Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


HPRT1 hypoxanthine phosphoribosyltransferase 1 [Homo sapiens (human)]

Gene Symbol HPRT1
Entrez Gene ID 3251
Full Name hypoxanthine phosphoribosyltransferase 1
Synonyms HGPRT, HPRT
General protein information
Preferred Names
hypoxanthine-guanine phosphoribosyltransferase
Names
hypoxanthine-guanine phosphoribosyltransferase
HGPRTase
NP_000185.1
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

X

Xq26.1

Summary The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]. lac of sum
Disorder MIM:

308000

Disorder Html: Lesch-Nyhan syndrome, 300322 (3); HPRT-related gout, 300323 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu26272 NM_000194 Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu58312 XM_011531328 PREDICTED: Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu26272D
Sequence Information ORF Nucleotide Sequence (Length: 657bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 16-JUL-2015
Organism Homo sapiens (human)
Product hypoxanthine-guanine phosphoribosyltransferase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC004383.1, M31642.1 and BC000578.2. This sequence is a reference standard in the RefSeqGene project. On Jan 9, 2008 this sequence version replaced gi:4504482. Summary: The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC000578.2, M31642.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
ATGGCGACCC GCAGCCCTGG CGTCGTGATT AGTGATGATG AACCAGGTTA TGACCTTGAT 
TTATTTTGCA TACCTAATCA TTATGCTGAG GATTTGGAAA GGGTGTTTAT TCCTCATGGA
CTAATTATGG ACAGGACTGA ACGTCTTGCT CGAGATGTGA TGAAGGAGAT GGGAGGCCAT
CACATTGTAG CCCTCTGTGT GCTCAAGGGG GGCTATAAAT TCTTTGCTGA CCTGCTGGAT
TACATCAAAG CACTGAATAG AAATAGTGAT AGATCCATTC CTATGACTGT AGATTTTATC
AGACTGAAGA GCTATTGTAA TGACCAGTCA ACAGGGGACA TAAAAGTAAT TGGTGGAGAT
GATCTCTCAA CTTTAACTGG AAAGAATGTC TTGATTGTGG AAGATATAAT TGACACTGGC
AAAACAATGC AGACTTTGCT TTCCTTGGTC AGGCAGTATA ATCCAAAGAT GGTCAAGGTC
GCAAGCTTGC TGGTGAAAAG GACCCCACGA AGTGTTGGAT ATAAGCCAGA CTTTGTTGGA
TTTGAAATTC CAGACAAGTT TGTTGTAGGA TATGCCCTTG ACTATAATGA ATACTTCAGG
GATTTGAATC ATGTTTGTGT CATTAGTGAA ACTGGAAAAG CAAAATACAA AGCCTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_000185.1
CDS168..824
Misc Feature(1)171..173(+)
Misc Feature(2)306..713(+)
Misc Feature(3)369..665(+)
Misc Feature(4)474..476(+)
Exon (1)1..194
Gene:HPRT1
Gene Synonym:
Exon (2)195..301
Gene:HPRT1
Gene Synonym:
Exon (3)302..485
Gene:HPRT1
Gene Synonym:
Exon (4)486..551
Gene:HPRT1
Gene Synonym:
Exon (5)552..569
Gene:HPRT1
Gene Synonym:
Exon (6)570..652
Gene:HPRT1
Gene Synonym:
Exon (7)653..699
Gene:HPRT1
Gene Synonym:
Exon (8)700..776
Gene:HPRT1
Gene Synonym:
Exon (9)777..1415
Gene:HPRT1
Gene Synonym:
Translation
Position Chain Variation Link
5 5 a, g dbSNP:755400454
8 8 c, g dbSNP:779220571
12 12 c, g dbSNP:193054558
80 80 c, g dbSNP:758761334
82 82 c, g dbSNP:777691523
119 119 c, t dbSNP:747134233
125 125 -, tcc dbSNP:753582058
128 128 g, t dbSNP:780711727
133 133 c, t dbSNP:745334358
135 135 a, g dbSNP:770732111
142 142 c, g dbSNP:769271794
147 147 a, c, t dbSNP:776633368
155 155 c, g dbSNP:769125081
213 213 a, g dbSNP:137852499
221 221 a, c dbSNP:374646638
244 244 a, c dbSNP:762739119
289 289 c, t dbSNP:137852480
301 301 a, g dbSNP:137852491
308 308 a, g dbSNP:368429361
309 309 c, t dbSNP:779370129
310 310 a, g dbSNP:387906725
318 318 c, g, t dbSNP:137852494
319 319 a, g dbSNP:371800609
322 322 a, g dbSNP:137852502
326 326 a, g dbSNP:748568278
337 337 c, t dbSNP:137852495
339 339 a, g dbSNP:137852500
350 350 c, t dbSNP:145358570
353 353 c, t dbSNP:375425889
360 360 c, t dbSNP:137852506
376 376 a, g dbSNP:137852487
378 378 c, g dbSNP:137852488
379 379 -, g dbSNP:786200980
389 389 a, c dbSNP:137852481
399 399 c, g dbSNP:137852501
401 401 a, g dbSNP:760963305
406 406 a, t dbSNP:137852478
479 479 a, c dbSNP:137852485
492 492 a, c, t dbSNP:137852489
496 496 c, t dbSNP:137852482
503 503 a, g dbSNP:754484997
535 535 c, t dbSNP:369065223
556 556 a, t dbSNP:137852483
563 563 g, t dbSNP:137852477
586 586 a, g dbSNP:137852503
587 587 a, c dbSNP:757630214
595 595 a, t dbSNP:137852496
599 599 a, g dbSNP:781608428
608 608 c, t dbSNP:746094095
611 611 c, t dbSNP:756264380
623 623 a, g dbSNP:745871049
626 626 g, t dbSNP:137852505
647 647 c, t dbSNP:148780933
648 648 g, t dbSNP:137852484
650 650 a, g dbSNP:752527618
663 663 a, g dbSNP:398123242
670 670 c, t dbSNP:137852498
672 672 c, g dbSNP:534390401
675 675 a, c, t dbSNP:137852497
676 676 a, g dbSNP:767780010
689 689 c, t dbSNP:750762293
694 694 c, t dbSNP:137852493
696 696 g, t dbSNP:137852492
738 738 a, t dbSNP:770859486
747 747 a, g dbSNP:267606863
749 749 c, g dbSNP:137852504
762 762 g, t dbSNP:137852486
769 769 a, g dbSNP:137852479
777 777 c, g dbSNP:137852490
791 791 c, t dbSNP:755123688
810 810 -, aaatacaaagcctaagatgag dbSNP:387906428
817 817 a, g dbSNP:778888249
822 822 a, t dbSNP:398123243
831 831 a, g dbSNP:752771994
850 850 a, t dbSNP:758384857
865 865 a, g dbSNP:781229145
867 867 a, t dbSNP:745795558
870 870 c, t dbSNP:764716652
871 871 a, g dbSNP:779937475
872 872 c, t dbSNP:748954438
890 890 a, g dbSNP:752091179
909 909 a, g dbSNP:754889942
919 919 c, t dbSNP:781138479
932 932 a, c dbSNP:747928867
1025 1025 a, g dbSNP:185836119
1043 1043 c, g dbSNP:189158218
1091 1091 g, t dbSNP:763951920
1113 1113 -, at dbSNP:750812920
1115 1115 -, at dbSNP:17879494
1123 1123 a, g dbSNP:71653611
1164 1164 a, g dbSNP:41299094
1206 1206 g, t dbSNP:746142732
1334 1334 c, t dbSNP:370744074
1362 1362 -, a dbSNP:35095771
1362 1362 g, t dbSNP:772273024

Target ORF information:

RefSeq Version NM_000194
Organism Homo sapiens (human)
Definition Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_000194

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
ATGGCGACCC GCAGCCCTGG CGTCGTGATT AGTGATGATG AACCAGGTTA TGACCTTGAT 
TTATTTTGCA TACCTAATCA TTATGCTGAG GATTTGGAAA GGGTGTTTAT TCCTCATGGA
CTAATTATGG ACAGGACTGA ACGTCTTGCT CGAGATGTGA TGAAGGAGAT GGGAGGCCAT
CACATTGTAG CCCTCTGTGT GCTCAAGGGG GGCTATAAAT TCTTTGCTGA CCTGCTGGAT
TACATCAAAG CACTGAATAG AAATAGTGAT AGATCCATTC CTATGACTGT AGATTTTATC
AGACTGAAGA GCTATTGTAA TGACCAGTCA ACAGGGGACA TAAAAGTAAT TGGTGGAGAT
GATCTCTCAA CTTTAACTGG AAAGAATGTC TTGATTGTGG AAGATATAAT TGACACTGGC
AAAACAATGC AGACTTTGCT TTCCTTGGTC AGGCAGTATA ATCCAAAGAT GGTCAAGGTC
GCAAGCTTGC TGGTGAAAAG GACCCCACGA AGTGTTGGAT ATAAGCCAGA CTTTGTTGGA
TTTGAAATTC CAGACAAGTT TGTTGTAGGA TATGCCCTTG ACTATAATGA ATACTTCAGG
GATTTGAATC ATGTTTGTGT CATTAGTGAA ACTGGAAAAG CAAAATACAA AGCCTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu58312D
Sequence Information ORF Nucleotide Sequence (Length: 675bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product hypoxanthine-guanine phosphoribosyltransferase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011786.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
ATGCCAAAGC CTGCAAGATA CAGGAAGCTG CCAGGCCACC AGTTGATTAG TGATGATGAA 
CCAGGTTATG ACCTTGATTT ATTTTGCATA CCTAATCATT ATGCTGAGGA TTTGGAAAGG
GTGTTTATTC CTCATGGACT AATTATGGAC AGGACTGAAC GTCTTGCTCG AGATGTGATG
AAGGAGATGG GAGGCCATCA CATTGTAGCC CTCTGTGTGC TCAAGGGGGG CTATAAATTC
TTTGCTGACC TGCTGGATTA CATCAAAGCA CTGAATAGAA ATAGTGATAG ATCCATTCCT
ATGACTGTAG ATTTTATCAG ACTGAAGAGC TATTGTAATG ACCAGTCAAC AGGGGACATA
AAAGTAATTG GTGGAGATGA TCTCTCAACT TTAACTGGAA AGAATGTCTT GATTGTGGAA
GATATAATTG ACACTGGCAA AACAATGCAG ACTTTGCTTT CCTTGGTCAG GCAGTATAAT
CCAAAGATGG TCAAGGTCGC AAGCTTGCTG GTGAAAAGGA CCCCACGAAG TGTTGGATAT
AAGCCAGACT TTGTTGGATT TGAAATTCCA GACAAGTTTG TTGTAGGATA TGCCCTTGAC
TATAATGAAT ACTTCAGGGA TTTGAATCAT GTTTGTGTCA TTAGTGAAAC TGGAAAAGCA
AAATACAAAG CCTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_011529630.1
CDS109..783
Misc Feature(1)265..672(+)
Misc Feature(2)328..624(+)
Translation
Position Chain Variation Link
43 43 a, g dbSNP:189964429
76 76 c, g dbSNP:751818374
94 94 a, c dbSNP:757667453
101 101 c, t dbSNP:181260181
108 108 -, c dbSNP:35853117
111 111 a, g dbSNP:767573446
145 145 c, t dbSNP:773933212
172 172 a, g dbSNP:137852499
180 180 a, c dbSNP:374646638
203 203 a, c dbSNP:762739119
248 248 c, t dbSNP:137852480
260 260 a, g dbSNP:137852491
267 267 a, g dbSNP:368429361
268 268 c, t dbSNP:779370129
269 269 a, g dbSNP:387906725
277 277 c, g, t dbSNP:137852494
278 278 a, g dbSNP:371800609
281 281 a, g dbSNP:137852502
285 285 a, g dbSNP:748568278
296 296 c, t dbSNP:137852495
298 298 a, g dbSNP:137852500
309 309 c, t dbSNP:145358570
312 312 c, t dbSNP:375425889
319 319 c, t dbSNP:137852506
335 335 a, g dbSNP:137852487
337 337 c, g dbSNP:137852488
338 338 -, g dbSNP:786200980
348 348 a, c dbSNP:137852481
358 358 c, g dbSNP:137852501
360 360 a, g dbSNP:760963305
365 365 a, t dbSNP:137852478
438 438 a, c dbSNP:137852485
451 451 a, c, t dbSNP:137852489
455 455 c, t dbSNP:137852482
462 462 a, g dbSNP:754484997
494 494 c, t dbSNP:369065223
515 515 a, t dbSNP:137852483
522 522 g, t dbSNP:137852477
545 545 a, g dbSNP:137852503
546 546 a, c dbSNP:757630214
554 554 a, t dbSNP:137852496
558 558 a, g dbSNP:781608428
567 567 c, t dbSNP:746094095
570 570 c, t dbSNP:756264380
582 582 a, g dbSNP:745871049
585 585 g, t dbSNP:137852505
606 606 c, t dbSNP:148780933
607 607 g, t dbSNP:137852484
609 609 a, g dbSNP:752527618
622 622 a, g dbSNP:398123242
629 629 c, t dbSNP:137852498
631 631 c, g dbSNP:534390401
634 634 a, c, t dbSNP:137852497
635 635 a, g dbSNP:767780010
648 648 c, t dbSNP:750762293
653 653 c, t dbSNP:137852493
655 655 g, t dbSNP:137852492
697 697 a, t dbSNP:770859486
706 706 a, g dbSNP:267606863
708 708 c, g dbSNP:137852504
721 721 g, t dbSNP:137852486
728 728 a, g dbSNP:137852479
736 736 c, g dbSNP:137852490
750 750 c, t dbSNP:755123688
769 769 -, aaatacaaagcctaagatgag dbSNP:387906428
776 776 a, g dbSNP:778888249
781 781 a, t dbSNP:398123243
790 790 a, g dbSNP:752771994
809 809 a, t dbSNP:758384857
824 824 a, g dbSNP:781229145
826 826 a, t dbSNP:745795558
829 829 c, t dbSNP:764716652
830 830 a, g dbSNP:779937475
831 831 c, t dbSNP:748954438
849 849 a, g dbSNP:752091179
868 868 a, g dbSNP:754889942
878 878 c, t dbSNP:781138479
891 891 a, c dbSNP:747928867
984 984 a, g dbSNP:185836119
1002 1002 c, g dbSNP:189158218
1050 1050 g, t dbSNP:763951920
1072 1072 -, at dbSNP:750812920
1074 1074 -, at dbSNP:17879494
1082 1082 a, g dbSNP:71653611
1123 1123 a, g dbSNP:41299094
1165 1165 g, t dbSNP:746142732
1293 1293 c, t dbSNP:370744074
1321 1321 -, a dbSNP:35095771
1321 1321 g, t dbSNP:772273024

Target ORF information:

RefSeq Version XM_011531328
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens hypoxanthine phosphoribosyltransferase 1 (HPRT1), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
XM_011531328

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
ATGCCAAAGC CTGCAAGATA CAGGAAGCTG CCAGGCCACC AGTTGATTAG TGATGATGAA 
CCAGGTTATG ACCTTGATTT ATTTTGCATA CCTAATCATT ATGCTGAGGA TTTGGAAAGG
GTGTTTATTC CTCATGGACT AATTATGGAC AGGACTGAAC GTCTTGCTCG AGATGTGATG
AAGGAGATGG GAGGCCATCA CATTGTAGCC CTCTGTGTGC TCAAGGGGGG CTATAAATTC
TTTGCTGACC TGCTGGATTA CATCAAAGCA CTGAATAGAA ATAGTGATAG ATCCATTCCT
ATGACTGTAG ATTTTATCAG ACTGAAGAGC TATTGTAATG ACCAGTCAAC AGGGGACATA
AAAGTAATTG GTGGAGATGA TCTCTCAACT TTAACTGGAA AGAATGTCTT GATTGTGGAA
GATATAATTG ACACTGGCAA AACAATGCAG ACTTTGCTTT CCTTGGTCAG GCAGTATAAT
CCAAAGATGG TCAAGGTCGC AAGCTTGCTG GTGAAAAGGA CCCCACGAAG TGTTGGATAT
AAGCCAGACT TTGTTGGATT TGAAATTCCA GACAAGTTTG TTGTAGGATA TGCCCTTGAC
TATAATGAAT ACTTCAGGGA TTTGAATCAT GTTTGTGTCA TTAGTGAAAC TGGAAAAGCA
AAATACAAAG CCTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.