 9690 a, g dbSNP:781002043
9700 9700 c, t dbSNP:362308
9704 9704 a, c, t dbSNP:769006451
9705 9705 a, g dbSNP:748823223
9713 9713 a, g dbSNP:770497692
9714 9714 -, t dbSNP:759551839
9718 9718 c, t dbSNP:371160721
9722 9722 c, t dbSNP:778248380
9723 9723 a, g dbSNP:374128370
9743 9743 a, g dbSNP:769267244
9754 9754 a, g dbSNP:367756566
9758 9758 c, t dbSNP:762266111
9759 9759 c, g dbSNP:770220152
9760 9760 a, g dbSNP:773493298
9764 9764 a, g dbSNP:763034423
9770 9770 c, t dbSNP:766508050
9772 9772 g, t dbSNP:751558413
9777 9777 a, g dbSNP:531163346
9778 9778 c, g, t dbSNP:767429060
9783 9783 c, g dbSNP:550957192
9784 9784 a, c dbSNP:370044029
9792 9792 a, g dbSNP:371997188
9802 9802 a, g dbSNP:753560198
9807 9807 a, c dbSNP:567968972
9810 9810 c, t dbSNP:362307
9811 9811 a, g dbSNP:546979671
9831 9831 c, g dbSNP:566565467
9848 9848 c, t dbSNP:538741503
9860 9860 g, t dbSNP:148278311
9863 9863 a, c dbSNP:73193321
9865 9865 c, t dbSNP:537268502
9867 9867 a, c dbSNP:556949545
9869 9869 a, g dbSNP:750523088
9874 9874 c, t dbSNP:573883182
9875 9875 a, g, t dbSNP:542218918
9887 9887 a, t dbSNP:59292988
9890 9890 a, g dbSNP:142715334
9899 9899 c, t dbSNP:116198062
9920 9920 c, t dbSNP:752618946
9939 9939 a, g dbSNP:73792378
9987 9987 a, c dbSNP:73792379
9998 9998 a, g dbSNP:755989079
10010 10010 a, t dbSNP:189003905
10015 10015 a, g dbSNP:561380440
10016 10016 a, g dbSNP:112765468
10030 10030 a, t dbSNP:530408662
10065 10065 a, g dbSNP:362306
10079 10079 a, g dbSNP:368848364
10113 10113 c, g dbSNP:362268
10125 10125 c, g dbSNP:362305
10143 10143 a, c dbSNP:552220905
10150 10150 a, g dbSNP:569033320
10188 10188 a, g dbSNP:144996044
10205 10205 c, t dbSNP:371097921
10209 10209 c, g dbSNP:113512033
10211 10211 a, g dbSNP:778117120
10237 10237 a, c dbSNP:362304
10247 10247 c, t dbSNP:769039581
10260 10260 a, g dbSNP:542298546
10272 10272 c, t dbSNP:362303
10292 10292 -, tcttt dbSNP:745938026
10322 10322 a, g dbSNP:181402508
10347 10347 c, t dbSNP:138835084
10357 10357 g, t dbSNP:770032283
10383 10383 c, t dbSNP:142037345
10403 10403 c, t dbSNP:557184045
10404 10404 a, g dbSNP:575304924
10409 10409 c, t dbSNP:763031039
10441 10441 a, g dbSNP:150858902
10468 10468 g, t dbSNP:115429408
10469 10469 c, t dbSNP:530256515
10477 10477 a, g dbSNP:540511933
10483 10483 c, t dbSNP:114344383
10484 10484 a, g dbSNP:561016800
10503 10503 a, g dbSNP:112877527
10515 10515 a, g dbSNP:552157571
10523 10523 a, c dbSNP:139353505
10533 10533 c, t dbSNP:371573674
10537 10537 a, g dbSNP:539444154
10548 10548 c, t dbSNP:372664017
10549 10549 a, g dbSNP:763919549
10571 10571 c, t dbSNP:528208553
10623 10623 c, t dbSNP:73792381
10648 10648 c, t dbSNP:536071864
10655 10655 c, t dbSNP:553275339
10701 10701 a, g dbSNP:753692069
10731 10731 c, t dbSNP:757081569
10758 10758 a, c dbSNP:149616739
10759 10759 c, t dbSNP:538596089
10767 10767 a, c dbSNP:764988033
10787 10787 -, g dbSNP:527795881
10788 10788 g, t dbSNP:558576044
10812 10812 a, g dbSNP:750039820
10814 10814 g, t dbSNP:557769619
10879 10879 c, g dbSNP:575175146
10881 10881 c, t dbSNP:1557210
10885 10885 c, t dbSNP:362302
10886 10886 a, g dbSNP:113285146
10903 10903 g, t dbSNP:144364475
10950 10950 c, t dbSNP:755530909
10971 10971 c, t dbSNP:540450258
10972 10972 a, g dbSNP:781510993
10973 10973 g, t dbSNP:3025805
11013 11013 c, t dbSNP:560369649
11014 11014 g, t dbSNP:532677433
11019 11019 c, t dbSNP:546129303
11027 11027 c, t dbSNP:562897859
11044 11044 a, c dbSNP:531636405
11149 11149 -, tga dbSNP:529946605
11183 11183 -, g dbSNP:538524560
11183 11183 c, t dbSNP:362267
11203 11203 c, g dbSNP:760201400
11206 11206 a, g dbSNP:770083840
11231 11231 a, g dbSNP:57969431
11232 11232 c, t dbSNP:529867585
11255 11255 a, g dbSNP:116419279
11262 11262 c, g dbSNP:111820718
11281 11281 c, t dbSNP:566711785
11322 11322 a, g dbSNP:538929778
11359 11359 a, g dbSNP:191419457
11367 11367 a, c dbSNP:182741654
11370 11370 a, g dbSNP:537461178
11402 11402 g, t dbSNP:362301
11446 11446 -, aaagggagcccctgctc dbSNP:6148278
11446 11446 c, g dbSNP:78277727
11459 11459 -, gctcaaagggagcccct dbSNP:58276479
11474 11474 c, t dbSNP:554623992
11510 11510 c, t dbSNP:574453307
11526 11526 c, g dbSNP:759036865
11548 11548 a, g dbSNP:534087040
11581 11581 c, t dbSNP:553937425
11600 11600 c, t dbSNP:577070583
11625 11625 c, t dbSNP:541871913
11626 11626 c, g dbSNP:560091271
11640 11640 -, ttc, ttct dbSNP:3072133
11640 11640 a, c dbSNP:201739406
11641 11641 -, ttc dbSNP:33979070
11643 11643 -, ttc dbSNP:397805399
11645 11645 a, g dbSNP:563054554
11665 11665 -, t dbSNP:753138356
11709 11709 c, g dbSNP:576357327
11738 11738 -, g dbSNP:5855774
11746 11746 c, g dbSNP:541860621
11769 11769 a, g dbSNP:115335747
11781 11781 a, g dbSNP:527774263
11801 11801 a, g dbSNP:547956108
11846 11846 a, g dbSNP:2159172
11852 11852 a, g dbSNP:560364159
11857 11857 a, g dbSNP:532379411
11865 11865 a, g dbSNP:564105368
11891 11891 a, g, t dbSNP:759488296
11896 11896 a, g dbSNP:569081403
11934 11934 a, g dbSNP:776367599
11935 11935 a, g dbSNP:537803049
11975 11975 c, t dbSNP:547888128
11978 11978 a, g dbSNP:761716011
12009 12009 g, t dbSNP:528773778
12026 12026 c, t dbSNP:73792382
12027 12027 a, g dbSNP:185984868
12068 12068 c, t dbSNP:547000450
12089 12089 c, t dbSNP:141042597
12091 12091 c, t dbSNP:765898262
12113 12113 c, t dbSNP:751110440
12125 12125 c, t dbSNP:754377322
12129 12129 -, acac dbSNP:369266342
12139 12139 c, t dbSNP:539665251
12140 12140 a, g dbSNP:781728046
12151 12151 a, g dbSNP:556768869
12167 12167 a, g dbSNP:753258934
12204 12204 c, t dbSNP:756605680
12205 12205 a, g dbSNP:778147682
12215 12215 a, g dbSNP:190661859
12223 12223 c, t dbSNP:542549546
12227 12227 a, t dbSNP:749626330
12241 12241 c, g dbSNP:561930394
12247 12247 c, t dbSNP:750676945
12293 12293 a, c dbSNP:112989843
12325 12325 -, aggg dbSNP:780291510
12328 12328 -, gagg dbSNP:370559848
12391 12391 g, t dbSNP:529466564
12472 12472 c, t dbSNP:541518643
12537 12537 c, t dbSNP:77140169
12556 12556 a, g dbSNP:532321260
12561 12561 a, g dbSNP:144163319
12563 12563 a, g dbSNP:562763314
12640 12640 a, g dbSNP:2237008
12641 12641 c, t dbSNP:139507275
12659 12659 a, g dbSNP:567696877
12682 12682 c, t dbSNP:374130012
12720 12720 c, t dbSNP:777607672
12731 12731 a, g dbSNP:568998679
12784 12784 c, t dbSNP:547060784
12839 12839 g, t dbSNP:570216430
12861 12861 g, t dbSNP:114691062
12868 12868 c, t dbSNP:187717515
12879 12879 c, t dbSNP:570275023
12892 12892 c, t dbSNP:761910102
12893 12893 a, g dbSNP:362300
12894 12894 c, t dbSNP:556126952
12897 12897 c, t dbSNP:367961756
12901 12901 a, g dbSNP:572434199
12911 12911 -, gtta dbSNP:755058635
12927 12927 c, t dbSNP:541461241
12950 12950 c, t dbSNP:762614506
12958 12958 c, t dbSNP:745404168
12989 12989 c, t dbSNP:766058040
13022 13022 c, t dbSNP:2530595
13046 13046 g, t dbSNP:759211438
13088 13088 a, g dbSNP:192163538
13137 13137 g, t dbSNP:766999367
13159 13159 a, g dbSNP:752167691
13170 13170 c, g dbSNP:375197727
13175 13175 c, t dbSNP:546355741
13176 13176 a, g dbSNP:543938904
13178 13178 a, g dbSNP:562539579
13188 13188 c, g dbSNP:531563144
13197 13197 c, g dbSNP:369506183
13218 13218 a, g dbSNP:375014405
13229 13229 a, g dbSNP:183027246
13260 13260 c, t dbSNP:756658712
13284 13284 a, t dbSNP:28475694
13297 13297 a, g dbSNP:527239965
13301 13301 c, t dbSNP:142559407
13338 13338 c, t dbSNP:150960575
13339 13339 a, g dbSNP:532882108
13347 13347 c, g dbSNP:372797396
13376 13376 c, t dbSNP:754236820
13386 13386 a, g dbSNP:187319754
13388 13388 c, g dbSNP:566547209
13404 13404 g, t dbSNP:570133286
13426 13426 a, g dbSNP:536058610
13457 13457 c, t dbSNP:61745472
13464 13464 a, g dbSNP:1803770
13494 13494 -, c dbSNP:35915896
13513 13513 a, g dbSNP:184486879
13519 13519 c, t dbSNP:140805376
13543 13543 a, c dbSNP:578007911
13545 13545 a, g dbSNP:1803771
13576 13576 c, t dbSNP:189515556
13577 13577 a, g dbSNP:557462801
13612 13612 c, t dbSNP:576122432

Target ORF information:

RefSeq Version NM_002111
Organism Homo sapiens (human)
Definition Homo sapiens huntingtin (HTT), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.