
APOE cDNA ORF clone, Homo sapiens (human)

Gene Symbol APOE
Entrez Gene ID 348
Full Name apolipoprotein E
Synonyms AD2, APO-E, LDLCQ5, LPG
General protein information
Preferred Names
apolipoprotein E
apolipoprotein E
apolipoprotein E3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. lac of sum
Disorder MIM:


Disorder Html: Hyperlipoproteinemia, type III (3); {Myocardial infarction

The following APOE gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the APOE cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu52233 NM_001302688 Homo sapiens apolipoprotein E (APOE), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00
NM_000041 Homo sapiens apolipoprotein E (APOE), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001302691 Homo sapiens apolipoprotein E (APOE), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001302690 Homo sapiens apolipoprotein E (APOE), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001302689 Homo sapiens apolipoprotein E (APOE), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu52233
Accession Version NM_001302688.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1032bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product apolipoprotein E isoform a precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY056112.1, BM042032.1, BC003557.1 and AL037046.3. On Nov 7, 2014 this sequence version replaced gi:530416440. Summary: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BI602495.1, BU190668.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)19..21(+)
Misc Feature(2)508..1095(+)
Exon (1)1..175
Gene Synonym:
Exon (2)176..241
Gene Synonym:
Exon (3)242..434
Gene Synonym:
Exon (4)435..1297
Gene Synonym:
Position Chain Variation Link
7 7 c, g dbSNP:539159437
11 11 g, t dbSNP:767814822
18 18 a, g dbSNP:758379972
36 36 a, g dbSNP:766215051
39 39 c, g dbSNP:750782549
51 51 c, t dbSNP:751150968
56 56 c, t dbSNP:577386185
60 60 a, t dbSNP:780699141
79 79 c, t dbSNP:539986817
84 84 c, t dbSNP:553197505
85 85 c, t dbSNP:72654467
108 108 c, t dbSNP:9282609
109 109 -, g dbSNP:766084317
118 118 a, g dbSNP:555840707
131 131 a, g dbSNP:373985746
132 132 a, g dbSNP:749645156
141 141 a, g dbSNP:771620473
162 162 c, g dbSNP:440446
173 173 c, t dbSNP:772022603
175 175 a, g dbSNP:563571689
180 180 g, t dbSNP:755877232
185 185 -, t dbSNP:755136353
210 210 -, tgggc dbSNP:778989940
213 213 a, g dbSNP:777551553
218 218 c, t dbSNP:754318486
219 219 c, g dbSNP:373321868
224 224 c, t dbSNP:779278130
225 225 a, g dbSNP:746382742
229 229 a, g, t dbSNP:144354013
233 233 a, t dbSNP:747078681
238 238 a, g dbSNP:559532612
240 240 a, g dbSNP:768934589
241 241 g, t dbSNP:752693941
250 250 a, c, g dbSNP:533904656
253 253 a, g dbSNP:11542036
259 259 a, g dbSNP:121918392
261 261 a, g dbSNP:763720372
266 266 c, t dbSNP:776242156
267 267 a, g dbSNP:111833428
281 281 c, t dbSNP:764929617
282 282 a, g dbSNP:150688032
288 288 c, g dbSNP:370227413
289 289 a, g dbSNP:201672011
295 295 c, t dbSNP:752079771
306 306 c, g, t dbSNP:755434388
307 307 a, g dbSNP:142480126
314 314 a, g dbSNP:756353413
318 318 c, t dbSNP:373020952
319 319 a, g dbSNP:749406635
325 325 c, t dbSNP:121918399
326 326 a, g dbSNP:371694216
327 327 c, t dbSNP:746975744
330 330 a, g dbSNP:768684471
333 333 a, g dbSNP:758606895
335 335 c, t dbSNP:769452
336 336 a, g dbSNP:761381769
342 342 c, g dbSNP:751675227
346 346 c, g, t dbSNP:11542029
347 347 a, c, g, t dbSNP:762461580
348 348 c, t dbSNP:11542031
363 363 c, g dbSNP:376607258
365 365 a, g dbSNP:752790054
376 376 a, g dbSNP:28931576
378 378 a, g dbSNP:11542038
381 381 g, t dbSNP:200125743
390 390 a, c, g dbSNP:370594287
397 397 a, g dbSNP:780035531
403 403 c, t dbSNP:139948786
404 404 c, t dbSNP:768780599
408 408 c, t dbSNP:781192562
412 412 c, t dbSNP:757100480
418 418 g, t dbSNP:747975000
419 419 c, t dbSNP:769366285
420 420 a, c dbSNP:772554321
425 425 a, g dbSNP:762703669
427 427 a, g dbSNP:770545391
437 437 a, c dbSNP:774000134
438 438 a, g dbSNP:759134820
444 444 g, t dbSNP:557845700
447 447 c, t dbSNP:767980905
464 464 c, t dbSNP:368210726
476 476 a, c dbSNP:761285934
477 477 a, g dbSNP:371331933
479 479 a, c dbSNP:776830091
480 480 c, g dbSNP:761988169
489 489 -, g dbSNP:527236160
494 494 a, g dbSNP:577618688
498 498 a, g dbSNP:267605543
502 502 a, c dbSNP:11542040
503 503 a, c, g, t dbSNP:11083750
504 504 a, g dbSNP:368495194
508 508 a, g dbSNP:767382895
510 510 a, g dbSNP:752409518
516 516 a, g dbSNP:756130353
519 519 a, g dbSNP:777571029
521 521 a, g dbSNP:749160976
524 524 -, a dbSNP:761350032
526 526 a, c dbSNP:756776560
527 527 a, g dbSNP:778348297
533 533 a, c dbSNP:745552623
534 534 a, c dbSNP:11542033
535 535 a, g dbSNP:771594795
543 543 a, g dbSNP:141549454
547 547 a, g dbSNP:28931577
548 548 c, t dbSNP:372938213
552 552 g, t dbSNP:768998148
554 554 a, c dbSNP:777291619
559 559 a, c, t dbSNP:11542037
562 562 a, c dbSNP:587778876
564 564 g, t dbSNP:765437285
579 579 a, g dbSNP:773391883
580 580 a, g dbSNP:763313394
582 582 c, t dbSNP:766493265
583 583 a, g dbSNP:752600356
586 586 c, t dbSNP:429358
592 592 a, c, t dbSNP:11542041
602 602 a, g dbSNP:753798476
603 603 a, g dbSNP:757148922
607 607 c, t dbSNP:573658040
608 608 a, g dbSNP:11542035
610 610 a, g dbSNP:543363163
614 614 a, t dbSNP:41382345
615 615 a, g dbSNP:758127435
616 616 a, g, t dbSNP:779569800
624 624 a, c dbSNP:11542039
625 625 a, c, t dbSNP:768925016
631 631 a, g dbSNP:748703149
632 632 a, g dbSNP:267606664
633 633 -, gaggtgcaggccatgctcggc dbSNP:397514254
642 642 c, g dbSNP:773479792
645 645 c, g dbSNP:762933906
647 647 a, g dbSNP:11542034
649 649 a, c dbSNP:587778877
651 651 c, g dbSNP:563140413
652 652 c, t dbSNP:531939919
653 653 a, c, g dbSNP:28931578
658 658 a, c, t dbSNP:121918393
659 659 c, g dbSNP:200703101
660 660 c, t dbSNP:753601274
676 676 c, t dbSNP:387906567
678 678 a, c dbSNP:761790162
685 685 c, t dbSNP:769455
686 686 a, c, g dbSNP:121918397
688 688 a, c, g dbSNP:121918394
694 694 -, ctc dbSNP:746494694
698 698 -, tcc dbSNP:515726148
701 701 a, g dbSNP:376170967
706 706 c, g dbSNP:267606662
714 714 a, c dbSNP:757859088
724 724 c, t dbSNP:7412
736 736 c, t dbSNP:751200677
741 741 g, t dbSNP:754627330
753 753 c, t dbSNP:781722239
763 763 a, g dbSNP:11542032
777 777 c, g dbSNP:748506927
784 784 c, t dbSNP:770485817
785 785 a, g dbSNP:778425259
812 812 a, g dbSNP:11542030
817 817 c, t dbSNP:749750245
820 820 c, g dbSNP:770942678
825 825 a, g dbSNP:774452222
838 838 a, g dbSNP:759721023
842 842 c, t dbSNP:11542027
849 849 c, t dbSNP:72654468
871 871 a, g dbSNP:547472686
881 881 a, g dbSNP:121918396
886 886 a, g dbSNP:567353589
895 895 c, g dbSNP:554251788
901 901 c, t dbSNP:530010303
915 915 a, g dbSNP:761592007
922 922 c, g dbSNP:387906568
923 923 a, c, g dbSNP:267606663
934 934 c, t dbSNP:121918395
943 943 c, g dbSNP:762906934
944 944 a, g dbSNP:765845034
945 945 a, g dbSNP:771354248
959 959 a, t dbSNP:199768005
962 962 c, t dbSNP:780984110
963 963 a, g dbSNP:752327439
971 971 a, g dbSNP:756564996
973 973 c, g dbSNP:778237451
982 982 a, g dbSNP:140808909
984 984 a, g dbSNP:569017773
985 985 a, g dbSNP:190853081
998 998 a, g dbSNP:745950059
1001 1001 -, a dbSNP:773268787
1003 1003 c, g, t dbSNP:267606661
1008 1008 a, g dbSNP:747184737
1019 1019 c, g dbSNP:551256627
1024 1024 c, t dbSNP:371110159
1030 1030 c, t dbSNP:762845923
1031 1031 -, cc dbSNP:760500094
1031 1031 a, g dbSNP:767339630
1044 1044 c, g dbSNP:778901516
1049 1049 a, g dbSNP:773797268
1050 1050 g, t dbSNP:759118026
1054 1054 a, c, t dbSNP:750138933
1057 1057 a, g dbSNP:755792921
1065 1065 c, t dbSNP:77903069
1073 1073 a, g dbSNP:121918398
1080 1080 g, t dbSNP:557715042
1081 1081 a, g dbSNP:754211171
1084 1084 a, g, t dbSNP:757764781
1092 1092 a, g dbSNP:746294588
1097 1097 a, g dbSNP:758487955
1098 1098 c, g dbSNP:780067631
1107 1107 a, t dbSNP:747272511
1109 1109 c, g dbSNP:539470710
1110 1110 c, t dbSNP:772936346
1111 1111 a, g dbSNP:749102800
1118 1118 c, t dbSNP:770562611
1125 1125 c, t dbSNP:774354369
1129 1129 c, g dbSNP:759501381
1138 1138 a, c dbSNP:28931579
1151 1151 -, a dbSNP:766248543
1151 1151 a, g dbSNP:775113061
1154 1154 c, t dbSNP:760456587
1155 1155 a, g dbSNP:763790607
1157 1157 c, t dbSNP:754223652
1165 1165 -, gca dbSNP:753523910
1165 1165 a, g dbSNP:757647161
1172 1172 c, g, t dbSNP:201463764
1177 1177 c, t dbSNP:374329439
1179 1179 a, c, t dbSNP:367866106
1184 1184 c, t dbSNP:780156942
1186 1186 a, g dbSNP:747076678
1189 1189 c, t dbSNP:755218314
1191 1191 -, tgcctcc dbSNP:755219928
1191 1191 a, g, t dbSNP:372055776
1193 1193 a, g dbSNP:770779481
1198 1198 c, g dbSNP:778534804
1244 1244 c, t dbSNP:553874843
1249 1249 c, t dbSNP:573693195
1251 1251 c, t dbSNP:747919742

Target ORF information:

RefSeq Version NM_001302688
Organism Homo sapiens (human)
Definition Homo sapiens apolipoprotein E (APOE), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27296
Accession Version NM_000041.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 954bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product apolipoprotein E isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY056112.1, BC003557.1 and AL037046.3. This sequence is a reference standard in the RefSeqGene project. On Nov 7, 2014 this sequence version replaced gi:48762938. Summary: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. Transcript Variant: This variant (2) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HY036369.1, BC003557.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)42..44(+)
Misc Feature(2)354..881(+)
Misc Feature(3)393..395(+)
Misc Feature(4)426..1013(+)
Misc Feature(5)543..545(+)
Misc Feature(6)588..620(+)
Misc Feature(7)600..611(+)
Misc Feature(8)750..752(+)
Misc Feature(9)801..824(+)
Misc Feature(10)972..974(+)
Misc Feature(11)984..986(+)
Exon (1)1..93
Gene Synonym:
Exon (2)94..159
Gene Synonym:
Exon (3)160..352
Gene Synonym:
Exon (4)353..1215
Gene Synonym:
Position Chain Variation Link
7 7 c, g dbSNP:539159437
11 11 g, t dbSNP:767814822
18 18 a, g dbSNP:758379972
36 36 a, g dbSNP:766215051
39 39 c, g dbSNP:750782549
51 51 c, t dbSNP:751150968
56 56 c, t dbSNP:577386185
60 60 a, t dbSNP:780699141
79 79 c, t dbSNP:539986817
84 84 c, t dbSNP:553197505
85 85 c, t dbSNP:72654467
98 98 g, t dbSNP:755877232
103 103 -, t dbSNP:755136353
128 128 -, tgggc dbSNP:778989940
131 131 a, g dbSNP:777551553
136 136 c, t dbSNP:754318486
137 137 c, g dbSNP:373321868
142 142 c, t dbSNP:779278130
143 143 a, g dbSNP:746382742
147 147 a, g, t dbSNP:144354013
151 151 a, t dbSNP:747078681
156 156 a, g dbSNP:559532612
158 158 a, g dbSNP:768934589
159 159 g, t dbSNP:752693941
168 168 a, c, g dbSNP:533904656
171 171 a, g dbSNP:11542036
177 177 a, g dbSNP:121918392
179 179 a, g dbSNP:763720372
184 184 c, t dbSNP:776242156
185 185 a, g dbSNP:111833428
199 199 c, t dbSNP:764929617
200 200 a, g dbSNP:150688032
206 206 c, g dbSNP:370227413
207 207 a, g dbSNP:201672011
213 213 c, t dbSNP:752079771
224 224 c, g, t dbSNP:755434388
225 225 a, g dbSNP:142480126
232 232 a, g dbSNP:756353413
236 236 c, t dbSNP:373020952
237 237 a, g dbSNP:749406635
243 243 c, t dbSNP:121918399
244 244 a, g dbSNP:371694216
245 245 c, t dbSNP:746975744
248 248 a, g dbSNP:768684471
251 251 a, g dbSNP:758606895
253 253 c, t dbSNP:769452
254 254 a, g dbSNP:761381769
260 260 c, g dbSNP:751675227
264 264 c, g, t dbSNP:11542029
265 265 a, c, g, t dbSNP:762461580
266 266 c, t dbSNP:11542031
281 281 c, g dbSNP:376607258
283 283 a, g dbSNP:752790054
294 294 a, g dbSNP:28931576
296 296 a, g dbSNP:11542038
299 299 g, t dbSNP:200125743
308 308 a, c, g dbSNP:370594287
315 315 a, g dbSNP:780035531
321 321 c, t dbSNP:139948786
322 322 c, t dbSNP:768780599
326 326 c, t dbSNP:781192562
330 330 c, t dbSNP:757100480
336 336 g, t dbSNP:747975000
337 337 c, t dbSNP:769366285
338 338 a, c dbSNP:772554321
343 343 a, g dbSNP:762703669
345 345 a, g dbSNP:770545391
355 355 a, c dbSNP:774000134
356 356 a, g dbSNP:759134820
362 362 g, t dbSNP:557845700
365 365 c, t dbSNP:767980905
382 382 c, t dbSNP:368210726
394 394 a, c dbSNP:761285934
395 395 a, g dbSNP:371331933
397 397 a, c dbSNP:776830091
398 398 c, g dbSNP:761988169
407 407 -, g dbSNP:527236160
412 412 a, g dbSNP:577618688
416 416 a, g dbSNP:267605543
420 420 a, c dbSNP:11542040
421 421 a, c, g, t dbSNP:11083750
422 422 a, g dbSNP:368495194
426 426 a, g dbSNP:767382895
428 428 a, g dbSNP:752409518
434 434 a, g dbSNP:756130353
437 437 a, g dbSNP:777571029
439 439 a, g dbSNP:749160976
442 442 -, a dbSNP:761350032
444 444 a, c dbSNP:756776560
445 445 a, g dbSNP:778348297
451 451 a, c dbSNP:745552623
452 452 a, c dbSNP:11542033
453 453 a, g dbSNP:771594795
461 461 a, g dbSNP:141549454
465 465 a, g dbSNP:28931577
466 466 c, t dbSNP:372938213
470 470 g, t dbSNP:768998148
472 472 a, c dbSNP:777291619
477 477 a, c, t dbSNP:11542037
480 480 a, c dbSNP:587778876
482 482 g, t dbSNP:765437285
497 497 a, g dbSNP:773391883
498 498 a, g dbSNP:763313394
500 500 c, t dbSNP:766493265
501 501 a, g dbSNP:752600356
504 504 c, t dbSNP:429358
510 510 a, c, t dbSNP:11542041
520 520 a, g dbSNP:753798476
521 521 a, g dbSNP:757148922
525 525 c, t dbSNP:573658040
526 526 a, g dbSNP:11542035
528 528 a, g dbSNP:543363163
532 532 a, t dbSNP:41382345
533 533 a, g dbSNP:758127435
534 534 a, g, t dbSNP:779569800
542 542 a, c dbSNP:11542039
543 543 a, c, t dbSNP:768925016
549 549 a, g dbSNP:748703149
550 550 a, g dbSNP:267606664
551 551 -, gaggtgcaggccatgctcggc dbSNP:397514254
560 560 c, g dbSNP:773479792
563 563 c, g dbSNP:762933906
565 565 a, g dbSNP:11542034
567 567 a, c dbSNP:587778877
569 569 c, g dbSNP:563140413
570 570 c, t dbSNP:531939919
571 571 a, c, g dbSNP:28931578
576 576 a, c, t dbSNP:121918393
577 577 c, g dbSNP:200703101
578 578 c, t dbSNP:753601274
594 594 c, t dbSNP:387906567
596 596 a, c dbSNP:761790162
603 603 c, t dbSNP:769455
604 604 a, c, g dbSNP:121918397
606 606 a, c, g dbSNP:121918394
612 612 -, ctc dbSNP:746494694
616 616 -, tcc dbSNP:515726148
619 619 a, g dbSNP:376170967
624 624 c, g dbSNP:267606662
632 632 a, c dbSNP:757859088
642 642 c, t dbSNP:7412
654 654 c, t dbSNP:751200677
659 659 g, t dbSNP:754627330
671 671 c, t dbSNP:781722239
681 681 a, g dbSNP:11542032
695 695 c, g dbSNP:748506927
702 702 c, t dbSNP:770485817
703 703 a, g dbSNP:778425259
730 730 a, g dbSNP:11542030
735 735 c, t dbSNP:749750245
738 738 c, g dbSNP:770942678
743 743 a, g dbSNP:774452222
756 756 a, g dbSNP:759721023
760 760 c, t dbSNP:11542027
767 767 c, t dbSNP:72654468
789 789 a, g dbSNP:547472686
799 799 a, g dbSNP:121918396
804 804 a, g dbSNP:567353589
813 813 c, g dbSNP:554251788
819 819 c, t dbSNP:530010303
833 833 a, g dbSNP:761592007
840 840 c, g dbSNP:387906568
841 841 a, c, g dbSNP:267606663
852 852 c, t dbSNP:121918395
861 861 c, g dbSNP:762906934
862 862 a, g dbSNP:765845034
863 863 a, g dbSNP:771354248
877 877 a, t dbSNP:199768005
880 880 c, t dbSNP:780984110
881 881 a, g dbSNP:752327439
889 889 a, g dbSNP:756564996
891 891 c, g dbSNP:778237451
900 900 a, g dbSNP:140808909
902 902 a, g dbSNP:569017773
903 903 a, g dbSNP:190853081
916 916 a, g dbSNP:745950059
919 919 -, a dbSNP:773268787
921 921 c, g, t dbSNP:267606661
926 926 a, g dbSNP:747184737
937 937 c, g dbSNP:551256627
942 942 c, t dbSNP:371110159
948 948 c, t dbSNP:762845923
949 949 -, cc dbSNP:760500094
949 949 a, g dbSNP:767339630
962 962 c, g dbSNP:778901516
967 967 a, g dbSNP:773797268
968 968 g, t dbSNP:759118026
972 972 a, c, t dbSNP:750138933
975 975 a, g dbSNP:755792921
983 983 c, t dbSNP:77903069
991 991 a, g dbSNP:121918398
998 998 g, t dbSNP:557715042
999 999 a, g dbSNP:754211171
1002 1002 a, g, t dbSNP:757764781
1010 1010 a, g dbSNP:746294588
1015 1015 a, g dbSNP:758487955
1016 1016 c, g dbSNP:780067631
1025 1025 a, t dbSNP:747272511
1027 1027 c, g dbSNP:539470710
1028 1028 c, t dbSNP:772936346
1029 1029 a, g dbSNP:749102800
1036 1036 c, t dbSNP:770562611
1043 1043 c, t dbSNP:774354369
1047 1047 c, g dbSNP:759501381
1056 1056 a, c dbSNP:28931579
1069 1069 -, a dbSNP:766248543
1069 1069 a, g dbSNP:775113061
1072 1072 c, t dbSNP:760456587
1073 1073 a, g dbSNP:763790607
1075 1075 c, t dbSNP:754223652
1083 1083 -, gca dbSNP:753523910
1083 1083 a, g dbSNP:757647161
1090 1090 c, g, t dbSNP:201463764
1095 1095 c, t dbSNP:374329439
1097 1097 a, c, t dbSNP:367866106
1102 1102 c, t dbSNP:780156942
1104 1104 a, g dbSNP:747076678
1107 1107 c, t dbSNP:755218314
1109 1109 -, tgcctcc dbSNP:755219928
1109 1109 a, g, t dbSNP:372055776
1111 1111 a, g dbSNP:770779481
1116 1116 c, g dbSNP:778534804
1162 1162 c, t dbSNP:553874843
1167 1167 c, t dbSNP:573693195
1169 1169 c, t dbSNP:747919742

Target ORF information:

RefSeq Version NM_000041
Organism Homo sapiens (human)
Definition Homo sapiens apolipoprotein E (APOE), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27296
Accession Version NM_001302691.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 954bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 13-MAY-2015
Organism Homo sapiens (human)
Product apolipoprotein E isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY056112.1, BI550631.1, BC003557.1 and AL037046.3. Summary: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. Transcript Variant: This variant (5) contains an alternate 5' terminal exon and uses an alternate splice site in another 5' exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BI550631.1, BI670331.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)42..44(+)
Misc Feature(2)369..896(+)
Misc Feature(3)441..1028(+)
Misc Feature(4)558..560(+)
Misc Feature(5)570..572(+)
Misc Feature(6)603..635(+)
Misc Feature(7)615..626(+)
Misc Feature(8)816..839(+)
Exon (1)1..93
Gene Synonym:
Exon (2)94..174
Gene Synonym:
Exon (3)175..367
Gene Synonym:
Exon (4)368..1230
Gene Synonym:
Position Chain Variation Link
7 7 c, g dbSNP:539159437
11 11 g, t dbSNP:767814822
18 18 a, g dbSNP:758379972
36 36 a, g dbSNP:766215051
39 39 c, g dbSNP:750782549
51 51 c, t dbSNP:751150968
56 56 c, t dbSNP:577386185
60 60 a, t dbSNP:780699141
79 79 c, t dbSNP:539986817
84 84 c, t dbSNP:553197505
85 85 c, t dbSNP:72654467
107 107 a, c, t dbSNP:113191942
113 113 g, t dbSNP:755877232
118 118 -, t dbSNP:755136353
143 143 -, tgggc dbSNP:778989940
146 146 a, g dbSNP:777551553
151 151 c, t dbSNP:754318486
152 152 c, g dbSNP:373321868
157 157 c, t dbSNP:779278130
158 158 a, g dbSNP:746382742
162 162 a, g, t dbSNP:144354013
166 166 a, t dbSNP:747078681
171 171 a, g dbSNP:559532612
173 173 a, g dbSNP:768934589
174 174 g, t dbSNP:752693941
183 183 a, c, g dbSNP:533904656
186 186 a, g dbSNP:11542036
192 192 a, g dbSNP:121918392
194 194 a, g dbSNP:763720372
199 199 c, t dbSNP:776242156
200 200 a, g dbSNP:111833428
214 214 c, t dbSNP:764929617
215 215 a, g dbSNP:150688032
221 221 c, g dbSNP:370227413
222 222 a, g dbSNP:201672011
228 228 c, t dbSNP:752079771
239 239 c, g, t dbSNP:755434388
240 240 a, g dbSNP:142480126
247 247 a, g dbSNP:756353413
251 251 c, t dbSNP:373020952
252 252 a, g dbSNP:749406635
258 258 c, t dbSNP:121918399
259 259 a, g dbSNP:371694216
260 260 c, t dbSNP:746975744
263 263 a, g dbSNP:768684471
266 266 a, g dbSNP:758606895
268 268 c, t dbSNP:769452
269 269 a, g dbSNP:761381769
275 275 c, g dbSNP:751675227
279 279 c, g, t dbSNP:11542029
280 280 a, c, g, t dbSNP:762461580
281 281 c, t dbSNP:11542031
296 296 c, g dbSNP:376607258
298 298 a, g dbSNP:752790054
309 309 a, g dbSNP:28931576
311 311 a, g dbSNP:11542038
314 314 g, t dbSNP:200125743
323 323 a, c, g dbSNP:370594287
330 330 a, g dbSNP:780035531
336 336 c, t dbSNP:139948786
337 337 c, t dbSNP:768780599
341 341 c, t dbSNP:781192562
345 345 c, t dbSNP:757100480
351 351 g, t dbSNP:747975000
352 352 c, t dbSNP:769366285
353 353 a, c dbSNP:772554321
358 358 a, g dbSNP:762703669
360 360 a, g dbSNP:770545391
370 370 a, c dbSNP:774000134
371 371 a, g dbSNP:759134820
377 377 g, t dbSNP:557845700
380 380 c, t dbSNP:767980905
397 397 c, t dbSNP:368210726
409 409 a, c dbSNP:761285934
410 410 a, g dbSNP:371331933
412 412 a, c dbSNP:776830091
413 413 c, g dbSNP:761988169
422 422 -, g dbSNP:527236160
427 427 a, g dbSNP:577618688
431 431 a, g dbSNP:267605543
435 435 a, c dbSNP:11542040
436 436 a, c, g, t dbSNP:11083750
437 437 a, g dbSNP:368495194
441 441 a, g dbSNP:767382895
443 443 a, g dbSNP:752409518
449 449 a, g dbSNP:756130353
452 452 a, g dbSNP:777571029
454 454 a, g dbSNP:749160976
457 457 -, a dbSNP:761350032
459 459 a, c dbSNP:756776560
460 460 a, g dbSNP:778348297
466 466 a, c dbSNP:745552623
467 467 a, c dbSNP:11542033
468 468 a, g dbSNP:771594795
476 476 a, g dbSNP:141549454
480 480 a, g dbSNP:28931577
481 481 c, t dbSNP:372938213
485 485 g, t dbSNP:768998148
487 487 a, c dbSNP:777291619
492 492 a, c, t dbSNP:11542037
495 495 a, c dbSNP:587778876
497 497 g, t dbSNP:765437285
512 512 a, g dbSNP:773391883
513 513 a, g dbSNP:763313394
515 515 c, t dbSNP:766493265
516 516 a, g dbSNP:752600356
519 519 c, t dbSNP:429358
525 525 a, c, t dbSNP:11542041
535 535 a, g dbSNP:753798476
536 536 a, g dbSNP:757148922
540 540 c, t dbSNP:573658040
541 541 a, g dbSNP:11542035
543 543 a, g dbSNP:543363163
547 547 a, t dbSNP:41382345
548 548 a, g dbSNP:758127435
549 549 a, g, t dbSNP:779569800
557 557 a, c dbSNP:11542039
558 558 a, c, t dbSNP:768925016
564 564 a, g dbSNP:748703149
565 565 a, g dbSNP:267606664
566 566 -, gaggtgcaggccatgctcggc dbSNP:397514254
575 575 c, g dbSNP:773479792
578 578 c, g dbSNP:762933906
580 580 a, g dbSNP:11542034
582 582 a, c dbSNP:587778877
584 584 c, g dbSNP:563140413
585 585 c, t dbSNP:531939919
586 586 a, c, g dbSNP:28931578
591 591 a, c, t dbSNP:121918393
592 592 c, g dbSNP:200703101
593 593 c, t dbSNP:753601274
609 609 c, t dbSNP:387906567
611 611 a, c dbSNP:761790162
618 618 c, t dbSNP:769455
619 619 a, c, g dbSNP:121918397
621 621 a, c, g dbSNP:121918394
627 627 -, ctc dbSNP:746494694
631 631 -, tcc dbSNP:515726148
634 634 a, g dbSNP:376170967
639 639 c, g dbSNP:267606662
647 647 a, c dbSNP:757859088
657 657 c, t dbSNP:7412
669 669 c, t dbSNP:751200677
674 674 g, t dbSNP:754627330
686 686 c, t dbSNP:781722239
696 696 a, g dbSNP:11542032
710 710 c, g dbSNP:748506927
717 717 c, t dbSNP:770485817
718 718 a, g dbSNP:778425259
745 745 a, g dbSNP:11542030
750 750 c, t dbSNP:749750245
753 753 c, g dbSNP:770942678
758 758 a, g dbSNP:774452222
771 771 a, g dbSNP:759721023
775 775 c, t dbSNP:11542027
782 782 c, t dbSNP:72654468
804 804 a, g dbSNP:547472686
814 814 a, g dbSNP:121918396
819 819 a, g dbSNP:567353589
828 828 c, g dbSNP:554251788
834 834 c, t dbSNP:530010303
848 848 a, g dbSNP:761592007
855 855 c, g dbSNP:387906568
856 856 a, c, g dbSNP:267606663
867 867 c, t dbSNP:121918395
876 876 c, g dbSNP:762906934
877 877 a, g dbSNP:765845034
878 878 a, g dbSNP:771354248
892 892 a, t dbSNP:199768005
895 895 c, t dbSNP:780984110
896 896 a, g dbSNP:752327439
904 904 a, g dbSNP:756564996
906 906 c, g dbSNP:778237451
915 915 a, g dbSNP:140808909
917 917 a, g dbSNP:569017773
918 918 a, g dbSNP:190853081
931 931 a, g dbSNP:745950059
934 934 -, a dbSNP:773268787
936 936 c, g, t dbSNP:267606661
941 941 a, g dbSNP:747184737
952 952 c, g dbSNP:551256627
957 957 c, t dbSNP:371110159
963 963 c, t dbSNP:762845923
964 964 -, cc dbSNP:760500094
964 964 a, g dbSNP:767339630
977 977 c, g dbSNP:778901516
982 982 a, g dbSNP:773797268
983 983 g, t dbSNP:759118026
987 987 a, c, t dbSNP:750138933
990 990 a, g dbSNP:755792921
998 998 c, t dbSNP:77903069
1006 1006 a, g dbSNP:121918398
1013 1013 g, t dbSNP:557715042
1014 1014 a, g dbSNP:754211171
1017 1017 a, g, t dbSNP:757764781
1025 1025 a, g dbSNP:746294588
1030 1030 a, g dbSNP:758487955
1031 1031 c, g dbSNP:780067631
1040 1040 a, t dbSNP:747272511
1042 1042 c, g dbSNP:539470710
1043 1043 c, t dbSNP:772936346
1044 1044 a, g dbSNP:749102800
1051 1051 c, t dbSNP:770562611
1058 1058 c, t dbSNP:774354369
1062 1062 c, g dbSNP:759501381
1071 1071 a, c dbSNP:28931579
1084 1084 -, a dbSNP:766248543
1084 1084 a, g dbSNP:775113061
1087 1087 c, t dbSNP:760456587
1088 1088 a, g dbSNP:763790607
1090 1090 c, t dbSNP:754223652
1098 1098 -, gca dbSNP:753523910
1098 1098 a, g dbSNP:757647161
1105 1105 c, g, t dbSNP:201463764
1110 1110 c, t dbSNP:374329439
1112 1112 a, c, t dbSNP:367866106
1117 1117 c, t dbSNP:780156942
1119 1119 a, g dbSNP:747076678
1122 1122 c, t dbSNP:755218314
1124 1124 -, tgcctcc dbSNP:755219928
1124 1124 a, g, t dbSNP:372055776
1126 1126 a, g dbSNP:770779481
1131 1131 c, g dbSNP:778534804
1177 1177 c, t dbSNP:553874843
1182 1182 c, t dbSNP:573693195
1184 1184 c, t dbSNP:747919742

Target ORF information:

RefSeq Version NM_001302691
Organism Homo sapiens (human)
Definition Homo sapiens apolipoprotein E (APOE), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27296
Accession Version NM_001302690.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 954bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 13-MAY-2015
Organism Homo sapiens (human)
Product apolipoprotein E isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CA771535.1, HY074888.1, BC003557.1 and AL037046.3. Summary: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. Transcript Variant: This variant (4) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HY074888.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2145122 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)79..81(+)
Misc Feature(2)385..912(+)
Misc Feature(3)457..1044(+)
Misc Feature(4)574..576(+)
Misc Feature(5)586..588(+)
Misc Feature(6)619..651(+)
Misc Feature(7)631..642(+)
Misc Feature(8)832..855(+)
Exon (1)1..124
Gene Synonym:
Exon (2)125..190
Gene Synonym:
Exon (3)191..383
Gene Synonym:
Exon (4)384..1246
Gene Synonym:
Position Chain Variation Link
49 49 c, t dbSNP:568489254
83 83 a, c dbSNP:544583447
84 84 g, t dbSNP:556984560
108 108 c, t dbSNP:577113356
129 129 g, t dbSNP:755877232
134 134 -, t dbSNP:755136353
159 159 -, tgggc dbSNP:778989940
162 162 a, g dbSNP:777551553
167 167 c, t dbSNP:754318486
168 168 c, g dbSNP:373321868
173 173 c, t dbSNP:779278130
174 174 a, g dbSNP:746382742
178 178 a, g, t dbSNP:144354013
182 182 a, t dbSNP:747078681
187 187 a, g dbSNP:559532612
189 189 a, g dbSNP:768934589
190 190 g, t dbSNP:752693941
199 199 a, c, g dbSNP:533904656
202 202 a, g dbSNP:11542036
208 208 a, g dbSNP:121918392
210 210 a, g dbSNP:763720372
215 215 c, t dbSNP:776242156
216 216 a, g dbSNP:111833428
230 230 c, t dbSNP:764929617
231 231 a, g dbSNP:150688032
237 237 c, g dbSNP:370227413
238 238 a, g dbSNP:201672011
244 244 c, t dbSNP:752079771
255 255 c, g, t dbSNP:755434388
256 256 a, g dbSNP:142480126
263 263 a, g dbSNP:756353413
267 267 c, t dbSNP:373020952
268 268 a, g dbSNP:749406635
274 274 c, t dbSNP:121918399
275 275 a, g dbSNP:371694216
276 276 c, t dbSNP:746975744
279 279 a, g dbSNP:768684471
282 282 a, g dbSNP:758606895
284 284 c, t dbSNP:769452
285 285 a, g dbSNP:761381769
291 291 c, g dbSNP:751675227
295 295 c, g, t dbSNP:11542029
296 296 a, c, g, t dbSNP:762461580
297 297 c, t dbSNP:11542031
312 312 c, g dbSNP:376607258
314 314 a, g dbSNP:752790054
325 325 a, g dbSNP:28931576
327 327 a, g dbSNP:11542038
330 330 g, t dbSNP:200125743
339 339 a, c, g dbSNP:370594287
346 346 a, g dbSNP:780035531
352 352 c, t dbSNP:139948786
353 353 c, t dbSNP:768780599
357 357 c, t dbSNP:781192562
361 361 c, t dbSNP:757100480
367 367 g, t dbSNP:747975000
368 368 c, t dbSNP:769366285
369 369 a, c dbSNP:772554321
374 374 a, g dbSNP:762703669
376 376 a, g dbSNP:770545391
386 386 a, c dbSNP:774000134
387 387 a, g dbSNP:759134820
393 393 g, t dbSNP:557845700
396 396 c, t dbSNP:767980905
413 413 c, t dbSNP:368210726
425 425 a, c dbSNP:761285934
426 426 a, g dbSNP:371331933
428 428 a, c dbSNP:776830091
429 429 c, g dbSNP:761988169
438 438 -, g dbSNP:527236160
443 443 a, g dbSNP:577618688
447 447 a, g dbSNP:267605543
451 451 a, c dbSNP:11542040
452 452 a, c, g, t dbSNP:11083750
453 453 a, g dbSNP:368495194
457 457 a, g dbSNP:767382895
459 459 a, g dbSNP:752409518
465 465 a, g dbSNP:756130353
468 468 a, g dbSNP:777571029
470 470 a, g dbSNP:749160976
473 473 -, a dbSNP:761350032
475 475 a, c dbSNP:756776560
476 476 a, g dbSNP:778348297
482 482 a, c dbSNP:745552623
483 483 a, c dbSNP:11542033
484 484 a, g dbSNP:771594795
492 492 a, g dbSNP:141549454
496 496 a, g dbSNP:28931577
497 497 c, t dbSNP:372938213
501 501 g, t dbSNP:768998148
503 503 a, c dbSNP:777291619
508 508 a, c, t dbSNP:11542037
511 511 a, c dbSNP:587778876
513 513 g, t dbSNP:765437285
528 528 a, g dbSNP:773391883
529 529 a, g dbSNP:763313394
531 531 c, t dbSNP:766493265
532 532 a, g dbSNP:752600356
535 535 c, t dbSNP:429358
541 541 a, c, t dbSNP:11542041
551 551 a, g dbSNP:753798476
552 552 a, g dbSNP:757148922
556 556 c, t dbSNP:573658040
557 557 a, g dbSNP:11542035
559 559 a, g dbSNP:543363163
563 563 a, t dbSNP:41382345
564 564 a, g dbSNP:758127435
565 565 a, g, t dbSNP:779569800
573 573 a, c dbSNP:11542039
574 574 a, c, t dbSNP:768925016
580 580 a, g dbSNP:748703149
581 581 a, g dbSNP:267606664
582 582 -, gaggtgcaggccatgctcggc dbSNP:397514254
591 591 c, g dbSNP:773479792
594 594 c, g dbSNP:762933906
596 596 a, g dbSNP:11542034
598 598 a, c dbSNP:587778877
600 600 c, g dbSNP:563140413
601 601 c, t dbSNP:531939919
602 602 a, c, g dbSNP:28931578
607 607 a, c, t dbSNP:121918393
608 608 c, g dbSNP:200703101
609 609 c, t dbSNP:753601274
625 625 c, t dbSNP:387906567
627 627 a, c dbSNP:761790162
634 634 c, t dbSNP:769455
635 635 a, c, g dbSNP:121918397
637 637 a, c, g dbSNP:121918394
643 643 -, ctc dbSNP:746494694
647 647 -, tcc dbSNP:515726148
650 650 a, g dbSNP:376170967
655 655 c, g dbSNP:267606662
663 663 a, c dbSNP:757859088
673 673 c, t dbSNP:7412
685 685 c, t dbSNP:751200677
690 690 g, t dbSNP:754627330
702 702 c, t dbSNP:781722239
712 712 a, g dbSNP:11542032
726 726 c, g dbSNP:748506927
733 733 c, t dbSNP:770485817
734 734 a, g dbSNP:778425259
761 761 a, g dbSNP:11542030
766 766 c, t dbSNP:749750245
769 769 c, g dbSNP:770942678
774 774 a, g dbSNP:774452222
787 787 a, g dbSNP:759721023
791 791 c, t dbSNP:11542027
798 798 c, t dbSNP:72654468
820 820 a, g dbSNP:547472686
830 830 a, g dbSNP:121918396
835 835 a, g dbSNP:567353589
844 844 c, g dbSNP:554251788
850 850 c, t dbSNP:530010303
864 864 a, g dbSNP:761592007
871 871 c, g dbSNP:387906568
872 872 a, c, g dbSNP:267606663
883 883 c, t dbSNP:121918395
892 892 c, g dbSNP:762906934
893 893 a, g dbSNP:765845034
894 894 a, g dbSNP:771354248
908 908 a, t dbSNP:199768005
911 911 c, t dbSNP:780984110
912 912 a, g dbSNP:752327439
920 920 a, g dbSNP:756564996
922 922 c, g dbSNP:778237451
931 931 a, g dbSNP:140808909
933 933 a, g dbSNP:569017773
934 934 a, g dbSNP:190853081
947 947 a, g dbSNP:745950059
950 950 -, a dbSNP:773268787
952 952 c, g, t dbSNP:267606661
957 957 a, g dbSNP:747184737
968 968 c, g dbSNP:551256627
973 973 c, t dbSNP:371110159
979 979 c, t dbSNP:762845923
980 980 -, cc dbSNP:760500094
980 980 a, g dbSNP:767339630
993 993 c, g dbSNP:778901516
998 998 a, g dbSNP:773797268
999 999 g, t dbSNP:759118026
1003 1003 a, c, t dbSNP:750138933
1006 1006 a, g dbSNP:755792921
1014 1014 c, t dbSNP:77903069
1022 1022 a, g dbSNP:121918398
1029 1029 g, t dbSNP:557715042
1030 1030 a, g dbSNP:754211171
1033 1033 a, g, t dbSNP:757764781
1041 1041 a, g dbSNP:746294588
1046 1046 a, g dbSNP:758487955
1047 1047 c, g dbSNP:780067631
1056 1056 a, t dbSNP:747272511
1058 1058 c, g dbSNP:539470710
1059 1059 c, t dbSNP:772936346
1060 1060 a, g dbSNP:749102800
1067 1067 c, t dbSNP:770562611
1074 1074 c, t dbSNP:774354369
1078 1078 c, g dbSNP:759501381
1087 1087 a, c dbSNP:28931579
1100 1100 -, a dbSNP:766248543
1100 1100 a, g dbSNP:775113061
1103 1103 c, t dbSNP:760456587
1104 1104 a, g dbSNP:763790607
1106 1106 c, t dbSNP:754223652
1114 1114 -, gca dbSNP:753523910
1114 1114 a, g dbSNP:757647161
1121 1121 c, g, t dbSNP:201463764
1126 1126 c, t dbSNP:374329439
1128 1128 a, c, t dbSNP:367866106
1133 1133 c, t dbSNP:780156942
1135 1135 a, g dbSNP:747076678
1138 1138 c, t dbSNP:755218314
1140 1140 -, tgcctcc dbSNP:755219928
1140 1140 a, g, t dbSNP:372055776
1142 1142 a, g dbSNP:770779481
1147 1147 c, g dbSNP:778534804
1193 1193 c, t dbSNP:553874843
1198 1198 c, t dbSNP:573693195
1200 1200 c, t dbSNP:747919742

Target ORF information:

RefSeq Version NM_001302690
Organism Homo sapiens (human)
Definition Homo sapiens apolipoprotein E (APOE), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27296
Accession Version NM_001302689.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 954bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 13-MAY-2015
Organism Homo sapiens (human)
Product apolipoprotein E isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB486513.1, HY074384.1, BC003557.1 and AL037046.3. Summary: The protein encoded by this gene is a major apoprotein of the chylomicron. It binds to a specific liver and peripheral cell receptor, and is essential for the normal catabolism of triglyceride-rich lipoprotein constituents. This gene maps to chromosome 19 in a cluster with the related apolipoprotein C1 and C2 genes. Mutations in this gene result in familial dysbetalipoproteinemia, or type III hyperlipoproteinemia (HLP III), in which increased plasma cholesterol and triglycerides are the consequence of impaired clearance of chylomicron and VLDL remnants. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]. Transcript Variant: This variant (3) contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 3, 4 and 5 all encode isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: DB486513.1, HY075493.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA1970526 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)285..812(+)
Misc Feature(2)357..944(+)
Misc Feature(3)474..476(+)
Misc Feature(4)486..488(+)
Misc Feature(5)519..551(+)
Misc Feature(6)531..542(+)
Misc Feature(7)732..755(+)
Exon (1)1..24
Gene Synonym:
Exon (2)25..90
Gene Synonym:
Exon (3)91..283
Gene Synonym:
Exon (4)284..1146
Gene Synonym:
Position Chain Variation Link
6 6 a, c dbSNP:877973
29 29 g, t dbSNP:755877232
34 34 -, t dbSNP:755136353
59 59 -, tgggc dbSNP:778989940
62 62 a, g dbSNP:777551553
67 67 c, t dbSNP:754318486
68 68 c, g dbSNP:373321868
73 73 c, t dbSNP:779278130
74 74 a, g dbSNP:746382742
78 78 a, g, t dbSNP:144354013
82 82 a, t dbSNP:747078681
87 87 a, g dbSNP:559532612
89 89 a, g dbSNP:768934589
90 90 g, t dbSNP:752693941
99 99 a, c, g dbSNP:533904656
102 102 a, g dbSNP:11542036
108 108 a, g dbSNP:121918392
110 110 a, g dbSNP:763720372
115 115 c, t dbSNP:776242156
116 116 a, g dbSNP:111833428
130 130 c, t dbSNP:764929617
131 131 a, g dbSNP:150688032
137 137 c, g dbSNP:370227413
138 138 a, g dbSNP:201672011
144 144 c, t dbSNP:752079771
155 155 c, g, t dbSNP:755434388
156 156 a, g dbSNP:142480126
163 163 a, g dbSNP:756353413
167 167 c, t dbSNP:373020952
168 168 a, g dbSNP:749406635
174 174 c, t dbSNP:121918399
175 175 a, g dbSNP:371694216
176 176 c, t dbSNP:746975744
179 179 a, g dbSNP:768684471
182 182 a, g dbSNP:758606895
184 184 c, t dbSNP:769452
185 185 a, g dbSNP:761381769
191 191 c, g dbSNP:751675227
195 195 c, g, t dbSNP:11542029
196 196 a, c, g, t dbSNP:762461580
197 197 c, t dbSNP:11542031
212 212 c, g dbSNP:376607258
214 214 a, g dbSNP:752790054
225 225 a, g dbSNP:28931576
227 227 a, g dbSNP:11542038
230 230 g, t dbSNP:200125743
239 239 a, c, g dbSNP:370594287
246 246 a, g dbSNP:780035531
252 252 c, t dbSNP:139948786
253 253 c, t dbSNP:768780599
257 257 c, t dbSNP:781192562
261 261 c, t dbSNP:757100480
267 267 g, t dbSNP:747975000
268 268 c, t dbSNP:769366285
269 269 a, c dbSNP:772554321
274 274 a, g dbSNP:762703669
276 276 a, g dbSNP:770545391
286 286 a, c dbSNP:774000134
287 287 a, g dbSNP:759134820
293 293 g, t dbSNP:557845700
296 296 c, t dbSNP:767980905
313 313 c, t dbSNP:368210726
325 325 a, c dbSNP:761285934
326 326 a, g dbSNP:371331933
328 328 a, c dbSNP:776830091
329 329 c, g dbSNP:761988169
338 338 -, g dbSNP:527236160
343 343 a, g dbSNP:577618688
347 347 a, g dbSNP:267605543
351 351 a, c dbSNP:11542040
352 352 a, c, g, t dbSNP:11083750
353 353 a, g dbSNP:368495194
357 357 a, g dbSNP:767382895
359 359 a, g dbSNP:752409518
365 365 a, g dbSNP:756130353
368 368 a, g dbSNP:777571029
370 370 a, g dbSNP:749160976
373 373 -, a dbSNP:761350032
375 375 a, c dbSNP:756776560
376 376 a, g dbSNP:778348297
382 382 a, c dbSNP:745552623
383 383 a, c dbSNP:11542033
384 384 a, g dbSNP:771594795
392 392 a, g dbSNP:141549454
396 396 a, g dbSNP:28931577
397 397 c, t dbSNP:372938213
401 401 g, t dbSNP:768998148
403 403 a, c dbSNP:777291619
408 408 a, c, t dbSNP:11542037
411 411 a, c dbSNP:587778876
413 413 g, t dbSNP:765437285
428 428 a, g dbSNP:773391883
429 429 a, g dbSNP:763313394
431 431 c, t dbSNP:766493265
432 432 a, g dbSNP:752600356
435 435 c, t dbSNP:429358
441 441 a, c, t dbSNP:11542041
451 451 a, g dbSNP:753798476
452 452 a, g dbSNP:757148922
456 456 c, t dbSNP:573658040
457 457 a, g dbSNP:11542035
459 459 a, g dbSNP:543363163
463 463 a, t dbSNP:41382345
464 464 a, g dbSNP:758127435
465 465 a, g, t dbSNP:779569800
473 473 a, c dbSNP:11542039
474 474 a, c, t dbSNP:768925016
480 480 a, g dbSNP:748703149
481 481 a, g dbSNP:267606664
482 482 -, gaggtgcaggccatgctcggc dbSNP:397514254
491 491 c, g dbSNP:773479792
494 494 c, g dbSNP:762933906
496 496 a, g dbSNP:11542034
498 498 a, c dbSNP:587778877
500 500 c, g dbSNP:563140413
501 501 c, t dbSNP:531939919
502 502 a, c, g dbSNP:28931578
507 507 a, c, t dbSNP:121918393
508 508 c, g dbSNP:200703101
509 509 c, t dbSNP:753601274
525 525 c, t dbSNP:387906567
527 527 a, c dbSNP:761790162
534 534 c, t dbSNP:769455
535 535 a, c, g dbSNP:121918397
537 537 a, c, g dbSNP:121918394
543 543 -, ctc dbSNP:746494694
547 547 -, tcc dbSNP:515726148
550 550 a, g dbSNP:376170967
555 555 c, g dbSNP:267606662
563 563 a, c dbSNP:757859088
573 573 c, t dbSNP:7412
585 585 c, t dbSNP:751200677
590 590 g, t dbSNP:754627330
602 602 c, t dbSNP:781722239
612 612 a, g dbSNP:11542032
626 626 c, g dbSNP:748506927
633 633 c, t dbSNP:770485817
634 634 a, g dbSNP:778425259
661 661 a, g dbSNP:11542030
666 666 c, t dbSNP:749750245
669 669 c, g dbSNP:770942678
674 674 a, g dbSNP:774452222
687 687 a, g dbSNP:759721023
691 691 c, t dbSNP:11542027
698 698 c, t dbSNP:72654468
720 720 a, g dbSNP:547472686
730 730 a, g dbSNP:121918396
735 735 a, g dbSNP:567353589
744 744 c, g dbSNP:554251788
750 750 c, t dbSNP:530010303
764 764 a, g dbSNP:761592007
771 771 c, g dbSNP:387906568
772 772 a, c, g dbSNP:267606663
783 783 c, t dbSNP:121918395
792 792 c, g dbSNP:762906934
793 793 a, g dbSNP:765845034
794 794 a, g dbSNP:771354248
808 808 a, t dbSNP:199768005
811 811 c, t dbSNP:780984110
812 812 a, g dbSNP:752327439
820 820 a, g dbSNP:756564996
822 822 c, g dbSNP:778237451
831 831 a, g dbSNP:140808909
833 833 a, g dbSNP:569017773
834 834 a, g dbSNP:190853081
847 847 a, g dbSNP:745950059
850 850 -, a dbSNP:773268787
852 852 c, g, t dbSNP:267606661
857 857 a, g dbSNP:747184737
868 868 c, g dbSNP:551256627
873 873 c, t dbSNP:371110159
879 879 c, t dbSNP:762845923
880 880 -, cc dbSNP:760500094
880 880 a, g dbSNP:767339630
893 893 c, g dbSNP:778901516
898 898 a, g dbSNP:773797268
899 899 g, t dbSNP:759118026
903 903 a, c, t dbSNP:750138933
906 906 a, g dbSNP:755792921
914 914 c, t dbSNP:77903069
922 922 a, g dbSNP:121918398
929 929 g, t dbSNP:557715042
930 930 a, g dbSNP:754211171
933 933 a, g, t dbSNP:757764781
941 941 a, g dbSNP:746294588
946 946 a, g dbSNP:758487955
947 947 c, g dbSNP:780067631
956 956 a, t dbSNP:747272511
958 958 c, g dbSNP:539470710
959 959 c, t dbSNP:772936346
960 960 a, g dbSNP:749102800
967 967 c, t dbSNP:770562611
974 974 c, t dbSNP:774354369
978 978 c, g dbSNP:759501381
987 987 a, c dbSNP:28931579
1000 1000 -, a dbSNP:766248543
1000 1000 a, g dbSNP:775113061
1003 1003 c, t dbSNP:760456587
1004 1004 a, g dbSNP:763790607
1006 1006 c, t dbSNP:754223652
1014 1014 -, gca dbSNP:753523910
1014 1014 a, g dbSNP:757647161
1021 1021 c, g, t dbSNP:201463764
1026 1026 c, t dbSNP:374329439
1028 1028 a, c, t dbSNP:367866106
1033 1033 c, t dbSNP:780156942
1035 1035 a, g dbSNP:747076678
1038 1038 c, t dbSNP:755218314
1040 1040 -, tgcctcc dbSNP:755219928
1040 1040 a, g, t dbSNP:372055776
1042 1042 a, g dbSNP:770779481
1047 1047 c, g dbSNP:778534804
1093 1093 c, t dbSNP:553874843
1098 1098 c, t dbSNP:573693195
1100 1100 c, t dbSNP:747919742

Target ORF information:

RefSeq Version NM_001302689
Organism Homo sapiens (human)
Definition Homo sapiens apolipoprotein E (APOE), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
