Email to GenScript

HLA-C major histocompatibility complex, class I, C [Homo sapiens (human)]

Gene Symbol HLA-C
Entrez Gene ID 3107
Full Name major histocompatibility complex, class I, C
Synonyms D6S204, HLA-JY3, HLC-C, PSORS1
General protein information
Preferred Names
HLA class I histocompatibility antigen, Cw-1 alpha chain
HLA class I histocompatibility antigen, Cw-1 alpha chain
MHC class I antigen heavy chain HLA-C
human leukocyte antigen-C alpha chain
major histocompatibility antigen HLA-C
HLA class I histocompatibility antigen, C alpha chain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Over one hundred HLA-C alleles have been described [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Psoriasis susceptibility 1}, 177900 (3); {HIV-1

The following HLA-C gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HLA-C gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu31524 NM_001243042 Homo sapiens major histocompatibility complex, class I, C (HLA-C), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu21205 NM_002117 Homo sapiens major histocompatibility complex, class I, C (HLA-C), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $299

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu31524
Accession Version NM_001243042.1
Sequence Information ORF Nucleotide Sequence (Length: 1101bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 02-FEB-2014
Organism Homo sapiens (human)
Product HLA class I histocompatibility antigen, Cw-1 alpha chain precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL662833.4. This sequence is a reference standard in the RefSeqGene project. On or before Aug 3, 2011 this sequence version replaced gi:341916161, gi:341916163, gi:341916165, gi:341916167, gi:341916169, gi:341916171, gi:341916173, gi:341916175, gi:341916177, gi:341916179, gi:341916181, gi:310124822, gi:341916183, gi:310124824, gi:341916185, gi:310124826, gi:310124828, gi:341916187, gi:310124830, gi:310124832, gi:310125088, gi:310124834, gi:310125090, gi:310124836, gi:310125092, gi:310124838, gi:310125094, gi:310124840, gi:310125096, gi:310124842, gi:310125098, gi:310124844, gi:310125100, gi:310124846, gi:310125102, gi:310124848, gi:310125104, gi:310125106, gi:310125108, gi:310125110, gi:310125112, gi:310125116, gi:310125114, gi:310125197, gi:310125201, gi:310125199, gi:310125205, gi:310125203, gi:310125207, gi:310125211, gi:310125209, gi:310125213, gi:310125215, gi:310125217, gi:310125219, gi:310125221, gi:310125223, gi:310125225, gi:341916159. Summary: HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Over one hundred HLA-C alleles have been described [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) represents the C*07:01:01:01 allele of the HLA-C gene, as represented in the alternate locus group ALT_REF_LOCI_2 of the reference genome. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC033293.1, M24097.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025083, ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)138..407(+)
Misc Feature(2)141..674(+)
Misc Feature(3)408..683(+)
Misc Feature(4)684..962(+)
Misc Feature(5)684..959(+)
Misc Feature(6)741..869(+)
Misc Feature(7)762..929(+)
Misc Feature(8)960..989(+)
Misc Feature(9)990..1064(+)
Exon (1)1..138
Gene Synonym:
Exon (2)139..408
Gene Synonym:
Exon (3)409..684
Gene Synonym:
Exon (4)685..960
Gene Synonym:
Exon (5)961..1080
Gene Synonym:
Exon (6)1081..1113
Gene Synonym:
Exon (7)1114..1161
Gene Synonym:
Exon (8)1162..1586
Gene Synonym:
Position Chain Variation Link
2 2 a, c dbSNP:115120050
18 18 a, g dbSNP:2074491
22 22 g, t dbSNP:755969105
24 24 -, cccagtc dbSNP:200353551
24 24 a, c dbSNP:750442366
26 26 -, tga dbSNP:772945048
30 30 -, c dbSNP:281860315
38 38 c, g dbSNP:541363928
42 42 -, ctcaca dbSNP:748047809
45 45 ac, gg dbSNP:71533838
45 45 a, g dbSNP:2074492
46 46 a, c, g dbSNP:9264674
47 47 a, g dbSNP:759721210
48 48 a, t dbSNP:776832579
54 54 c, t dbSNP:771346628
56 56 a, c dbSNP:747389317
59 59 c, g dbSNP:7767581
70 70 c, g dbSNP:772484756
76 76 a, c, t dbSNP:199783871
79 79 c, t dbSNP:754478879
80 80 a, g dbSNP:749015634
83 83 c, t dbSNP:779837272
84 84 c, t dbSNP:41548414
85 85 a, g dbSNP:41548123
87 87 a, g dbSNP:2308525
88 88 a, c dbSNP:755610458
89 89 c, t dbSNP:41543119
90 90 c, g dbSNP:751484302
93 93 a, c, g dbSNP:2308527
94 94 c, t dbSNP:41562218
104 104 c, g dbSNP:553352228
106 106 a, c dbSNP:766595242
107 107 a, g dbSNP:370651735
109 109 c, g dbSNP:773587386
110 110 a, g dbSNP:772455798
112 112 c, g, t dbSNP:1050451
115 115 c, t dbSNP:774915913
121 121 a, t dbSNP:281860316
124 124 c, g, t dbSNP:41549413
125 125 c, t dbSNP:72558133
128 128 c, g dbSNP:769594453
135 135 a, g dbSNP:41553415
138 138 c, g, t dbSNP:2074493
139 139 c, g dbSNP:281860318
141 141 g, t dbSNP:41546415
142 142 a, c dbSNP:281860319
143 143 c, g, t dbSNP:200202980
144 144 c, t dbSNP:79057049
145 145 a, g dbSNP:281860320
146 146 c, g, t dbSNP:41543915
148 148 a, c, t dbSNP:11547360
149 149 c, g, t dbSNP:281860321
150 150 a, c, t dbSNP:281860322
151 151 a, g, t dbSNP:61759936
153 153 a, g dbSNP:281860323
154 154 a, g, t dbSNP:1131151
155 155 a, c, g, t dbSNP:41548017
156 156 c, g, t dbSNP:281860324
157 157 -, a dbSNP:281860325
157 157 a, g, t dbSNP:281860326
158 158 c, t dbSNP:281860327
159 159 a, t dbSNP:281860328
160 160 -, at dbSNP:748692371
161 161 a, c, t dbSNP:281860329
162 162 -, ca, cc dbSNP:755774847
162 162 a, c, g, t dbSNP:9264668
163 163 -, aca dbSNP:747423310
163 163 a, c, g, t dbSNP:1071650
165 165 a, c, g dbSNP:281860330
166 166 c, t dbSNP:281860331
167 167 a, c dbSNP:1050446
168 168 -, gc dbSNP:759038234
168 168 g, t dbSNP:1050445
169 169 -, atc dbSNP:778249437
169 169 a, c, t dbSNP:72558124
170 170 c, g, t dbSNP:1050444
171 171 a, c, g, t dbSNP:2308538
172 172 a, g, t dbSNP:41557119
173 173 a, c, g dbSNP:61759937
175 175 a, c, g dbSNP:281860332
176 176 a, c, g dbSNP:775278499
177 177 c, g, t dbSNP:281860333
177 177 c, t dbSNP:41542423
178 178 a, g, t dbSNP:72558134
179 179 a, c, g dbSNP:281860334
180 180 a, c dbSNP:41558512
181 181 a, c, t dbSNP:281860335
182 182 a, c, g, t dbSNP:281860336
183 183 a, c, g, t dbSNP:281860337
183 183 a, g, t dbSNP:151341100
184 184 g, t dbSNP:751209811
185 185 a, c, t dbSNP:762671594
186 186 a, c, g, t dbSNP:41555420
187 187 a, c, g, t dbSNP:41560916
188 188 a, c, t dbSNP:199830079
189 189 a, c, g, t dbSNP:281860338
190 190 a, c, g, t dbSNP:45574634
191 191 a, g dbSNP:41542719
192 192 a, c, g, t dbSNP:1050438
193 193 a, t dbSNP:281860339
194 194 g, t dbSNP:746351359
195 195 a, c dbSNP:780748676
196 196 a, c, g, t dbSNP:281860340
197 197 c, t dbSNP:756747936
198 198 c, t dbSNP:72558135
199 199 a, g dbSNP:1050437
201 201 a, g, t dbSNP:281860341
203 203 c, t dbSNP:41554619
206 206 c, t dbSNP:41564220
207 207 a, c, g, t dbSNP:707911
209 209 a, c, g dbSNP:16895957
212 212 a, g dbSNP:281860342
213 213 a, g dbSNP:281860343
214 214 a, g dbSNP:281860344
215 215 a, c dbSNP:281860345
216 216 a, t dbSNP:281860346
218 218 a, c, t dbSNP:281860347
219 219 a, c, g dbSNP:41561612
222 222 a, g dbSNP:75512631
223 223 a, g dbSNP:281860348
224 224 c, g dbSNP:281860349
225 225 a, c, g, t dbSNP:72558126
227 227 c, t dbSNP:281860350
229 229 c, t dbSNP:281860351
230 230 a, c, g dbSNP:16895963
231 231 c, t dbSNP:281860352
232 232 a, g, t dbSNP:41545521
235 235 c, g, t dbSNP:281860353
236 236 c, t dbSNP:41555812
237 237 a, c, g dbSNP:281860354
238 238 a, c, g, t dbSNP:77670405
239 239 a, g dbSNP:281860355
240 240 a, c, t dbSNP:281860356
241 241 a, c, g dbSNP:1050428
242 242 a, g dbSNP:281860357
243 243 c, t dbSNP:281860358
244 244 c, t dbSNP:41550118
245 245 c, g, t dbSNP:281860359
246 246 a, c, g dbSNP:281860360
248 248 c, t dbSNP:281860361
250 250 a, g dbSNP:281860362
251 251 a, c, g dbSNP:281860363
252 252 a, g, t dbSNP:281860364
254 254 a, c, t dbSNP:281860365
255 255 a, g dbSNP:281860366
257 257 a, c, g, t dbSNP:281860367
258 258 a, g dbSNP:77850534
259 259 c, g, t dbSNP:281860368
261 261 a, g dbSNP:281860369
262 262 a, g dbSNP:79777994
263 263 c, t dbSNP:146215372
264 264 c, g, t dbSNP:12721931
266 266 a, g dbSNP:1050420
267 267 a, g, t dbSNP:281860370
268 268 c, g dbSNP:72558130
269 269 -, ag dbSNP:753232182
269 269 a, g dbSNP:72558131
270 270 a, g dbSNP:201563781
271 271 -, at dbSNP:765603264
271 271 a, c, g, t dbSNP:41548913
272 272 a, g dbSNP:1065380
274 274 a, c, g dbSNP:281860371
275 275 a, g dbSNP:281860372
276 276 c, g, t dbSNP:281860373
277 277 c, g dbSNP:281860374
278 278 c, g dbSNP:1050414
279 279 a, c, t dbSNP:281860375
281 281 a, c, g, t dbSNP:11547353
282 282 a, g, t dbSNP:72558132
283 283 a, c, g dbSNP:1050409
284 284 g, t dbSNP:281860376
285 285 c, t dbSNP:41551015
286 286 c, g, t dbSNP:41546817
287 287 a, g dbSNP:281860377
291 291 a, g, t dbSNP:1065382
293 293 a, g dbSNP:1065384
297 297 -, cag dbSNP:281860378
297 297 a, c, g dbSNP:751611903
298 298 a, g, t dbSNP:281860379
299 299 a, g dbSNP:763124213
299 299 -, g dbSNP:281860380
300 300 a, c, g dbSNP:77429690
301 301 a, t dbSNP:281860381
302 302 a, g dbSNP:281860382
303 303 c, g, t dbSNP:281860383
304 304 a, c, g dbSNP:41540214
305 305 a, g, t dbSNP:281860384
306 306 a, c, t dbSNP:281860385
307 307 a, c, g, t dbSNP:72558136
308 308 a, c, g dbSNP:72558137
309 309 a, c, g dbSNP:41559013
311 311 a, g, t dbSNP:281860386
312 312 a, t dbSNP:281860387
313 313 a, g dbSNP:281860388
314 314 c, g, t dbSNP:281860389
316 316 a, g dbSNP:281860390
317 317 a, g dbSNP:281860391
318 318 c, g dbSNP:281860392
319 319 a, g dbSNP:281860393
320 320 c, t dbSNP:281860394
321 321 c, g, t dbSNP:45438695
322 322 a, c, g, t dbSNP:281860395
323 323 a, c, g dbSNP:61759940
324 324 a, c, g dbSNP:1065385
326 326 c, g dbSNP:281860396
327 327 a, c dbSNP:281860397
329 329 a, g dbSNP:41555917
330 330 -, ca dbSNP:755090232
330 330 a, c, g dbSNP:281860398
331 331 a, t dbSNP:281860399
332 332 -, ga dbSNP:753820145
332 332 a, g dbSNP:281860400
335 335 c, g, t dbSNP:28626310
337 337 a, t dbSNP:747530395
339 339 a, g dbSNP:281860401
340 340 a, g dbSNP:281860402
341 341 a, c, g dbSNP:281860403
342 342 a, c, t dbSNP:74972087
343 343 a, c, g dbSNP:45609431
344 344 -, aa dbSNP:766611417
345 345 c, t dbSNP:76638752
346 346 a, g dbSNP:281860404
347 347 -, gg dbSNP:760864385
348 348 a, g, t dbSNP:281860405
349 349 c, t dbSNP:281860406
352 352 a, c dbSNP:45500292
353 353 c, g, t dbSNP:281860407
354 354 a, g dbSNP:41543814
355 355 c, g dbSNP:539016289
356 356 a, t dbSNP:281860408
357 357 c, g dbSNP:281860409
359 359 c, t dbSNP:281860410
360 360 a, c, g, t dbSNP:41549514
361 361 a, c, g dbSNP:11547351
364 364 a, t dbSNP:41550619
365 365 a, g, t dbSNP:281860411
366 366 a, g, t dbSNP:41559713
367 367 a, c, g, t dbSNP:2308557
368 368 a, c, t dbSNP:281860412
369 369 c, t dbSNP:281860413
370 370 c, g, t dbSNP:281860414
372 372 c, g, t dbSNP:281860415
373 373 a, c, g dbSNP:281860416
374 374 a, g dbSNP:281860417
375 375 a, c, g dbSNP:281860418
376 376 a, c, g dbSNP:281860419
377 377 a, c, t dbSNP:17408553
380 380 a, g dbSNP:41549919
381 381 c, t dbSNP:281860420
382 382 a, g, t dbSNP:281860421
383 383 c, t dbSNP:281860422
384 384 a, c, g, t dbSNP:281860423
386 386 a, c dbSNP:760645620
387 387 c, t dbSNP:77376497
388 388 a, g dbSNP:45501796
389 389 c, t dbSNP:281860424
391 391 a, g dbSNP:281860425
392 392 a, c, t dbSNP:41558820
393 393 a, g dbSNP:281860426
395 395 a, c, t dbSNP:281860427
396 396 c, t dbSNP:281860428
397 397 a, g dbSNP:281860429
398 398 a, c, g dbSNP:281860430
400 400 a, g dbSNP:281860431
401 401 c, g, t dbSNP:281860432
402 402 a, g dbSNP:281860433
404 404 c, g dbSNP:281860434
405 405 a, g, t dbSNP:281860435
406 406 a, c, t dbSNP:1131123
407 407 a, c, t dbSNP:281860436
408 408 a, c, g dbSNP:1131122
409 409 -, g dbSNP:281860439
410 410 -, g dbSNP:281860440
410 410 g, t dbSNP:41543218
411 411 c, g, t dbSNP:41563413
412 412 a, c, g dbSNP:41548520
413 413 g, t dbSNP:281860441
415 415 a, t dbSNP:41560716
416 416 -, caccc dbSNP:745508968
416 416 a, c, t dbSNP:281860442
417 417 -, ac dbSNP:769608795
417 417 a, g dbSNP:281860443
418 418 a, c, t dbSNP:1131119
419 419 -, cc dbSNP:778339286
419 419 c, g, t dbSNP:201542001
420 420 a, c, t dbSNP:1071649
421 421 a, c, g, t dbSNP:41546913
422 422 -, acttgg, gg dbSNP:748394002
422 422 a, c, g, t dbSNP:201441823
424 424 a, g dbSNP:281860444
425 425 a, g dbSNP:281860445
426 426 a, c, g, t dbSNP:1131118
427 427 a, c, g, t dbSNP:2308567
428 428 a, c, g, t dbSNP:41556316
429 429 a, g, t dbSNP:281860446
430 430 c, g, t dbSNP:281860447
431 431 a, g dbSNP:281860448
432 432 c, g, t dbSNP:281860449
433 433 a, c, g, t dbSNP:1131115
434 434 a, c, g, t dbSNP:1131114
436 436 a, g dbSNP:281860450
437 437 c, t dbSNP:41563216
438 438 a, t dbSNP:281860451
439 439 a, g dbSNP:41564314
440 440 a, c, t dbSNP:281860452
441 441 a, g, t dbSNP:45619135
443 443 a, c, t dbSNP:281860453
444 444 a, c, g, t dbSNP:34592426
446 446 g, t dbSNP:281860454
447 447 a, g dbSNP:281860455
448 448 a, c, g dbSNP:281860456
449 449 a, g, t dbSNP:41540712
450 450 a, c, t dbSNP:41546215
451 451 a, c dbSNP:281860457
452 452 a, c, g dbSNP:1050384
453 453 a, c, g, t dbSNP:41544015
455 455 a, c, g, t dbSNP:45558335
456 456 a, c, g, t dbSNP:77244469
457 457 c, g dbSNP:281860458
458 458 a, c, g dbSNP:281860459
459 459 a, c, g, t dbSNP:281860460
460 460 a, g, t dbSNP:281860461
461 461 a, c, t dbSNP:41563421
462 462 c, g, t dbSNP:201232509
464 464 a, c, t dbSNP:41554814
465 465 c, g, t dbSNP:281860462
467 467 c, g dbSNP:281860463
468 468 c, t dbSNP:281860464
469 469 a, g, t dbSNP:281860465
470 470 c, t dbSNP:281860466
471 471 a, c, g dbSNP:41562320
472 472 a, c, g dbSNP:182798226
473 473 a, c, g, t dbSNP:45626438
474 474 a, c, t dbSNP:2308574
475 475 a, g, t dbSNP:41555122
476 476 c, g, t dbSNP:41562313
477 477 a, c, g dbSNP:2308575
478 478 a, g, t dbSNP:41542424
479 479 a, c, g, t dbSNP:281860467
480 480 c, t dbSNP:281860468
481 481 a, g dbSNP:281860469
483 483 g, t dbSNP:41553719
484 484 a, c, t dbSNP:713032
485 485 a, c, g, t dbSNP:1065406
486 486 c, g, t dbSNP:61759941
487 487 c, t dbSNP:281860470
490 490 a, g dbSNP:281860471
491 491 a, c, g, t dbSNP:200172948
492 492 a, c, g, t dbSNP:72558147
494 494 a, c, g, t dbSNP:281860472
495 495 a, c, g, t dbSNP:45580333
496 496 g, t dbSNP:41551916
497 497 c, t dbSNP:281860473
499 499 a, g, t dbSNP:281860474
500 500 a, g dbSNP:201375064
501 501 a, g, t dbSNP:281860475
502 502 a, t dbSNP:281860476
504 504 c, t dbSNP:281860477
505 505 a, t dbSNP:281860478
506 506 c, g, t dbSNP:281860479
508 508 a, t dbSNP:281860480
510 510 a, g, t dbSNP:281860481
511 511 a, c, t dbSNP:41550023
512 512 c, t dbSNP:281860482
513 513 c, t dbSNP:281860483
514 514 a, t dbSNP:41541817
518 518 a, c, g, t dbSNP:1050373
519 519 a, c, g, t dbSNP:281860484
520 520 a, t dbSNP:281860485
521 521 a, g dbSNP:281860486
522 522 a, c, g, t dbSNP:281860487
523 523 a, c, g, t dbSNP:17850337
524 524 c, t dbSNP:1050371
526 526 a, c, t dbSNP:281860488
527 527 a, g dbSNP:41557216
528 528 a, c, t dbSNP:76907552
529 529 a, c, g, t dbSNP:281860489
530 530 a, c dbSNP:281860490
532 532 c, t dbSNP:41542612
533 533 c, g, t dbSNP:281860491
536 536 c, g dbSNP:281860492
537 537 a, g dbSNP:78897778
538 538 c, t dbSNP:41543518
539 539 a, c, t dbSNP:41553316
540 540 a, c, g dbSNP:41562518
541 541 c, t dbSNP:281860493
542 542 c, g, t dbSNP:41550715
544 544 c, g, t dbSNP:72558148
545 545 a, c, g dbSNP:281860494
548 548 c, g dbSNP:200892438
549 549 a, t dbSNP:45505091
550 550 -, ccg dbSNP:200155513
550 550 a, c, g, t dbSNP:2308584
551 551 a, c, g, t dbSNP:2308585
553 553 a, c, g, t dbSNP:281860495
554 554 a, g dbSNP:281860496
555 555 a, c, g, t dbSNP:45578735
556 556 a, c dbSNP:760838701
557 557 c, t dbSNP:41541313
558 558 a, c, t dbSNP:281860497
560 560 g, t dbSNP:281860498
561 561 a, g dbSNP:45622747
562 562 c, g, t dbSNP:45465598
563 563 a, c, g, t dbSNP:45597335
564 564 -, a dbSNP:281860499
564 564 a, t dbSNP:142570222
565 565 -, c dbSNP:281860500
565 565 c, t dbSNP:281860501
566 566 c, g, t dbSNP:11547350
567 567 a, c dbSNP:200392944
568 568 a, g dbSNP:281860502
569 569 a, c, g, t dbSNP:41557114
570 570 a, c, g, t dbSNP:281860503
571 571 a, c, g, t dbSNP:75272234
572 572 c, g dbSNP:281860504
574 574 a, t dbSNP:281860505
575 575 c, g dbSNP:281860506
576 576 c, t dbSNP:281860507
577 577 a, g, t dbSNP:1050366
578 578 a, c, g, t dbSNP:281860508
579 579 -, g dbSNP:202134505
579 579 a, g dbSNP:41550816
580 580 a, g dbSNP:281860509
583 583 c, t dbSNP:41540014
584 584 a, g dbSNP:281860510
585 585 a, c, g dbSNP:281860511
586 586 c, t dbSNP:61759942
587 587 c, g dbSNP:281860512
588 588 c, g, t dbSNP:41551019
589 589 a, c, g, t dbSNP:41543523
591 591 a, c, g, t dbSNP:41552817
592 592 a, c, g, t dbSNP:2308590
594 594 a, g dbSNP:41551016
595 595 c, t dbSNP:281860513
596 596 a, c, g dbSNP:41560918
597 597 c, g dbSNP:281860514
601 601 a, g dbSNP:281860515
602 602 -, ga dbSNP:779505818
602 602 a, g dbSNP:281860516
603 603 a, c, g, t dbSNP:697743
604 604 -, tg dbSNP:766416978
604 604 a, g, t dbSNP:2308592
604 604 a, g, t dbSNP:79636386
605 605 -, g, gac dbSNP:754000278
605 605 c, g dbSNP:780586514
607 607 c, g dbSNP:281860517
608 608 a, g dbSNP:113350320
609 609 a, c, g dbSNP:141142418
610 610 a, c, t dbSNP:770460734
611 611 c, g, t dbSNP:281860518
612 612 c, t dbSNP:281860519
613 613 a, g dbSNP:777483601
614 614 a, c, t dbSNP:281860520
615 615 a, c, g, t dbSNP:41561720
616 616 g, t dbSNP:281860521
617 617 a, g dbSNP:755010190
618 618 a, c, g dbSNP:281860522
619 619 a, t dbSNP:75032224
620 620 c, g dbSNP:281860523
621 621 -, ggcacgtgc dbSNP:281860524
621 621 -, ggcacg dbSNP:761676408
622 622 -, gc dbSNP:756397003
622 622 a, c, g dbSNP:281860525
623 623 a, c, t dbSNP:41553425
624 624 a, c, g dbSNP:1050685
625 625 -, ct, t dbSNP:767670473
625 625 a, c, g, t dbSNP:1050686
626 626 c, g, t dbSNP:41555814
627 627 g, t dbSNP:41562916
627 627 -, t dbSNP:773980967
628 628 a, c, g, t dbSNP:41543517
629 629 -, agatacct dbSNP:764138042
629 629 a, c, g, t dbSNP:281860527
629 629 -, c dbSNP:281860526
630 630 -, gtggag dbSNP:281860528
631 631 a, t dbSNP:281860529
632 632 a, g dbSNP:281860530
633 633 c, g dbSNP:281860531
634 634 a, t dbSNP:281860532
635 635 c, g dbSNP:138584390
635 635 -, g dbSNP:281860533
636 636 g, t dbSNP:201707949
637 637 c, g dbSNP:150127748
638 638 g, t dbSNP:281860534
640 640 c, t dbSNP:281860535
641 641 c, t dbSNP:41563115
643 643 a, g, t dbSNP:61759943
644 644 c, g, t dbSNP:281860536
645 645 a, c, g dbSNP:2308598
647 647 a, g dbSNP:281860537
648 648 c, t dbSNP:77935220
649 649 a, g dbSNP:281860538
650 650 a, c dbSNP:41550613
651 651 c, g, t dbSNP:281860539
652 652 c, g, t dbSNP:281860540
654 654 a, g dbSNP:1050357
655 655 a, c dbSNP:281860541
656 656 a, g dbSNP:281860542
659 659 a, c, g, t dbSNP:1131104
660 660 a, c, g, t dbSNP:41552417
662 662 c, g dbSNP:281860543
663 663 a, g dbSNP:41561213
664 664 a, g dbSNP:75912596
665 665 a, g dbSNP:281860544
666 666 a, c, g dbSNP:1131103
668 668 a, c, g dbSNP:17413678
670 670 a, c, t dbSNP:17413685
671 671 a, g dbSNP:281860545
672 672 c, g dbSNP:281860546
673 673 c, t dbSNP:55730145
675 675 c, g dbSNP:41555616
678 678 c, g, t dbSNP:41552115
679 679 a, c, g dbSNP:281860547
679 679 -, g dbSNP:775204752
680 680 c, t dbSNP:281860548
681 681 a, c, g, t dbSNP:17849598
682 682 c, g, t dbSNP:281860549
683 683 a, g, t dbSNP:2308604
684 684 a, g dbSNP:41541114
686 686 a, c dbSNP:41547620
687 687 c, t dbSNP:776358281
688 688 a, c, g dbSNP:1131096
694 694 a, g dbSNP:148650077
701 701 c, t dbSNP:1131292
702 702 a, c, g dbSNP:281860550
710 710 c, g dbSNP:749335588
711 711 c, g, t dbSNP:530888210
713 713 c, t dbSNP:1050344
715 715 c, g, t dbSNP:1050343
716 716 c, t dbSNP:281860551
717 717 a, c, g dbSNP:1050716
723 723 c, g dbSNP:281860552
727 727 a, c, g dbSNP:281860553
733 733 c, t dbSNP:41545014
735 735 a, g dbSNP:281860554
736 736 c, t dbSNP:200200386
741 741 -, ctga dbSNP:748566651
742 742 a, g dbSNP:752209897
742 742 -, g dbSNP:281860555
743 743 a, g, t dbSNP:41559418
751 751 c, t dbSNP:776448653
753 753 a, c dbSNP:74500356
758 758 c, t dbSNP:760659881
759 759 c, t dbSNP:281860556
761 761 c, t dbSNP:281860557
762 762 c, t dbSNP:61759944
768 768 a, g dbSNP:41562012
769 769 c, g, t dbSNP:281860558
770 770 a, c, g, t dbSNP:769960960
780 780 c, g dbSNP:281860559
784 784 c, t dbSNP:746059014
790 790 a, g dbSNP:781732593
792 792 c, t dbSNP:1050328
793 793 a, g dbSNP:747310853
797 797 c, t dbSNP:281860560
800 800 c, g, t dbSNP:1050326
801 801 a, g dbSNP:281860561
803 803 a, g dbSNP:281860562
807 807 a, c, t dbSNP:281860563
809 809 a, g dbSNP:1050320
811 811 c, t dbSNP:281860564
812 812 c, t dbSNP:1050317
818 818 c, t dbSNP:281860565
821 821 c, t dbSNP:2308618
822 822 c, g dbSNP:41547622
831 831 a, g dbSNP:281860566
837 837 a, c dbSNP:41542217
838 838 g, t dbSNP:185215782
839 839 a, g dbSNP:281860567
852 852 a, g dbSNP:281860568
856 856 a, c, t dbSNP:281860569
857 857 c, t dbSNP:761788831
859 859 c, t dbSNP:201434209
860 860 c, t dbSNP:375805634
866 866 g, t dbSNP:769913093
871 871 a, c dbSNP:79767529
879 879 a, g dbSNP:1050276
883 883 c, t dbSNP:78176797
886 886 -, c dbSNP:779125415
894 894 a, c, g dbSNP:707908
896 896 a, g dbSNP:202162097
899 899 a, g dbSNP:41542914
901 901 a, g dbSNP:747398768
904 904 a, c, g dbSNP:758864867
909 909 a, c dbSNP:28636630
911 911 a, c, g dbSNP:72558149
913 913 g, t dbSNP:778342450
915 915 c, t dbSNP:754494629
918 918 a, c, g dbSNP:2308622
919 919 a, t dbSNP:755718131
920 920 c, g, t dbSNP:41540117
921 921 c, t dbSNP:767313484
922 922 a, g dbSNP:761723651
923 923 a, g, t dbSNP:281860570
924 924 a, c, t dbSNP:759718165
926 926 c, t dbSNP:61759945
927 927 a, g, t dbSNP:760945018
928 928 a, g dbSNP:773512808
929 929 c, g, t dbSNP:748401710
930 930 a, g dbSNP:281860571
931 931 a, g, t dbSNP:748822620
932 932 g, t dbSNP:779521311
933 933 c, t dbSNP:41541219
935 935 g, t dbSNP:750087008
936 936 -, cg dbSNP:769245842
936 936 c, g dbSNP:780909240
937 937 a, c, g, t dbSNP:1131015
938 938 a, g dbSNP:1131014
939 939 g, t dbSNP:762961008
940 940 -, ag dbSNP:749793856
940 940 a, t dbSNP:754009857
941 941 a, g, t dbSNP:760860472
942 942 c, g dbSNP:773494915
943 943 a, c, g, t dbSNP:281860572
944 944 a, c, g, t dbSNP:779607111
945 945 c, t dbSNP:41558713
946 946 a, c, g, t dbSNP:41546713
947 947 a, c, g dbSNP:777680006
948 948 a, c, t dbSNP:752664590
950 950 a, c, g, t dbSNP:45481597
951 951 a, c dbSNP:750433169
952 952 c, g, t dbSNP:761922220
953 953 a, g, t dbSNP:764437898
954 954 a, g, t dbSNP:775991103
955 955 g, t dbSNP:770133431
956 956 a, c, g dbSNP:2308628
956 956 -, c dbSNP:780167261
957 957 c, t dbSNP:770657043
958 958 a, c, g dbSNP:777765932
959 959 a, c, g, t dbSNP:281860573
960 960 a, c, g, t dbSNP:41556321
961 961 -, agccatcttcccagcccaccatccccatcatgggcatcgttgctgg dbSNP:281860578
961 961 a, g dbSNP:9264621
962 962 g, t dbSNP:281860579
963 963 a, c, t dbSNP:281860580
964 964 a, c dbSNP:281860581
965 965 a, g dbSNP:34794906
966 966 g, t dbSNP:281860582
975 975 c, t dbSNP:45485294
977 977 c, t dbSNP:11757919
981 981 a, g dbSNP:774464615
988 988 a, t dbSNP:1065600
989 989 c, t dbSNP:560618122
990 990 a, g, t dbSNP:1050180
994 994 c, g dbSNP:756565144
995 995 -, c dbSNP:759148595
996 996 -, gctg dbSNP:776231802
998 998 c, t dbSNP:45486697
999 999 a, c, g, t dbSNP:12209550
1001 1001 g, t dbSNP:751081918
1002 1002 g, t dbSNP:41545712
1006 1006 -, g dbSNP:281860583
1006 1006 g, t dbSNP:200704360
1009 1009 c, t dbSNP:199559204
1010 1010 a, g dbSNP:201152245
1017 1017 c, t dbSNP:752359489
1019 1019 a, g dbSNP:764803422
1020 1020 -, ctatcc dbSNP:768890479
1021 1021 c, t dbSNP:1050147
1022 1022 c, t dbSNP:776358198
1023 1023 c, g dbSNP:766349491
1028 1028 a, g dbSNP:369623690
1029 1029 c, g dbSNP:760627621
1032 1032 a, g dbSNP:774363497
1035 1035 a, c dbSNP:45443998
1036 1036 -, agctgtcc dbSNP:749599742
1037 1037 -, a dbSNP:780546377
1037 1037 a, t dbSNP:41556617
1044 1044 a, g dbSNP:146911342
1046 1046 a, g dbSNP:775863640
1047 1047 a, g dbSNP:1050118
1048 1048 -, tca dbSNP:770251054
1049 1049 caccgctatg, ggctgttgtt dbSNP:386698960
1049 1049 c, g dbSNP:41540512
1050 1050 a, g dbSNP:1130947
1052 1052 c, t dbSNP:1050106
1053 1053 a, g dbSNP:747536207
1054 1054 c, g, t dbSNP:1050105
1056 1056 a, c, g dbSNP:1130935
1057 1057 a, t dbSNP:41542414
1058 1058 -, ttgtt dbSNP:745972874
1058 1058 g, t dbSNP:2308650
1060 1060 -, t dbSNP:281860584
1061 1061 a, g dbSNP:41540416
1062 1062 c, t dbSNP:41560617
1063 1063 -, ataca dbSNP:781097410
1063 1063 a, g dbSNP:1143551
1064 1064 c, t dbSNP:181100963
1065 1065 a, g dbSNP:763124905
1078 1078 c, t dbSNP:775663281
1094 1094 a, g dbSNP:568718965
1099 1099 a, g dbSNP:76294545
1100 1100 c, t dbSNP:751554648
1108 1108 c, t dbSNP:41559915
1111 1111 c, g, t dbSNP:139702282
1112 1112 a, g dbSNP:281860588
1114 1114 c, g dbSNP:35708511
1117 1117 c, g, t dbSNP:61759946
1122 1122 a, g dbSNP:750476831
1123 1123 a, g dbSNP:781416483
1140 1140 g, t dbSNP:757448813
1145 1145 c, t dbSNP:751964800
1151 1151 c, g, t dbSNP:763576150
1152 1152 a, g dbSNP:1130838
1156 1156 a, g dbSNP:765733803
1160 1160 -, a dbSNP:41544716
1161 1161 a, g dbSNP:758988637
1167 1167 c, g dbSNP:774174568
1175 1175 c, t dbSNP:768516524
1177 1177 -, t dbSNP:759523818
1181 1181 a, g, t dbSNP:776754624
1197 1197 g, t dbSNP:187426182
1198 1198 a, c dbSNP:747027422
1199 1199 c, t dbSNP:777877461
1208 1208 a, g, t dbSNP:183137172
1212 1212 -, c dbSNP:753440750
1212 1212 c, t dbSNP:1049853
1213 1213 c, t dbSNP:193100294
1232 1232 c, t dbSNP:755494300
1233 1233 c, t dbSNP:555741820
1240 1240 a, g dbSNP:754410106
1246 1246 g, t dbSNP:766924602
1250 1250 a, g dbSNP:1049724
1257 1257 a, c dbSNP:749904907
1258 1258 ac, gt dbSNP:386698953
1258 1258 a, g dbSNP:1049709
1259 1259 c, t dbSNP:1065711
1261 1261 c, t dbSNP:774085113
1266 1266 a, g dbSNP:573037014
1267 1267 c, t dbSNP:3176007
1272 1272 a, g dbSNP:775414363
1273 1273 c, t dbSNP:769667277
1274 1274 a, g dbSNP:747137926
1276 1276 c, t dbSNP:41289069
1285 1285 c, t dbSNP:187712210
1286 1286 a, c dbSNP:576380455
1291 1291 a, g dbSNP:1049668
1296 1296 a, g dbSNP:755396660
1298 1298 a, g dbSNP:749628936
1299 1299 a, g, t dbSNP:1049663
1304 1304 c, g dbSNP:1049650
1305 1305 a, t dbSNP:780750189
1308 1308 -, c dbSNP:201629107
1308 1308 c, t dbSNP:567563075
1312 1312 c, t dbSNP:116229144
1328 1328 c, t dbSNP:764717839
1329 1329 a, g dbSNP:551575665
1345 1345 c, t dbSNP:1049579
1346 1346 a, g dbSNP:562645899
1350 1350 a, g dbSNP:550708188
1367 1367 a, g dbSNP:551933356
1388 1388 c, g dbSNP:529358989
1390 1390 a, g dbSNP:1094
1396 1396 -, g dbSNP:9279068
1396 1396 -, g dbSNP:529404116
1414 1414 c, t dbSNP:540241542
1416 1416 c, t dbSNP:573111446
1422 1422 a, c dbSNP:1130592
1425 1425 c, t dbSNP:3207555
1427 1427 c, t dbSNP:3207561
1428 1428 c, g dbSNP:9264589
1429 1429 -, g dbSNP:67384697
1432 1432 c, t dbSNP:1130586
1433 1433 a, g dbSNP:1130580
1444 1444 a, g dbSNP:1130576
1448 1448 -, ctta dbSNP:60637457
1451 1451 -, actt dbSNP:369987786
1460 1460 a, c dbSNP:1130559
1465 1465 a, g dbSNP:1130558
1466 1466 a, t dbSNP:1130554
1469 1469 a, g dbSNP:1130552
1473 1473 c, g, t dbSNP:1071643
1490 1490 g, t dbSNP:1130538
1510 1510 -, g dbSNP:9281298
1510 1510 -, g dbSNP:572896906
1511 1511 agc, gag dbSNP:386698952
1511 1511 a, g dbSNP:116302614
1512 1512 -, c dbSNP:371948185
1512 1512 a, g dbSNP:115906458
1513 1513 -, c dbSNP:67157575
1513 1513 c, g dbSNP:3189472
1522 1522 a, g dbSNP:115510686
1541 1541 c, t dbSNP:114027487
1542 1542 c, t dbSNP:11547334
1545 1545 a, g dbSNP:1049281
1549 1549 g, t dbSNP:182562544
1552 1552 a, g dbSNP:564373825
1553 1553 a, g dbSNP:577311753
1578 1578 c, t dbSNP:35075694

Target ORF information:

RefSeq Version NM_001243042
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class I, C (HLA-C), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21205
Accession Version NM_002117.5
Sequence Information ORF Nucleotide Sequence (Length: 1101bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product HLA class I histocompatibility antigen, Cw-1 alpha chain precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL671883.3 and BC007814.2. On Jul 13, 2011 this sequence version replaced gi:52630341. Summary: HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Over one hundred HLA-C alleles have been described [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the C*07:02:01 allele of the HLA-C gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC033293.1, M24097.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2149398, SAMEA2153932 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)138..407(+)
Misc Feature(2)141..674(+)
Misc Feature(3)393..395(+)
Misc Feature(4)408..683(+)
Misc Feature(5)684..962(+)
Misc Feature(6)684..959(+)
Misc Feature(7)741..869(+)
Misc Feature(8)762..929(+)
Misc Feature(9)960..989(+)
Misc Feature(10)990..1064(+)
Exon (1)1..138
Gene Synonym:
Exon (2)139..408
Gene Synonym:
Exon (3)409..684
Gene Synonym:
Exon (4)685..960
Gene Synonym:
Exon (5)961..1080
Gene Synonym:
Exon (6)1081..1113
Gene Synonym:
Exon (7)1114..1161
Gene Synonym:
Exon (8)1162..1586
Gene Synonym:
Position Chain Variation Link
2 2 a, c dbSNP:115120050
18 18 a, g dbSNP:2074491
22 22 g, t dbSNP:755969105
24 24 -, cccagtc dbSNP:200353551
24 24 a, c dbSNP:750442366
26 26 -, tga dbSNP:772945048
30 30 -, c dbSNP:281860315
38 38 c, g dbSNP:541363928
42 42 -, ctcaca dbSNP:748047809
45 45 ac, gg dbSNP:71533838
45 45 a, g dbSNP:2074492
46 46 a, c, g dbSNP:9264674
47 47 a, g dbSNP:759721210
48 48 a, t dbSNP:776832579
54 54 c, t dbSNP:771346628
56 56 a, c dbSNP:747389317
59 59 c, g dbSNP:7767581
70 70 c, g dbSNP:772484756
76 76 a, c, t dbSNP:199783871
79 79 c, t dbSNP:754478879
80 80 a, g dbSNP:749015634
83 83 c, t dbSNP:779837272
84 84 c, t dbSNP:41548414
85 85 a, g dbSNP:41548123
87 87 a, g dbSNP:2308525
88 88 a, c dbSNP:755610458
89 89 c, t dbSNP:41543119
90 90 c, g dbSNP:751484302
93 93 a, c, g dbSNP:2308527
94 94 c, t dbSNP:41562218
104 104 c, g dbSNP:553352228
106 106 a, c dbSNP:766595242
107 107 a, g dbSNP:370651735
109 109 c, g dbSNP:773587386
110 110 a, g dbSNP:772455798
112 112 c, g, t dbSNP:1050451
115 115 c, t dbSNP:774915913
121 121 a, t dbSNP:281860316
124 124 c, g, t dbSNP:41549413
125 125 c, t dbSNP:72558133
128 128 c, g dbSNP:769594453
135 135 a, g dbSNP:41553415
138 138 c, g, t dbSNP:2074493
139 139 c, g dbSNP:281860318
141 141 g, t dbSNP:41546415
142 142 a, c dbSNP:281860319
143 143 c, g, t dbSNP:200202980
144 144 c, t dbSNP:79057049
145 145 a, g dbSNP:281860320
146 146 c, g, t dbSNP:41543915
148 148 a, c, t dbSNP:11547360
149 149 c, g, t dbSNP:281860321
150 150 a, c, t dbSNP:281860322
151 151 a, g, t dbSNP:61759936
153 153 a, g dbSNP:281860323
154 154 a, g, t dbSNP:1131151
155 155 a, c, g, t dbSNP:41548017
156 156 c, g, t dbSNP:281860324
157 157 -, a dbSNP:281860325
157 157 a, g, t dbSNP:281860326
158 158 c, t dbSNP:281860327
159 159 a, t dbSNP:281860328
160 160 -, at dbSNP:748692371
161 161 a, c, t dbSNP:281860329
162 162 -, ca, cc dbSNP:755774847
162 162 a, c, g, t dbSNP:9264668
163 163 -, aca dbSNP:747423310
163 163 a, c, g, t dbSNP:1071650
165 165 a, c, g dbSNP:281860330
166 166 c, t dbSNP:281860331
167 167 a, c dbSNP:1050446
168 168 -, gc dbSNP:759038234
168 168 g, t dbSNP:1050445
169 169 -, atc dbSNP:778249437
169 169 a, c, t dbSNP:72558124
170 170 c, g, t dbSNP:1050444
171 171 a, c, g, t dbSNP:2308538
172 172 a, g, t dbSNP:41557119
173 173 a, c, g dbSNP:61759937
175 175 a, c, g dbSNP:281860332
176 176 a, c, g dbSNP:775278499
177 177 c, g, t dbSNP:281860333
177 177 c, t dbSNP:41542423
178 178 a, g, t dbSNP:72558134
179 179 a, c, g dbSNP:281860334
180 180 a, c dbSNP:41558512
181 181 a, c, t dbSNP:281860335
182 182 a, c, g, t dbSNP:281860336
183 183 a, c, g, t dbSNP:281860337
183 183 a, g, t dbSNP:151341100
184 184 g, t dbSNP:751209811
185 185 a, c, t dbSNP:762671594
186 186 a, c, g, t dbSNP:41555420
187 187 a, c, g, t dbSNP:41560916
188 188 a, c, t dbSNP:199830079
189 189 a, c, g, t dbSNP:281860338
190 190 a, c, g, t dbSNP:45574634
191 191 a, g dbSNP:41542719
192 192 a, c, g, t dbSNP:1050438
193 193 a, t dbSNP:281860339
194 194 g, t dbSNP:746351359
195 195 a, c dbSNP:780748676
196 196 a, c, g, t dbSNP:281860340
197 197 c, t dbSNP:756747936
198 198 c, t dbSNP:72558135
199 199 a, g dbSNP:1050437
201 201 a, g, t dbSNP:281860341
203 203 c, t dbSNP:41554619
206 206 c, t dbSNP:41564220
207 207 a, c, g, t dbSNP:707911
209 209 a, c, g dbSNP:16895957
212 212 a, g dbSNP:281860342
213 213 a, g dbSNP:281860343
214 214 a, g dbSNP:281860344
215 215 a, c dbSNP:281860345
216 216 a, t dbSNP:281860346
218 218 a, c, t dbSNP:281860347
219 219 a, c, g dbSNP:41561612
222 222 a, g dbSNP:75512631
223 223 a, g dbSNP:281860348
224 224 c, g dbSNP:281860349
225 225 a, c, g, t dbSNP:72558126
227 227 c, t dbSNP:281860350
229 229 c, t dbSNP:281860351
230 230 a, c, g dbSNP:16895963
231 231 c, t dbSNP:281860352
232 232 a, g, t dbSNP:41545521
235 235 c, g, t dbSNP:281860353
236 236 c, t dbSNP:41555812
237 237 a, c, g dbSNP:281860354
238 238 a, c, g, t dbSNP:77670405
239 239 a, g dbSNP:281860355
240 240 a, c, t dbSNP:281860356
241 241 a, c, g dbSNP:1050428
242 242 a, g dbSNP:281860357
243 243 c, t dbSNP:281860358
244 244 c, t dbSNP:41550118
245 245 c, g, t dbSNP:281860359
246 246 a, c, g dbSNP:281860360
248 248 c, t dbSNP:281860361
250 250 a, g dbSNP:281860362
251 251 a, c, g dbSNP:281860363
252 252 a, g, t dbSNP:281860364
254 254 a, c, t dbSNP:281860365
255 255 a, g dbSNP:281860366
257 257 a, c, g, t dbSNP:281860367
258 258 a, g dbSNP:77850534
259 259 c, g, t dbSNP:281860368
261 261 a, g dbSNP:281860369
262 262 a, g dbSNP:79777994
263 263 c, t dbSNP:146215372
264 264 c, g, t dbSNP:12721931
266 266 a, g dbSNP:1050420
267 267 a, g, t dbSNP:281860370
268 268 c, g dbSNP:72558130
269 269 -, ag dbSNP:753232182
269 269 a, g dbSNP:72558131
270 270 a, g dbSNP:201563781
271 271 -, at dbSNP:765603264
271 271 a, c, g, t dbSNP:41548913
272 272 a, g dbSNP:1065380
274 274 a, c, g dbSNP:281860371
275 275 a, g dbSNP:281860372
276 276 c, g, t dbSNP:281860373
277 277 c, g dbSNP:281860374
278 278 c, g dbSNP:1050414
279 279 a, c, t dbSNP:281860375
281 281 a, c, g, t dbSNP:11547353
282 282 a, g, t dbSNP:72558132
283 283 a, c, g dbSNP:1050409
284 284 g, t dbSNP:281860376
285 285 c, t dbSNP:41551015
286 286 c, g, t dbSNP:41546817
287 287 a, g dbSNP:281860377
291 291 a, g, t dbSNP:1065382
293 293 a, g dbSNP:1065384
297 297 -, cag dbSNP:281860378
297 297 a, c, g dbSNP:751611903
298 298 a, g, t dbSNP:281860379
299 299 a, g dbSNP:763124213
299 299 -, g dbSNP:281860380
300 300 a, c, g dbSNP:77429690
301 301 a, t dbSNP:281860381
302 302 a, g dbSNP:281860382
303 303 c, g, t dbSNP:281860383
304 304 a, c, g dbSNP:41540214
305 305 a, g, t dbSNP:281860384
306 306 a, c, t dbSNP:281860385
307 307 a, c, g, t dbSNP:72558136
308 308 a, c, g dbSNP:72558137
309 309 a, c, g dbSNP:41559013
311 311 a, g, t dbSNP:281860386
312 312 a, t dbSNP:281860387
313 313 a, g dbSNP:281860388
314 314 c, g, t dbSNP:281860389
316 316 a, g dbSNP:281860390
317 317 a, g dbSNP:281860391
318 318 c, g dbSNP:281860392
319 319 a, g dbSNP:281860393
320 320 c, t dbSNP:281860394
321 321 c, g, t dbSNP:45438695
322 322 a, c, g, t dbSNP:281860395
323 323 a, c, g dbSNP:61759940
324 324 a, c, g dbSNP:1065385
326 326 c, g dbSNP:281860396
327 327 a, c dbSNP:281860397
329 329 a, g dbSNP:41555917
330 330 -, ca dbSNP:755090232
330 330 a, c, g dbSNP:281860398
331 331 a, t dbSNP:281860399
332 332 -, ga dbSNP:753820145
332 332 a, g dbSNP:281860400
335 335 c, g, t dbSNP:28626310
337 337 a, t dbSNP:747530395
339 339 a, g dbSNP:281860401
340 340 a, g dbSNP:281860402
341 341 a, c, g dbSNP:281860403
342 342 a, c, t dbSNP:74972087
343 343 a, c, g dbSNP:45609431
344 344 -, aa dbSNP:766611417
345 345 c, t dbSNP:76638752
346 346 a, g dbSNP:281860404
347 347 -, gg dbSNP:760864385
348 348 a, g, t dbSNP:281860405
349 349 c, t dbSNP:281860406
352 352 a, c dbSNP:45500292
353 353 c, g, t dbSNP:281860407
354 354 a, g dbSNP:41543814
355 355 c, g dbSNP:539016289
356 356 a, t dbSNP:281860408
357 357 c, g dbSNP:281860409
359 359 c, t dbSNP:281860410
360 360 a, c, g, t dbSNP:41549514
361 361 a, c, g dbSNP:11547351
364 364 a, t dbSNP:41550619
365 365 a, g, t dbSNP:281860411
366 366 a, g, t dbSNP:41559713
367 367 a, c, g, t dbSNP:2308557
368 368 a, c, t dbSNP:281860412
369 369 c, t dbSNP:281860413
370 370 c, g, t dbSNP:281860414
372 372 c, g, t dbSNP:281860415
373 373 a, c, g dbSNP:281860416
374 374 a, g dbSNP:281860417
375 375 a, c, g dbSNP:281860418
376 376 a, c, g dbSNP:281860419
377 377 a, c, t dbSNP:17408553
380 380 a, g dbSNP:41549919
381 381 c, t dbSNP:281860420
382 382 a, g, t dbSNP:281860421
383 383 c, t dbSNP:281860422
384 384 a, c, g, t dbSNP:281860423
386 386 a, c dbSNP:760645620
387 387 c, t dbSNP:77376497
388 388 a, g dbSNP:45501796
389 389 c, t dbSNP:281860424
391 391 a, g dbSNP:281860425
392 392 a, c, t dbSNP:41558820
393 393 a, g dbSNP:281860426
395 395 a, c, t dbSNP:281860427
396 396 c, t dbSNP:281860428
397 397 a, g dbSNP:281860429
398 398 a, c, g dbSNP:281860430
400 400 a, g dbSNP:281860431
401 401 c, g, t dbSNP:281860432
402 402 a, g dbSNP:281860433
404 404 c, g dbSNP:281860434
405 405 a, g, t dbSNP:281860435
406 406 a, c, t dbSNP:1131123
407 407 a, c, t dbSNP:281860436
408 408 a, c, g dbSNP:1131122
409 409 -, g dbSNP:281860439
410 410 -, g dbSNP:281860440
410 410 g, t dbSNP:41543218
411 411 c, g, t dbSNP:41563413
412 412 a, c, g dbSNP:41548520
413 413 g, t dbSNP:281860441
415 415 a, t dbSNP:41560716
416 416 -, caccc dbSNP:745508968
416 416 a, c, t dbSNP:281860442
417 417 -, ac dbSNP:769608795
417 417 a, g dbSNP:281860443
418 418 a, c, t dbSNP:1131119
419 419 -, cc dbSNP:778339286
419 419 c, g, t dbSNP:201542001
420 420 a, c, t dbSNP:1071649
421 421 a, c, g, t dbSNP:41546913
422 422 -, acttgg, gg dbSNP:748394002
422 422 a, c, g, t dbSNP:201441823
424 424 a, g dbSNP:281860444
425 425 a, g dbSNP:281860445
426 426 a, c, g, t dbSNP:1131118
427 427 a, c, g, t dbSNP:2308567
428 428 a, c, g, t dbSNP:41556316
429 429 a, g, t dbSNP:281860446
430 430 c, g, t dbSNP:281860447
431 431 a, g dbSNP:281860448
432 432 c, g, t dbSNP:281860449
433 433 a, c, g, t dbSNP:1131115
434 434 a, c, g, t dbSNP:1131114
436 436 a, g dbSNP:281860450
437 437 c, t dbSNP:41563216
438 438 a, t dbSNP:281860451
439 439 a, g dbSNP:41564314
440 440 a, c, t dbSNP:281860452
441 441 a, g, t dbSNP:45619135
443 443 a, c, t dbSNP:281860453
444 444 a, c, g, t dbSNP:34592426
446 446 g, t dbSNP:281860454
447 447 a, g dbSNP:281860455
448 448 a, c, g dbSNP:281860456
449 449 a, g, t dbSNP:41540712
450 450 a, c, t dbSNP:41546215
451 451 a, c dbSNP:281860457
452 452 a, c, g dbSNP:1050384
453 453 a, c, g, t dbSNP:41544015
455 455 a, c, g, t dbSNP:45558335
456 456 a, c, g, t dbSNP:77244469
457 457 c, g dbSNP:281860458
458 458 a, c, g dbSNP:281860459
459 459 a, c, g, t dbSNP:281860460
460 460 a, g, t dbSNP:281860461
461 461 a, c, t dbSNP:41563421
462 462 c, g, t dbSNP:201232509
464 464 a, c, t dbSNP:41554814
465 465 c, g, t dbSNP:281860462
467 467 c, g dbSNP:281860463
468 468 c, t dbSNP:281860464
469 469 a, g, t dbSNP:281860465
470 470 c, t dbSNP:281860466
471 471 a, c, g dbSNP:41562320
472 472 a, c, g dbSNP:182798226
473 473 a, c, g, t dbSNP:45626438
474 474 a, c, t dbSNP:2308574
475 475 a, g, t dbSNP:41555122
476 476 c, g, t dbSNP:41562313
477 477 a, c, g dbSNP:2308575
478 478 a, g, t dbSNP:41542424
479 479 a, c, g, t dbSNP:281860467
480 480 c, t dbSNP:281860468
481 481 a, g dbSNP:281860469
483 483 g, t dbSNP:41553719
484 484 a, c, t dbSNP:713032
485 485 a, c, g, t dbSNP:1065406
486 486 c, g, t dbSNP:61759941
487 487 c, t dbSNP:281860470
490 490 a, g dbSNP:281860471
491 491 a, c, g, t dbSNP:200172948
492 492 a, c, g, t dbSNP:72558147
494 494 a, c, g, t dbSNP:281860472
495 495 a, c, g, t dbSNP:45580333
496 496 g, t dbSNP:41551916
497 497 c, t dbSNP:281860473
499 499 a, g, t dbSNP:281860474
500 500 a, g dbSNP:201375064
501 501 a, g, t dbSNP:281860475
502 502 a, t dbSNP:281860476
504 504 c, t dbSNP:281860477
505 505 a, t dbSNP:281860478
506 506 c, g, t dbSNP:281860479
508 508 a, t dbSNP:281860480
510 510 a, g, t dbSNP:281860481
511 511 a, c, t dbSNP:41550023
512 512 c, t dbSNP:281860482
513 513 c, t dbSNP:281860483
514 514 a, t dbSNP:41541817
518 518 a, c, g, t dbSNP:1050373
519 519 a, c, g, t dbSNP:281860484
520 520 a, t dbSNP:281860485
521 521 a, g dbSNP:281860486
522 522 a, c, g, t dbSNP:281860487
523 523 a, c, g, t dbSNP:17850337
524 524 c, t dbSNP:1050371
526 526 a, c, t dbSNP:281860488
527 527 a, g dbSNP:41557216
528 528 a, c, t dbSNP:76907552
529 529 a, c, g, t dbSNP:281860489
530 530 a, c dbSNP:281860490
532 532 c, t dbSNP:41542612
533 533 c, g, t dbSNP:281860491
536 536 c, g dbSNP:281860492
537 537 a, g dbSNP:78897778
538 538 c, t dbSNP:41543518
539 539 a, c, t dbSNP:41553316
540 540 a, c, g dbSNP:41562518
541 541 c, t dbSNP:281860493
542 542 c, g, t dbSNP:41550715
544 544 c, g, t dbSNP:72558148
545 545 a, c, g dbSNP:281860494
548 548 c, g dbSNP:200892438
549 549 a, t dbSNP:45505091
550 550 -, ccg dbSNP:200155513
550 550 a, c, g, t dbSNP:2308584
551 551 a, c, g, t dbSNP:2308585
553 553 a, c, g, t dbSNP:281860495
554 554 a, g dbSNP:281860496
555 555 a, c, g, t dbSNP:45578735
556 556 a, c dbSNP:760838701
557 557 c, t dbSNP:41541313
558 558 a, c, t dbSNP:281860497
560 560 g, t dbSNP:281860498
561 561 a, g dbSNP:45622747
562 562 c, g, t dbSNP:45465598
563 563 a, c, g, t dbSNP:45597335
564 564 -, a dbSNP:281860499
564 564 a, t dbSNP:142570222
565 565 -, c dbSNP:281860500
565 565 c, t dbSNP:281860501
566 566 c, g, t dbSNP:11547350
567 567 a, c dbSNP:200392944
568 568 a, g dbSNP:281860502
569 569 a, c, g, t dbSNP:41557114
570 570 a, c, g, t dbSNP:281860503
571 571 a, c, g, t dbSNP:75272234
572 572 c, g dbSNP:281860504
574 574 a, t dbSNP:281860505
575 575 c, g dbSNP:281860506
576 576 c, t dbSNP:281860507
577 577 a, g, t dbSNP:1050366
578 578 a, c, g, t dbSNP:281860508
579 579 -, g dbSNP:202134505
579 579 a, g dbSNP:41550816
580 580 a, g dbSNP:281860509
583 583 c, t dbSNP:41540014
584 584 a, g dbSNP:281860510
585 585 a, c, g dbSNP:281860511
586 586 c, t dbSNP:61759942
587 587 c, g dbSNP:281860512
588 588 c, g, t dbSNP:41551019
589 589 a, c, g, t dbSNP:41543523
591 591 a, c, g, t dbSNP:41552817
592 592 a, c, g, t dbSNP:2308590
594 594 a, g dbSNP:41551016
595 595 c, t dbSNP:281860513
596 596 a, c, g dbSNP:41560918
597 597 c, g dbSNP:281860514
601 601 a, g dbSNP:281860515
602 602 -, ga dbSNP:779505818
602 602 a, g dbSNP:281860516
603 603 a, c, g, t dbSNP:697743
604 604 -, tg dbSNP:766416978
604 604 a, g, t dbSNP:2308592
604 604 a, g, t dbSNP:79636386
605 605 -, g, gac dbSNP:754000278
605 605 c, g dbSNP:780586514
607 607 c, g dbSNP:281860517
608 608 a, g dbSNP:113350320
609 609 a, c, g dbSNP:141142418
610 610 a, c, t dbSNP:770460734
611 611 c, g, t dbSNP:281860518
612 612 c, t dbSNP:281860519
613 613 a, g dbSNP:777483601
614 614 a, c, t dbSNP:281860520
615 615 a, c, g, t dbSNP:41561720
616 616 g, t dbSNP:281860521
617 617 a, g dbSNP:755010190
618 618 a, c, g dbSNP:281860522
619 619 a, t dbSNP:75032224
620 620 c, g dbSNP:281860523
621 621 -, ggcacgtgc dbSNP:281860524
621 621 -, ggcacg dbSNP:761676408
622 622 -, gc dbSNP:756397003
622 622 a, c, g dbSNP:281860525
623 623 a, c, t dbSNP:41553425
624 624 a, c, g dbSNP:1050685
625 625 -, ct, t dbSNP:767670473
625 625 a, c, g, t dbSNP:1050686
626 626 c, g, t dbSNP:41555814
627 627 g, t dbSNP:41562916
627 627 -, t dbSNP:773980967
628 628 a, c, g, t dbSNP:41543517
629 629 -, agatacct dbSNP:764138042
629 629 a, c, g, t dbSNP:281860527
629 629 -, c dbSNP:281860526
630 630 -, gtggag dbSNP:281860528
631 631 a, t dbSNP:281860529
632 632 a, g dbSNP:281860530
633 633 c, g dbSNP:281860531
634 634 a, t dbSNP:281860532
635 635 c, g dbSNP:138584390
635 635 -, g dbSNP:281860533
636 636 g, t dbSNP:201707949
637 637 c, g dbSNP:150127748
638 638 g, t dbSNP:281860534
640 640 c, t dbSNP:281860535
641 641 c, t dbSNP:41563115
643 643 a, g, t dbSNP:61759943
644 644 c, g, t dbSNP:281860536
645 645 a, c, g dbSNP:2308598
647 647 a, g dbSNP:281860537
648 648 c, t dbSNP:77935220
649 649 a, g dbSNP:281860538
650 650 a, c dbSNP:41550613
651 651 c, g, t dbSNP:281860539
652 652 c, g, t dbSNP:281860540
654 654 a, g dbSNP:1050357
655 655 a, c dbSNP:281860541
656 656 a, g dbSNP:281860542
659 659 a, c, g, t dbSNP:1131104
660 660 a, c, g, t dbSNP:41552417
662 662 c, g dbSNP:281860543
663 663 a, g dbSNP:41561213
664 664 a, g dbSNP:75912596
665 665 a, g dbSNP:281860544
666 666 a, c, g dbSNP:1131103
668 668 a, c, g dbSNP:17413678
670 670 a, c, t dbSNP:17413685
671 671 a, g dbSNP:281860545
672 672 c, g dbSNP:281860546
673 673 c, t dbSNP:55730145
675 675 c, g dbSNP:41555616
678 678 c, g, t dbSNP:41552115
679 679 a, c, g dbSNP:281860547
679 679 -, g dbSNP:775204752
680 680 c, t dbSNP:281860548
681 681 a, c, g, t dbSNP:17849598
682 682 c, g, t dbSNP:281860549
683 683 a, g, t dbSNP:2308604
684 684 a, g dbSNP:41541114
686 686 a, c dbSNP:41547620
687 687 c, t dbSNP:776358281
688 688 a, c, g dbSNP:1131096
694 694 a, g dbSNP:148650077
701 701 c, t dbSNP:1131292
702 702 a, c, g dbSNP:281860550
710 710 c, g dbSNP:749335588
711 711 c, g, t dbSNP:530888210
713 713 c, t dbSNP:1050344
715 715 c, g, t dbSNP:1050343
716 716 c, t dbSNP:281860551
717 717 a, c, g dbSNP:1050716
723 723 c, g dbSNP:281860552
727 727 a, c, g dbSNP:281860553
733 733 c, t dbSNP:41545014
735 735 a, g dbSNP:281860554
736 736 c, t dbSNP:200200386
741 741 -, ctga dbSNP:748566651
742 742 a, g dbSNP:752209897
742 742 -, g dbSNP:281860555
743 743 a, g, t dbSNP:41559418
751 751 c, t dbSNP:776448653
753 753 a, c dbSNP:74500356
758 758 c, t dbSNP:760659881
759 759 c, t dbSNP:281860556
761 761 c, t dbSNP:281860557
762 762 c, t dbSNP:61759944
768 768 a, g dbSNP:41562012
769 769 c, g, t dbSNP:281860558
770 770 a, c, g, t dbSNP:769960960
780 780 c, g dbSNP:281860559
784 784 c, t dbSNP:746059014
790 790 a, g dbSNP:781732593
792 792 c, t dbSNP:1050328
793 793 a, g dbSNP:747310853
797 797 c, t dbSNP:281860560
800 800 c, g, t dbSNP:1050326
801 801 a, g dbSNP:281860561
803 803 a, g dbSNP:281860562
807 807 a, c, t dbSNP:281860563
809 809 a, g dbSNP:1050320
811 811 c, t dbSNP:281860564
812 812 c, t dbSNP:1050317
818 818 c, t dbSNP:281860565
821 821 c, t dbSNP:2308618
822 822 c, g dbSNP:41547622
831 831 a, g dbSNP:281860566
837 837 a, c dbSNP:41542217
838 838 g, t dbSNP:185215782
839 839 a, g dbSNP:281860567
852 852 a, g dbSNP:281860568
856 856 a, c, t dbSNP:281860569
857 857 c, t dbSNP:761788831
859 859 c, t dbSNP:201434209
860 860 c, t dbSNP:375805634
866 866 g, t dbSNP:769913093
871 871 a, c dbSNP:79767529
879 879 a, g dbSNP:1050276
883 883 c, t dbSNP:78176797
886 886 -, c dbSNP:779125415
894 894 a, c, g dbSNP:707908
896 896 a, g dbSNP:202162097
899 899 a, g dbSNP:41542914
901 901 a, g dbSNP:747398768
904 904 a, c, g dbSNP:758864867
909 909 a, c dbSNP:28636630
911 911 a, c, g dbSNP:72558149
913 913 g, t dbSNP:778342450
915 915 c, t dbSNP:754494629
918 918 a, c, g dbSNP:2308622
919 919 a, t dbSNP:755718131
920 920 c, g, t dbSNP:41540117
921 921 c, t dbSNP:767313484
922 922 a, g dbSNP:761723651
923 923 a, g, t dbSNP:281860570
924 924 a, c, t dbSNP:759718165
926 926 c, t dbSNP:61759945
927 927 a, g, t dbSNP:760945018
928 928 a, g dbSNP:773512808
929 929 c, g, t dbSNP:748401710
930 930 a, g dbSNP:281860571
931 931 a, g, t dbSNP:748822620
932 932 g, t dbSNP:779521311
933 933 c, t dbSNP:41541219
935 935 g, t dbSNP:750087008
936 936 -, cg dbSNP:769245842
936 936 c, g dbSNP:780909240
937 937 a, c, g, t dbSNP:1131015
938 938 a, g dbSNP:1131014
939 939 g, t dbSNP:762961008
940 940 -, ag dbSNP:749793856
940 940 a, t dbSNP:754009857
941 941 a, g, t dbSNP:760860472
942 942 c, g dbSNP:773494915
943 943 a, c, g, t dbSNP:281860572
944 944 a, c, g, t dbSNP:779607111
945 945 c, t dbSNP:41558713
946 946 a, c, g, t dbSNP:41546713
947 947 a, c, g dbSNP:777680006
948 948 a, c, t dbSNP:752664590
950 950 a, c, g, t dbSNP:45481597
951 951 a, c dbSNP:750433169
952 952 c, g, t dbSNP:761922220
953 953 a, g, t dbSNP:764437898
954 954 a, g, t dbSNP:775991103
955 955 g, t dbSNP:770133431
956 956 a, c, g dbSNP:2308628
956 956 -, c dbSNP:780167261
957 957 c, t dbSNP:770657043
958 958 a, c, g dbSNP:777765932
959 959 a, c, g, t dbSNP:281860573
960 960 a, c, g, t dbSNP:41556321
961 961 -, agccatcttcccagcccaccatccccatcatgggcatcgttgctgg dbSNP:281860578
961 961 a, g dbSNP:9264621
962 962 g, t dbSNP:281860579
963 963 a, c, t dbSNP:281860580
964 964 a, c dbSNP:281860581
965 965 a, g dbSNP:34794906
966 966 g, t dbSNP:281860582
975 975 c, t dbSNP:45485294
977 977 c, t dbSNP:11757919
981 981 a, g dbSNP:774464615
988 988 a, t dbSNP:1065600
989 989 c, t dbSNP:560618122
990 990 a, g, t dbSNP:1050180
994 994 c, g dbSNP:756565144
995 995 -, c dbSNP:759148595
996 996 -, gctg dbSNP:776231802
998 998 c, t dbSNP:45486697
999 999 a, c, g, t dbSNP:12209550
1001 1001 g, t dbSNP:751081918
1002 1002 g, t dbSNP:41545712
1006 1006 -, g dbSNP:281860583
1006 1006 g, t dbSNP:200704360
1009 1009 c, t dbSNP:199559204
1010 1010 a, g dbSNP:201152245
1017 1017 c, t dbSNP:752359489
1019 1019 a, g dbSNP:764803422
1020 1020 -, ctatcc dbSNP:768890479
1021 1021 c, t dbSNP:1050147
1022 1022 c, t dbSNP:776358198
1023 1023 c, g dbSNP:766349491
1028 1028 a, g dbSNP:369623690
1029 1029 c, g dbSNP:760627621
1032 1032 a, g dbSNP:774363497
1035 1035 a, c dbSNP:45443998
1036 1036 -, agctgtcc dbSNP:749599742
1037 1037 -, a dbSNP:780546377
1037 1037 a, t dbSNP:41556617
1044 1044 a, g dbSNP:146911342
1046 1046 a, g dbSNP:775863640
1047 1047 a, g dbSNP:1050118
1048 1048 -, tca dbSNP:770251054
1049 1049 caccgctatg, ggctgttgtt dbSNP:386698960
1049 1049 c, g dbSNP:41540512
1050 1050 a, g dbSNP:1130947
1052 1052 c, t dbSNP:1050106
1053 1053 a, g dbSNP:747536207
1054 1054 c, g, t dbSNP:1050105
1056 1056 a, c, g dbSNP:1130935
1057 1057 a, t dbSNP:41542414
1058 1058 -, ttgtt dbSNP:745972874
1058 1058 g, t dbSNP:2308650
1060 1060 -, t dbSNP:281860584
1061 1061 a, g dbSNP:41540416
1062 1062 c, t dbSNP:41560617
1063 1063 -, ataca dbSNP:781097410
1063 1063 a, g dbSNP:1143551
1064 1064 c, t dbSNP:181100963
1065 1065 a, g dbSNP:763124905
1078 1078 c, t dbSNP:775663281
1094 1094 a, g dbSNP:568718965
1099 1099 a, g dbSNP:76294545
1100 1100 c, t dbSNP:751554648
1108 1108 c, t dbSNP:41559915
1111 1111 c, g, t dbSNP:139702282
1112 1112 a, g dbSNP:281860588
1114 1114 c, g dbSNP:35708511
1117 1117 c, g, t dbSNP:61759946
1122 1122 a, g dbSNP:750476831
1123 1123 a, g dbSNP:781416483
1140 1140 g, t dbSNP:757448813
1145 1145 c, t dbSNP:751964800
1151 1151 c, g, t dbSNP:763576150
1152 1152 a, g dbSNP:1130838
1156 1156 a, g dbSNP:765733803
1160 1160 -, a dbSNP:41544716
1161 1161 a, g dbSNP:758988637
1167 1167 c, g dbSNP:774174568
1175 1175 c, t dbSNP:768516524
1177 1177 -, t dbSNP:759523818
1181 1181 a, g, t dbSNP:776754624
1197 1197 g, t dbSNP:187426182
1198 1198 a, c dbSNP:747027422
1199 1199 c, t dbSNP:777877461
1208 1208 a, g, t dbSNP:183137172
1212 1212 -, c dbSNP:753440750
1212 1212 c, t dbSNP:1049853
1213 1213 c, t dbSNP:193100294
1232 1232 c, t dbSNP:755494300
1233 1233 c, t dbSNP:555741820
1240 1240 a, g dbSNP:754410106
1246 1246 g, t dbSNP:766924602
1250 1250 a, g dbSNP:1049724
1257 1257 a, c dbSNP:749904907
1258 1258 ac, gt dbSNP:386698953
1258 1258 a, g dbSNP:1049709
1259 1259 c, t dbSNP:1065711
1261 1261 c, t dbSNP:774085113
1266 1266 a, g dbSNP:573037014
1267 1267 c, t dbSNP:3176007
1272 1272 a, g dbSNP:775414363
1273 1273 c, t dbSNP:769667277
1274 1274 a, g dbSNP:747137926
1276 1276 c, t dbSNP:41289069
1285 1285 c, t dbSNP:187712210
1286 1286 a, c dbSNP:576380455
1291 1291 a, g dbSNP:1049668
1296 1296 a, g dbSNP:755396660
1298 1298 a, g dbSNP:749628936
1299 1299 a, g, t dbSNP:1049663
1304 1304 c, g dbSNP:1049650
1305 1305 a, t dbSNP:780750189
1308 1308 -, c dbSNP:201629107
1308 1308 c, t dbSNP:567563075
1312 1312 c, t dbSNP:116229144
1328 1328 c, t dbSNP:764717839
1329 1329 a, g dbSNP:551575665
1345 1345 c, t dbSNP:1049579
1346 1346 a, g dbSNP:562645899
1350 1350 a, g dbSNP:550708188
1367 1367 a, g dbSNP:551933356
1388 1388 c, g dbSNP:529358989
1390 1390 a, g dbSNP:1094
1396 1396 -, g dbSNP:9279068
1396 1396 -, g dbSNP:529404116
1414 1414 c, t dbSNP:540241542
1416 1416 c, t dbSNP:573111446
1422 1422 a, c dbSNP:1130592
1425 1425 c, t dbSNP:3207555
1427 1427 c, t dbSNP:3207561
1428 1428 c, g dbSNP:9264589
1429 1429 -, g dbSNP:67384697
1432 1432 c, t dbSNP:1130586
1433 1433 a, g dbSNP:1130580
1444 1444 a, g dbSNP:1130576
1448 1448 -, ctta dbSNP:60637457
1451 1451 -, actt dbSNP:369987786
1460 1460 a, c dbSNP:1130559
1465 1465 a, g dbSNP:1130558
1466 1466 a, t dbSNP:1130554
1469 1469 a, g dbSNP:1130552
1473 1473 c, g, t dbSNP:1071643
1490 1490 g, t dbSNP:1130538
1510 1510 -, g dbSNP:9281298
1510 1510 -, g dbSNP:572896906
1511 1511 agc, gag dbSNP:386698952
1511 1511 a, g dbSNP:116302614
1512 1512 -, c dbSNP:371948185
1512 1512 a, g dbSNP:115906458
1513 1513 -, c dbSNP:67157575
1513 1513 c, g dbSNP:3189472
1522 1522 a, g dbSNP:115510686
1541 1541 c, t dbSNP:114027487
1542 1542 c, t dbSNP:11547334
1545 1545 a, g dbSNP:1049281
1549 1549 g, t dbSNP:182562544
1552 1552 a, g dbSNP:564373825
1553 1553 a, g dbSNP:577311753
1578 1578 c, t dbSNP:35075694

Target ORF information:

RefSeq Version NM_002117
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class I, C (HLA-C), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.