Email to GenScript

HLA-DRB1 major histocompatibility complex, class II, DR beta 1 [Homo sapiens (human)]

Gene Symbol HLA-DRB1
Entrez Gene ID 3123
Full Name major histocompatibility complex, class II, DR beta 1
Synonyms DRB1, DRw10, HLA-DR1B, HLA-DRB, SS1
General protein information
Preferred Names
major histocompatibility complex, class II, DR beta 1
major histocompatibility complex, class II, DR beta 1
MHC class II antigen
lymphocyte antigen DRB1
MHC class II HLA-DRw10-beta
human leucocyte antigen DRB1
MHC class II HLA-DR beta 1 chain
MHC class II HLA-DR-beta cell surface glycoprotein
HLA class II histocompatibility antigen, DR-1 beta chain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogs DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: {Pemphigoid, susceptibility to} (2); {Sarcoidosis, susceptibility

The following HLA-DRB1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the HLA-DRB1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu27047 NM_002124 Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu29136 NM_001243965 Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu27047
Accession Version NM_002124.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 801bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu27047D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product major histocompatibility complex, class II, DR beta 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK291987.1 and BC033827.1. On or before Feb 15, 2014 this sequence version replaced gi:578841493, gi:578841740, gi:155030210. Summary: HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogs DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the DRB1*15:01:01:01 allele of the HLA-DRB1 gene, as represented in the assembled chromosome 6 in the primary assembly of the reference genome. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC033827.1, BC007920.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2147920, SAMEA2154405 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)47..49(+)
Misc Feature(2)182..466(+)
Misc Feature(3)221..442(+)
Misc Feature(4)467..775(+)
Misc Feature(5)470..751(+)
Misc Feature(6)485..649(+)
Misc Feature(7)548..646(+)
Misc Feature(8)776..838(+)
Exon (1)1..194
Gene Synonym:
Exon (2)195..464
Gene Synonym:
Exon (3)465..746
Gene Synonym:
Exon (4)747..857
Gene Synonym:
Exon (5)858..881
Gene Synonym:
Exon (6)882..1217
Gene Synonym:
Position Chain Variation Link
2 2 -, c dbSNP:201273461
3 3 c, t dbSNP:549230406
8 8 c, t dbSNP:17211105
25 25 -, a dbSNP:28383887
27 27 c, g dbSNP:560765312
28 28 -, g dbSNP:199616059
29 29 -, g dbSNP:769108864
29 29 g, t dbSNP:17211091
30 30 -, c dbSNP:34230188
30 30 c, g, t dbSNP:17211084
45 45 -, at, t dbSNP:778557046
46 46 g, t dbSNP:17204758
48 48 a, g dbSNP:759475268
50 50 a, g dbSNP:776292792
52 52 c, g dbSNP:770697955
54 54 c, t dbSNP:28366221
55 55 a, g, t dbSNP:28366220
56 56 a, c dbSNP:747708806
59 59 a, c, g dbSNP:769076405
61 61 -, a dbSNP:755006718
61 61 c, t dbSNP:749738288
62 62 a, c, g, t dbSNP:1059546
63 63 c, t dbSNP:781437070
64 64 c, t dbSNP:561980359
65 65 c, g dbSNP:17204744
66 66 g, t dbSNP:764164775
68 68 a, g dbSNP:17204737
69 69 c, g, t dbSNP:766218985
70 70 a, c dbSNP:760558042
71 71 a, c dbSNP:17211078
76 76 a, t dbSNP:767298735
78 78 c, t dbSNP:17211071
80 80 g, t dbSNP:138717279
82 82 c, g dbSNP:768155953
83 83 a, c dbSNP:540570475
84 84 c, t dbSNP:776134575
85 85 c, g dbSNP:1059547
87 87 g, t dbSNP:746283636
88 88 -, ctcc dbSNP:779584698
88 88 -, ct dbSNP:753684527
90 90 -, cc dbSNP:749893822
91 91 -, tt dbSNP:755644163
104 104 c, t dbSNP:201125976
108 108 a, g dbSNP:707953
110 110 c, t dbSNP:17879020
111 111 c, t dbSNP:201726340
112 112 a, c dbSNP:374594903
117 117 a, g dbSNP:111934004
118 118 a, g dbSNP:766387784
120 120 a, g dbSNP:756065229
121 121 c, t dbSNP:750272842
125 125 a, t dbSNP:199514452
126 126 a, g dbSNP:761573085
127 127 c, t dbSNP:34396110
128 128 a, t dbSNP:201540428
129 129 c, t dbSNP:762568730
131 131 a, g dbSNP:9270303
134 134 a, g, t dbSNP:17878475
135 135 c, g, t dbSNP:9270302
136 136 a, g, t dbSNP:9270301
137 137 c, t dbSNP:150644773
140 140 a, g dbSNP:758526015
149 149 c, t dbSNP:34187469
153 153 c, t dbSNP:35053532
156 156 g, t dbSNP:534556045
159 159 a, t dbSNP:750329958
161 161 -, tggtgctga dbSNP:767161055
165 165 c, t dbSNP:187619904
168 168 c, g, t dbSNP:148093782
172 172 a, g dbSNP:763861040
174 174 c, t dbSNP:762465894
178 178 c, g dbSNP:201614260
179 179 a, g, t dbSNP:9270299
180 180 a, c dbSNP:777186597
182 182 c, g dbSNP:771393800
183 183 g, t dbSNP:761074986
184 184 g, t dbSNP:773398506
185 185 a, c, g dbSNP:372634318
186 186 a, g dbSNP:201700261
187 187 c, t dbSNP:779064494
188 188 a, c, t dbSNP:749376442
189 189 a, c dbSNP:781319760
190 190 a, c, t dbSNP:751394570
191 191 a, c, g, t dbSNP:9256943
192 192 a, g, t dbSNP:17879746
194 194 a, c, g, t dbSNP:761045049
195 195 a, c, t dbSNP:745460990
197 197 c, g dbSNP:41308497
203 203 -, c dbSNP:767010367
203 203 c, t dbSNP:9269960
203 203 c, t dbSNP:534059203
204 204 -, cga dbSNP:761252314
205 205 -, g dbSNP:773489989
206 206 -, tg dbSNP:772011591
206 206 a, c, g, t dbSNP:9269959
207 207 -, ggc dbSNP:774455138
207 207 -, a dbSNP:762139928
207 207 a, g dbSNP:9269958
209 209 -, c dbSNP:768883657
209 209 c, g, t dbSNP:9269957
210 210 a, t dbSNP:17882663
211 211 -, ta dbSNP:749085224
211 211 c, g dbSNP:9269956
212 212 -, cctaaga dbSNP:766848979
212 212 -, cctaa dbSNP:756741350
212 212 a, c, g, t dbSNP:9269955
213 213 -, ctaag dbSNP:754316114
213 213 a, c, g, t dbSNP:17878703
214 214 -, tgg dbSNP:745775563
215 215 -, aagagg dbSNP:774423362
215 215 -, gg dbSNP:780805378
215 215 a, t dbSNP:766505678
216 216 -, acat dbSNP:746487937
216 216 a, c, g, t dbSNP:1136756
217 217 -, c, tat dbSNP:758070868
217 217 a, g dbSNP:17887028
218 218 a, c, g, t dbSNP:1136758
219 219 -, ggg dbSNP:745615811
219 219 a, c, g, t dbSNP:1136759
220 220 -, ggag dbSNP:770838956
220 220 g, t dbSNP:9269951
221 221 a, g dbSNP:17882014
222 222 -, agtataa dbSNP:776465322
223 223 a, g dbSNP:17885011
227 227 c, t dbSNP:17879702
229 229 a, t dbSNP:17879981
230 230 a, t dbSNP:776415590
233 233 c, t dbSNP:114435757
235 235 c, t dbSNP:45600431
238 238 c, t dbSNP:1136763
239 239 c, g dbSNP:61759931
240 240 c, g dbSNP:17879469
242 242 a, t dbSNP:61759932
243 243 a, c dbSNP:61759933
244 244 c, g dbSNP:17881146
246 246 -, agcggg dbSNP:746519337
248 248 a, c, g dbSNP:74812266
249 249 c, g dbSNP:17882378
250 250 a, g dbSNP:191828595
251 251 -, gtgcgg dbSNP:201929829
253 253 g, t dbSNP:772708247
254 254 c, t dbSNP:188617679
255 255 a, g, t dbSNP:17885382
256 256 g, t dbSNP:74481206
257 257 a, t dbSNP:201128876
258 258 a, t dbSNP:1059569
258 258 a, t dbSNP:16822516
259 259 a, c, g, t dbSNP:1059572
261 261 a, c, g, t dbSNP:17878671
263 263 a, c, g, t dbSNP:17878947
264 264 a, g, t dbSNP:200532329
265 265 a, c, g dbSNP:1059575
266 266 a, g dbSNP:771765212
267 267 -, gatact dbSNP:780612309
267 267 g, t dbSNP:747606824
268 268 a, t dbSNP:17878437
269 269 c, g, t dbSNP:11554462
270 270 a, g, t dbSNP:3175105
271 271 c, t dbSNP:17884729
272 272 a, g, t dbSNP:17882300
275 275 c, g, t dbSNP:1064664
276 276 a, g dbSNP:751566442
278 278 a, c, g dbSNP:17879995
280 280 a, c, t dbSNP:17879242
282 282 a, g dbSNP:17879476
283 283 a, g dbSNP:17882603
285 285 a, g dbSNP:55655909
286 286 a, g dbSNP:17885071
287 287 g, t dbSNP:773064485
289 289 a, g dbSNP:17882641
290 290 a, c, g, t dbSNP:16822820
291 291 a, c, t dbSNP:707957
291 291 a, c, t dbSNP:17883134
292 292 c, t dbSNP:72558164
293 293 a, c, g, t dbSNP:17878614
293 293 -, g dbSNP:200676666
294 294 c, t dbSNP:17878951
295 295 a, g, t dbSNP:747140232
296 296 c, g, t dbSNP:754953589
297 297 a, g dbSNP:17886928
298 298 c, g dbSNP:17885772
300 300 a, g, t dbSNP:17882455
302 302 a, g dbSNP:56158521
307 307 c, t dbSNP:183889763
308 308 g, t dbSNP:767221650
310 310 c, t dbSNP:75044270
311 311 a, c, g dbSNP:150747106
313 313 a, c, g dbSNP:72558165
314 314 a, c, g dbSNP:17885437
316 316 a, g dbSNP:776046212
319 319 c, g dbSNP:17882006
320 320 c, t dbSNP:29029548
321 321 a, t dbSNP:17884945
322 322 c, t dbSNP:17879688
323 323 a, c, t dbSNP:17879937
324 324 a, g, t dbSNP:17886436
325 325 a, g dbSNP:55917654
327 327 a, c, t dbSNP:17879432
328 328 a, g dbSNP:35499948
329 329 g, t dbSNP:17885257
330 330 c, t dbSNP:17885908
331 331 a, g dbSNP:778040505
333 333 c, g, t dbSNP:1059582
334 334 a, g, t dbSNP:17880973
335 335 a, c, g, t dbSNP:17883065
336 336 a, t dbSNP:780784592
338 338 a, c, g dbSNP:72558166
340 340 a, g dbSNP:17878622
344 344 c, t dbSNP:17878902
345 345 g, t dbSNP:41308498
347 347 c, g dbSNP:17887012
348 348 c, t dbSNP:201749971
349 349 c, t dbSNP:72558167
350 350 a, g dbSNP:17880292
351 351 a, c, g, t dbSNP:17885129
352 352 -, cgc dbSNP:750756276
352 352 c, g, t dbSNP:17853228
352 352 c, t dbSNP:2308802
353 353 a, c, g dbSNP:1059583
354 354 -, ct dbSNP:767913528
354 354 a, c, g, t dbSNP:1059584
355 355 c, g, t dbSNP:3167799
355 355 c, g, t dbSNP:17853229
356 356 -, cgg dbSNP:757724655
356 356 c, g dbSNP:17879954
357 357 a, g dbSNP:17879230
358 358 -, gac dbSNP:751646781
358 358 a, c, g dbSNP:17886514
359 359 a, c, t dbSNP:17882583
360 360 a, c dbSNP:1059586
361 361 a, c dbSNP:769883645
367 367 c, t dbSNP:201721658
369 369 a, g dbSNP:41508449
370 370 c, t dbSNP:745750329
372 372 a, g dbSNP:17882098
373 373 -, g dbSNP:17885020
374 374 -, a dbSNP:17878577
375 375 -, a dbSNP:397844204
375 375 a, g dbSNP:781165610
377 377 a, g dbSNP:17878874
378 378 a, g dbSNP:757039955
380 380 a, c, t dbSNP:17886918
382 382 a, c dbSNP:757984583
383 383 c, g, t dbSNP:17881176
384 384 g, t dbSNP:41308499
385 385 c, g dbSNP:764682247
387 387 -, a dbSNP:764153503
387 387 a, c, g dbSNP:17882450
388 388 a, g dbSNP:17885388
389 389 -, caggc dbSNP:781606444
389 389 -, gg dbSNP:776433632
389 389 a, c, g dbSNP:17881965
390 390 -, ca dbSNP:770836206
390 390 -, a dbSNP:746964425
390 390 a, g dbSNP:17884070
391 391 c, g dbSNP:17879599
392 392 a, c, g, t dbSNP:1064592
392 392 a, g dbSNP:568948309
393 393 -, aa, ag dbSNP:746231220
393 393 a, c, g, t dbSNP:9269942
393 393 -, c dbSNP:778735727
394 394 -, a, ag, gg dbSNP:778205073
394 394 a, g dbSNP:17880366
395 395 -, cg dbSNP:9281873
395 395 a, c, g, t dbSNP:17885222
395 395 -, c dbSNP:758506454
396 396 -, tg dbSNP:752707222
396 396 a, c, g, t dbSNP:17885869
397 397 -, gg dbSNP:67187877
397 397 c, g, t dbSNP:17884749
398 398 -, g dbSNP:370743542
398 398 g, t dbSNP:17883297
399 399 -, cc dbSNP:753645589
399 399 c, g dbSNP:17878857
399 399 c, t dbSNP:777553115
400 400 a, c, g, t dbSNP:3208330
401 401 -, t dbSNP:766169385
401 401 a, c, g dbSNP:16822805
402 402 -, a, aa, ca dbSNP:772090580
402 402 a, c, g, t dbSNP:17886882
402 402 -, c dbSNP:67476479
403 403 a, c, g dbSNP:17880261
405 405 c, t dbSNP:753377038
406 406 a, c, g dbSNP:756577940
407 407 a, g, t dbSNP:61759934
408 408 a, c dbSNP:767943289
409 409 a, c, g dbSNP:774753056
410 410 a, g, t dbSNP:17885079
411 411 a, c dbSNP:9269941
412 412 a, c, t dbSNP:16822512
413 413 c, g, t dbSNP:17884043
414 414 a, t dbSNP:17879620
415 415 a, c, g, t dbSNP:11554463
416 416 g, t dbSNP:748753529
417 417 g, t dbSNP:779577456
418 418 a, c dbSNP:756601075
421 421 a, t dbSNP:750986830
422 422 a, c, t dbSNP:29029549
424 424 c, t dbSNP:780337501
429 429 a, t dbSNP:751957355
430 430 c, t dbSNP:45542832
431 431 a, c, g dbSNP:17879213
432 432 g, t dbSNP:763165642
433 433 a, g dbSNP:17885752
435 435 c, t dbSNP:17424145
437 437 a, g dbSNP:61759935
438 438 a, g, t dbSNP:17885482
439 439 g, t dbSNP:17882028
444 444 a, g dbSNP:771986476
445 445 a, c, t dbSNP:17883271
451 451 a, g dbSNP:1136782
454 454 c, g dbSNP:45594032
456 456 a, g dbSNP:748921985
457 457 a, g dbSNP:779549521
458 458 a, c dbSNP:17879125
460 460 a, g dbSNP:17878311
464 464 a, g dbSNP:17885959
465 465 c, t dbSNP:754898862
466 466 a, c, t dbSNP:140866337
467 467 a, c, g, t dbSNP:17882084
468 468 a, t dbSNP:756774358
469 469 a, g, t dbSNP:1071752
469 469 a, t dbSNP:4999095
471 471 c, g, t dbSNP:79706935
472 472 c, g, t dbSNP:62799161
473 473 a, c, g dbSNP:759910238
473 473 a, c, g, t dbSNP:17405219
475 475 a, c, g, t dbSNP:17424180
476 476 a, g dbSNP:771131230
477 477 c, g, t dbSNP:80190494
478 478 a, c, g, t dbSNP:74944677
479 479 a, c, g dbSNP:1136791
480 480 a, g dbSNP:76895951
481 481 a, g dbSNP:62889561
482 482 c, g dbSNP:773389640
484 484 a, g, t dbSNP:2308759
488 488 c, t dbSNP:148699775
491 491 g, t dbSNP:2308760
492 492 -, a dbSNP:35616319
492 492 c, t dbSNP:201929247
493 493 a, c dbSNP:2308761
495 495 -, a dbSNP:200088269
496 496 a, g dbSNP:200078051
497 497 a, g, t dbSNP:17433947
497 497 a, g, t dbSNP:751064148
498 498 a, c dbSNP:200516145
499 499 a, c, g, t dbSNP:17401330
500 500 -, c dbSNP:753045406
505 505 c, t dbSNP:1064596
510 510 -, a dbSNP:756424707
515 515 c, t dbSNP:751099504
517 517 a, c, g, t dbSNP:77689370
518 518 -, aac dbSNP:746056914
519 519 a, g dbSNP:753240578
521 521 c, t dbSNP:41557115
523 523 c, g dbSNP:765766762
523 523 c, g, t dbSNP:1059615
527 527 c, g dbSNP:759833767
529 529 c, g dbSNP:17885192
532 532 c, t dbSNP:707941
532 532 c, t dbSNP:2308764
540 540 a, g dbSNP:1059351
540 540 a, g dbSNP:74626234
542 542 c, g dbSNP:760934639
546 546 a, c, g, t dbSNP:2308765
547 547 c, t dbSNP:773547095
549 549 a, g dbSNP:112796209
551 551 c, t dbSNP:748235111
555 555 c, g dbSNP:16822698
555 555 c, g dbSNP:775624700
560 560 a, g dbSNP:202047044
568 568 c, t dbSNP:745655219
579 579 a, g, t dbSNP:707954
580 580 a, g dbSNP:746709087
583 583 c, t dbSNP:2308767
583 583 c, t dbSNP:35363435
584 584 a, g dbSNP:757966595
586 586 c, g dbSNP:752147302
592 592 a, t dbSNP:779295390
599 599 a, g dbSNP:78916069
599 599 a, g dbSNP:755474816
600 600 c, g dbSNP:754180747
604 604 -, gat dbSNP:199824918
605 605 a, g dbSNP:701829
607 607 g, t dbSNP:63548860
611 611 a, g dbSNP:2308769
613 613 c, t dbSNP:761090565
615 615 a, c dbSNP:750742941
616 616 a, g dbSNP:78767604
622 622 a, g dbSNP:2308770
628 628 c, g, t dbSNP:77637983
630 630 a, g dbSNP:572938448
634 634 c, g dbSNP:2308771
637 637 c, t dbSNP:74867190
638 638 g, t dbSNP:759467362
643 643 c, t dbSNP:62930562
650 650 a, c dbSNP:770748207
652 652 a, c dbSNP:113663708
656 656 a, g dbSNP:112116022
664 664 a, g dbSNP:16822692
664 664 a, g dbSNP:79182498
669 669 c, t dbSNP:747689830
670 670 a, t dbSNP:778441312
677 677 -, a dbSNP:375154056
677 677 -, a dbSNP:781180880
677 677 c, t dbSNP:754428084
678 678 a, g dbSNP:3205588
679 679 a, c, g, t dbSNP:701831
681 681 a, g dbSNP:35300013
681 681 -, g dbSNP:757139064
684 684 a, c, g dbSNP:2308775
684 684 c, g dbSNP:762086217
685 685 a, t dbSNP:751612214
687 687 -, aggtttacacctgccaagtg dbSNP:140357311
688 688 a, c, g dbSNP:16822972
689 689 g, t dbSNP:776695055
694 694 a, c, g, t dbSNP:2308777
697 697 c, t dbSNP:17405325
700 700 c, t dbSNP:34938122
703 703 a, g dbSNP:771739125
704 704 c, g dbSNP:36044702
712 712 c, t dbSNP:34295373
712 712 c, t dbSNP:550518162
717 717 a, g dbSNP:768278955
718 718 c, t dbSNP:199704140
719 719 a, c, g dbSNP:111739605
719 719 a, c, g dbSNP:756622211
721 721 a, g dbSNP:1059705
722 722 a, t dbSNP:781648698
723 723 c, t dbSNP:200809587
724 724 a, c, g, t dbSNP:28732329
724 724 a, g dbSNP:2308818
725 725 c, g dbSNP:33926824
728 728 c, g dbSNP:1136846
728 728 c, g dbSNP:764214319
729 729 c, t dbSNP:17885501
729 729 c, t dbSNP:758561149
730 730 a, g dbSNP:1071837
734 734 -, tg dbSNP:35837054
735 735 c, t dbSNP:752658977
736 736 a, g dbSNP:17878677
736 736 a, g dbSNP:111403823
740 740 c, g dbSNP:33936261
747 747 a, g dbSNP:758322418
748 748 a, t dbSNP:1136881
751 751 a, t dbSNP:764982121
752 752 c, t dbSNP:34624872
753 753 a, g dbSNP:17856290
757 757 c, t dbSNP:765850840
762 762 c, t dbSNP:760231231
763 763 c, t dbSNP:773654170
764 764 g, t dbSNP:768010958
765 765 a, c dbSNP:377738927
768 768 a, g dbSNP:374360042
770 770 a, g dbSNP:768891284
775 775 a, g dbSNP:549532696
777 777 c, t dbSNP:775749976
788 788 a, g dbSNP:769831677
790 790 a, c, t dbSNP:368802150
791 791 a, g dbSNP:531360990
794 794 a, g, t dbSNP:778903456
799 799 c, t dbSNP:113175445
800 800 a, g dbSNP:201698383
805 805 c, g, t dbSNP:567255279
808 808 c, t dbSNP:755592812
812 812 c, t dbSNP:549336174
816 816 c, t dbSNP:527579312
819 819 c, t dbSNP:762260834
823 823 -, at dbSNP:762166606
824 824 a, g dbSNP:3830125
825 825 -, cc dbSNP:774519641
826 826 a, c, g, t dbSNP:3830126
828 828 a, g dbSNP:769996810
830 830 c, t dbSNP:1059362
830 830 c, t dbSNP:574897295
832 832 a, g dbSNP:1059808
835 835 c, t dbSNP:201168487
836 836 a, c dbSNP:199873800
840 840 a, g dbSNP:748138944
844 844 c, t dbSNP:778993299
846 846 a, g dbSNP:71547382
854 854 a, c, g dbSNP:779578123
871 871 c, t dbSNP:35067512
871 871 c, t dbSNP:541637298
873 873 a, c dbSNP:17887154
873 873 a, c dbSNP:574793750
874 874 a, g dbSNP:192487435
878 878 a, g dbSNP:572671781
879 879 c, g dbSNP:9269744
879 879 c, g dbSNP:765247121
884 884 c, t dbSNP:35445101
887 887 c, t dbSNP:34475960
897 897 a, c, g dbSNP:9269693
900 900 a, c dbSNP:34955866
907 907 -, cc dbSNP:771348340
908 908 a, c dbSNP:201099263
908 908 -, c dbSNP:68069105
910 910 -, ca dbSNP:760049502
910 910 -, c dbSNP:777675672
911 911 -, a dbSNP:771788701
911 911 a, g dbSNP:763867874
914 914 c, t dbSNP:1059920
917 917 a, g, t dbSNP:1064691
920 920 a, g dbSNP:202053852
921 921 a, g dbSNP:201375698
924 924 c, g, t dbSNP:1064692
925 925 -, c dbSNP:747939071
925 925 c, t dbSNP:1064694
927 927 a, t dbSNP:200538592
930 930 g, t dbSNP:1064695
931 931 c, t dbSNP:36217728
935 935 a, g dbSNP:1064697
936 936 a, g, t dbSNP:749335421
938 938 a, t dbSNP:780993144
939 939 c, g, t dbSNP:200849525
940 940 g, t dbSNP:777757658
942 942 a, c dbSNP:146292738
943 943 a, g dbSNP:752464470
944 944 a, g, t dbSNP:35324556
945 945 a, g dbSNP:36217730
946 946 a, t dbSNP:766819429
948 948 g, t dbSNP:761293855
952 952 a, c, t dbSNP:35236441
953 953 a, g dbSNP:35521457
954 954 c, t dbSNP:774571917
956 956 a, t dbSNP:768859416
957 957 -, t dbSNP:764735614
957 957 c, t dbSNP:1064699
958 958 c, g, t dbSNP:12363
959 959 -, ctcc dbSNP:368419083
960 960 -, tg dbSNP:754848562
960 960 a, c, t dbSNP:3180268
961 961 a, c, g, t dbSNP:3180799
962 962 -, cttg dbSNP:755803542
963 963 -, cc dbSNP:753402410
963 963 c, t dbSNP:9269688
964 964 -, t dbSNP:71864678
966 966 a, g dbSNP:754612942
967 967 a, c, t dbSNP:779655749
968 968 a, c, t dbSNP:1064701
969 969 a, c, g dbSNP:1141869
971 971 c, t dbSNP:3200898
972 972 a, c, t dbSNP:763280715
973 973 c, t dbSNP:775540137
974 974 a, t dbSNP:769982464
975 975 a, c dbSNP:759675096
976 976 a, t dbSNP:773293837
977 977 a, t dbSNP:772066074
978 978 c, g dbSNP:747981161
980 980 a, g dbSNP:182030800
981 981 c, t dbSNP:116358897
982 982 a, g dbSNP:1060081
984 984 c, g dbSNP:779563658
988 988 a, g dbSNP:755638414
989 989 a, g, t dbSNP:34844328
990 990 c, g dbSNP:36084494
991 991 c, t dbSNP:751986414
995 995 c, g dbSNP:34007709
998 998 a, c, t dbSNP:34022924
1002 1002 c, t dbSNP:113734598
1003 1003 c, t dbSNP:753021267
1004 1004 a, t dbSNP:35463048
1005 1005 a, g dbSNP:1060129
1010 1010 c, t dbSNP:34009233
1016 1016 a, g dbSNP:759691504
1020 1020 a, g, t dbSNP:1064707
1023 1023 -, gc dbSNP:34160410
1024 1024 -, ct dbSNP:35165835
1024 1024 a, g, t dbSNP:3200044
1026 1026 -, ct dbSNP:148582499
1036 1036 a, g dbSNP:112871130
1036 1036 c, t dbSNP:3179306
1037 1037 c, t dbSNP:142078339
1052 1052 g, t dbSNP:1732
1056 1056 c, t dbSNP:35716402
1059 1059 c, t dbSNP:1060176
1060 1060 c, t dbSNP:113804375
1061 1061 a, c dbSNP:775216421
1062 1062 c, g dbSNP:35000099
1064 1064 a, g dbSNP:3200047
1065 1065 c, t dbSNP:1064709
1066 1066 a, c, t dbSNP:1064710
1067 1067 c, t dbSNP:3208409
1070 1070 a, g dbSNP:747615942
1071 1071 a, g dbSNP:778127920
1075 1075 g, t dbSNP:758801058
1078 1078 -, cc dbSNP:35306263
1079 1079 c, t dbSNP:1060185
1081 1081 -, a, ca dbSNP:9281863
1081 1081 a, c dbSNP:35195677
1082 1082 -, cac dbSNP:763256972
1082 1082 c, t dbSNP:755300637
1083 1083 -, ca dbSNP:113493811
1083 1083 a, g dbSNP:754083017
1086 1086 a, t dbSNP:1060190
1089 1089 a, g dbSNP:1730
1090 1090 a, g dbSNP:1064712
1093 1093 a, g, t dbSNP:34981130
1097 1097 c, t dbSNP:1064713
1098 1098 a, c, g dbSNP:3201069
1107 1107 -, c dbSNP:34205910
1108 1108 -, c dbSNP:199703384
1109 1109 a, c dbSNP:80136018
1111 1111 c, g dbSNP:34542752
1121 1121 c, t dbSNP:35263976
1128 1128 a, g dbSNP:3201080
1132 1132 a, g dbSNP:118126743
1134 1134 a, c, t dbSNP:1729
1135 1135 c, g dbSNP:34215479
1136 1136 c, t dbSNP:34900518
1137 1137 a, c, g, t dbSNP:1064715
1139 1139 a, c dbSNP:34923246
1140 1140 c, t dbSNP:35418460
1141 1141 g, t dbSNP:6920823
1144 1144 a, c dbSNP:185448040
1147 1147 -, ccgtgcat dbSNP:200428856
1148 1148 c, t dbSNP:1064717
1149 1149 a, g dbSNP:3205684
1160 1160 c, t dbSNP:1060270
1163 1163 a, c dbSNP:35513414
1164 1164 c, t dbSNP:35413567
1165 1165 c, g dbSNP:36042073
1170 1170 a, g dbSNP:35705303
1171 1171 cc, tg dbSNP:71535483
1171 1171 c, t dbSNP:1141883
1172 1172 -, cc dbSNP:369671770
1172 1172 c, g dbSNP:3208365
1173 1173 a, c dbSNP:34266013
1184 1184 a, g dbSNP:35297326
1204 1204 a, c dbSNP:114103896
1206 1206 c, g dbSNP:34839759

Target ORF information:

RefSeq Version NM_002124
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu29136
Accession Version NM_001243965.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 801bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu29136D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product major histocompatibility complex, class II, DR beta 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB246210.1, X00699.1 and BM671866.1. This sequence is a reference standard in the RefSeqGene project. On Jul 26, 2012 this sequence version replaced gi:397138357. Summary: HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogs DRB3, DRB4 and DRB5. DRB1 is present in all individuals. Allelic variants of DRB1 are linked with either none or one of the genes DRB3, DRB4 and DRB5. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) represents the DRB1*03:01:01:01 allele of the HLA-DRB1 gene, as represented in the alternate locus group ALT_REF_LOCI_2 of the reference genome. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK291987.1, AK293020.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2147920, SAMEA2154405 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)47..49(+)
Misc Feature(2)182..463(+)
Misc Feature(3)218..442(+)
Misc Feature(4)464..745(+)
Misc Feature(5)470..751(+)
Misc Feature(6)746..775(+)
Misc Feature(7)776..844(+)
Exon (1)1..194
Gene Synonym:
Exon (2)195..464
Gene Synonym:
Exon (3)465..746
Gene Synonym:
Exon (4)747..857
Gene Synonym:
Exon (5)858..881
Gene Synonym:
Exon (6)882..1218
Gene Synonym:
Position Chain Variation Link
2 2 -, c dbSNP:201273461
3 3 c, t dbSNP:549230406
8 8 c, t dbSNP:17211105
25 25 -, a dbSNP:28383887
27 27 c, g dbSNP:560765312
28 28 -, g dbSNP:199616059
29 29 -, g dbSNP:769108864
29 29 g, t dbSNP:17211091
30 30 -, c dbSNP:34230188
30 30 c, g, t dbSNP:17211084
45 45 -, at, t dbSNP:778557046
46 46 g, t dbSNP:17204758
48 48 a, g dbSNP:759475268
50 50 a, g dbSNP:776292792
52 52 c, g dbSNP:770697955
54 54 c, t dbSNP:28366221
55 55 a, g, t dbSNP:28366220
56 56 a, c dbSNP:747708806
59 59 a, c, g dbSNP:769076405
61 61 -, a dbSNP:755006718
61 61 c, t dbSNP:749738288
62 62 a, c, g, t dbSNP:1059546
63 63 c, t dbSNP:781437070
64 64 c, t dbSNP:561980359
65 65 c, g dbSNP:17204744
66 66 g, t dbSNP:764164775
68 68 a, g dbSNP:17204737
69 69 c, g, t dbSNP:766218985
70 70 a, c dbSNP:760558042
71 71 a, c dbSNP:17211078
76 76 a, t dbSNP:767298735
78 78 c, t dbSNP:17211071
80 80 g, t dbSNP:138717279
82 82 c, g dbSNP:768155953
83 83 a, c dbSNP:540570475
84 84 c, t dbSNP:776134575
85 85 c, g dbSNP:1059547
87 87 g, t dbSNP:746283636
88 88 -, ctcc dbSNP:779584698
88 88 -, ct dbSNP:753684527
90 90 -, cc dbSNP:749893822
91 91 -, tt dbSNP:755644163
104 104 c, t dbSNP:201125976
108 108 a, g dbSNP:707953
110 110 c, t dbSNP:17879020
111 111 c, t dbSNP:201726340
112 112 a, c dbSNP:374594903
117 117 a, g dbSNP:111934004
118 118 a, g dbSNP:766387784
120 120 a, g dbSNP:756065229
121 121 c, t dbSNP:750272842
125 125 a, t dbSNP:199514452
126 126 a, g dbSNP:761573085
127 127 c, t dbSNP:34396110
128 128 a, t dbSNP:201540428
129 129 c, t dbSNP:762568730
131 131 a, g dbSNP:9270303
134 134 a, g, t dbSNP:17878475
135 135 c, g, t dbSNP:9270302
136 136 a, g, t dbSNP:9270301
137 137 c, t dbSNP:150644773
140 140 a, g dbSNP:758526015
149 149 c, t dbSNP:34187469
153 153 c, t dbSNP:35053532
156 156 g, t dbSNP:534556045
159 159 a, t dbSNP:750329958
161 161 -, tggtgctga dbSNP:767161055
165 165 c, t dbSNP:187619904
168 168 c, g, t dbSNP:148093782
172 172 a, g dbSNP:763861040
174 174 c, t dbSNP:762465894
178 178 c, g dbSNP:201614260
179 179 a, g, t dbSNP:9270299
180 180 a, c dbSNP:777186597
182 182 c, g dbSNP:771393800
183 183 g, t dbSNP:761074986
184 184 g, t dbSNP:773398506
185 185 a, c, g dbSNP:372634318
186 186 a, g dbSNP:201700261
187 187 c, t dbSNP:779064494
188 188 a, c, t dbSNP:749376442
189 189 a, c dbSNP:781319760
190 190 a, c, t dbSNP:751394570
191 191 a, c, g, t dbSNP:9256943
192 192 a, g, t dbSNP:17879746
194 194 a, c, g, t dbSNP:761045049
195 195 a, c, t dbSNP:745460990
197 197 c, g dbSNP:41308497
203 203 -, c dbSNP:767010367
203 203 c, t dbSNP:9269960
203 203 c, t dbSNP:534059203
204 204 -, cga dbSNP:761252314
205 205 -, g dbSNP:773489989
206 206 -, tg dbSNP:772011591
206 206 a, c, g, t dbSNP:9269959
207 207 -, ggc dbSNP:774455138
207 207 -, a dbSNP:762139928
207 207 a, g dbSNP:9269958
209 209 -, c dbSNP:768883657
209 209 c, g, t dbSNP:9269957
210 210 a, t dbSNP:17882663
211 211 -, ta dbSNP:749085224
211 211 c, g dbSNP:9269956
212 212 -, cctaaga dbSNP:766848979
212 212 -, cctaa dbSNP:756741350
212 212 a, c, g, t dbSNP:9269955
213 213 -, ctaag dbSNP:754316114
213 213 a, c, g, t dbSNP:17878703
214 214 -, tgg dbSNP:745775563
215 215 -, aagagg dbSNP:774423362
215 215 -, gg dbSNP:780805378
215 215 a, t dbSNP:766505678
216 216 -, acat dbSNP:746487937
216 216 a, c, g, t dbSNP:1136756
217 217 -, c, tat dbSNP:758070868
217 217 a, g dbSNP:17887028
218 218 a, c, g, t dbSNP:1136758
219 219 -, ggg dbSNP:745615811
219 219 a, c, g, t dbSNP:1136759
220 220 -, ggag dbSNP:770838956
220 220 g, t dbSNP:9269951
221 221 a, g dbSNP:17882014
222 222 -, agtataa dbSNP:776465322
223 223 a, g dbSNP:17885011
227 227 c, t dbSNP:17879702
229 229 a, t dbSNP:17879981
230 230 a, t dbSNP:776415590
233 233 c, t dbSNP:114435757
235 235 c, t dbSNP:45600431
238 238 c, t dbSNP:1136763
239 239 c, g dbSNP:61759931
240 240 c, g dbSNP:17879469
242 242 a, t dbSNP:61759932
243 243 a, c dbSNP:61759933
244 244 c, g dbSNP:17881146
246 246 -, agcggg dbSNP:746519337
248 248 a, c, g dbSNP:74812266
249 249 c, g dbSNP:17882378
250 250 a, g dbSNP:191828595
251 251 -, gtgcgg dbSNP:201929829
253 253 g, t dbSNP:772708247
254 254 c, t dbSNP:188617679
255 255 a, g, t dbSNP:17885382
256 256 g, t dbSNP:74481206
257 257 a, t dbSNP:201128876
258 258 a, t dbSNP:1059569
258 258 a, t dbSNP:16822516
259 259 a, c, g, t dbSNP:1059572
261 261 a, c, g, t dbSNP:17878671
263 263 a, c, g, t dbSNP:17878947
264 264 a, g, t dbSNP:200532329
265 265 a, c, g dbSNP:1059575
266 266 a, g dbSNP:771765212
267 267 -, gatact dbSNP:780612309
267 267 g, t dbSNP:747606824
268 268 a, t dbSNP:17878437
269 269 c, g, t dbSNP:11554462
270 270 a, g, t dbSNP:3175105
271 271 c, t dbSNP:17884729
272 272 a, g, t dbSNP:17882300
275 275 c, g, t dbSNP:1064664
276 276 a, g dbSNP:751566442
278 278 a, c, g dbSNP:17879995
280 280 a, c, t dbSNP:17879242
282 282 a, g dbSNP:17879476
283 283 a, g dbSNP:17882603
285 285 a, g dbSNP:55655909
286 286 a, g dbSNP:17885071
287 287 g, t dbSNP:773064485
289 289 a, g dbSNP:17882641
290 290 a, c, g, t dbSNP:16822820
291 291 a, c, t dbSNP:707957
291 291 a, c, t dbSNP:17883134
292 292 c, t dbSNP:72558164
293 293 a, c, g, t dbSNP:17878614
293 293 -, g dbSNP:200676666
294 294 c, t dbSNP:17878951
295 295 a, g, t dbSNP:747140232
296 296 c, g, t dbSNP:754953589
297 297 a, g dbSNP:17886928
298 298 c, g dbSNP:17885772
300 300 a, g, t dbSNP:17882455
302 302 a, g dbSNP:56158521
307 307 c, t dbSNP:183889763
308 308 g, t dbSNP:767221650
310 310 c, t dbSNP:75044270
311 311 a, c, g dbSNP:150747106
313 313 a, c, g dbSNP:72558165
314 314 a, c, g dbSNP:17885437
316 316 a, g dbSNP:776046212
319 319 c, g dbSNP:17882006
320 320 c, t dbSNP:29029548
321 321 a, t dbSNP:17884945
322 322 c, t dbSNP:17879688
323 323 a, c, t dbSNP:17879937
324 324 a, g, t dbSNP:17886436
325 325 a, g dbSNP:55917654
327 327 a, c, t dbSNP:17879432
328 328 a, g dbSNP:35499948
329 329 g, t dbSNP:17885257
330 330 c, t dbSNP:17885908
331 331 a, g dbSNP:778040505
333 333 c, g, t dbSNP:1059582
334 334 a, g, t dbSNP:17880973
335 335 a, c, g, t dbSNP:17883065
336 336 a, t dbSNP:780784592
338 338 a, c, g dbSNP:72558166
340 340 a, g dbSNP:17878622
344 344 c, t dbSNP:17878902
345 345 g, t dbSNP:41308498
347 347 c, g dbSNP:17887012
348 348 c, t dbSNP:201749971
349 349 c, t dbSNP:72558167
350 350 a, g dbSNP:17880292
351 351 a, c, g, t dbSNP:17885129
352 352 -, cgc dbSNP:750756276
352 352 c, g, t dbSNP:17853228
352 352 c, t dbSNP:2308802
353 353 a, c, g dbSNP:1059583
354 354 -, ct dbSNP:767913528
354 354 a, c, g, t dbSNP:1059584
355 355 c, g, t dbSNP:3167799
355 355 c, g, t dbSNP:17853229
356 356 -, cgg dbSNP:757724655
356 356 c, g dbSNP:17879954
357 357 a, g dbSNP:17879230
358 358 -, gac dbSNP:751646781
358 358 a, c, g dbSNP:17886514
359 359 a, c, t dbSNP:17882583
360 360 a, c dbSNP:1059586
361 361 a, c dbSNP:769883645
367 367 c, t dbSNP:201721658
369 369 a, g dbSNP:41508449
370 370 c, t dbSNP:745750329
372 372 a, g dbSNP:17882098
373 373 -, g dbSNP:17885020
374 374 -, a dbSNP:17878577
375 375 -, a dbSNP:397844204
375 375 a, g dbSNP:781165610
377 377 a, g dbSNP:17878874
378 378 a, g dbSNP:757039955
380 380 a, c, t dbSNP:17886918
382 382 a, c dbSNP:757984583
383 383 c, g, t dbSNP:17881176
384 384 g, t dbSNP:41308499
385 385 c, g dbSNP:764682247
387 387 -, a dbSNP:764153503
387 387 a, c, g dbSNP:17882450
388 388 a, g dbSNP:17885388
389 389 -, caggc dbSNP:781606444
389 389 -, gg dbSNP:776433632
389 389 a, c, g dbSNP:17881965
390 390 -, ca dbSNP:770836206
390 390 -, a dbSNP:746964425
390 390 a, g dbSNP:17884070
391 391 c, g dbSNP:17879599
392 392 a, c, g, t dbSNP:1064592
392 392 a, g dbSNP:568948309
393 393 -, aa, ag dbSNP:746231220
393 393 a, c, g, t dbSNP:9269942
393 393 -, c dbSNP:778735727
394 394 -, a, ag, gg dbSNP:778205073
394 394 a, g dbSNP:17880366
395 395 -, cg dbSNP:9281873
395 395 a, c, g, t dbSNP:17885222
395 395 -, c dbSNP:758506454
396 396 -, tg dbSNP:752707222
396 396 a, c, g, t dbSNP:17885869
397 397 -, gg dbSNP:67187877
397 397 c, g, t dbSNP:17884749
398 398 -, g dbSNP:370743542
398 398 g, t dbSNP:17883297
399 399 -, cc dbSNP:753645589
399 399 c, g dbSNP:17878857
399 399 c, t dbSNP:777553115
400 400 a, c, g, t dbSNP:3208330
401 401 -, t dbSNP:766169385
401 401 a, c, g dbSNP:16822805
402 402 -, a, aa, ca dbSNP:772090580
402 402 a, c, g, t dbSNP:17886882
402 402 -, c dbSNP:67476479
403 403 a, c, g dbSNP:17880261
405 405 c, t dbSNP:753377038
406 406 a, c, g dbSNP:756577940
407 407 a, g, t dbSNP:61759934
408 408 a, c dbSNP:767943289
409 409 a, c, g dbSNP:774753056
410 410 a, g, t dbSNP:17885079
411 411 a, c dbSNP:9269941
412 412 a, c, t dbSNP:16822512
413 413 c, g, t dbSNP:17884043
414 414 a, t dbSNP:17879620
415 415 a, c, g, t dbSNP:11554463
416 416 g, t dbSNP:748753529
417 417 g, t dbSNP:779577456
418 418 a, c dbSNP:756601075
421 421 a, t dbSNP:750986830
422 422 a, c, t dbSNP:29029549
424 424 c, t dbSNP:780337501
429 429 a, t dbSNP:751957355
430 430 c, t dbSNP:45542832
431 431 a, c, g dbSNP:17879213
432 432 g, t dbSNP:763165642
433 433 a, g dbSNP:17885752
435 435 c, t dbSNP:17424145
437 437 a, g dbSNP:61759935
438 438 a, g, t dbSNP:17885482
439 439 g, t dbSNP:17882028
444 444 a, g dbSNP:771986476
445 445 a, c, t dbSNP:17883271
451 451 a, g dbSNP:1136782
454 454 c, g dbSNP:45594032
456 456 a, g dbSNP:748921985
457 457 a, g dbSNP:779549521
458 458 a, c dbSNP:17879125
460 460 a, g dbSNP:17878311
464 464 a, g dbSNP:17885959
465 465 c, t dbSNP:754898862
466 466 a, c, t dbSNP:140866337
467 467 a, c, g, t dbSNP:17882084
468 468 a, t dbSNP:756774358
469 469 a, g, t dbSNP:1071752
469 469 a, t dbSNP:4999095
471 471 c, g, t dbSNP:79706935
472 472 c, g, t dbSNP:62799161
473 473 a, c, g dbSNP:759910238
473 473 a, c, g, t dbSNP:17405219
475 475 a, c, g, t dbSNP:17424180
476 476 a, g dbSNP:771131230
477 477 c, g, t dbSNP:80190494
478 478 a, c, g, t dbSNP:74944677
479 479 a, c, g dbSNP:1136791
480 480 a, g dbSNP:76895951
481 481 a, g dbSNP:62889561
482 482 c, g dbSNP:773389640
484 484 a, g, t dbSNP:2308759
488 488 c, t dbSNP:148699775
491 491 g, t dbSNP:2308760
492 492 -, a dbSNP:35616319
492 492 c, t dbSNP:201929247
493 493 a, c dbSNP:2308761
495 495 -, a dbSNP:200088269
496 496 a, g dbSNP:200078051
497 497 a, g, t dbSNP:17433947
497 497 a, g, t dbSNP:751064148
498 498 a, c dbSNP:200516145
499 499 a, c, g, t dbSNP:17401330
500 500 -, c dbSNP:753045406
505 505 c, t dbSNP:1064596
510 510 -, a dbSNP:756424707
515 515 c, t dbSNP:751099504
517 517 a, c, g, t dbSNP:77689370
518 518 -, aac dbSNP:746056914
519 519 a, g dbSNP:753240578
521 521 c, t dbSNP:41557115
523 523 c, g dbSNP:765766762
523 523 c, g, t dbSNP:1059615
527 527 c, g dbSNP:759833767
529 529 c, g dbSNP:17885192
532 532 c, t dbSNP:707941
532 532 c, t dbSNP:2308764
540 540 a, g dbSNP:1059351
540 540 a, g dbSNP:74626234
542 542 c, g dbSNP:760934639
546 546 a, c, g, t dbSNP:2308765
547 547 c, t dbSNP:773547095
549 549 a, g dbSNP:112796209
551 551 c, t dbSNP:748235111
555 555 c, g dbSNP:16822698
555 555 c, g dbSNP:775624700
560 560 a, g dbSNP:202047044
568 568 c, t dbSNP:745655219
579 579 a, g, t dbSNP:707954
580 580 a, g dbSNP:746709087
583 583 c, t dbSNP:2308767
583 583 c, t dbSNP:35363435
584 584 a, g dbSNP:757966595
586 586 c, g dbSNP:752147302
592 592 a, t dbSNP:779295390
599 599 a, g dbSNP:78916069
599 599 a, g dbSNP:755474816
600 600 c, g dbSNP:754180747
604 604 -, gat dbSNP:199824918
605 605 a, g dbSNP:701829
607 607 g, t dbSNP:63548860
611 611 a, g dbSNP:2308769
613 613 c, t dbSNP:761090565
615 615 a, c dbSNP:750742941
616 616 a, g dbSNP:78767604
622 622 a, g dbSNP:2308770
628 628 c, g, t dbSNP:77637983
630 630 a, g dbSNP:572938448
634 634 c, g dbSNP:2308771
637 637 c, t dbSNP:74867190
638 638 g, t dbSNP:759467362
643 643 c, t dbSNP:62930562
650 650 a, c dbSNP:770748207
652 652 a, c dbSNP:113663708
656 656 a, g dbSNP:112116022
664 664 a, g dbSNP:16822692
664 664 a, g dbSNP:79182498
669 669 c, t dbSNP:747689830
670 670 a, t dbSNP:778441312
677 677 -, a dbSNP:375154056
677 677 -, a dbSNP:781180880
677 677 c, t dbSNP:754428084
678 678 a, g dbSNP:3205588
679 679 a, c, g, t dbSNP:701831
681 681 a, g dbSNP:35300013
681 681 -, g dbSNP:757139064
684 684 a, c, g dbSNP:2308775
684 684 c, g dbSNP:762086217
685 685 a, t dbSNP:751612214
687 687 -, aggtttacacctgccaagtg dbSNP:140357311
688 688 a, c, g dbSNP:16822972
689 689 g, t dbSNP:776695055
694 694 a, c, g, t dbSNP:2308777
697 697 c, t dbSNP:17405325
700 700 c, t dbSNP:34938122
703 703 a, g dbSNP:771739125
704 704 c, g dbSNP:36044702
712 712 c, t dbSNP:34295373
712 712 c, t dbSNP:550518162
717 717 a, g dbSNP:768278955
718 718 c, t dbSNP:199704140
719 719 a, c, g dbSNP:111739605
719 719 a, c, g dbSNP:756622211
721 721 a, g dbSNP:1059705
722 722 a, t dbSNP:781648698
723 723 c, t dbSNP:200809587
724 724 a, c, g, t dbSNP:28732329
724 724 a, g dbSNP:2308818
725 725 c, g dbSNP:33926824
728 728 c, g dbSNP:1136846
728 728 c, g dbSNP:764214319
729 729 c, t dbSNP:17885501
729 729 c, t dbSNP:758561149
730 730 a, g dbSNP:1071837
734 734 -, tg dbSNP:35837054
735 735 c, t dbSNP:752658977
736 736 a, g dbSNP:17878677
736 736 a, g dbSNP:111403823
740 740 c, g dbSNP:33936261
747 747 a, g dbSNP:758322418
748 748 a, t dbSNP:1136881
751 751 a, t dbSNP:764982121
752 752 c, t dbSNP:34624872
753 753 a, g dbSNP:17856290
757 757 c, t dbSNP:765850840
762 762 c, t dbSNP:760231231
763 763 c, t dbSNP:773654170
764 764 g, t dbSNP:768010958
765 765 a, c dbSNP:377738927
768 768 a, g dbSNP:374360042
770 770 a, g dbSNP:768891284
775 775 a, g dbSNP:549532696
777 777 c, t dbSNP:775749976
788 788 a, g dbSNP:769831677
790 790 a, c, t dbSNP:368802150
791 791 a, g dbSNP:531360990
794 794 a, g, t dbSNP:778903456
799 799 c, t dbSNP:113175445
800 800 a, g dbSNP:201698383
805 805 c, g, t dbSNP:567255279
808 808 c, t dbSNP:755592812
812 812 c, t dbSNP:549336174
816 816 c, t dbSNP:527579312
819 819 c, t dbSNP:762260834
823 823 -, at dbSNP:762166606
824 824 a, g dbSNP:3830125
825 825 -, cc dbSNP:774519641
826 826 a, c, g, t dbSNP:3830126
828 828 a, g dbSNP:769996810
830 830 c, t dbSNP:1059362
830 830 c, t dbSNP:574897295
832 832 a, g dbSNP:1059808
835 835 c, t dbSNP:201168487
836 836 a, c dbSNP:199873800
840 840 a, g dbSNP:748138944
844 844 c, t dbSNP:778993299
846 846 a, g dbSNP:71547382
854 854 a, c, g dbSNP:779578123
871 871 c, t dbSNP:35067512
871 871 c, t dbSNP:541637298
873 873 a, c dbSNP:17887154
873 873 a, c dbSNP:574793750
874 874 a, g dbSNP:192487435
878 878 a, g dbSNP:572671781
879 879 c, g dbSNP:9269744
879 879 c, g dbSNP:765247121
884 884 c, t dbSNP:35445101
887 887 c, t dbSNP:34475960
897 897 a, c, g dbSNP:9269693
900 900 a, c dbSNP:34955866
909 909 -, ca dbSNP:760049502
909 909 -, c dbSNP:777675672
910 910 -, a dbSNP:771788701
910 910 a, g dbSNP:763867874
913 913 c, t dbSNP:1059920
916 916 a, g, t dbSNP:1064691
919 919 a, g dbSNP:202053852
920 920 a, g dbSNP:201375698
923 923 c, g, t dbSNP:1064692
924 924 -, c dbSNP:747939071
924 924 c, t dbSNP:1064694
926 926 a, t dbSNP:200538592
929 929 g, t dbSNP:1064695
930 930 c, t dbSNP:36217728
934 934 a, g dbSNP:1064697
935 935 a, g, t dbSNP:749335421
937 937 a, t dbSNP:780993144
938 938 c, g, t dbSNP:200849525
939 939 g, t dbSNP:777757658
941 941 a, c dbSNP:146292738
942 942 a, g dbSNP:752464470
943 943 a, g, t dbSNP:35324556
944 944 a, g dbSNP:36217730
945 945 a, t dbSNP:766819429
947 947 g, t dbSNP:761293855
951 951 a, c, t dbSNP:35236441
952 952 a, g dbSNP:35521457
953 953 c, t dbSNP:774571917
955 955 a, t dbSNP:768859416
956 956 -, t dbSNP:764735614
956 956 c, t dbSNP:1064699
957 957 c, g, t dbSNP:12363
958 958 -, ctcc dbSNP:368419083
959 959 -, tg dbSNP:754848562
959 959 a, c, t dbSNP:3180268
960 960 a, c, g, t dbSNP:3180799
961 961 -, cttg dbSNP:755803542
962 962 -, cc dbSNP:753402410
962 962 c, t dbSNP:9269688
963 963 -, t dbSNP:71864678
965 965 a, g dbSNP:754612942
966 966 a, c, t dbSNP:779655749
967 967 a, c, t dbSNP:1064701
968 968 a, c, g dbSNP:1141869
970 970 c, t dbSNP:3200898
971 971 a, c, t dbSNP:763280715
972 972 c, t dbSNP:775540137
973 973 a, t dbSNP:769982464
974 974 a, c dbSNP:759675096
975 975 a, t dbSNP:773293837
976 976 a, t dbSNP:772066074
977 977 c, g dbSNP:747981161
979 979 a, g dbSNP:182030800
980 980 c, t dbSNP:116358897
981 981 a, g dbSNP:1060081
983 983 c, g dbSNP:779563658
987 987 a, g dbSNP:755638414
988 988 a, g, t dbSNP:34844328
989 989 c, g dbSNP:36084494
990 990 c, t dbSNP:751986414
994 994 c, g dbSNP:34007709
997 997 a, c, t dbSNP:34022924
1001 1001 c, t dbSNP:113734598
1002 1002 c, t dbSNP:753021267
1003 1003 a, t dbSNP:35463048
1004 1004 a, g dbSNP:1060129
1009 1009 c, t dbSNP:34009233
1015 1015 a, g dbSNP:759691504
1019 1019 a, g, t dbSNP:1064707
1022 1022 -, gc dbSNP:34160410
1023 1023 -, ct dbSNP:35165835
1023 1023 a, g, t dbSNP:3200044
1025 1025 -, ct dbSNP:148582499
1035 1035 a, g dbSNP:112871130
1035 1035 c, t dbSNP:3179306
1036 1036 c, t dbSNP:142078339
1051 1051 g, t dbSNP:1732
1055 1055 c, t dbSNP:35716402
1058 1058 c, t dbSNP:1060176
1059 1059 c, t dbSNP:113804375
1060 1060 a, c dbSNP:775216421
1061 1061 c, g dbSNP:35000099
1063 1063 a, g dbSNP:3200047
1064 1064 c, t dbSNP:1064709
1065 1065 a, c, t dbSNP:1064710
1066 1066 c, t dbSNP:3208409
1069 1069 a, g dbSNP:747615942
1070 1070 a, g dbSNP:778127920
1074 1074 g, t dbSNP:758801058
1077 1077 -, cc dbSNP:35306263
1078 1078 c, t dbSNP:1060185
1080 1080 -, a, ca dbSNP:9281863
1080 1080 a, c dbSNP:35195677
1081 1081 -, cac dbSNP:763256972
1081 1081 c, t dbSNP:755300637
1082 1082 -, ca dbSNP:113493811
1082 1082 a, g dbSNP:754083017
1087 1087 a, t dbSNP:1060190
1090 1090 a, g dbSNP:1730
1091 1091 a, g dbSNP:1064712
1094 1094 a, g, t dbSNP:34981130
1098 1098 c, t dbSNP:1064713
1099 1099 a, c, g dbSNP:3201069
1108 1108 -, c dbSNP:34205910
1109 1109 -, c dbSNP:199703384
1110 1110 a, c dbSNP:80136018
1112 1112 c, g dbSNP:34542752
1122 1122 c, t dbSNP:35263976
1129 1129 a, g dbSNP:3201080
1133 1133 a, g dbSNP:118126743
1135 1135 a, c, t dbSNP:1729
1136 1136 c, g dbSNP:34215479
1137 1137 c, t dbSNP:34900518
1138 1138 a, c, g, t dbSNP:1064715
1140 1140 a, c dbSNP:34923246
1141 1141 c, t dbSNP:35418460
1142 1142 g, t dbSNP:6920823
1145 1145 a, c dbSNP:185448040
1148 1148 -, ccgtgcat dbSNP:200428856
1149 1149 c, t dbSNP:1064717
1150 1150 a, g dbSNP:3205684
1161 1161 c, t dbSNP:1060270
1164 1164 a, c dbSNP:35513414
1165 1165 c, t dbSNP:35413567
1166 1166 c, g dbSNP:36042073
1171 1171 a, g dbSNP:35705303
1172 1172 cc, tg dbSNP:71535483
1172 1172 c, t dbSNP:1141883
1173 1173 -, cc dbSNP:369671770
1173 1173 c, g dbSNP:3208365
1174 1174 a, c dbSNP:34266013
1185 1185 a, g dbSNP:35297326
1205 1205 a, c dbSNP:114103896
1207 1207 c, g dbSNP:34839759

Target ORF information:

RefSeq Version NM_001243965
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.