Email to GenScript

HLA-DPB1 major histocompatibility complex, class II, DP beta 1 [Homo sapiens (human)]

Gene Symbol HLA-DPB1
Entrez Gene ID 3115
Full Name major histocompatibility complex, class II, DP beta 1
General protein information
Preferred Names
HLA class II histocompatibility antigen, DP beta 1 chain
HLA class II histocompatibility antigen, DP beta 1 chain
HLA DP14-beta chain
class II HLA beta chain
MHC class II antigen DPB1
MHC class II HLA-DP-beta-1
MHC class II antigen DPbeta1
MHC class II antigen beta chain
beta1 domain MHC class II HLA DPB
MHC class II antigen DP beta 1 chain
HLA-DP histocompatibility type, beta-1 subunit
HLA class II histocompatibility antigen, DP(W4) beta chain
major histocompatibility complex class II antigen beta chain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Beryllium disease, chronic, susceptibility to} (3)

The following HLA-DPB1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HLA-DPB1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu20874 NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199
OHu40287 XM_006715078 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu54617 XM_006725040 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu40287 XM_006725699 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu40287 XM_006725817 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu54617 XM_006725908 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu40287 XM_006725998 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu40287 XM_006726088 PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu20874
Accession Version NM_002121.5
Sequence Information ORF Nucleotide Sequence (Length: 777bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP213121.1, AL645931.7 and M28202.1. This sequence is a reference standard in the RefSeqGene project. On Jun 2, 2011 this sequence version replaced gi:24797075. Summary: HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: M83664.1, BC013184.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)57..59(+)
Misc Feature(2)204..479(+)
Misc Feature(3)243..455(+)
Misc Feature(4)480..761(+)
Misc Feature(5)486..767(+)
Misc Feature(6)501..665(+)
Misc Feature(7)540..758(+)
Misc Feature(8)564..662(+)
Misc Feature(9)762..791(+)
Misc Feature(10)792..854(+)
Exon (1)1..216
Gene Synonym:
Exon (2)217..480
Gene Synonym:
Exon (3)481..762
Gene Synonym:
Exon (4)763..873
Gene Synonym:
Exon (5)874..897
Gene Synonym:
Exon (6)898..4055
Gene Synonym:
Position Chain Variation Link
54 54 c, t dbSNP:770227296
84 84 a, g dbSNP:760093942
86 86 g, t dbSNP:765608440
91 91 c, t dbSNP:144456909
92 92 a, c dbSNP:757916051
99 99 c, g dbSNP:763673115
102 102 c, t dbSNP:146638354
103 103 c, g dbSNP:149181738
113 113 c, t dbSNP:781135433
123 123 a, c, g dbSNP:773568820
140 140 a, g dbSNP:41540314
142 142 a, c dbSNP:779921780
143 143 a, c, t dbSNP:536111967
144 144 a, c dbSNP:763314196
147 147 c, g, t dbSNP:777782877
159 159 c, g dbSNP:771074929
163 163 c, t dbSNP:41558014
167 167 a, g dbSNP:146214653
175 175 c, t dbSNP:770193215
176 176 a, g dbSNP:376742482
178 178 a, t dbSNP:763465797
186 186 a, c, g dbSNP:763726124
187 187 c, t dbSNP:11551416
188 188 a, g dbSNP:761566912
190 190 c, g dbSNP:751203807
197 197 -, cagg dbSNP:759178727
197 197 c, t dbSNP:139072161
205 205 a, g dbSNP:755900839
216 216 g, t dbSNP:779874572
224 224 -, gtg dbSNP:751536871
224 224 a, c dbSNP:41544522
224 224 a, c dbSNP:776253405
225 225 ctttt, gtgca, gtgta dbSNP:386699868
225 225 c, g dbSNP:1126504
226 226 c, t dbSNP:202176660
227 227 g, t dbSNP:1126506
228 228 c, g, t dbSNP:12722013
229 229 a, t dbSNP:1126509
231 231 c, t dbSNP:79389600
234 234 gg, tt dbSNP:386699869
234 234 g, t dbSNP:1126511
235 235 g, t dbSNP:1126513
236 236 a, g dbSNP:780390413
238 238 g, t dbSNP:41540313
243 243 c, g dbSNP:749490757
244 244 a, g dbSNP:755441461
251 251 c, t dbSNP:188627284
252 252 a, c, g dbSNP:41555313
260 260 c, t dbSNP:772565701
269 269 a, g dbSNP:772611590
278 278 a, g dbSNP:746588116
280 280 a, t dbSNP:770346059
281 281 a, g dbSNP:776310599
285 285 g, t dbSNP:41553416
286 286 a, g dbSNP:765041810
297 297 a, c, t dbSNP:41545716
298 298 c, g dbSNP:41561114
300 300 c, g dbSNP:12722018
302 302 a, g dbSNP:41555423
306 306 c, t dbSNP:9277348
307 307 a, t dbSNP:1042117
308 308 a, c, t dbSNP:41555415
310 310 c, t dbSNP:1042121
318 318 g, t dbSNP:77062860
323 323 c, g dbSNP:753055175
326 326 c, t dbSNP:758676800
330 330 g, t dbSNP:41552915
331 331 g, t dbSNP:778412325
332 332 a, g dbSNP:12722022
337 337 a, t dbSNP:145190720
343 343 a, c dbSNP:147611944
344 344 a, g, t dbSNP:553686794
347 347 a, g dbSNP:575237777
349 349 c, g, t dbSNP:200784721
351 351 c, g dbSNP:200055547
352 352 a, t dbSNP:200572113
361 361 g, t dbSNP:201374258
367 367 ag, ct dbSNP:386699870
367 367 a, c, t dbSNP:707958
368 368 c, g, t dbSNP:9277351
370 370 a, c dbSNP:1042131
371 371 a, c, g dbSNP:80330773
373 373 a, c dbSNP:766596554
373 373 a, t dbSNP:41545212
374 374 c, g dbSNP:1042133
375 375 c, t dbSNP:114493737
381 381 a, c dbSNP:41550319
382 382 a, c dbSNP:765613028
393 393 c, g dbSNP:41560812
396 396 a, c, t dbSNP:1042136
397 397 a, t dbSNP:41547212
399 399 c, t dbSNP:41547418
402 402 g, t dbSNP:41553216
403 403 -, aggaga dbSNP:757051224
403 403 -, gc dbSNP:780905041
404 404 -, c, gg dbSNP:750649897
405 405 c, g dbSNP:199865386
406 406 a, g dbSNP:201237929
408 408 -, aa, cg dbSNP:780236425
408 408 a, c, g, t dbSNP:1042140
409 409 a, g dbSNP:12722027
411 411 c, t dbSNP:41554314
413 413 g, t dbSNP:41560217
415 415 -, cg dbSNP:768901004
415 415 a, c dbSNP:539497216
416 416 -, g dbSNP:779542214
416 416 a, c dbSNP:769285895
417 417 g, t dbSNP:41546618
418 418 a, c, t dbSNP:748869910
419 419 g, t dbSNP:41556420
420 420 c, g dbSNP:761813230
421 421 c, t dbSNP:41551920
422 422 g, t dbSNP:377295463
425 425 -, acct dbSNP:772481600
425 425 c, t dbSNP:61759928
426 426 -, cctatt dbSNP:759170101
426 426 a, g dbSNP:577903981
427 427 -, ggatg dbSNP:769459532
427 427 -, gg dbSNP:773453957
428 428 -, cct dbSNP:774939603
428 428 a, c, g, t dbSNP:759757752
428 428 a, g dbSNP:41545021
429 429 atg, gta dbSNP:386699871
429 429 a, g dbSNP:1042151
430 430 c, t dbSNP:111596796
431 431 -, cctac dbSNP:763640068
431 431 a, g dbSNP:1042153
431 431 -, g dbSNP:762418075
432 432 c, t dbSNP:751808149
433 433 a, g dbSNP:757602402
446 446 c, g dbSNP:768075332
447 447 a, g dbSNP:750894680
450 450 c, t dbSNP:755668966
452 452 a, g dbSNP:779381535
453 453 a, g dbSNP:76968043
454 454 a, g, t dbSNP:1042169
456 456 -, a dbSNP:141530233
457 457 a, g dbSNP:9277354
457 457 a, g dbSNP:534577141
459 459 c, g dbSNP:9277355
459 459 c, g dbSNP:552975041
461 461 ca, g dbSNP:386699872
461 461 c, g dbSNP:1126532
462 462 -, a dbSNP:202162010
462 462 a, g dbSNP:9277356
467 467 c, g dbSNP:773324204
470 470 a, g dbSNP:41542615
471 471 c, g dbSNP:536113120
475 475 a, g dbSNP:41541915
476 476 c, t dbSNP:41563418
481 481 c, t dbSNP:761183155
490 490 a, g dbSNP:1126537
491 491 c, g dbSNP:754366191
497 497 c, t dbSNP:1126541
499 499 a, t dbSNP:764783267
509 509 c, t dbSNP:752423599
514 514 a, t dbSNP:758087295
517 517 a, g dbSNP:61736937
522 522 a, c, g, t dbSNP:1042187
533 533 a, c dbSNP:751346150
539 539 a, g dbSNP:757067798
547 547 a, g dbSNP:61736936
556 556 c, t dbSNP:562166558
557 557 a, g dbSNP:1042212
568 568 c, t dbSNP:778922500
571 571 a, g dbSNP:61736935
574 574 a, g dbSNP:140447065
584 584 c, t dbSNP:772223745
585 585 c, t dbSNP:773409536
586 586 a, g dbSNP:368841277
590 590 a, c, g dbSNP:61736934
599 599 c, t dbSNP:760040959
603 603 c, t dbSNP:764687991
606 606 g, t dbSNP:566678973
620 620 g, t dbSNP:372905365
621 621 a, g dbSNP:534162897
625 625 g, t dbSNP:751221886
642 642 c, t dbSNP:757047904
643 643 a, g dbSNP:780989395
647 647 c, t dbSNP:750357586
649 649 a, g dbSNP:756011172
668 668 c, t dbSNP:376906908
673 673 a, t dbSNP:61736938
677 677 a, g dbSNP:778977608
680 680 a, g dbSNP:748284821
688 688 -, c dbSNP:780393867
689 689 c, t dbSNP:772135792
690 690 c, t dbSNP:778011110
693 693 c, g dbSNP:747234343
699 699 g, t dbSNP:771222927
702 702 c, g dbSNP:144181653
704 704 c, t dbSNP:1042331
705 705 a, g dbSNP:770371240
712 712 c, t dbSNP:1042335
713 713 c, t dbSNP:772872005
716 716 c, t dbSNP:762588336
731 731 c, t dbSNP:370864722
735 735 a, c, t dbSNP:14362
740 740 c, t dbSNP:1071597
752 752 c, t dbSNP:41559424
753 753 a, g dbSNP:750173090
762 762 a, g dbSNP:755847836
766 766 c, t dbSNP:143091535
768 768 c, t dbSNP:148208390
771 771 a, c, t dbSNP:766140335
783 783 c, t dbSNP:142745911
784 784 a, c, g, t dbSNP:9276
794 794 a, c dbSNP:376840874
797 797 a, g dbSNP:757274982
799 799 c, t dbSNP:766141291
800 800 a, c, g dbSNP:137879953
802 802 a, g dbSNP:780522601
809 809 a, g dbSNP:749814887
811 811 a, g dbSNP:199834306
815 815 c, t dbSNP:769226188
816 816 a, g dbSNP:11551421
822 822 a, g dbSNP:747760493
835 835 a, g dbSNP:771451667
838 838 c, g dbSNP:772967195
841 841 -, t dbSNP:754165149
847 847 a, c, t dbSNP:3097675
848 848 a, c dbSNP:770745804
852 852 a, g dbSNP:776345909
863 863 a, g dbSNP:759486323
878 878 a, g dbSNP:150818884
879 879 c, t dbSNP:780867126
880 880 a, g dbSNP:745501672
886 886 c, t dbSNP:201552902
889 889 -, acaaggaa dbSNP:748621826
889 889 a, c dbSNP:769658433
891 891 -, c dbSNP:778150610
892 892 -, a dbSNP:67523850
894 894 -, g dbSNP:747365417
907 907 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
907 907 c, g dbSNP:1126719
913 913 c, t dbSNP:1126723
924 924 a, t dbSNP:1042448
935 935 aac, gaa dbSNP:386699893
935 935 a, g dbSNP:9277522
937 937 a, c dbSNP:9277523
940 940 c, g dbSNP:564159821
942 942 a, t dbSNP:532241225
955 955 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
955 955 c, t dbSNP:1042467
956 956 a, g dbSNP:3749984
959 959 a, g dbSNP:559452923
960 960 a, g dbSNP:6760
963 963 c, t dbSNP:1042488
968 968 c, t dbSNP:1042497
982 982 c, t dbSNP:1042502
986 986 a, g dbSNP:1042507
992 992 a, c dbSNP:1042508
995 995 g, t dbSNP:1042511
996 996 a, t dbSNP:1042516
1003 1003 g, t dbSNP:34087328
1015 1015 c, g dbSNP:3749985
1039 1039 a, g dbSNP:1042544
1045 1045 c, t dbSNP:114068468
1055 1055 c, t dbSNP:759169647
1064 1064 g, t dbSNP:11551420
1101 1101 c, t dbSNP:1042644
1130 1130 a, g dbSNP:545910027
1132 1132 aag, gac dbSNP:386699895
1132 1132 a, g dbSNP:931
1134 1134 c, g dbSNP:928
1137 1137 c, t dbSNP:186748908
1141 1141 c, t dbSNP:1042634
1159 1159 c, t dbSNP:529885638
1161 1161 c, t dbSNP:935
1168 1168 a, g dbSNP:932
1177 1177 c, t dbSNP:933
1182 1182 -, ttctc dbSNP:144401610
1183 1183 -, tctct dbSNP:3833672
1191 1191 a, g dbSNP:1014
1201 1201 a, g dbSNP:929
1209 1209 a, g dbSNP:367833675
1238 1238 aacataggaaagaagagaaccatgaaaatggggatatgttaactattg tataatggggcctgttac, cacgtaggaaagaagagaagcatgaaagtggagatatgttaactattg tataatgtggcctgttat dbSNP:386699896
1238 1238 a, c dbSNP:930
1241 1241 a, g dbSNP:934
1252 1252 a, g dbSNP:568686979
1257 1257 c, g dbSNP:9277529
1258 1258 a, c dbSNP:143935385
1265 1265 a, g dbSNP:9277530
1269 1269 a, g dbSNP:9277531
1293 1293 g, t dbSNP:9277532
1303 1303 c, t dbSNP:9277533
1353 1353 c, g dbSNP:375176024
1389 1389 a, g dbSNP:9277534
1407 1407 a, g dbSNP:553212622
1409 1409 a, g dbSNP:148631508
1443 1443 a, g dbSNP:9277535
1457 1457 c, g dbSNP:142130667
1467 1467 a, t dbSNP:115991335
1472 1472 c, t dbSNP:9277536
1500 1500 c, t dbSNP:564060644
1506 1506 g, t dbSNP:3097677
1581 1581 c, t dbSNP:772533259
1591 1591 a, c dbSNP:9277537
1616 1616 c, t dbSNP:372571124
1629 1629 atagacgtcatttgtcgtctaagtctgcattca, gtagacgtcatttgtcgtctaagtctgcattcg dbSNP:386699897
1629 1629 a, g dbSNP:9277538
1644 1644 c, t dbSNP:747535022
1661 1661 a, g dbSNP:9277539
1680 1680 c, t dbSNP:9501255
1694 1694 a, g dbSNP:3097678
1705 1705 a, g dbSNP:9277540
1709 1709 a, g dbSNP:539592780
1740 1740 a, g dbSNP:9277541
1768 1768 -, ttt dbSNP:67703005
1779 1779 -, c dbSNP:9280312
1779 1779 c, t dbSNP:72500564
1787 1787 g, t dbSNP:534325583
1809 1809 c, t dbSNP:375342014
1829 1829 c, t dbSNP:9277542
1862 1862 -, ttc dbSNP:139610109
1864 1864 -, c, ct dbSNP:9280313
1864 1864 -, c dbSNP:540086241
1864 1864 c, t dbSNP:367734650
1869 1869 -, tc dbSNP:541802787
1870 1870 -, c dbSNP:9280314
1870 1870 c, t dbSNP:73740309
1871 1871 g, t dbSNP:557330813
1876 1876 a, g dbSNP:9277543
1890 1890 c, t dbSNP:9277544
1892 1892 c, t dbSNP:3097679
1905 1905 c, t dbSNP:9277545
1914 1914 c, t dbSNP:540330554
1928 1928 g, t dbSNP:9277546
1937 1937 a, g dbSNP:9501257
1942 1942 a, g dbSNP:9501258
1949 1949 a, c dbSNP:9277547
1966 1966 a, t dbSNP:527319816
1971 1971 g, t dbSNP:765293588
1972 1972 c, t dbSNP:9277548
1977 1977 c, t dbSNP:551656344
1986 1986 g, t dbSNP:568432283
2001 2001 a, g dbSNP:9277549
2017 2017 a, t dbSNP:551251831
2022 2022 a, g dbSNP:200599840
2053 2053 c, g dbSNP:146520390
2069 2069 c, t dbSNP:9277550
2076 2076 g, t dbSNP:9277551
2081 2081 a, t dbSNP:112119417
2083 2083 c, t dbSNP:9277552
2084 2084 a, g dbSNP:539758150
2098 2098 c, t dbSNP:9277553
2120 2120 cacagacttgggcg, tacagacttgggca dbSNP:386699898
2120 2120 c, t dbSNP:9277554
2133 2133 a, g, t dbSNP:9501259
2187 2187 a, g dbSNP:9277555
2236 2236 g, t dbSNP:777184976
2247 2247 -, tct dbSNP:148969528
2247 2247 -, tct dbSNP:577797166
2250 2250 -, ctt dbSNP:72548081
2251 2251 -, ctt dbSNP:376017737
2251 2251 -, ctt dbSNP:9280315
2253 2253 -, ctt dbSNP:77767960
2302 2302 -, c dbSNP:112170964
2303 2303 -, c dbSNP:60460211
2305 2305 -, c dbSNP:369472644
2307 2307 g, t dbSNP:192449683
2310 2310 a, c dbSNP:567910044
2362 2362 c, t dbSNP:3128963
2367 2367 c, t dbSNP:533414261
2400 2400 a, g dbSNP:3128964
2424 2424 -, ttta dbSNP:202073495
2426 2426 -, tatc dbSNP:5875436
2426 2426 -, tatc dbSNP:201709182
2427 2427 -, atct dbSNP:58245331
2427 2427 -, atct dbSNP:538069815
2427 2427 -, atct dbSNP:9280316
2427 2427 a, g dbSNP:77339491
2481 2481 a, g dbSNP:3128965
2494 2494 a, g dbSNP:527924392
2502 2502 a, g dbSNP:116508234
2528 2528 a, g dbSNP:3128966
2547 2547 a, t dbSNP:531863958
2559 2559 a, g dbSNP:550164894
2598 2598 c, g dbSNP:140975703
2602 2602 c, t dbSNP:539307606
2651 2651 a, g dbSNP:3117229
2678 2678 c, t dbSNP:62407982
2679 2679 a, g, t dbSNP:3128967
2702 2702 g, t dbSNP:150147034
2710 2710 c, t dbSNP:138605898
2713 2713 c, t dbSNP:367967323
2728 2728 a, g dbSNP:58649023
2732 2732 c, g dbSNP:577262586
2740 2740 -, ac dbSNP:9280317
2740 2740 -, ac dbSNP:566978547
2742 2742 -, ac dbSNP:374289517
2749 2749 a, g dbSNP:545366585
2789 2789 c, t dbSNP:3130186
2802 2802 c, g dbSNP:753645933
2835 2835 a, t dbSNP:3128968
2838 2838 c, g dbSNP:148951134
2865 2865 c, g dbSNP:755378172
2926 2926 a, g dbSNP:768041140
2933 2933 a, c dbSNP:752359262
2956 2956 a, g dbSNP:3128969
2966 2966 a, g dbSNP:9461832
2978 2978 -, g, ggga, gggg dbSNP:11440264
2979 2979 -, g dbSNP:9282413
2981 2981 -, a, g dbSNP:370425045
2987 2987 c, t dbSNP:3130187
3017 3017 g, t dbSNP:3117228
3043 3043 c, t dbSNP:781606216
3087 3087 a, g dbSNP:532580156
3091 3091 -, gag dbSNP:746607761
3138 3138 c, t dbSNP:371575614
3148 3148 c, t dbSNP:3091281
3191 3191 -, cctctgac dbSNP:748510495
3232 3232 c, t dbSNP:9501260
3235 3235 c, t dbSNP:368192351
3248 3248 c, t dbSNP:548736161
3267 3267 c, t dbSNP:35717031
3276 3276 c, t dbSNP:9277557
3293 3293 c, t dbSNP:9277558
3313 3313 c, t dbSNP:9277559
3320 3320 c, g dbSNP:9277560
3331 3331 c, t dbSNP:9277561
3344 3344 caaca, tgatg dbSNP:386699899
3344 3344 c, t dbSNP:9277562
3345 3345 aaca, gatg dbSNP:386699900
3345 3345 a, g dbSNP:9277563
3346 3346 a, g dbSNP:111656434
3347 3347 c, t dbSNP:9277564
3348 3348 a, g, t dbSNP:3117227
3370 3370 a, g dbSNP:9296075
3372 3372 a, g dbSNP:143732348
3375 3375 c, t dbSNP:532380359
3410 3410 c, t dbSNP:547742800
3422 3422 c, t dbSNP:9296076
3435 3435 a, g dbSNP:527544010
3441 3441 a, g dbSNP:548870282
3479 3479 c, t dbSNP:9277565
3498 3498 g, t dbSNP:9277566
3504 3504 a, g dbSNP:760689516
3521 3521 a, g dbSNP:116233905
3544 3544 c, t dbSNP:3097649
3547 3547 c, t dbSNP:373781933
3572 3572 c, t dbSNP:9501262
3576 3576 c, g dbSNP:73743105
3595 3595 a, c dbSNP:9277567
3608 3608 c, g dbSNP:184799022
3635 3635 c, t dbSNP:376534841
3636 3636 -, tt dbSNP:66953188
3637 3637 c, t dbSNP:9277568
3638 3638 -, tt dbSNP:370163351
3661 3661 a, c dbSNP:767951157
3663 3663 c, g dbSNP:35824566
3686 3686 c, t dbSNP:73743106
3696 3696 a, g dbSNP:112303369
3706 3706 a, g dbSNP:116633358
3713 3713 c, t dbSNP:73743107
3717 3717 a, g dbSNP:138293641
3727 3727 c, t dbSNP:537383712
3758 3758 c, t dbSNP:3130188
3763 3763 c, t dbSNP:372822875
3780 3780 c, g dbSNP:3091282
3787 3787 a, g dbSNP:531521473
3795 3795 c, t dbSNP:3091283
3814 3814 c, t dbSNP:3128970
3826 3826 g, t dbSNP:3091284
3835 3835 c, t dbSNP:547221656
3858 3858 c, t dbSNP:768562879
3905 3905 a, g dbSNP:181449363
3907 3907 a, t dbSNP:536288619
3932 3932 c, t dbSNP:9296077
3933 3933 a, g dbSNP:9501263
3945 3945 a, c dbSNP:9296078
3955 3955 c, t dbSNP:559069707
3969 3969 c, g dbSNP:577371085
4022 4022 c, t dbSNP:3097650

Target ORF information:

RefSeq Version NM_002121
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu40287
Accession Version XM_006715078.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007592.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578811641. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)418..699(+)
Misc Feature(2)433..597(+)
Misc Feature(3)472..690(+)
Misc Feature(4)496..594(+)
Position Chain Variation Link
5 5 a, g dbSNP:754909567
19 19 c, t dbSNP:139338683
20 20 g, t dbSNP:548325353
21 21 c, t dbSNP:17214664
32 32 a, c dbSNP:17214671
35 35 -, c dbSNP:201451888
61 61 -, cagtgagt dbSNP:199519145
84 84 c, t dbSNP:769224035
86 86 c, g dbSNP:774984431
92 92 a, g dbSNP:2567283
99 99 -, a dbSNP:764048597
117 117 c, g dbSNP:767021209
129 129 c, g dbSNP:750089900
156 156 -, gtg dbSNP:751536871
156 156 a, c dbSNP:41544522
156 156 a, c dbSNP:776253405
157 157 ctttt, gtgca, gtgta dbSNP:386699868
157 157 c, g dbSNP:1126504
158 158 c, t dbSNP:202176660
159 159 g, t dbSNP:1126506
160 160 c, g, t dbSNP:12722013
161 161 a, t dbSNP:1126509
163 163 c, t dbSNP:79389600
166 166 gg, tt dbSNP:386699869
166 166 g, t dbSNP:1126511
167 167 g, t dbSNP:1126513
168 168 a, g dbSNP:780390413
170 170 g, t dbSNP:41540313
175 175 c, g dbSNP:749490757
176 176 a, g dbSNP:755441461
183 183 c, t dbSNP:188627284
184 184 a, c, g dbSNP:41555313
192 192 c, t dbSNP:772565701
201 201 a, g dbSNP:772611590
210 210 a, g dbSNP:746588116
212 212 a, t dbSNP:770346059
213 213 a, g dbSNP:776310599
217 217 g, t dbSNP:41553416
218 218 a, g dbSNP:765041810
229 229 a, c, t dbSNP:41545716
230 230 c, g dbSNP:41561114
232 232 c, g dbSNP:12722018
234 234 a, g dbSNP:41555423
238 238 c, t dbSNP:9277348
239 239 a, t dbSNP:1042117
240 240 a, c, t dbSNP:41555415
242 242 c, t dbSNP:1042121
250 250 g, t dbSNP:77062860
255 255 c, g dbSNP:753055175
258 258 c, t dbSNP:758676800
262 262 g, t dbSNP:41552915
263 263 g, t dbSNP:778412325
264 264 a, g dbSNP:12722022
269 269 a, t dbSNP:145190720
275 275 a, c dbSNP:147611944
276 276 a, g, t dbSNP:553686794
279 279 a, g dbSNP:575237777
281 281 c, g, t dbSNP:200784721
283 283 c, g dbSNP:200055547
284 284 a, t dbSNP:200572113
293 293 g, t dbSNP:201374258
299 299 ag, ct dbSNP:386699870
299 299 a, c, t dbSNP:707958
300 300 c, g, t dbSNP:9277351
302 302 a, c dbSNP:1042131
303 303 a, c, g dbSNP:80330773
305 305 a, c dbSNP:766596554
305 305 a, t dbSNP:41545212
306 306 c, g dbSNP:1042133
307 307 c, t dbSNP:114493737
313 313 a, c dbSNP:41550319
314 314 a, c dbSNP:765613028
325 325 c, g dbSNP:41560812
328 328 a, c, t dbSNP:1042136
329 329 a, t dbSNP:41547212
331 331 c, t dbSNP:41547418
334 334 g, t dbSNP:41553216
335 335 -, aggaga dbSNP:757051224
335 335 -, gc dbSNP:780905041
336 336 -, c, gg dbSNP:750649897
337 337 c, g dbSNP:199865386
338 338 a, g dbSNP:201237929
340 340 -, aa, cg dbSNP:780236425
340 340 a, c, g, t dbSNP:1042140
341 341 a, g dbSNP:12722027
343 343 c, t dbSNP:41554314
345 345 g, t dbSNP:41560217
347 347 -, cg dbSNP:768901004
347 347 a, c dbSNP:539497216
348 348 -, g dbSNP:779542214
348 348 a, c dbSNP:769285895
349 349 g, t dbSNP:41546618
350 350 a, c, t dbSNP:748869910
351 351 g, t dbSNP:41556420
352 352 c, g dbSNP:761813230
353 353 c, t dbSNP:41551920
354 354 g, t dbSNP:377295463
357 357 -, acct dbSNP:772481600
357 357 c, t dbSNP:61759928
358 358 -, cctatt dbSNP:759170101
358 358 a, g dbSNP:577903981
359 359 -, ggatg dbSNP:769459532
359 359 -, gg dbSNP:773453957
360 360 -, cct dbSNP:774939603
360 360 a, c, g, t dbSNP:759757752
360 360 a, g dbSNP:41545021
361 361 atg, gta dbSNP:386699871
361 361 a, g dbSNP:1042151
362 362 c, t dbSNP:111596796
363 363 -, cctac dbSNP:763640068
363 363 a, g dbSNP:1042153
363 363 -, g dbSNP:762418075
364 364 c, t dbSNP:751808149
365 365 a, g dbSNP:757602402
378 378 c, g dbSNP:768075332
379 379 a, g dbSNP:750894680
382 382 c, t dbSNP:755668966
384 384 a, g dbSNP:779381535
385 385 a, g dbSNP:76968043
386 386 a, g, t dbSNP:1042169
388 388 -, a dbSNP:141530233
389 389 a, g dbSNP:9277354
389 389 a, g dbSNP:534577141
391 391 c, g dbSNP:9277355
391 391 c, g dbSNP:552975041
393 393 ca, g dbSNP:386699872
393 393 c, g dbSNP:1126532
394 394 -, a dbSNP:202162010
394 394 a, g dbSNP:9277356
399 399 c, g dbSNP:773324204
402 402 a, g dbSNP:41542615
403 403 c, g dbSNP:536113120
407 407 a, g dbSNP:41541915
408 408 c, t dbSNP:41563418
413 413 c, t dbSNP:761183155
422 422 a, g dbSNP:1126537
423 423 c, g dbSNP:754366191
429 429 c, t dbSNP:1126541
431 431 a, t dbSNP:764783267
441 441 c, t dbSNP:752423599
446 446 a, t dbSNP:758087295
449 449 a, g dbSNP:61736937
454 454 a, c, g, t dbSNP:1042187
465 465 a, c dbSNP:751346150
471 471 a, g dbSNP:757067798
479 479 a, g dbSNP:61736936
488 488 c, t dbSNP:562166558
489 489 a, g dbSNP:1042212
500 500 c, t dbSNP:778922500
503 503 a, g dbSNP:61736935
506 506 a, g dbSNP:140447065
516 516 c, t dbSNP:772223745
517 517 c, t dbSNP:773409536
518 518 a, g dbSNP:368841277
522 522 a, c, g dbSNP:61736934
531 531 c, t dbSNP:760040959
535 535 c, t dbSNP:764687991
538 538 g, t dbSNP:566678973
552 552 g, t dbSNP:372905365
553 553 a, g dbSNP:534162897
557 557 g, t dbSNP:751221886
574 574 c, t dbSNP:757047904
575 575 a, g dbSNP:780989395
579 579 c, t dbSNP:750357586
581 581 a, g dbSNP:756011172
600 600 c, t dbSNP:376906908
605 605 a, t dbSNP:61736938
609 609 a, g dbSNP:778977608
612 612 a, g dbSNP:748284821
620 620 -, c dbSNP:780393867
621 621 c, t dbSNP:772135792
622 622 c, t dbSNP:778011110
625 625 c, g dbSNP:747234343
631 631 g, t dbSNP:771222927
634 634 c, g dbSNP:144181653
636 636 c, t dbSNP:1042331
637 637 a, g dbSNP:770371240
644 644 c, t dbSNP:1042335
645 645 c, t dbSNP:772872005
648 648 c, t dbSNP:762588336
663 663 c, t dbSNP:370864722
667 667 a, c, t dbSNP:14362
672 672 c, t dbSNP:1071597
684 684 c, t dbSNP:41559424
685 685 a, g dbSNP:750173090
694 694 a, g dbSNP:755847836
698 698 c, t dbSNP:143091535
700 700 c, t dbSNP:148208390
703 703 a, c, t dbSNP:766140335
715 715 c, t dbSNP:142745911
716 716 a, c, g, t dbSNP:9276
726 726 a, c dbSNP:376840874
729 729 a, g dbSNP:757274982
731 731 c, t dbSNP:766141291
732 732 a, c, g dbSNP:137879953
734 734 a, g dbSNP:780522601
741 741 a, g dbSNP:749814887
743 743 a, g dbSNP:199834306
747 747 c, t dbSNP:769226188
748 748 a, g dbSNP:11551421
754 754 a, g dbSNP:747760493
767 767 a, g dbSNP:771451667
770 770 c, g dbSNP:772967195
773 773 -, t dbSNP:754165149
779 779 a, c, t dbSNP:3097675
780 780 a, c dbSNP:770745804
784 784 a, g dbSNP:776345909
795 795 a, g dbSNP:759486323
810 810 a, g dbSNP:150818884
811 811 c, t dbSNP:780867126
812 812 a, g dbSNP:745501672
818 818 c, t dbSNP:201552902
821 821 -, acaaggaa dbSNP:748621826
821 821 a, c dbSNP:769658433
823 823 -, c dbSNP:778150610
824 824 -, a dbSNP:67523850
826 826 -, g dbSNP:747365417
839 839 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
839 839 c, g dbSNP:1126719
845 845 c, t dbSNP:1126723
856 856 a, t dbSNP:1042448
867 867 aac, gaa dbSNP:386699893
867 867 a, g dbSNP:9277522
869 869 a, c dbSNP:9277523
872 872 c, g dbSNP:564159821
874 874 a, t dbSNP:532241225
887 887 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
887 887 c, t dbSNP:1042467
888 888 a, g dbSNP:3749984
891 891 a, g dbSNP:559452923
892 892 a, g dbSNP:6760
895 895 c, t dbSNP:1042488
900 900 c, t dbSNP:1042497
914 914 c, t dbSNP:1042502
918 918 a, g dbSNP:1042507
924 924 a, c dbSNP:1042508
927 927 g, t dbSNP:1042511
928 928 a, t dbSNP:1042516
935 935 g, t dbSNP:34087328
947 947 c, g dbSNP:3749985
971 971 a, g dbSNP:1042544
977 977 c, t dbSNP:114068468
987 987 c, t dbSNP:759169647
996 996 g, t dbSNP:11551420
1033 1033 c, t dbSNP:1042644
1062 1062 a, g dbSNP:545910027
1064 1064 aag, gac dbSNP:386699895
1064 1064 a, g dbSNP:931
1066 1066 c, g dbSNP:928
1069 1069 c, t dbSNP:186748908
1073 1073 c, t dbSNP:1042634
1091 1091 c, t dbSNP:529885638
1093 1093 c, t dbSNP:935
1100 1100 a, g dbSNP:932

Target ORF information:

RefSeq Version XM_006715078
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54617
Accession Version XM_006725040.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167244.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578839599. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)378..659(+)
Misc Feature(2)393..557(+)
Misc Feature(3)432..650(+)
Misc Feature(4)456..554(+)
Position Chain Variation Link
21 21 -, cagtgagt dbSNP:199519145
44 44 c, t dbSNP:769224035
46 46 c, g dbSNP:774984431
52 52 a, g dbSNP:2567283
59 59 -, a dbSNP:764048597
77 77 c, g dbSNP:767021209
89 89 c, g dbSNP:750089900
116 116 -, gtg dbSNP:751536871
116 116 a, c dbSNP:41544522
116 116 a, c dbSNP:776253405
117 117 ctttt, gtgca, gtgta dbSNP:386699868
117 117 c, g dbSNP:1126504
118 118 c, t dbSNP:202176660
119 119 g, t dbSNP:1126506
120 120 c, g, t dbSNP:12722013
121 121 a, t dbSNP:1126509
123 123 c, t dbSNP:79389600
126 126 gg, tt dbSNP:386699869
126 126 g, t dbSNP:1126511
127 127 g, t dbSNP:1126513
128 128 a, g dbSNP:780390413
130 130 g, t dbSNP:41540313
135 135 c, g dbSNP:749490757
136 136 a, g dbSNP:755441461
143 143 c, t dbSNP:188627284
144 144 a, c, g dbSNP:41555313
152 152 c, t dbSNP:772565701
161 161 a, g dbSNP:772611590
170 170 a, g dbSNP:746588116
172 172 a, t dbSNP:770346059
173 173 a, g dbSNP:776310599
177 177 g, t dbSNP:41553416
178 178 a, g dbSNP:765041810
189 189 a, c, t dbSNP:41545716
190 190 c, g dbSNP:41561114
192 192 c, g dbSNP:12722018
194 194 a, g dbSNP:41555423
198 198 c, t dbSNP:9277348
199 199 a, t dbSNP:1042117
200 200 a, c, t dbSNP:41555415
202 202 c, t dbSNP:1042121
210 210 g, t dbSNP:77062860
215 215 c, g dbSNP:753055175
218 218 c, t dbSNP:758676800
222 222 g, t dbSNP:41552915
223 223 g, t dbSNP:778412325
224 224 a, g dbSNP:12722022
229 229 a, t dbSNP:145190720
235 235 a, c dbSNP:147611944
236 236 a, g, t dbSNP:553686794
239 239 a, g dbSNP:575237777
241 241 c, g, t dbSNP:200784721
243 243 c, g dbSNP:200055547
244 244 a, t dbSNP:200572113
253 253 g, t dbSNP:201374258
259 259 ag, ct dbSNP:386699870
259 259 a, c, t dbSNP:707958
260 260 c, g, t dbSNP:9277351
262 262 a, c dbSNP:1042131
263 263 a, c, g dbSNP:80330773
265 265 a, c dbSNP:766596554
265 265 a, t dbSNP:41545212
266 266 c, g dbSNP:1042133
267 267 c, t dbSNP:114493737
273 273 a, c dbSNP:41550319
274 274 a, c dbSNP:765613028
285 285 c, g dbSNP:41560812
288 288 a, c, t dbSNP:1042136
289 289 a, t dbSNP:41547212
291 291 c, t dbSNP:41547418
294 294 g, t dbSNP:41553216
295 295 -, aggaga dbSNP:757051224
295 295 -, gc dbSNP:780905041
296 296 -, c, gg dbSNP:750649897
297 297 c, g dbSNP:199865386
298 298 a, g dbSNP:201237929
300 300 -, aa, cg dbSNP:780236425
300 300 a, c, g, t dbSNP:1042140
301 301 a, g dbSNP:12722027
303 303 c, t dbSNP:41554314
305 305 g, t dbSNP:41560217
307 307 -, cg dbSNP:768901004
307 307 a, c dbSNP:539497216
308 308 -, g dbSNP:779542214
308 308 a, c dbSNP:769285895
309 309 g, t dbSNP:41546618
310 310 a, c, t dbSNP:748869910
311 311 g, t dbSNP:41556420
312 312 c, g dbSNP:761813230
313 313 c, t dbSNP:41551920
314 314 g, t dbSNP:377295463
317 317 -, acct dbSNP:772481600
317 317 c, t dbSNP:61759928
318 318 -, cctatt dbSNP:759170101
318 318 a, g dbSNP:577903981
319 319 -, ggatg dbSNP:769459532
319 319 -, gg dbSNP:773453957
320 320 -, cct dbSNP:774939603
320 320 a, c, g, t dbSNP:759757752
320 320 a, g dbSNP:41545021
321 321 atg, gta dbSNP:386699871
321 321 a, g dbSNP:1042151
322 322 c, t dbSNP:111596796
323 323 -, cctac dbSNP:763640068
323 323 a, g dbSNP:1042153
323 323 -, g dbSNP:762418075
324 324 c, t dbSNP:751808149
325 325 a, g dbSNP:757602402
338 338 c, g dbSNP:768075332
339 339 a, g dbSNP:750894680
342 342 c, t dbSNP:755668966
344 344 a, g dbSNP:779381535
345 345 a, g dbSNP:76968043
346 346 a, g, t dbSNP:1042169
348 348 -, a dbSNP:141530233
349 349 a, g dbSNP:9277354
349 349 a, g dbSNP:534577141
351 351 c, g dbSNP:9277355
351 351 c, g dbSNP:552975041
353 353 ca, g dbSNP:386699872
353 353 c, g dbSNP:1126532
354 354 -, a dbSNP:202162010
354 354 a, g dbSNP:9277356
359 359 c, g dbSNP:773324204
362 362 a, g dbSNP:41542615
363 363 c, g dbSNP:536113120
367 367 a, g dbSNP:41541915
368 368 c, t dbSNP:41563418
373 373 c, t dbSNP:761183155
382 382 a, g dbSNP:1126537
383 383 c, g dbSNP:754366191
389 389 c, t dbSNP:1126541
391 391 a, t dbSNP:764783267
401 401 c, t dbSNP:752423599
406 406 a, t dbSNP:758087295
409 409 a, g dbSNP:61736937
414 414 a, c, g, t dbSNP:1042187
425 425 a, c dbSNP:751346150
431 431 a, g dbSNP:757067798
439 439 a, g dbSNP:61736936
448 448 c, t dbSNP:562166558
449 449 a, g dbSNP:1042212
460 460 c, t dbSNP:778922500
463 463 a, g dbSNP:61736935
466 466 a, g dbSNP:140447065
476 476 c, t dbSNP:772223745
477 477 c, t dbSNP:773409536
478 478 a, g dbSNP:368841277
482 482 a, c, g dbSNP:61736934
491 491 c, t dbSNP:760040959
495 495 c, t dbSNP:764687991
498 498 g, t dbSNP:566678973
512 512 g, t dbSNP:372905365
513 513 a, g dbSNP:534162897
517 517 g, t dbSNP:751221886
534 534 c, t dbSNP:757047904
535 535 a, g dbSNP:780989395
539 539 c, t dbSNP:750357586
541 541 a, g dbSNP:756011172
560 560 c, t dbSNP:376906908
565 565 a, t dbSNP:61736938
569 569 a, g dbSNP:778977608
572 572 a, g dbSNP:748284821
580 580 -, c dbSNP:780393867
581 581 c, t dbSNP:772135792
582 582 c, t dbSNP:778011110
585 585 c, g dbSNP:747234343
591 591 g, t dbSNP:771222927
594 594 c, g dbSNP:144181653
596 596 c, t dbSNP:1042331
597 597 a, g dbSNP:770371240
604 604 c, t dbSNP:1042335
605 605 c, t dbSNP:772872005
608 608 c, t dbSNP:762588336
623 623 c, t dbSNP:370864722
627 627 a, c, t dbSNP:14362
632 632 c, t dbSNP:1071597
644 644 c, t dbSNP:41559424
645 645 a, g dbSNP:750173090
654 654 a, g dbSNP:755847836
658 658 c, t dbSNP:143091535
660 660 c, t dbSNP:148208390
663 663 a, c, t dbSNP:766140335
675 675 c, t dbSNP:142745911
676 676 a, c, g, t dbSNP:9276
686 686 a, c dbSNP:376840874
689 689 a, g dbSNP:757274982
691 691 c, t dbSNP:766141291
692 692 a, c, g dbSNP:137879953
694 694 a, g dbSNP:780522601
701 701 a, g dbSNP:749814887
703 703 a, g dbSNP:199834306
707 707 c, t dbSNP:769226188
708 708 a, g dbSNP:11551421
714 714 a, g dbSNP:747760493
727 727 a, g dbSNP:771451667
730 730 c, g dbSNP:772967195
733 733 -, t dbSNP:754165149
739 739 a, c, t dbSNP:3097675
740 740 a, c dbSNP:770745804
744 744 a, g dbSNP:776345909
755 755 a, g dbSNP:759486323
770 770 a, g dbSNP:150818884
771 771 c, t dbSNP:780867126
772 772 a, g dbSNP:745501672
778 778 c, t dbSNP:201552902
781 781 -, acaaggaa dbSNP:748621826
781 781 a, c dbSNP:769658433
783 783 -, c dbSNP:778150610
784 784 -, a dbSNP:67523850
786 786 -, g dbSNP:747365417
799 799 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
799 799 c, g dbSNP:1126719
805 805 c, t dbSNP:1126723
816 816 a, t dbSNP:1042448
827 827 aac, gaa dbSNP:386699893
827 827 a, g dbSNP:9277522
829 829 a, c dbSNP:9277523
832 832 c, g dbSNP:564159821
834 834 a, t dbSNP:532241225
847 847 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
847 847 c, t dbSNP:1042467
848 848 a, g dbSNP:3749984
851 851 a, g dbSNP:559452923
852 852 a, g dbSNP:6760
855 855 c, t dbSNP:1042488
860 860 c, t dbSNP:1042497
874 874 c, t dbSNP:1042502
878 878 a, g dbSNP:1042507
884 884 a, c dbSNP:1042508
887 887 g, t dbSNP:1042511
888 888 a, t dbSNP:1042516
895 895 g, t dbSNP:34087328
907 907 c, g dbSNP:3749985
931 931 a, g dbSNP:1042544
937 937 c, t dbSNP:114068468
947 947 c, t dbSNP:759169647
956 956 g, t dbSNP:11551420
993 993 c, t dbSNP:1042644
1022 1022 a, g dbSNP:545910027
1024 1024 aag, gac dbSNP:386699895
1024 1024 a, g dbSNP:931
1026 1026 c, g dbSNP:928
1029 1029 c, t dbSNP:186748908
1033 1033 c, t dbSNP:1042634
1051 1051 c, t dbSNP:529885638
1053 1053 c, t dbSNP:935
1060 1060 a, g dbSNP:932

Target ORF information:

RefSeq Version XM_006725040
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu40287
Accession Version XM_006725699.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167245.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578841357. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)418..699(+)
Misc Feature(2)433..597(+)
Misc Feature(3)472..690(+)
Misc Feature(4)496..594(+)
Position Chain Variation Link
5 5 a, g dbSNP:754909567
19 19 c, t dbSNP:139338683
20 20 g, t dbSNP:548325353
21 21 c, t dbSNP:17214664
32 32 a, c dbSNP:17214671
35 35 -, c dbSNP:201451888
61 61 -, cagtgagt dbSNP:199519145
84 84 c, t dbSNP:769224035
86 86 c, g dbSNP:774984431
92 92 a, g dbSNP:2567283
99 99 -, a dbSNP:764048597
117 117 c, g dbSNP:767021209
129 129 c, g dbSNP:750089900
156 156 -, gtg dbSNP:751536871
156 156 a, c dbSNP:41544522
156 156 a, c dbSNP:776253405
157 157 ctttt, gtgca, gtgta dbSNP:386699868
157 157 c, g dbSNP:1126504
158 158 c, t dbSNP:202176660
159 159 g, t dbSNP:1126506
160 160 c, g, t dbSNP:12722013
161 161 a, t dbSNP:1126509
163 163 c, t dbSNP:79389600
166 166 gg, tt dbSNP:386699869
166 166 g, t dbSNP:1126511
167 167 g, t dbSNP:1126513
168 168 a, g dbSNP:780390413
170 170 g, t dbSNP:41540313
175 175 c, g dbSNP:749490757
176 176 a, g dbSNP:755441461
183 183 c, t dbSNP:188627284
184 184 a, c, g dbSNP:41555313
192 192 c, t dbSNP:772565701
201 201 a, g dbSNP:772611590
210 210 a, g dbSNP:746588116
212 212 a, t dbSNP:770346059
213 213 a, g dbSNP:776310599
217 217 g, t dbSNP:41553416
218 218 a, g dbSNP:765041810
229 229 a, c, t dbSNP:41545716
230 230 c, g dbSNP:41561114
232 232 c, g dbSNP:12722018
234 234 a, g dbSNP:41555423
238 238 c, t dbSNP:9277348
239 239 a, t dbSNP:1042117
240 240 a, c, t dbSNP:41555415
242 242 c, t dbSNP:1042121
250 250 g, t dbSNP:77062860
255 255 c, g dbSNP:753055175
258 258 c, t dbSNP:758676800
262 262 g, t dbSNP:41552915
263 263 g, t dbSNP:778412325
264 264 a, g dbSNP:12722022
269 269 a, t dbSNP:145190720
275 275 a, c dbSNP:147611944
276 276 a, g, t dbSNP:553686794
279 279 a, g dbSNP:575237777
281 281 c, g, t dbSNP:200784721
283 283 c, g dbSNP:200055547
284 284 a, t dbSNP:200572113
293 293 g, t dbSNP:201374258
299 299 ag, ct dbSNP:386699870
299 299 a, c, t dbSNP:707958
300 300 c, g, t dbSNP:9277351
302 302 a, c dbSNP:1042131
303 303 a, c, g dbSNP:80330773
305 305 a, c dbSNP:766596554
305 305 a, t dbSNP:41545212
306 306 c, g dbSNP:1042133
307 307 c, t dbSNP:114493737
313 313 a, c dbSNP:41550319
314 314 a, c dbSNP:765613028
325 325 c, g dbSNP:41560812
328 328 a, c, t dbSNP:1042136
329 329 a, t dbSNP:41547212
331 331 c, t dbSNP:41547418
334 334 g, t dbSNP:41553216
335 335 -, aggaga dbSNP:757051224
335 335 -, gc dbSNP:780905041
336 336 -, c, gg dbSNP:750649897
337 337 c, g dbSNP:199865386
338 338 a, g dbSNP:201237929
340 340 -, aa, cg dbSNP:780236425
340 340 a, c, g, t dbSNP:1042140
341 341 a, g dbSNP:12722027
343 343 c, t dbSNP:41554314
345 345 g, t dbSNP:41560217
347 347 -, cg dbSNP:768901004
347 347 a, c dbSNP:539497216
348 348 -, g dbSNP:779542214
348 348 a, c dbSNP:769285895
349 349 g, t dbSNP:41546618
350 350 a, c, t dbSNP:748869910
351 351 g, t dbSNP:41556420
352 352 c, g dbSNP:761813230
353 353 c, t dbSNP:41551920
354 354 g, t dbSNP:377295463
357 357 -, acct dbSNP:772481600
357 357 c, t dbSNP:61759928
358 358 -, cctatt dbSNP:759170101
358 358 a, g dbSNP:577903981
359 359 -, ggatg dbSNP:769459532
359 359 -, gg dbSNP:773453957
360 360 -, cct dbSNP:774939603
360 360 a, c, g, t dbSNP:759757752
360 360 a, g dbSNP:41545021
361 361 atg, gta dbSNP:386699871
361 361 a, g dbSNP:1042151
362 362 c, t dbSNP:111596796
363 363 -, cctac dbSNP:763640068
363 363 a, g dbSNP:1042153
363 363 -, g dbSNP:762418075
364 364 c, t dbSNP:751808149
365 365 a, g dbSNP:757602402
378 378 c, g dbSNP:768075332
379 379 a, g dbSNP:750894680
382 382 c, t dbSNP:755668966
384 384 a, g dbSNP:779381535
385 385 a, g dbSNP:76968043
386 386 a, g, t dbSNP:1042169
388 388 -, a dbSNP:141530233
389 389 a, g dbSNP:9277354
389 389 a, g dbSNP:534577141
391 391 c, g dbSNP:9277355
391 391 c, g dbSNP:552975041
393 393 ca, g dbSNP:386699872
393 393 c, g dbSNP:1126532
394 394 -, a dbSNP:202162010
394 394 a, g dbSNP:9277356
399 399 c, g dbSNP:773324204
402 402 a, g dbSNP:41542615
403 403 c, g dbSNP:536113120
407 407 a, g dbSNP:41541915
408 408 c, t dbSNP:41563418
413 413 c, t dbSNP:761183155
422 422 a, g dbSNP:1126537
423 423 c, g dbSNP:754366191
429 429 c, t dbSNP:1126541
431 431 a, t dbSNP:764783267
441 441 c, t dbSNP:752423599
446 446 a, t dbSNP:758087295
449 449 a, g dbSNP:61736937
454 454 a, c, g, t dbSNP:1042187
465 465 a, c dbSNP:751346150
471 471 a, g dbSNP:757067798
479 479 a, g dbSNP:61736936
488 488 c, t dbSNP:562166558
489 489 a, g dbSNP:1042212
500 500 c, t dbSNP:778922500
503 503 a, g dbSNP:61736935
506 506 a, g dbSNP:140447065
516 516 c, t dbSNP:772223745
517 517 c, t dbSNP:773409536
518 518 a, g dbSNP:368841277
522 522 a, c, g dbSNP:61736934
531 531 c, t dbSNP:760040959
535 535 c, t dbSNP:764687991
538 538 g, t dbSNP:566678973
552 552 g, t dbSNP:372905365
553 553 a, g dbSNP:534162897
557 557 g, t dbSNP:751221886
574 574 c, t dbSNP:757047904
575 575 a, g dbSNP:780989395
579 579 c, t dbSNP:750357586
581 581 a, g dbSNP:756011172
600 600 c, t dbSNP:376906908
605 605 a, t dbSNP:61736938
609 609 a, g dbSNP:778977608
612 612 a, g dbSNP:748284821
620 620 -, c dbSNP:780393867
621 621 c, t dbSNP:772135792
622 622 c, t dbSNP:778011110
625 625 c, g dbSNP:747234343
631 631 g, t dbSNP:771222927
634 634 c, g dbSNP:144181653
636 636 c, t dbSNP:1042331
637 637 a, g dbSNP:770371240
644 644 c, t dbSNP:1042335
645 645 c, t dbSNP:772872005
648 648 c, t dbSNP:762588336
663 663 c, t dbSNP:370864722
667 667 a, c, t dbSNP:14362
672 672 c, t dbSNP:1071597
684 684 c, t dbSNP:41559424
685 685 a, g dbSNP:750173090
694 694 a, g dbSNP:755847836
698 698 c, t dbSNP:143091535
700 700 c, t dbSNP:148208390
703 703 a, c, t dbSNP:766140335
715 715 c, t dbSNP:142745911
716 716 a, c, g, t dbSNP:9276
726 726 a, c dbSNP:376840874
729 729 a, g dbSNP:757274982
731 731 c, t dbSNP:766141291
732 732 a, c, g dbSNP:137879953
734 734 a, g dbSNP:780522601
741 741 a, g dbSNP:749814887
743 743 a, g dbSNP:199834306
747 747 c, t dbSNP:769226188
748 748 a, g dbSNP:11551421
754 754 a, g dbSNP:747760493
767 767 a, g dbSNP:771451667
770 770 c, g dbSNP:772967195
773 773 -, t dbSNP:754165149
779 779 a, c, t dbSNP:3097675
780 780 a, c dbSNP:770745804
784 784 a, g dbSNP:776345909
795 795 a, g dbSNP:759486323
810 810 a, g dbSNP:150818884
811 811 c, t dbSNP:780867126
812 812 a, g dbSNP:745501672
818 818 c, t dbSNP:201552902
821 821 -, acaaggaa dbSNP:748621826
821 821 a, c dbSNP:769658433
823 823 -, c dbSNP:778150610
824 824 -, a dbSNP:67523850
826 826 -, g dbSNP:747365417
839 839 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
839 839 c, g dbSNP:1126719
845 845 c, t dbSNP:1126723
856 856 a, t dbSNP:1042448
867 867 aac, gaa dbSNP:386699893
867 867 a, g dbSNP:9277522
869 869 a, c dbSNP:9277523
872 872 c, g dbSNP:564159821
874 874 a, t dbSNP:532241225
887 887 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
887 887 c, t dbSNP:1042467
888 888 a, g dbSNP:3749984
891 891 a, g dbSNP:559452923
892 892 a, g dbSNP:6760
895 895 c, t dbSNP:1042488
900 900 c, t dbSNP:1042497
914 914 c, t dbSNP:1042502
918 918 a, g dbSNP:1042507
924 924 a, c dbSNP:1042508
927 927 g, t dbSNP:1042511
928 928 a, t dbSNP:1042516
935 935 g, t dbSNP:34087328
947 947 c, g dbSNP:3749985
971 971 a, g dbSNP:1042544
977 977 c, t dbSNP:114068468
987 987 c, t dbSNP:759169647
996 996 g, t dbSNP:11551420
1033 1033 c, t dbSNP:1042644
1062 1062 a, g dbSNP:545910027
1064 1064 aag, gac dbSNP:386699895
1064 1064 a, g dbSNP:931
1066 1066 c, g dbSNP:928
1069 1069 c, t dbSNP:186748908
1073 1073 c, t dbSNP:1042634
1091 1091 c, t dbSNP:529885638
1093 1093 c, t dbSNP:935
1100 1100 a, g dbSNP:932

Target ORF information:

RefSeq Version XM_006725699
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu40287
Accession Version XM_006725817.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167246.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578841634. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)375..656(+)
Misc Feature(2)390..554(+)
Misc Feature(3)429..647(+)
Misc Feature(4)453..551(+)
Position Chain Variation Link
18 18 -, cagtgagt dbSNP:199519145
41 41 c, t dbSNP:769224035
43 43 c, g dbSNP:774984431
49 49 a, g dbSNP:2567283
56 56 -, a dbSNP:764048597
74 74 c, g dbSNP:767021209
86 86 c, g dbSNP:750089900
113 113 -, gtg dbSNP:751536871
113 113 a, c dbSNP:41544522
113 113 a, c dbSNP:776253405
114 114 ctttt, gtgca, gtgta dbSNP:386699868
114 114 c, g dbSNP:1126504
115 115 c, t dbSNP:202176660
116 116 g, t dbSNP:1126506
117 117 c, g, t dbSNP:12722013
118 118 a, t dbSNP:1126509
120 120 c, t dbSNP:79389600
123 123 gg, tt dbSNP:386699869
123 123 g, t dbSNP:1126511
124 124 g, t dbSNP:1126513
125 125 a, g dbSNP:780390413
127 127 g, t dbSNP:41540313
132 132 c, g dbSNP:749490757
133 133 a, g dbSNP:755441461
140 140 c, t dbSNP:188627284
141 141 a, c, g dbSNP:41555313
149 149 c, t dbSNP:772565701
158 158 a, g dbSNP:772611590
167 167 a, g dbSNP:746588116
169 169 a, t dbSNP:770346059
170 170 a, g dbSNP:776310599
174 174 g, t dbSNP:41553416
175 175 a, g dbSNP:765041810
186 186 a, c, t dbSNP:41545716
187 187 c, g dbSNP:41561114
189 189 c, g dbSNP:12722018
191 191 a, g dbSNP:41555423
195 195 c, t dbSNP:9277348
196 196 a, t dbSNP:1042117
197 197 a, c, t dbSNP:41555415
199 199 c, t dbSNP:1042121
207 207 g, t dbSNP:77062860
212 212 c, g dbSNP:753055175
215 215 c, t dbSNP:758676800
219 219 g, t dbSNP:41552915
220 220 g, t dbSNP:778412325
221 221 a, g dbSNP:12722022
226 226 a, t dbSNP:145190720
232 232 a, c dbSNP:147611944
233 233 a, g, t dbSNP:553686794
236 236 a, g dbSNP:575237777
238 238 c, g, t dbSNP:200784721
240 240 c, g dbSNP:200055547
241 241 a, t dbSNP:200572113
250 250 g, t dbSNP:201374258
256 256 ag, ct dbSNP:386699870
256 256 a, c, t dbSNP:707958
257 257 c, g, t dbSNP:9277351
259 259 a, c dbSNP:1042131
260 260 a, c, g dbSNP:80330773
262 262 a, c dbSNP:766596554
262 262 a, t dbSNP:41545212
263 263 c, g dbSNP:1042133
264 264 c, t dbSNP:114493737
270 270 a, c dbSNP:41550319
271 271 a, c dbSNP:765613028
282 282 c, g dbSNP:41560812
285 285 a, c, t dbSNP:1042136
286 286 a, t dbSNP:41547212
288 288 c, t dbSNP:41547418
291 291 g, t dbSNP:41553216
292 292 -, aggaga dbSNP:757051224
292 292 -, gc dbSNP:780905041
293 293 -, c, gg dbSNP:750649897
294 294 c, g dbSNP:199865386
295 295 a, g dbSNP:201237929
297 297 -, aa, cg dbSNP:780236425
297 297 a, c, g, t dbSNP:1042140
298 298 a, g dbSNP:12722027
300 300 c, t dbSNP:41554314
302 302 g, t dbSNP:41560217
304 304 -, cg dbSNP:768901004
304 304 a, c dbSNP:539497216
305 305 -, g dbSNP:779542214
305 305 a, c dbSNP:769285895
306 306 g, t dbSNP:41546618
307 307 a, c, t dbSNP:748869910
308 308 g, t dbSNP:41556420
309 309 c, g dbSNP:761813230
310 310 c, t dbSNP:41551920
311 311 g, t dbSNP:377295463
314 314 -, acct dbSNP:772481600
314 314 c, t dbSNP:61759928
315 315 -, cctatt dbSNP:759170101
315 315 a, g dbSNP:577903981
316 316 -, ggatg dbSNP:769459532
316 316 -, gg dbSNP:773453957
317 317 -, cct dbSNP:774939603
317 317 a, c, g, t dbSNP:759757752
317 317 a, g dbSNP:41545021
318 318 atg, gta dbSNP:386699871
318 318 a, g dbSNP:1042151
319 319 c, t dbSNP:111596796
320 320 -, cctac dbSNP:763640068
320 320 a, g dbSNP:1042153
320 320 -, g dbSNP:762418075
321 321 c, t dbSNP:751808149
322 322 a, g dbSNP:757602402
335 335 c, g dbSNP:768075332
336 336 a, g dbSNP:750894680
339 339 c, t dbSNP:755668966
341 341 a, g dbSNP:779381535
342 342 a, g dbSNP:76968043
343 343 a, g, t dbSNP:1042169
345 345 -, a dbSNP:141530233
346 346 a, g dbSNP:9277354
346 346 a, g dbSNP:534577141
348 348 c, g dbSNP:9277355
348 348 c, g dbSNP:552975041
350 350 ca, g dbSNP:386699872
350 350 c, g dbSNP:1126532
351 351 -, a dbSNP:202162010
351 351 a, g dbSNP:9277356
356 356 c, g dbSNP:773324204
359 359 a, g dbSNP:41542615
360 360 c, g dbSNP:536113120
364 364 a, g dbSNP:41541915
365 365 c, t dbSNP:41563418
370 370 c, t dbSNP:761183155
379 379 a, g dbSNP:1126537
380 380 c, g dbSNP:754366191
386 386 c, t dbSNP:1126541
388 388 a, t dbSNP:764783267
398 398 c, t dbSNP:752423599
403 403 a, t dbSNP:758087295
406 406 a, g dbSNP:61736937
411 411 a, c, g, t dbSNP:1042187
422 422 a, c dbSNP:751346150
428 428 a, g dbSNP:757067798
436 436 a, g dbSNP:61736936
445 445 c, t dbSNP:562166558
446 446 a, g dbSNP:1042212
457 457 c, t dbSNP:778922500
460 460 a, g dbSNP:61736935
463 463 a, g dbSNP:140447065
473 473 c, t dbSNP:772223745
474 474 c, t dbSNP:773409536
475 475 a, g dbSNP:368841277
479 479 a, c, g dbSNP:61736934
488 488 c, t dbSNP:760040959
492 492 c, t dbSNP:764687991
495 495 g, t dbSNP:566678973
509 509 g, t dbSNP:372905365
510 510 a, g dbSNP:534162897
514 514 g, t dbSNP:751221886
531 531 c, t dbSNP:757047904
532 532 a, g dbSNP:780989395
536 536 c, t dbSNP:750357586
538 538 a, g dbSNP:756011172
557 557 c, t dbSNP:376906908
562 562 a, t dbSNP:61736938
566 566 a, g dbSNP:778977608
569 569 a, g dbSNP:748284821
577 577 -, c dbSNP:780393867
578 578 c, t dbSNP:772135792
579 579 c, t dbSNP:778011110
582 582 c, g dbSNP:747234343
588 588 g, t dbSNP:771222927
591 591 c, g dbSNP:144181653
593 593 c, t dbSNP:1042331
594 594 a, g dbSNP:770371240
601 601 c, t dbSNP:1042335
602 602 c, t dbSNP:772872005
605 605 c, t dbSNP:762588336
620 620 c, t dbSNP:370864722
624 624 a, c, t dbSNP:14362
629 629 c, t dbSNP:1071597
641 641 c, t dbSNP:41559424
642 642 a, g dbSNP:750173090
651 651 a, g dbSNP:755847836
655 655 c, t dbSNP:143091535
657 657 c, t dbSNP:148208390
660 660 a, c, t dbSNP:766140335
672 672 c, t dbSNP:142745911
673 673 a, c, g, t dbSNP:9276
683 683 a, c dbSNP:376840874
686 686 a, g dbSNP:757274982
688 688 c, t dbSNP:766141291
689 689 a, c, g dbSNP:137879953
691 691 a, g dbSNP:780522601
698 698 a, g dbSNP:749814887
700 700 a, g dbSNP:199834306
704 704 c, t dbSNP:769226188
705 705 a, g dbSNP:11551421
711 711 a, g dbSNP:747760493
724 724 a, g dbSNP:771451667
727 727 c, g dbSNP:772967195
730 730 -, t dbSNP:754165149
736 736 a, c, t dbSNP:3097675
737 737 a, c dbSNP:770745804
741 741 a, g dbSNP:776345909
752 752 a, g dbSNP:759486323
767 767 a, g dbSNP:150818884
768 768 c, t dbSNP:780867126
769 769 a, g dbSNP:745501672
775 775 c, t dbSNP:201552902
778 778 -, acaaggaa dbSNP:748621826
778 778 a, c dbSNP:769658433
780 780 -, c dbSNP:778150610
781 781 -, a dbSNP:67523850
783 783 -, g dbSNP:747365417
796 796 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
796 796 c, g dbSNP:1126719
802 802 c, t dbSNP:1126723
813 813 a, t dbSNP:1042448
824 824 aac, gaa dbSNP:386699893
824 824 a, g dbSNP:9277522
826 826 a, c dbSNP:9277523
829 829 c, g dbSNP:564159821
831 831 a, t dbSNP:532241225
844 844 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
844 844 c, t dbSNP:1042467
845 845 a, g dbSNP:3749984
848 848 a, g dbSNP:559452923
849 849 a, g dbSNP:6760
852 852 c, t dbSNP:1042488
857 857 c, t dbSNP:1042497
871 871 c, t dbSNP:1042502
875 875 a, g dbSNP:1042507
881 881 a, c dbSNP:1042508
884 884 g, t dbSNP:1042511
885 885 a, t dbSNP:1042516
892 892 g, t dbSNP:34087328
904 904 c, g dbSNP:3749985
928 928 a, g dbSNP:1042544
934 934 c, t dbSNP:114068468
944 944 c, t dbSNP:759169647
953 953 g, t dbSNP:11551420
990 990 c, t dbSNP:1042644
1019 1019 a, g dbSNP:545910027
1021 1021 aag, gac dbSNP:386699895
1021 1021 a, g dbSNP:931
1023 1023 c, g dbSNP:928
1026 1026 c, t dbSNP:186748908
1030 1030 c, t dbSNP:1042634
1048 1048 c, t dbSNP:529885638
1050 1050 c, t dbSNP:935
1057 1057 a, g dbSNP:932

Target ORF information:

RefSeq Version XM_006725817
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54617
Accession Version XM_006725908.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167247.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578841859. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)378..659(+)
Misc Feature(2)393..557(+)
Misc Feature(3)432..650(+)
Misc Feature(4)456..554(+)
Position Chain Variation Link
21 21 -, cagtgagt dbSNP:199519145
44 44 c, t dbSNP:769224035
46 46 c, g dbSNP:774984431
52 52 a, g dbSNP:2567283
59 59 -, a dbSNP:764048597
77 77 c, g dbSNP:767021209
89 89 c, g dbSNP:750089900
116 116 -, gtg dbSNP:751536871
116 116 a, c dbSNP:41544522
116 116 a, c dbSNP:776253405
117 117 ctttt, gtgca, gtgta dbSNP:386699868
117 117 c, g dbSNP:1126504
118 118 c, t dbSNP:202176660
119 119 g, t dbSNP:1126506
120 120 c, g, t dbSNP:12722013
121 121 a, t dbSNP:1126509
123 123 c, t dbSNP:79389600
126 126 gg, tt dbSNP:386699869
126 126 g, t dbSNP:1126511
127 127 g, t dbSNP:1126513
128 128 a, g dbSNP:780390413
130 130 g, t dbSNP:41540313
135 135 c, g dbSNP:749490757
136 136 a, g dbSNP:755441461
143 143 c, t dbSNP:188627284
144 144 a, c, g dbSNP:41555313
152 152 c, t dbSNP:772565701
161 161 a, g dbSNP:772611590
170 170 a, g dbSNP:746588116
172 172 a, t dbSNP:770346059
173 173 a, g dbSNP:776310599
177 177 g, t dbSNP:41553416
178 178 a, g dbSNP:765041810
189 189 a, c, t dbSNP:41545716
190 190 c, g dbSNP:41561114
192 192 c, g dbSNP:12722018
194 194 a, g dbSNP:41555423
198 198 c, t dbSNP:9277348
199 199 a, t dbSNP:1042117
200 200 a, c, t dbSNP:41555415
202 202 c, t dbSNP:1042121
210 210 g, t dbSNP:77062860
215 215 c, g dbSNP:753055175
218 218 c, t dbSNP:758676800
222 222 g, t dbSNP:41552915
223 223 g, t dbSNP:778412325
224 224 a, g dbSNP:12722022
229 229 a, t dbSNP:145190720
235 235 a, c dbSNP:147611944
236 236 a, g, t dbSNP:553686794
239 239 a, g dbSNP:575237777
241 241 c, g, t dbSNP:200784721
243 243 c, g dbSNP:200055547
244 244 a, t dbSNP:200572113
253 253 g, t dbSNP:201374258
259 259 ag, ct dbSNP:386699870
259 259 a, c, t dbSNP:707958
260 260 c, g, t dbSNP:9277351
262 262 a, c dbSNP:1042131
263 263 a, c, g dbSNP:80330773
265 265 a, c dbSNP:766596554
265 265 a, t dbSNP:41545212
266 266 c, g dbSNP:1042133
267 267 c, t dbSNP:114493737
273 273 a, c dbSNP:41550319
274 274 a, c dbSNP:765613028
285 285 c, g dbSNP:41560812
288 288 a, c, t dbSNP:1042136
289 289 a, t dbSNP:41547212
291 291 c, t dbSNP:41547418
294 294 g, t dbSNP:41553216
295 295 -, aggaga dbSNP:757051224
295 295 -, gc dbSNP:780905041
296 296 -, c, gg dbSNP:750649897
297 297 c, g dbSNP:199865386
298 298 a, g dbSNP:201237929
300 300 -, aa, cg dbSNP:780236425
300 300 a, c, g, t dbSNP:1042140
301 301 a, g dbSNP:12722027
303 303 c, t dbSNP:41554314
305 305 g, t dbSNP:41560217
307 307 -, cg dbSNP:768901004
307 307 a, c dbSNP:539497216
308 308 -, g dbSNP:779542214
308 308 a, c dbSNP:769285895
309 309 g, t dbSNP:41546618
310 310 a, c, t dbSNP:748869910
311 311 g, t dbSNP:41556420
312 312 c, g dbSNP:761813230
313 313 c, t dbSNP:41551920
314 314 g, t dbSNP:377295463
317 317 -, acct dbSNP:772481600
317 317 c, t dbSNP:61759928
318 318 -, cctatt dbSNP:759170101
318 318 a, g dbSNP:577903981
319 319 -, ggatg dbSNP:769459532
319 319 -, gg dbSNP:773453957
320 320 -, cct dbSNP:774939603
320 320 a, c, g, t dbSNP:759757752
320 320 a, g dbSNP:41545021
321 321 atg, gta dbSNP:386699871
321 321 a, g dbSNP:1042151
322 322 c, t dbSNP:111596796
323 323 -, cctac dbSNP:763640068
323 323 a, g dbSNP:1042153
323 323 -, g dbSNP:762418075
324 324 c, t dbSNP:751808149
325 325 a, g dbSNP:757602402
338 338 c, g dbSNP:768075332
339 339 a, g dbSNP:750894680
342 342 c, t dbSNP:755668966
344 344 a, g dbSNP:779381535
345 345 a, g dbSNP:76968043
346 346 a, g, t dbSNP:1042169
348 348 -, a dbSNP:141530233
349 349 a, g dbSNP:9277354
349 349 a, g dbSNP:534577141
351 351 c, g dbSNP:9277355
351 351 c, g dbSNP:552975041
353 353 ca, g dbSNP:386699872
353 353 c, g dbSNP:1126532
354 354 -, a dbSNP:202162010
354 354 a, g dbSNP:9277356
359 359 c, g dbSNP:773324204
362 362 a, g dbSNP:41542615
363 363 c, g dbSNP:536113120
367 367 a, g dbSNP:41541915
368 368 c, t dbSNP:41563418
373 373 c, t dbSNP:761183155
382 382 a, g dbSNP:1126537
383 383 c, g dbSNP:754366191
389 389 c, t dbSNP:1126541
391 391 a, t dbSNP:764783267
401 401 c, t dbSNP:752423599
406 406 a, t dbSNP:758087295
409 409 a, g dbSNP:61736937
414 414 a, c, g, t dbSNP:1042187
425 425 a, c dbSNP:751346150
431 431 a, g dbSNP:757067798
439 439 a, g dbSNP:61736936
448 448 c, t dbSNP:562166558
449 449 a, g dbSNP:1042212
460 460 c, t dbSNP:778922500
463 463 a, g dbSNP:61736935
466 466 a, g dbSNP:140447065
476 476 c, t dbSNP:772223745
477 477 c, t dbSNP:773409536
478 478 a, g dbSNP:368841277
482 482 a, c, g dbSNP:61736934
491 491 c, t dbSNP:760040959
495 495 c, t dbSNP:764687991
498 498 g, t dbSNP:566678973
512 512 g, t dbSNP:372905365
513 513 a, g dbSNP:534162897
517 517 g, t dbSNP:751221886
534 534 c, t dbSNP:757047904
535 535 a, g dbSNP:780989395
539 539 c, t dbSNP:750357586
541 541 a, g dbSNP:756011172
560 560 c, t dbSNP:376906908
565 565 a, t dbSNP:61736938
569 569 a, g dbSNP:778977608
572 572 a, g dbSNP:748284821
580 580 -, c dbSNP:780393867
581 581 c, t dbSNP:772135792
582 582 c, t dbSNP:778011110
585 585 c, g dbSNP:747234343
591 591 g, t dbSNP:771222927
594 594 c, g dbSNP:144181653
596 596 c, t dbSNP:1042331
597 597 a, g dbSNP:770371240
604 604 c, t dbSNP:1042335
605 605 c, t dbSNP:772872005
608 608 c, t dbSNP:762588336
623 623 c, t dbSNP:370864722
627 627 a, c, t dbSNP:14362
632 632 c, t dbSNP:1071597
644 644 c, t dbSNP:41559424
645 645 a, g dbSNP:750173090
654 654 a, g dbSNP:755847836
658 658 c, t dbSNP:143091535
660 660 c, t dbSNP:148208390
663 663 a, c, t dbSNP:766140335
675 675 c, t dbSNP:142745911
676 676 a, c, g, t dbSNP:9276
686 686 a, c dbSNP:376840874
689 689 a, g dbSNP:757274982
691 691 c, t dbSNP:766141291
692 692 a, c, g dbSNP:137879953
694 694 a, g dbSNP:780522601
701 701 a, g dbSNP:749814887
703 703 a, g dbSNP:199834306
707 707 c, t dbSNP:769226188
708 708 a, g dbSNP:11551421
714 714 a, g dbSNP:747760493
727 727 a, g dbSNP:771451667
730 730 c, g dbSNP:772967195
733 733 -, t dbSNP:754165149
739 739 a, c, t dbSNP:3097675
740 740 a, c dbSNP:770745804
744 744 a, g dbSNP:776345909
755 755 a, g dbSNP:759486323
770 770 a, g dbSNP:150818884
771 771 c, t dbSNP:780867126
772 772 a, g dbSNP:745501672
778 778 c, t dbSNP:201552902
781 781 -, acaaggaa dbSNP:748621826
781 781 a, c dbSNP:769658433
783 783 -, c dbSNP:778150610
784 784 -, a dbSNP:67523850
786 786 -, g dbSNP:747365417
799 799 cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaa dbSNP:386699892
799 799 c, g dbSNP:1126719
805 805 c, t dbSNP:1126723
816 816 a, t dbSNP:1042448
827 827 aac, gaa dbSNP:386699893
827 827 a, g dbSNP:9277522
829 829 a, c dbSNP:9277523
832 832 c, g dbSNP:564159821
834 834 a, t dbSNP:532241225
847 847 cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaaga dbSNP:386699894
847 847 c, t dbSNP:1042467
848 848 a, g dbSNP:3749984
851 851 a, g dbSNP:559452923
852 852 a, g dbSNP:6760
855 855 c, t dbSNP:1042488
860 860 c, t dbSNP:1042497
874 874 c, t dbSNP:1042502
878 878 a, g dbSNP:1042507
884 884 a, c dbSNP:1042508
887 887 g, t dbSNP:1042511
888 888 a, t dbSNP:1042516
895 895 g, t dbSNP:34087328
907 907 c, g dbSNP:3749985
931 931 a, g dbSNP:1042544
937 937 c, t dbSNP:114068468
947 947 c, t dbSNP:759169647
956 956 g, t dbSNP:11551420
993 993 c, t dbSNP:1042644
1022 1022 a, g dbSNP:545910027
1024 1024 aag, gac dbSNP:386699895
1024 1024 a, g dbSNP:931
1026 1026 c, g dbSNP:928
1029 1029 c, t dbSNP:186748908
1033 1033 c, t dbSNP:1042634
1051 1051 c, t dbSNP:529885638
1053 1053 c, t dbSNP:935
1060 1060 a, g dbSNP:932

Target ORF information:

RefSeq Version XM_006725908
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu40287
Accession Version XM_006725998.2
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product HLA class II histocompatibility antigen, DP beta 1 chain isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167248.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578842075. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)376..657(+)
Misc Feature(2)391..555(+)
Misc Feature(3)430..648(+)
Misc Feature(4)454..552(+)
Position Chain Variation Link
19 19 -, cagtgagt dbSNP:199519145
42 42 c, t dbSNP:769224035
44 44 c, g dbSNP:774984431
50 50 a, g dbSNP:2567283
57 57 -, a dbSNP:764048597
75 75 c, g dbSNP:767021209
87 87 c, g dbSNP:750089900
114 114 -, gtg dbSNP:751536871
114 114 a, c dbSNP:41544522
114 114 a, c dbSNP:776253405
115 115 ctttt, gtgca, gtgta dbSNP:386699868
115 115 c, g dbSNP:1126504
116 116 c, t dbSNP:202176660
117 117 g, t dbSNP:1126506
118 118 c, g, t dbSNP:12722013
119 119 a, t dbSNP:1126509
121 121 c, t dbSNP:79389600
124 124 gg, tt dbSNP:386699869
124 124 g, t dbSNP:1126511
125 125 g, t dbSNP:1126513
126 126 a, g dbSNP:780390413
128 128 g, t dbSNP:41540313
133 133 c, g dbSNP:749490757
134 134 a, g dbSNP:755441461
141 141 c, t dbSNP:188627284
142 142 a, c, g dbSNP:41555313
150 150 c, t dbSNP:772565701
159 159 a, g dbSNP:772611590
168 168 a, g dbSNP:746588116
170 170 a, t dbSNP:770346059
171 171 a, g dbSNP:776310599
175 175 g, t dbSNP:41553416
176 176 a, g dbSNP:765041810
187 187 a, c, t dbSNP:41545716
188 188 c, g dbSNP:41561114
190 190 c, g dbSNP:12722018
192 192 a, g dbSNP:41555423
196 196 c, t dbSNP:9277348
197 197 a, t dbSNP:1042117
198 198 a, c, t dbSNP:41555415
200 200 c, t dbSNP:1042121
208 208 g, t dbSNP:77062860
213 213 c, g dbSNP:753055175
216 216 c, t dbSNP:758676800
220 220 g, t dbSNP:41552915
221 221 g, t dbSNP:778412325
222 222 a, g dbSNP:12722022
227 227 a, t dbSNP:145190720
233 233 a, c dbSNP:147611944
234 234 a, g, t dbSNP:553686794
237 237 a, g dbSNP:575237777
239 239 c, g, t dbSNP:200784721
241 241 c, g dbSNP:200055547
242 242 a, t dbSNP:200572113
251 251 g, t dbSNP:201374258
257 257 ag, ct dbSNP:386699870
257 257 a, c, t dbSNP:707958
258 258 c, g, t dbSNP:9277351
260 260 a, c dbSNP:1042131
261 261 a, c, g dbSNP:80330773
263 263 a, c dbSNP:766596554
263 263 a, t dbSNP:41545212
264 264 c, g dbSNP:1042133
265 265 c, t dbSNP:114493737
271 271 a, c dbSNP:41550319
272 272 a, c dbSNP:765613028
283 283 c, g dbSNP:41560812
286 286 a, c, t dbSNP:1042136
287 287 a, t dbSNP:41547212
289 289 c, t dbSNP:41547418
292 292 g, t dbSNP:41553216
293 293 -, aggaga dbSNP:757051224
293 293 -, gc dbSNP:780905041
294 294 -, c, gg dbSNP:750649897
295 295 c, g dbSNP:199865386
296 296 a, g dbSNP:201237929
298 298 -, aa, cg dbSNP:780236425
298 298 a, c, g, t dbSNP:1042140
299 299 a, g dbSNP:12722027
301 301 c, t dbSNP:41554314
303 303 g, t dbSNP:41560217
305 305 -, cg dbSNP:768901004
305 305 a, c dbSNP:539497216
306 306 -, g dbSNP:779542214
306 306 a, c dbSNP:769285895
307 307 g, t dbSNP:41546618
308 308 a, c, t dbSNP:748869910
309 309 g, t dbSNP:41556420
310 310 c, g dbSNP:761813230
311 311 c, t dbSNP:41551920
312 312 g, t dbSNP:377295463
315 315 -, acct dbSNP:772481600
315 315 c, t dbSNP:61759928
316 316 -, cctatt dbSNP:759170101
316 316 a, g dbSNP:577903981
317 317 -, ggatg dbSNP:769459532
317 317 -, gg dbSNP:773453957
318 318 -, cct dbSNP:774939603
318 318 a, c, g, t dbSNP:759757752
318 318 a, g dbSNP:41545021
319 319 atg, gta dbSNP:386699871
319 319 a, g dbSNP:1042151
320 320 c, t dbSNP:111596796
321 321 -, cctac dbSNP:763640068
321 321 a, g dbSNP:1042153
321 321 -, g dbSNP:762418075
322 322 c, t dbSNP:751808149
323 323 a, g dbSNP:757602402
336 336 c, g dbSNP:768075332
337 337 a, g dbSNP:750894680
340 340 c, t dbSNP:755668966
342 342 a, g dbSNP:779381535
343 343 a, g dbSNP:76968043
344 344 a, g, t dbSNP:1042169
346 346 -, a dbSNP:141530233
347 347 a, g dbSNP:9277354
347 347 a, g dbSNP:534577141
349 349 c, g dbSNP:9277355
349 349 c, g dbSNP:552975041
351 351 ca, g dbSNP:386699872
351 351 c, g dbSNP:1126532
352 352 -, a dbSNP:202162010
352 352 a, g dbSNP:9277356
357 357 c, g dbSNP:773324204
360 360 a, g dbSNP:41542615
361 361 c, g dbSNP:536113120
365 365 a, g dbSNP:41541915
366 366 c, t dbSNP:41563418
371 371 c, t dbSNP:761183155
380 380 a, g dbSNP:1126537
381 381 c, g dbSNP:754366191
387 387 c, t dbSNP:1126541
389 389 a, t dbSNP:764783267
399 399 c, t dbSNP:752423599
404 404 a, t dbSNP:758087295
407 407 a, g dbSNP:61736937
412 412 a, c, g, t dbSNP:1042187
423 423 a, c dbSNP:751346150
429 429 a, g dbSNP:757067798
437 437 a, g dbSNP:61736936
446 446 c, t dbSNP:562166558
447 447 a, g dbSNP:1042212
458 458 c, t dbSNP:778922500
461 461 a, g dbSNP:61736935
464 464 a, g dbSNP:140447065
474 474 c, t dbSNP:772223745
475 475 c, t dbSNP:773409536
476 476 a, g dbSNP:368841277
480 480 a, c, g dbSNP:61736934
489 489 c, t dbSNP:760040959
493 493 c, t dbSNP:764687991
496 496 g, t dbSNP:566678973
510 510 g, t dbSNP:372905365