Email to GenScript

IGF2 insulin-like growth factor 2 [Homo sapiens (human)]

Gene Symbol IGF2
Entrez Gene ID 3481
Full Name insulin-like growth factor 2
Synonyms C11orf43, GRDF, IGF-II, PP9974
General protein information
Preferred Names
insulin-like growth factor II
insulin-like growth factor II
insulin-like growth factor type 2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. lac of sum
Disorder MIM:


Disorder Html: Intrauterine and postnatal growth retardation (1)

The following IGF2 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the IGF2 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu28274 NM_001007139 Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu28274 NM_001291862 Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu28283 NM_001127598 Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $269
OHu28274 NM_000612 Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu28274 NM_001291861 Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu28274
Accession Version NM_001007139.5 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 543bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 31-JUL-2015
Organism Homo sapiens (human)
Product insulin-like growth factor II isoform 1 preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DQ104203.1, AC132217.15, X00910.1, AK025719.1, BC073756.1 and BQ014465.1. This sequence is a reference standard in the RefSeqGene project. On Aug 19, 2014 this sequence version replaced gi:183603938. Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. Transcript Variant: This variant (2) contains two alternate 5' non-coding exons, therefore, has a different 5' UTR compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: X00910.1, DQ104203.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA2162895 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 8385745 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)625..627(+)
Misc Feature(2)799..882(+)
Misc Feature(3)808..999(+)
Misc Feature(4)814..879(+)
Misc Feature(5)868..927(+)
Misc Feature(6)883..918(+)
Misc Feature(7)919..981(+)
Misc Feature(8)940..963(+)
Misc Feature(9)982..999(+)
Misc Feature(10)1060..1224(+)
Exon (1)1..478
Gene Synonym:
Exon (2)479..720
Gene Synonym:
Exon (3)721..883
Gene Synonym:
Exon (4)884..1032
Gene Synonym:
Exon (5)1033..5144
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:780688053
55 55 a, g dbSNP:534360218
56 56 a, g dbSNP:17883917
60 60 c, t dbSNP:563216765
61 61 a, g dbSNP:10743144
67 67 a, g dbSNP:561576478
88 88 c, g dbSNP:371728365
96 96 a, g dbSNP:767130295
101 101 a, g dbSNP:191126731
113 113 c, t dbSNP:779508024
149 149 c, t dbSNP:569231351
164 164 c, t dbSNP:114231071
176 176 c, t dbSNP:757648139
186 186 c, t dbSNP:529332022
197 197 c, g dbSNP:754236449
215 215 c, t dbSNP:772213511
216 216 c, t dbSNP:748524132
217 217 a, g dbSNP:774764219
218 218 c, t dbSNP:185576219
230 230 a, c dbSNP:749768732
240 240 a, g dbSNP:780612983
247 247 g, t dbSNP:756847403
248 248 c, t dbSNP:746456405
249 249 a, c, g dbSNP:758114081
257 257 a, t dbSNP:752505805
260 260 c, t dbSNP:765050882
265 265 c, g dbSNP:754921584
286 286 c, g dbSNP:200726543
287 287 a, g dbSNP:528231513
292 292 c, t dbSNP:760747482
296 296 c, g dbSNP:773217225
302 302 a, g dbSNP:376568033
303 303 g, t dbSNP:762018876
304 304 g, t dbSNP:759261999
311 311 c, t dbSNP:774615572
312 312 a, g dbSNP:564130690
316 316 a, c dbSNP:200140862
318 318 g, t dbSNP:546077421
324 324 a, g dbSNP:368141284
325 325 a, c dbSNP:756776069
329 329 c, t dbSNP:770369334
331 331 -, c dbSNP:745902608
339 339 a, g dbSNP:746579029
361 361 a, c dbSNP:777421135
363 363 c, g dbSNP:372250811
365 365 c, t dbSNP:78341923
366 366 a, g dbSNP:147404873
368 368 c, t dbSNP:754834109
369 369 a, g dbSNP:753511563
371 371 a, g dbSNP:144727382
373 373 c, g dbSNP:373593473
374 374 a, g dbSNP:750567953
376 376 c, t dbSNP:574503594
377 377 a, g dbSNP:201265629
391 391 a, g dbSNP:202124833
392 392 a, g dbSNP:374063480
405 405 c, g dbSNP:573338304
415 415 a, t dbSNP:558114041
416 416 c, t dbSNP:770493905
418 418 c, t dbSNP:370845078
421 421 -, c dbSNP:781540899
421 421 c, t dbSNP:772898246
422 422 a, g dbSNP:751104689
433 433 c, t dbSNP:543179100
435 435 c, g, t dbSNP:778633421
437 437 c, g dbSNP:768134140
440 440 c, t dbSNP:749164348
441 441 c, t dbSNP:779818488
447 447 a, g dbSNP:756085221
451 451 c, t dbSNP:750333739
452 452 a, g dbSNP:781055305
460 460 c, t dbSNP:376704926
461 461 a, g dbSNP:751525483
462 462 c, g dbSNP:764438424
467 467 a, t dbSNP:763085402
470 470 a, g dbSNP:200860409
471 471 c, g dbSNP:753157105
475 475 a, c dbSNP:199684370
478 478 g, t dbSNP:759931220
484 484 a, g dbSNP:531475925
491 491 c, t dbSNP:781110309
497 497 c, t dbSNP:368865985
498 498 c, g dbSNP:368323611
502 502 c, t dbSNP:10770125
527 527 c, t dbSNP:542049186
528 528 c, t dbSNP:373622226
534 534 c, t dbSNP:752989920
540 540 a, g dbSNP:765516077
550 550 c, t dbSNP:755400457
551 551 a, g dbSNP:754199654
570 570 a, g dbSNP:766966005
598 598 a, c dbSNP:369566517
609 609 a, g dbSNP:773951027
621 621 g, t dbSNP:771064056
626 626 a, g dbSNP:145087135
644 644 c, g dbSNP:762472654
652 652 a, g dbSNP:375522759
672 672 c, t dbSNP:769367976
709 709 c, t dbSNP:374993400
722 722 c, t dbSNP:768906240
724 724 c, t dbSNP:201281696
725 725 c, g dbSNP:780431646
726 726 a, t dbSNP:756627422
731 731 a, g, t dbSNP:781634507
740 740 g, t dbSNP:757907236
743 743 g, t dbSNP:752191866
746 746 a, c dbSNP:764865819
747 747 g, t dbSNP:146334276
750 750 a, g dbSNP:374362537
756 756 a, c, g dbSNP:760509523
766 766 a, g dbSNP:781483443
768 768 c, t dbSNP:773291559
769 769 c, t dbSNP:767507381
780 780 c, t dbSNP:762038895
785 785 c, g, t dbSNP:142012621
786 786 a, g dbSNP:200510687
790 790 c, t dbSNP:112276039
820 820 c, t dbSNP:202212014
825 825 c, t dbSNP:553443857
828 828 c, t dbSNP:775525616
831 831 a, g dbSNP:546567293
837 837 c, g dbSNP:768579799
840 840 a, g dbSNP:770173678
855 855 c, t dbSNP:140032633
856 856 a, g dbSNP:747135996
858 858 c, t dbSNP:757757921
864 864 g, t dbSNP:747697618
869 869 g, t dbSNP:778465733
870 870 c, t dbSNP:754399358
879 879 c, t dbSNP:753561980
891 891 c, t dbSNP:199968864
899 899 a, g dbSNP:761163170
908 908 a, g dbSNP:773449505
911 911 a, g dbSNP:768105151
916 916 c, t dbSNP:762200142
917 917 a, g dbSNP:369844466
920 920 a, g dbSNP:150610908
921 921 c, t dbSNP:774947322
924 924 c, t dbSNP:377034431
944 944 a, g dbSNP:745308728
960 960 c, g dbSNP:1803647
966 966 a, g dbSNP:148165917
971 971 c, t dbSNP:746888392
972 972 a, g dbSNP:777408420
982 982 a, c dbSNP:758164144
983 983 c, t dbSNP:748117121
985 985 a, c, g dbSNP:755066389
988 988 c, g dbSNP:753904854
996 996 c, t dbSNP:373036890
999 999 a, g dbSNP:756263625
1003 1003 a, g dbSNP:750845881
1005 1005 c, t dbSNP:767792397
1011 1011 a, g dbSNP:554586231
1014 1014 c, t dbSNP:202163388
1016 1016 c, t dbSNP:775000758
1019 1019 a, c, t dbSNP:143785521
1023 1023 c, t dbSNP:776276916
1029 1029 c, t dbSNP:770667067
1031 1031 c, t dbSNP:369122420
1032 1032 a, g dbSNP:536204564
1046 1046 g, t dbSNP:771744589
1047 1047 a, g dbSNP:761665707
1051 1051 a, c dbSNP:774104462
1053 1053 c, t dbSNP:750321513
1054 1054 a, g, t dbSNP:376878619
1055 1055 c, t dbSNP:769766130
1058 1058 g, t dbSNP:745901132
1086 1086 g, t dbSNP:14367
1099 1099 c, t dbSNP:781325329
1100 1100 a, g dbSNP:757547834
1107 1107 a, c, t dbSNP:1065443
1123 1123 c, t dbSNP:530101369
1133 1133 c, g dbSNP:778304668
1138 1138 c, t dbSNP:371682005
1142 1142 g, t dbSNP:369452652
1146 1146 c, t dbSNP:765719749
1147 1147 a, c, g dbSNP:375129654
1152 1152 c, t dbSNP:372036269
1153 1153 a, g dbSNP:200836416
1156 1156 a, c dbSNP:761436263
1164 1164 c, t dbSNP:773939360
1165 1165 a, c, g dbSNP:150866176
1167 1167 a, g dbSNP:139194127
1169 1169 a, c, t dbSNP:368814253
1170 1170 a, g dbSNP:781299823
1173 1173 c, t dbSNP:771327940
1174 1174 a, t dbSNP:760894162
1177 1177 a, g dbSNP:747266091
1180 1180 c, g dbSNP:778075715
1186 1186 c, t dbSNP:758849172
1187 1187 a, c, g dbSNP:146962483
1193 1193 a, g dbSNP:61732764
1195 1195 c, t dbSNP:755482890
1198 1198 -, c dbSNP:748459239
1198 1198 c, t dbSNP:749953596
1200 1200 a, g dbSNP:767032426
1206 1206 c, t dbSNP:756720073
1215 1215 c, t dbSNP:199646294
1221 1221 c, g dbSNP:763681027
1224 1224 c, g, t dbSNP:767815580
1225 1225 a, g, t dbSNP:377316111
1230 1230 c, t dbSNP:200036157
1231 1231 a, g, t dbSNP:554804044
1234 1234 a, g dbSNP:771138084
1235 1235 a, g dbSNP:747026832
1236 1236 c, t dbSNP:138399775
1238 1238 c, t dbSNP:773624887
1243 1243 c, g, t dbSNP:11545014
1244 1244 -, c dbSNP:755455183
1244 1244 a, c, g dbSNP:1050342
1248 1248 c, g dbSNP:749836523
1262 1262 a, g dbSNP:565575035
1266 1266 g, t dbSNP:12993
1275 1275 a, c dbSNP:756776702
1280 1280 c, t dbSNP:751058590
1282 1282 c, t dbSNP:763805360
1283 1283 a, g dbSNP:9282726
1295 1295 c, g, t dbSNP:3741214
1296 1296 a, g dbSNP:759186937
1298 1298 c, t dbSNP:2230949
1299 1299 a, g dbSNP:200131466
1310 1310 a, g dbSNP:760902159
1320 1320 c, t dbSNP:773392012
1329 1329 a, g dbSNP:3213234
1354 1354 a, g dbSNP:538267300
1365 1365 a, g dbSNP:763531701
1372 1372 c, t dbSNP:570973772
1378 1378 a, c dbSNP:376978352
1379 1379 -, c dbSNP:34337549
1397 1397 -, c dbSNP:771725807
1405 1405 a, g dbSNP:549471313
1438 1438 c, t dbSNP:537604316
1449 1449 a, g dbSNP:6223
1452 1452 a, g dbSNP:570199935
1463 1463 -, g dbSNP:747707965
1471 1471 a, g dbSNP:745965335
1476 1476 a, t dbSNP:11510
1482 1482 c, t dbSNP:774620139
1484 1484 c, t dbSNP:548852860
1508 1508 a, c dbSNP:1803648
1563 1563 a, g dbSNP:530360490
1571 1571 a, c, t dbSNP:562128978
1591 1591 -, ac dbSNP:11564731
1595 1595 a, c dbSNP:559762706
1596 1596 c, t dbSNP:547785690
1597 1597 -, cc dbSNP:199644459
1597 1597 -, c dbSNP:780035316
1597 1597 c, t dbSNP:200385877
1598 1598 a, c dbSNP:778189789
1620 1620 a, c dbSNP:532566359
1630 1630 c, t dbSNP:565338594
1703 1703 a, t dbSNP:543940445
1709 1709 -, a dbSNP:771147163
1719 1719 -, a dbSNP:749164758
1721 1721 a, g dbSNP:372089802
1775 1775 c, g dbSNP:74050125
1783 1783 c, t dbSNP:15737
1788 1788 c, g dbSNP:542883456
1852 1852 a, c, g dbSNP:680
1875 1875 c, t dbSNP:74050124
1876 1876 a, g dbSNP:538203994
1882 1882 c, g dbSNP:1065685
1887 1887 c, t dbSNP:190844832
1889 1889 c, t dbSNP:779715960
1903 1903 a, g dbSNP:546968081
1904 1904 c, t dbSNP:749914198
1917 1917 a, g dbSNP:778435747
1933 1933 a, c, g dbSNP:137976914
1956 1956 g, t dbSNP:146936885
1999 1999 a, c dbSNP:187623619
2002 2002 c, g dbSNP:142713948
2006 2006 c, t dbSNP:775043119
2007 2007 c, t dbSNP:753731732
2009 2009 a, g dbSNP:763881915
2012 2012 a, g dbSNP:760416231
2047 2047 a, g dbSNP:752913287
2057 2057 c, t dbSNP:553780601
2062 2062 a, c, g dbSNP:541387272
2078 2078 a, g dbSNP:759873867
2079 2079 a, t dbSNP:566342533
2086 2086 c, t dbSNP:774565080
2144 2144 c, t dbSNP:548119140
2155 2155 a, g dbSNP:532504917
2175 2175 a, g dbSNP:56731553
2178 2178 c, t dbSNP:773884586
2181 2181 a, g dbSNP:56154171
2187 2187 -, ca dbSNP:372409298
2199 2199 -, acagcacacacacgagcat, at dbSNP:59198946
2200 2200 -, ta dbSNP:113750887
2213 2213 -, aaacgcacagcacacacagcacacagat dbSNP:538900531
2213 2213 aaacgc, gagcat dbSNP:386749759
2213 2213 a, g dbSNP:61872709
2214 2214 a, g dbSNP:112372828
2215 2215 -, ac dbSNP:558774932
2215 2215 a, g dbSNP:61872708
2216 2216 c, t dbSNP:113064670
2217 2217 a, g dbSNP:78158653
2218 2218 c, t dbSNP:80242682
2226 2226 -, cacacaaacg dbSNP:376418013
2246 2246 c, t dbSNP:201857559
2264 2264 a, g dbSNP:184016711
2272 2272 -, cacacacg dbSNP:374501941
2279 2279 -, gcacacac dbSNP:760137562
2280 2280 -, ca dbSNP:375635884
2283 2283 a, g dbSNP:371884035
2286 2286 -, ca dbSNP:766905011
2307 2307 c, t dbSNP:561453232
2308 2308 g, t dbSNP:542421321
2321 2321 -, ac dbSNP:760986052
2323 2323 a, g dbSNP:185336081
2332 2332 c, t dbSNP:61872707
2338 2338 c, t dbSNP:61872706
2345 2345 -, cacacacaaacgcacag dbSNP:374335327
2350 2350 a, g dbSNP:11042774
2351 2351 -, ca dbSNP:763795580
2371 2371 a, g dbSNP:544949131
2373 2373 a, g dbSNP:199625419
2379 2379 -, ca dbSNP:745570290
2403 2403 -, ac dbSNP:200421505
2410 2410 c, t dbSNP:111218600
2423 2423 c, t dbSNP:577208678
2434 2434 c, t dbSNP:201271948
2435 2435 a, g dbSNP:111164747
2455 2455 -, caca dbSNP:59630895
2460 2460 -, acac dbSNP:141005898
2480 2480 -, caca dbSNP:552914810
2484 2484 a, c dbSNP:193063121
2490 2490 -, ca dbSNP:745754092
2519 2519 a, g dbSNP:375588366
2521 2521 a, g dbSNP:7111331
2547 2547 a, g dbSNP:573628608
2561 2561 a, c dbSNP:11042767
2563 2563 -, ca dbSNP:776461028
2565 2565 a, c dbSNP:188024661
2566 2566 -, ga dbSNP:202059019
2569 2569 -, ca dbSNP:770911134
2578 2578 -, ca dbSNP:141204597
2593 2593 c, t dbSNP:7129583
2595 2595 a, c dbSNP:28462050
2601 2601 -, ca dbSNP:200119028
2603 2603 a, g dbSNP:538118798
2610 2610 -, ca dbSNP:755229164
2615 2615 a, g dbSNP:566280780
2628 2628 -, ca dbSNP:369407323
2628 2628 a, c dbSNP:554505888
2633 2633 a, g dbSNP:28472590
2644 2644 -, ca dbSNP:58312807
2654 2654 a, g dbSNP:372916351
2656 2656 a, g dbSNP:571653867
2687 2687 -, ca dbSNP:60649995
2687 2687 -, ca dbSNP:398114950
2689 2689 a, c dbSNP:199699118
2695 2695 -, ca dbSNP:142373942
2705 2705 -, at dbSNP:200933432
2714 2714 -, ca dbSNP:200018341
2717 2717 -, caca dbSNP:374582945
2719 2719 c, t dbSNP:549876988
2722 2722 -, acac dbSNP:201879085
2731 2731 a, c, t dbSNP:58562468
2757 2757 -, ca dbSNP:762205555
2757 2757 c, t dbSNP:567611973
2795 2795 a, g dbSNP:143209706
2810 2810 c, t dbSNP:527480230
2815 2815 -, ca dbSNP:200159614
2818 2818 c, t dbSNP:559955724
2819 2819 a, g dbSNP:544886527
2829 2829 a, g dbSNP:374392622
2834 2834 a, c dbSNP:533083978
2842 2842 a, c dbSNP:79531557
2847 2847 a, g dbSNP:1065687
2895 2895 a, c dbSNP:3208122
2909 2909 a, g dbSNP:117486875
2923 2923 -, ac dbSNP:762624032
2934 2934 g, t dbSNP:555123166
2945 2945 c, g dbSNP:3168310
2973 2973 a, g dbSNP:778335820
2986 2986 c, t dbSNP:572669571
3019 3019 c, t dbSNP:554442693
3036 3036 c, t dbSNP:529166030
3058 3058 a, g dbSNP:770810653
3068 3068 c, t dbSNP:149099319
3080 3080 c, g dbSNP:561607562
3081 3081 a, t dbSNP:746965737
3116 3116 c, t dbSNP:556823779
3141 3141 a, g dbSNP:537801892
3147 3147 c, t dbSNP:567696295
3151 3151 -, a dbSNP:58527086
3160 3160 a, g dbSNP:181654351
3165 3165 a, g dbSNP:369965474
3184 3184 a, g dbSNP:566307265
3200 3200 c, t dbSNP:749731671
3219 3219 c, t dbSNP:59196953
3227 3227 c, g, t dbSNP:79275529
3351 3351 c, t dbSNP:562601781
3380 3380 a, g dbSNP:57156844
3434 3434 c, t dbSNP:3802971
3523 3523 a, g dbSNP:112863993
3594 3594 c, t dbSNP:540317644
3619 3619 a, g dbSNP:573004818
3645 3645 g, t dbSNP:117403190
3657 3657 -, ttttttttttt dbSNP:770477972
3664 3664 g, t dbSNP:545576517
3667 3667 g, t dbSNP:3180700
3668 3668 -, g dbSNP:370546130
3668 3668 g, t dbSNP:72851054
3673 3673 -, c dbSNP:143773245
3689 3689 a, t dbSNP:578217783
3698 3698 c, t dbSNP:556573980
3717 3717 -, cc dbSNP:57423851
3717 3717 -, a dbSNP:148117489
3717 3717 a, c, t dbSNP:113798050
3722 3722 a, c dbSNP:538570399
3723 3723 a, c dbSNP:573936129
3725 3725 c, g dbSNP:555759341
3727 3727 -, c dbSNP:368927765
3736 3736 a, g dbSNP:543215705
3760 3760 c, t dbSNP:375769044
3761 3761 a, g dbSNP:566593592
3769 3769 a, c dbSNP:749385462
3774 3774 a, c dbSNP:35818489
3820 3820 a, g dbSNP:551471446
3832 3832 -, c dbSNP:774865092
3851 3851 g, t dbSNP:759815269
3856 3856 a, g dbSNP:751847850
3857 3857 a, g dbSNP:531894998
3876 3876 c, g dbSNP:539200153
3914 3914 a, t dbSNP:569080826
3985 3985 c, t dbSNP:550594230
3990 3990 c, g dbSNP:529224313
4023 4023 a, g dbSNP:561506861
4074 4074 c, t dbSNP:766504615
4091 4091 a, g dbSNP:11825733
4136 4136 c, t dbSNP:528099798
4137 4137 g, t dbSNP:780201972
4144 4144 a, g dbSNP:150340979
4153 4153 a, g dbSNP:11541377
4159 4159 a, c dbSNP:545964592
4162 4162 c, g dbSNP:11541375
4178 4178 a, g dbSNP:770180341
4189 4189 a, g dbSNP:186411823
4200 4200 c, t dbSNP:11541373
4215 4215 a, g dbSNP:11541372
4285 4285 c, t dbSNP:578101955
4286 4286 a, g dbSNP:762424041
4301 4301 c, g dbSNP:563130821
4307 4307 g, t dbSNP:11541374
4348 4348 c, t dbSNP:544555994
4359 4359 a, g dbSNP:140620676
4390 4390 c, t dbSNP:750573966
4394 4394 a, g dbSNP:181296097
4405 4405 c, t dbSNP:781563957
4406 4406 a, g dbSNP:533893575
4417 4417 a, g dbSNP:572906158
4438 4438 a, g, t dbSNP:557827054
4460 4460 a, c dbSNP:3189464
4464 4464 a, c dbSNP:539585468
4467 4467 c, g dbSNP:568944971
4473 4473 c, t dbSNP:557151721
4474 4474 a, g dbSNP:189306072
4480 4480 c, t dbSNP:535313871
4481 4481 a, g dbSNP:568313093
4539 4539 a, c dbSNP:546917658
4547 4547 a, g dbSNP:367940335
4557 4557 a, g dbSNP:567572190
4560 4560 c, t dbSNP:570499894
4579 4579 c, t dbSNP:774024295
4584 4584 a, g dbSNP:552284844
4590 4590 c, t dbSNP:61745040
4591 4591 a, g dbSNP:11564732
4593 4593 c, t dbSNP:182285016
4610 4610 c, g dbSNP:11541376
4611 4611 a, g dbSNP:531452151
4628 4628 c, t dbSNP:779085863
4647 4647 a, t dbSNP:748150937
4683 4683 c, t dbSNP:528838501
4684 4684 a, g dbSNP:560032834
4685 4685 c, t dbSNP:562000081
4706 4706 c, t dbSNP:540571205
4707 4707 c, t dbSNP:572893695
4709 4709 c, g dbSNP:557767594
4719 4719 a, g dbSNP:754829205
4753 4753 c, t dbSNP:545962158
4754 4754 a, g dbSNP:575667124
4784 4784 c, t dbSNP:557192404
4785 4785 a, g dbSNP:535588189
4788 4788 c, t dbSNP:568306674
4789 4789 a, g dbSNP:7873
4798 4798 c, t dbSNP:753848645
4799 4799 a, g dbSNP:61745039
4811 4811 g, t dbSNP:570440401
4828 4828 c, t dbSNP:552174742
4838 4838 a, c dbSNP:530438878
4865 4865 c, t dbSNP:577941383
4866 4866 a, g dbSNP:777851365
4882 4882 c, t dbSNP:569692295
4902 4902 a, g dbSNP:547984204
4910 4910 a, t dbSNP:377720187
4911 4911 a, g dbSNP:143676947
4915 4915 c, t dbSNP:3177805
4927 4927 c, g dbSNP:1065715
4928 4928 c, g dbSNP:11541371
4930 4930 c, g dbSNP:561985938
4934 4934 c, t dbSNP:1049926
4949 4949 c, t dbSNP:3177946
4972 4972 c, t dbSNP:750441206
4996 4996 a, g dbSNP:765424512
5003 5003 a, g dbSNP:184965397
5008 5008 a, g dbSNP:374278108
5011 5011 c, t dbSNP:564464469
5013 5013 a, c dbSNP:1050035
5016 5016 a, t dbSNP:764594291
5024 5024 c, t dbSNP:557969372
5035 5035 c, t dbSNP:11541370
5037 5037 a, t dbSNP:776374257
5042 5042 a, g dbSNP:2585
5064 5064 c, t dbSNP:575634705
5065 5065 a, g dbSNP:549633109
5077 5077 c, t dbSNP:557421937
5080 5080 g, t dbSNP:564295484
5105 5105 c, t dbSNP:79148793
5107 5107 c, g dbSNP:1050141
5137 5137 a, t dbSNP:112372484

Target ORF information:

RefSeq Version NM_001007139
Organism Homo sapiens (human)
Definition Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28274
Accession Version NM_001291862.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 543bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 31-JUL-2015
Organism Homo sapiens (human)
Product insulin-like growth factor II isoform 1 preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC132217.15, CN277570.1, HM481220.1, S77035.1 and BQ014465.1. On Aug 19, 2014 this sequence version replaced gi:630044873. Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. Transcript Variant: This variant (5) differs in the 5' UTR exon, compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HM481220.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2153307, SAMEA962333 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 8385745 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)227..229(+)
Misc Feature(2)347..430(+)
Misc Feature(3)356..547(+)
Misc Feature(4)362..427(+)
Misc Feature(5)416..475(+)
Misc Feature(6)431..466(+)
Misc Feature(7)467..529(+)
Misc Feature(8)488..511(+)
Misc Feature(9)530..547(+)
Misc Feature(10)608..772(+)
Exon (1)1..268
Gene Synonym:
Exon (2)269..431
Gene Synonym:
Exon (3)432..580
Gene Synonym:
Exon (4)581..4692
Gene Synonym:
Position Chain Variation Link
4 4 c, t dbSNP:187259775
63 63 a, c dbSNP:574896585
81 81 a, c dbSNP:114780445
103 103 c, g dbSNP:182133033
113 113 c, t dbSNP:376456871
143 143 c, t dbSNP:759675653
146 146 a, g dbSNP:753905020
153 153 a, g dbSNP:766658545
157 157 c, t dbSNP:760012394
173 173 c, t dbSNP:760858115
190 190 c, t dbSNP:773618393
196 196 c, t dbSNP:772504548
208 208 c, t dbSNP:762040708
213 213 a, g, t dbSNP:768982587
220 220 c, g dbSNP:769679099
244 244 c, t dbSNP:542106497
246 246 a, c dbSNP:770745426
252 252 c, t dbSNP:746636459
257 257 a, t dbSNP:777252534
261 261 c, g dbSNP:772104464
265 265 c, t dbSNP:758219280
270 270 c, t dbSNP:768906240
272 272 c, t dbSNP:201281696
273 273 c, g dbSNP:780431646
274 274 a, t dbSNP:756627422
279 279 a, g, t dbSNP:781634507
288 288 g, t dbSNP:757907236
291 291 g, t dbSNP:752191866
294 294 a, c dbSNP:764865819
295 295 g, t dbSNP:146334276
298 298 a, g dbSNP:374362537
304 304 a, c, g dbSNP:760509523
314 314 a, g dbSNP:781483443
316 316 c, t dbSNP:773291559
317 317 c, t dbSNP:767507381
328 328 c, t dbSNP:762038895
333 333 c, g, t dbSNP:142012621
334 334 a, g dbSNP:200510687
338 338 c, t dbSNP:112276039
368 368 c, t dbSNP:202212014
373 373 c, t dbSNP:553443857
376 376 c, t dbSNP:775525616
379 379 a, g dbSNP:546567293
385 385 c, g dbSNP:768579799
388 388 a, g dbSNP:770173678
403 403 c, t dbSNP:140032633
404 404 a, g dbSNP:747135996
406 406 c, t dbSNP:757757921
412 412 g, t dbSNP:747697618
417 417 g, t dbSNP:778465733
418 418 c, t dbSNP:754399358
427 427 c, t dbSNP:753561980
439 439 c, t dbSNP:199968864
447 447 a, g dbSNP:761163170
456 456 a, g dbSNP:773449505
459 459 a, g dbSNP:768105151
464 464 c, t dbSNP:762200142
465 465 a, g dbSNP:369844466
468 468 a, g dbSNP:150610908
469 469 c, t dbSNP:774947322
472 472 c, t dbSNP:377034431
492 492 a, g dbSNP:745308728
508 508 c, g dbSNP:1803647
514 514 a, g dbSNP:148165917
519 519 c, t dbSNP:746888392
520 520 a, g dbSNP:777408420
530 530 a, c dbSNP:758164144
531 531 c, t dbSNP:748117121
533 533 a, c, g dbSNP:755066389
536 536 c, g dbSNP:753904854
544 544 c, t dbSNP:373036890
547 547 a, g dbSNP:756263625
551 551 a, g dbSNP:750845881
553 553 c, t dbSNP:767792397
559 559 a, g dbSNP:554586231
562 562 c, t dbSNP:202163388
564 564 c, t dbSNP:775000758
567 567 a, c, t dbSNP:143785521
571 571 c, t dbSNP:776276916
577 577 c, t dbSNP:770667067
579 579 c, t dbSNP:369122420
580 580 a, g dbSNP:536204564
594 594 g, t dbSNP:771744589
595 595 a, g dbSNP:761665707
599 599 a, c dbSNP:774104462
601 601 c, t dbSNP:750321513
602 602 a, g, t dbSNP:376878619
603 603 c, t dbSNP:769766130
606 606 g, t dbSNP:745901132
634 634 g, t dbSNP:14367
647 647 c, t dbSNP:781325329
648 648 a, g dbSNP:757547834
655 655 a, c, t dbSNP:1065443
671 671 c, t dbSNP:530101369
681 681 c, g dbSNP:778304668
686 686 c, t dbSNP:371682005
690 690 g, t dbSNP:369452652
694 694 c, t dbSNP:765719749
695 695 a, c, g dbSNP:375129654
700 700 c, t dbSNP:372036269
701 701 a, g dbSNP:200836416
704 704 a, c dbSNP:761436263
712 712 c, t dbSNP:773939360
713 713 a, c, g dbSNP:150866176
715 715 a, g dbSNP:139194127
717 717 a, c, t dbSNP:368814253
718 718 a, g dbSNP:781299823
721 721 c, t dbSNP:771327940
722 722 a, t dbSNP:760894162
725 725 a, g dbSNP:747266091
728 728 c, g dbSNP:778075715
734 734 c, t dbSNP:758849172
735 735 a, c, g dbSNP:146962483
741 741 a, g dbSNP:61732764
743 743 c, t dbSNP:755482890
746 746 -, c dbSNP:748459239
746 746 c, t dbSNP:749953596
748 748 a, g dbSNP:767032426
754 754 c, t dbSNP:756720073
763 763 c, t dbSNP:199646294
769 769 c, g dbSNP:763681027
772 772 c, g, t dbSNP:767815580
773 773 a, g, t dbSNP:377316111
778 778 c, t dbSNP:200036157
779 779 a, g, t dbSNP:554804044
782 782 a, g dbSNP:771138084
783 783 a, g dbSNP:747026832
784 784 c, t dbSNP:138399775
786 786 c, t dbSNP:773624887
791 791 c, g, t dbSNP:11545014
792 792 -, c dbSNP:755455183
792 792 a, c, g dbSNP:1050342
796 796 c, g dbSNP:749836523
810 810 a, g dbSNP:565575035
814 814 g, t dbSNP:12993
823 823 a, c dbSNP:756776702
828 828 c, t dbSNP:751058590
830 830 c, t dbSNP:763805360
831 831 a, g dbSNP:9282726
843 843 c, g, t dbSNP:3741214
844 844 a, g dbSNP:759186937
846 846 c, t dbSNP:2230949
847 847 a, g dbSNP:200131466
858 858 a, g dbSNP:760902159
868 868 c, t dbSNP:773392012
877 877 a, g dbSNP:3213234
902 902 a, g dbSNP:538267300
913 913 a, g dbSNP:763531701
920 920 c, t dbSNP:570973772
926 926 a, c dbSNP:376978352
927 927 -, c dbSNP:34337549
945 945 -, c dbSNP:771725807
953 953 a, g dbSNP:549471313
986 986 c, t dbSNP:537604316
997 997 a, g dbSNP:6223
1000 1000 a, g dbSNP:570199935
1011 1011 -, g dbSNP:747707965
1019 1019 a, g dbSNP:745965335
1024 1024 a, t dbSNP:11510
1030 1030 c, t dbSNP:774620139
1032 1032 c, t dbSNP:548852860
1056 1056 a, c dbSNP:1803648
1111 1111 a, g dbSNP:530360490
1119 1119 a, c, t dbSNP:562128978
1139 1139 -, ac dbSNP:11564731
1143 1143 a, c dbSNP:559762706
1144 1144 c, t dbSNP:547785690
1145 1145 -, cc dbSNP:199644459
1145 1145 -, c dbSNP:780035316
1145 1145 c, t dbSNP:200385877
1146 1146 a, c dbSNP:778189789
1168 1168 a, c dbSNP:532566359
1178 1178 c, t dbSNP:565338594
1251 1251 a, t dbSNP:543940445
1257 1257 -, a dbSNP:771147163
1267 1267 -, a dbSNP:749164758
1269 1269 a, g dbSNP:372089802
1323 1323 c, g dbSNP:74050125
1331 1331 c, t dbSNP:15737
1336 1336 c, g dbSNP:542883456
1400 1400 a, c, g dbSNP:680
1423 1423 c, t dbSNP:74050124
1424 1424 a, g dbSNP:538203994
1430 1430 c, g dbSNP:1065685
1435 1435 c, t dbSNP:190844832
1437 1437 c, t dbSNP:779715960
1451 1451 a, g dbSNP:546968081
1452 1452 c, t dbSNP:749914198
1465 1465 a, g dbSNP:778435747
1481 1481 a, c, g dbSNP:137976914
1504 1504 g, t dbSNP:146936885
1547 1547 a, c dbSNP:187623619
1550 1550 c, g dbSNP:142713948
1554 1554 c, t dbSNP:775043119
1555 1555 c, t dbSNP:753731732
1557 1557 a, g dbSNP:763881915
1560 1560 a, g dbSNP:760416231
1595 1595 a, g dbSNP:752913287
1605 1605 c, t dbSNP:553780601
1610 1610 a, c, g dbSNP:541387272
1626 1626 a, g dbSNP:759873867
1627 1627 a, t dbSNP:566342533
1634 1634 c, t dbSNP:774565080
1692 1692 c, t dbSNP:548119140
1703 1703 a, g dbSNP:532504917
1723 1723 a, g dbSNP:56731553
1726 1726 c, t dbSNP:773884586
1729 1729 a, g dbSNP:56154171
1735 1735 -, ca dbSNP:372409298
1747 1747 -, acagcacacacacgagcat, at dbSNP:59198946
1748 1748 -, ta dbSNP:113750887
1761 1761 -, aaacgcacagcacacacagcacacagat dbSNP:538900531
1761 1761 aaacgc, gagcat dbSNP:386749759
1761 1761 a, g dbSNP:61872709
1762 1762 a, g dbSNP:112372828
1763 1763 -, ac dbSNP:558774932
1763 1763 a, g dbSNP:61872708
1764 1764 c, t dbSNP:113064670
1765 1765 a, g dbSNP:78158653
1766 1766 c, t dbSNP:80242682
1774 1774 -, cacacaaacg dbSNP:376418013
1794 1794 c, t dbSNP:201857559
1812 1812 a, g dbSNP:184016711
1820 1820 -, cacacacg dbSNP:374501941
1827 1827 -, gcacacac dbSNP:760137562
1828 1828 -, ca dbSNP:375635884
1831 1831 a, g dbSNP:371884035
1834 1834 -, ca dbSNP:766905011
1855 1855 c, t dbSNP:561453232
1856 1856 g, t dbSNP:542421321
1869 1869 -, ac dbSNP:760986052
1871 1871 a, g dbSNP:185336081
1880 1880 c, t dbSNP:61872707
1886 1886 c, t dbSNP:61872706
1893 1893 -, cacacacaaacgcacag dbSNP:374335327
1898 1898 a, g dbSNP:11042774
1899 1899 -, ca dbSNP:763795580
1919 1919 a, g dbSNP:544949131
1921 1921 a, g dbSNP:199625419
1927 1927 -, ca dbSNP:745570290
1951 1951 -, ac dbSNP:200421505
1958 1958 c, t dbSNP:111218600
1971 1971 c, t dbSNP:577208678
1982 1982 c, t dbSNP:201271948
1983 1983 a, g dbSNP:111164747
2003 2003 -, caca dbSNP:59630895
2008 2008 -, acac dbSNP:141005898
2028 2028 -, caca dbSNP:552914810
2032 2032 a, c dbSNP:193063121
2038 2038 -, ca dbSNP:745754092
2067 2067 a, g dbSNP:375588366
2069 2069 a, g dbSNP:7111331
2095 2095 a, g dbSNP:573628608
2109 2109 a, c dbSNP:11042767
2111 2111 -, ca dbSNP:776461028
2113 2113 a, c dbSNP:188024661
2114 2114 -, ga dbSNP:202059019
2117 2117 -, ca dbSNP:770911134
2126 2126 -, ca dbSNP:141204597
2141 2141 c, t dbSNP:7129583
2143 2143 a, c dbSNP:28462050
2149 2149 -, ca dbSNP:200119028
2151 2151 a, g dbSNP:538118798
2158 2158 -, ca dbSNP:755229164
2163 2163 a, g dbSNP:566280780
2176 2176 -, ca dbSNP:369407323
2176 2176 a, c dbSNP:554505888
2181 2181 a, g dbSNP:28472590
2192 2192 -, ca dbSNP:58312807
2202 2202 a, g dbSNP:372916351
2204 2204 a, g dbSNP:571653867
2235 2235 -, ca dbSNP:60649995
2235 2235 -, ca dbSNP:398114950
2237 2237 a, c dbSNP:199699118
2243 2243 -, ca dbSNP:142373942
2253 2253 -, at dbSNP:200933432
2262 2262 -, ca dbSNP:200018341
2265 2265 -, caca dbSNP:374582945
2267 2267 c, t dbSNP:549876988
2270 2270 -, acac dbSNP:201879085
2279 2279 a, c, t dbSNP:58562468
2305 2305 -, ca dbSNP:762205555
2305 2305 c, t dbSNP:567611973
2343 2343 a, g dbSNP:143209706
2358 2358 c, t dbSNP:527480230
2363 2363 -, ca dbSNP:200159614
2366 2366 c, t dbSNP:559955724
2367 2367 a, g dbSNP:544886527
2377 2377 a, g dbSNP:374392622
2382 2382 a, c dbSNP:533083978
2390 2390 a, c dbSNP:79531557
2395 2395 a, g dbSNP:1065687
2443 2443 a, c dbSNP:3208122
2457 2457 a, g dbSNP:117486875
2471 2471 -, ac dbSNP:762624032
2482 2482 g, t dbSNP:555123166
2493 2493 c, g dbSNP:3168310
2521 2521 a, g dbSNP:778335820
2534 2534 c, t dbSNP:572669571
2567 2567 c, t dbSNP:554442693
2584 2584 c, t dbSNP:529166030
2606 2606 a, g dbSNP:770810653
2616 2616 c, t dbSNP:149099319
2628 2628 c, g dbSNP:561607562
2629 2629 a, t dbSNP:746965737
2664 2664 c, t dbSNP:556823779
2689 2689 a, g dbSNP:537801892
2695 2695 c, t dbSNP:567696295
2699 2699 -, a dbSNP:58527086
2708 2708 a, g dbSNP:181654351
2713 2713 a, g dbSNP:369965474
2732 2732 a, g dbSNP:566307265
2748 2748 c, t dbSNP:749731671
2767 2767 c, t dbSNP:59196953
2775 2775 c, g, t dbSNP:79275529
2899 2899 c, t dbSNP:562601781
2928 2928 a, g dbSNP:57156844
2982 2982 c, t dbSNP:3802971
3071 3071 a, g dbSNP:112863993
3142 3142 c, t dbSNP:540317644
3167 3167 a, g dbSNP:573004818
3193 3193 g, t dbSNP:117403190
3205 3205 -, ttttttttttt dbSNP:770477972
3212 3212 g, t dbSNP:545576517
3215 3215 g, t dbSNP:3180700
3216 3216 -, g dbSNP:370546130
3216 3216 g, t dbSNP:72851054
3221 3221 -, c dbSNP:143773245
3237 3237 a, t dbSNP:578217783
3246 3246 c, t dbSNP:556573980
3265 3265 -, cc dbSNP:57423851
3265 3265 -, a dbSNP:148117489
3265 3265 a, c, t dbSNP:113798050
3270 3270 a, c dbSNP:538570399
3271 3271 a, c dbSNP:573936129
3273 3273 c, g dbSNP:555759341
3275 3275 -, c dbSNP:368927765
3284 3284 a, g dbSNP:543215705
3308 3308 c, t dbSNP:375769044
3309 3309 a, g dbSNP:566593592
3317 3317 a, c dbSNP:749385462
3322 3322 a, c dbSNP:35818489
3368 3368 a, g dbSNP:551471446
3380 3380 -, c dbSNP:774865092
3399 3399 g, t dbSNP:759815269
3404 3404 a, g dbSNP:751847850
3405 3405 a, g dbSNP:531894998
3424 3424 c, g dbSNP:539200153
3462 3462 a, t dbSNP:569080826
3533 3533 c, t dbSNP:550594230
3538 3538 c, g dbSNP:529224313
3571 3571 a, g dbSNP:561506861
3622 3622 c, t dbSNP:766504615
3639 3639 a, g dbSNP:11825733
3684 3684 c, t dbSNP:528099798
3685 3685 g, t dbSNP:780201972
3692 3692 a, g dbSNP:150340979
3701 3701 a, g dbSNP:11541377
3707 3707 a, c dbSNP:545964592
3710 3710 c, g dbSNP:11541375
3726 3726 a, g dbSNP:770180341
3737 3737 a, g dbSNP:186411823
3748 3748 c, t dbSNP:11541373
3763 3763 a, g dbSNP:11541372
3833 3833 c, t dbSNP:578101955
3834 3834 a, g dbSNP:762424041
3849 3849 c, g dbSNP:563130821
3855 3855 g, t dbSNP:11541374
3896 3896 c, t dbSNP:544555994
3907 3907 a, g dbSNP:140620676
3938 3938 c, t dbSNP:750573966
3942 3942 a, g dbSNP:181296097
3953 3953 c, t dbSNP:781563957
3954 3954 a, g dbSNP:533893575
3965 3965 a, g dbSNP:572906158
3986 3986 a, g, t dbSNP:557827054
4008 4008 a, c dbSNP:3189464
4012 4012 a, c dbSNP:539585468
4015 4015 c, g dbSNP:568944971
4021 4021 c, t dbSNP:557151721
4022 4022 a, g dbSNP:189306072
4028 4028 c, t dbSNP:535313871
4029 4029 a, g dbSNP:568313093
4087 4087 a, c dbSNP:546917658
4095 4095 a, g dbSNP:367940335
4105 4105 a, g dbSNP:567572190
4108 4108 c, t dbSNP:570499894
4127 4127 c, t dbSNP:774024295
4132 4132 a, g dbSNP:552284844
4138 4138 c, t dbSNP:61745040
4139 4139 a, g dbSNP:11564732
4141 4141 c, t dbSNP:182285016
4158 4158 c, g dbSNP:11541376
4159 4159 a, g dbSNP:531452151
4176 4176 c, t dbSNP:779085863
4195 4195 a, t dbSNP:748150937
4231 4231 c, t dbSNP:528838501
4232 4232 a, g dbSNP:560032834
4233 4233 c, t dbSNP:562000081
4254 4254 c, t dbSNP:540571205
4255 4255 c, t dbSNP:572893695
4257 4257 c, g dbSNP:557767594
4267 4267 a, g dbSNP:754829205
4301 4301 c, t dbSNP:545962158
4302 4302 a, g dbSNP:575667124
4332 4332 c, t dbSNP:557192404
4333 4333 a, g dbSNP:535588189
4336 4336 c, t dbSNP:568306674
4337 4337 a, g dbSNP:7873
4346 4346 c, t dbSNP:753848645
4347 4347 a, g dbSNP:61745039
4359 4359 g, t dbSNP:570440401
4376 4376 c, t dbSNP:552174742
4386 4386 a, c dbSNP:530438878
4413 4413 c, t dbSNP:577941383
4414 4414 a, g dbSNP:777851365
4430 4430 c, t dbSNP:569692295
4450 4450 a, g dbSNP:547984204
4458 4458 a, t dbSNP:377720187
4459 4459 a, g dbSNP:143676947
4463 4463 c, t dbSNP:3177805
4475 4475 c, g dbSNP:1065715
4476 4476 c, g dbSNP:11541371
4478 4478 c, g dbSNP:561985938
4482 4482 c, t dbSNP:1049926
4497 4497 c, t dbSNP:3177946
4520 4520 c, t dbSNP:750441206
4544 4544 a, g dbSNP:765424512
4551 4551 a, g dbSNP:184965397
4556 4556 a, g dbSNP:374278108
4559 4559 c, t dbSNP:564464469
4561 4561 a, c dbSNP:1050035
4564 4564 a, t dbSNP:764594291
4572 4572 c, t dbSNP:557969372
4583 4583 c, t dbSNP:11541370
4585 4585 a, t dbSNP:776374257
4590 4590 a, g dbSNP:2585
4612 4612 c, t dbSNP:575634705
4613 4613 a, g dbSNP:549633109
4625 4625 c, t dbSNP:557421937
4628 4628 g, t dbSNP:564295484
4653 4653 c, t dbSNP:79148793
4655 4655 c, g dbSNP:1050141
4685 4685 a, t dbSNP:112372484

Target ORF information:

RefSeq Version NM_001291862
Organism Homo sapiens (human)
Definition Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28283
Accession Version NM_001127598.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 711bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 31-JUL-2015
Organism Homo sapiens (human)
Product insulin-like growth factor II isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC132217.15, BE270173.1, BP233290.1, AK025719.1, BC073756.1 and BQ014465.1. This sequence is a reference standard in the RefSeqGene project. On Aug 19, 2014 this sequence version replaced gi:189083845. Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. Transcript Variant: This variant (3) contains two alternate exons at the 5' end, one non-coding and another coding, compared to variant 1. This results in the use of an upstream AUG (not found in variants 1 and 2) and a longer isoform (2) with a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: HM481219.1, BP232340.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142853, SAMEA2145774 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 8385745 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)227..229(+)
Misc Feature(2)281..424(+)
Misc Feature(3)419..424(+)
Misc Feature(4)521..712(+)
Misc Feature(5)527..592(+)
Misc Feature(6)581..640(+)
Misc Feature(7)653..676(+)
Misc Feature(8)773..937(+)
Exon (1)1..268
Gene Synonym:
Exon (2)269..433
Gene Synonym:
Exon (3)434..596
Gene Synonym:
Exon (4)597..745
Gene Synonym:
Exon (5)746..4857
Gene Synonym:
Position Chain Variation Link
4 4 c, t dbSNP:187259775
63 63 a, c dbSNP:574896585
81 81 a, c dbSNP:114780445
103 103 c, g dbSNP:182133033
113 113 c, t dbSNP:376456871
143 143 c, t dbSNP:759675653
146 146 a, g dbSNP:753905020
153 153 a, g dbSNP:766658545
157 157 c, t dbSNP:760012394
173 173 c, t dbSNP:760858115
190 190 c, t dbSNP:773618393
196 196 c, t dbSNP:772504548
208 208 c, t dbSNP:762040708
213 213 a, g, t dbSNP:768982587
220 220 c, g dbSNP:769679099
244 244 c, t dbSNP:542106497
246 246 a, c dbSNP:770745426
252 252 c, t dbSNP:746636459
257 257 a, t dbSNP:777252534
261 261 c, g dbSNP:772104464
265 265 c, t dbSNP:758219280
272 272 a, t dbSNP:756029049
279 279 a, c dbSNP:746025448
280 280 a, c dbSNP:781101234
286 286 c, t dbSNP:757546694
291 291 a, c dbSNP:751750987
297 297 c, t dbSNP:764346209
299 299 c, g dbSNP:373288584
306 306 c, t dbSNP:753098162
307 307 c, t dbSNP:765912786
309 309 c, t dbSNP:759933587
310 310 c, g dbSNP:80080270
317 317 g, t dbSNP:766960611
321 321 c, t dbSNP:761349268
327 327 c, g dbSNP:773876826
328 328 a, t dbSNP:768237108
329 329 a, g, t dbSNP:775258358
332 332 c, t dbSNP:769762750
335 335 a, g dbSNP:745770033
337 337 a, c dbSNP:538586423
343 343 c, g dbSNP:770946569
348 348 a, g dbSNP:376196753
349 349 a, g dbSNP:778200577
353 353 a, g dbSNP:758689893
356 356 g, t dbSNP:572035729
361 361 c, t dbSNP:74050127
368 368 c, t dbSNP:200441006
377 377 c, t dbSNP:755323436
388 388 c, t dbSNP:754336261
390 390 a, g dbSNP:766839357
414 414 c, g, t dbSNP:376757645
430 430 a, g dbSNP:763799600
432 432 a, c dbSNP:531342492
433 433 c, g dbSNP:371300605
435 435 c, t dbSNP:768906240
437 437 c, t dbSNP:201281696
438 438 c, g dbSNP:780431646
439 439 a, t dbSNP:756627422
444 444 a, g, t dbSNP:781634507
453 453 g, t dbSNP:757907236
456 456 g, t dbSNP:752191866
459 459 a, c dbSNP:764865819
460 460 g, t dbSNP:146334276
463 463 a, g dbSNP:374362537
469 469 a, c, g dbSNP:760509523
479 479 a, g dbSNP:781483443
481 481 c, t dbSNP:773291559
482 482 c, t dbSNP:767507381
493 493 c, t dbSNP:762038895
498 498 c, g, t dbSNP:142012621
499 499 a, g dbSNP:200510687
503 503 c, t dbSNP:112276039
533 533 c, t dbSNP:202212014
538 538 c, t dbSNP:553443857
541 541 c, t dbSNP:775525616
544 544 a, g dbSNP:546567293
550 550 c, g dbSNP:768579799
553 553 a, g dbSNP:770173678
568 568 c, t dbSNP:140032633
569 569 a, g dbSNP:747135996
571 571 c, t dbSNP:757757921
577 577 g, t dbSNP:747697618
582 582 g, t dbSNP:778465733
583 583 c, t dbSNP:754399358
592 592 c, t dbSNP:753561980
604 604 c, t dbSNP:199968864
612 612 a, g dbSNP:761163170
621 621 a, g dbSNP:773449505
624 624 a, g dbSNP:768105151
629 629 c, t dbSNP:762200142
630 630 a, g dbSNP:369844466
633 633 a, g dbSNP:150610908
634 634 c, t dbSNP:774947322
637 637 c, t dbSNP:377034431
657 657 a, g dbSNP:745308728
673 673 c, g dbSNP:1803647
679 679 a, g dbSNP:148165917
684 684 c, t dbSNP:746888392
685 685 a, g dbSNP:777408420
695 695 a, c dbSNP:758164144
696 696 c, t dbSNP:748117121
698 698 a, c, g dbSNP:755066389
701 701 c, g dbSNP:753904854
709 709 c, t dbSNP:373036890
712 712 a, g dbSNP:756263625
716 716 a, g dbSNP:750845881
718 718 c, t dbSNP:767792397
724 724 a, g dbSNP:554586231
727 727 c, t dbSNP:202163388
729 729 c, t dbSNP:775000758
732 732 a, c, t dbSNP:143785521
736 736 c, t dbSNP:776276916
742 742 c, t dbSNP:770667067
744 744 c, t dbSNP:369122420
745 745 a, g dbSNP:536204564
759 759 g, t dbSNP:771744589
760 760 a, g dbSNP:761665707
764 764 a, c dbSNP:774104462
766 766 c, t dbSNP:750321513
767 767 a, g, t dbSNP:376878619
768 768 c, t dbSNP:769766130
771 771 g, t dbSNP:745901132
799 799 g, t dbSNP:14367
812 812 c, t dbSNP:781325329
813 813 a, g dbSNP:757547834
820 820 a, c, t dbSNP:1065443
836 836 c, t dbSNP:530101369
846 846 c, g dbSNP:778304668
851 851 c, t dbSNP:371682005
855 855 g, t dbSNP:369452652
859 859 c, t dbSNP:765719749
860 860 a, c, g dbSNP:375129654
865 865 c, t dbSNP:372036269
866 866 a, g dbSNP:200836416
869 869 a, c dbSNP:761436263
877 877 c, t dbSNP:773939360
878 878 a, c, g dbSNP:150866176
880 880 a, g dbSNP:139194127
882 882 a, c, t dbSNP:368814253
883 883 a, g dbSNP:781299823
886 886 c, t dbSNP:771327940
887 887 a, t dbSNP:760894162
890 890 a, g dbSNP:747266091
893 893 c, g dbSNP:778075715
899 899 c, t dbSNP:758849172
900 900 a, c, g dbSNP:146962483
906 906 a, g dbSNP:61732764
908 908 c, t dbSNP:755482890
911 911 -, c dbSNP:748459239
911 911 c, t dbSNP:749953596
913 913 a, g dbSNP:767032426
919 919 c, t dbSNP:756720073
928 928 c, t dbSNP:199646294
934 934 c, g dbSNP:763681027
937 937 c, g, t dbSNP:767815580
938 938 a, g, t dbSNP:377316111
943 943 c, t dbSNP:200036157
944 944 a, g, t dbSNP:554804044
947 947 a, g dbSNP:771138084
948 948 a, g dbSNP:747026832
949 949 c, t dbSNP:138399775
951 951 c, t dbSNP:773624887
956 956 c, g, t dbSNP:11545014
957 957 -, c dbSNP:755455183
957 957 a, c, g dbSNP:1050342
961 961 c, g dbSNP:749836523
975 975 a, g dbSNP:565575035
979 979 g, t dbSNP:12993
988 988 a, c dbSNP:756776702
993 993 c, t dbSNP:751058590
995 995 c, t dbSNP:763805360
996 996 a, g dbSNP:9282726
1008 1008 c, g, t dbSNP:3741214
1009 1009 a, g dbSNP:759186937
1011 1011 c, t dbSNP:2230949
1012 1012 a, g dbSNP:200131466
1023 1023 a, g dbSNP:760902159
1033 1033 c, t dbSNP:773392012
1042 1042 a, g dbSNP:3213234
1067 1067 a, g dbSNP:538267300
1078 1078 a, g dbSNP:763531701
1085 1085 c, t dbSNP:570973772
1091 1091 a, c dbSNP:376978352
1092 1092 -, c dbSNP:34337549
1110 1110 -, c dbSNP:771725807
1118 1118 a, g dbSNP:549471313
1151 1151 c, t dbSNP:537604316
1162 1162 a, g dbSNP:6223
1165 1165 a, g dbSNP:570199935
1176 1176 -, g dbSNP:747707965
1184 1184 a, g dbSNP:745965335
1189 1189 a, t dbSNP:11510
1195 1195 c, t dbSNP:774620139
1197 1197 c, t dbSNP:548852860
1221 1221 a, c dbSNP:1803648
1276 1276 a, g dbSNP:530360490
1284 1284 a, c, t dbSNP:562128978
1304 1304 -, ac dbSNP:11564731
1308 1308 a, c dbSNP:559762706
1309 1309 c, t dbSNP:547785690
1310 1310 -, cc dbSNP:199644459
1310 1310 -, c dbSNP:780035316
1310 1310 c, t dbSNP:200385877
1311 1311 a, c dbSNP:778189789
1333 1333 a, c dbSNP:532566359
1343 1343 c, t dbSNP:565338594
1416 1416 a, t dbSNP:543940445
1422 1422 -, a dbSNP:771147163
1432 1432 -, a dbSNP:749164758
1434 1434 a, g dbSNP:372089802
1488 1488 c, g dbSNP:74050125
1496 1496 c, t dbSNP:15737
1501 1501 c, g dbSNP:542883456
1565 1565 a, c, g dbSNP:680
1588 1588 c, t dbSNP:74050124
1589 1589 a, g dbSNP:538203994
1595 1595 c, g dbSNP:1065685
1600 1600 c, t dbSNP:190844832
1602 1602 c, t dbSNP:779715960
1616 1616 a, g dbSNP:546968081
1617 1617 c, t dbSNP:749914198
1630 1630 a, g dbSNP:778435747
1646 1646 a, c, g dbSNP:137976914
1669 1669 g, t dbSNP:146936885
1712 1712 a, c dbSNP:187623619
1715 1715 c, g dbSNP:142713948
1719 1719 c, t dbSNP:775043119
1720 1720 c, t dbSNP:753731732
1722 1722 a, g dbSNP:763881915
1725 1725 a, g dbSNP:760416231
1760 1760 a, g dbSNP:752913287
1770 1770 c, t dbSNP:553780601
1775 1775 a, c, g dbSNP:541387272
1791 1791 a, g dbSNP:759873867
1792 1792 a, t dbSNP:566342533
1799 1799 c, t dbSNP:774565080
1857 1857 c, t dbSNP:548119140
1868 1868 a, g dbSNP:532504917
1888 1888 a, g dbSNP:56731553
1891 1891 c, t dbSNP:773884586
1894 1894 a, g dbSNP:56154171
1900 1900 -, ca dbSNP:372409298
1912 1912 -, acagcacacacacgagcat, at dbSNP:59198946
1913 1913 -, ta dbSNP:113750887
1926 1926 -, aaacgcacagcacacacagcacacagat dbSNP:538900531
1926 1926 aaacgc, gagcat dbSNP:386749759
1926 1926 a, g dbSNP:61872709
1927 1927 a, g dbSNP:112372828
1928 1928 -, ac dbSNP:558774932
1928 1928 a, g dbSNP:61872708
1929 1929 c, t dbSNP:113064670
1930 1930 a, g dbSNP:78158653
1931 1931 c, t dbSNP:80242682
1939 1939 -, cacacaaacg dbSNP:376418013
1959 1959 c, t dbSNP:201857559
1977 1977 a, g dbSNP:184016711
1985 1985 -, cacacacg dbSNP:374501941
1992 1992 -, gcacacac dbSNP:760137562
1993 1993 -, ca dbSNP:375635884
1996 1996 a, g dbSNP:371884035
1999 1999 -, ca dbSNP:766905011
2020 2020 c, t dbSNP:561453232
2021 2021 g, t dbSNP:542421321
2034 2034 -, ac dbSNP:760986052
2036 2036 a, g dbSNP:185336081
2045 2045 c, t dbSNP:61872707
2051 2051 c, t dbSNP:61872706
2058 2058 -, cacacacaaacgcacag dbSNP:374335327
2063 2063 a, g dbSNP:11042774
2064 2064 -, ca dbSNP:763795580
2084 2084 a, g dbSNP:544949131
2086 2086 a, g dbSNP:199625419
2092 2092 -, ca dbSNP:745570290
2116 2116 -, ac dbSNP:200421505
2123 2123 c, t dbSNP:111218600
2136 2136 c, t dbSNP:577208678
2147 2147 c, t dbSNP:201271948
2148 2148 a, g dbSNP:111164747
2168 2168 -, caca dbSNP:59630895
2173 2173 -, acac dbSNP:141005898
2193 2193 -, caca dbSNP:552914810
2197 2197 a, c dbSNP:193063121
2203 2203 -, ca dbSNP:745754092
2232 2232 a, g dbSNP:375588366
2234 2234 a, g dbSNP:7111331
2260 2260 a, g dbSNP:573628608
2274 2274 a, c dbSNP:11042767
2276 2276 -, ca dbSNP:776461028
2278 2278 a, c dbSNP:188024661
2279 2279 -, ga dbSNP:202059019
2282 2282 -, ca dbSNP:770911134
2291 2291 -, ca dbSNP:141204597
2306 2306 c, t dbSNP:7129583
2308 2308 a, c dbSNP:28462050
2314 2314 -, ca dbSNP:200119028
2316 2316 a, g dbSNP:538118798
2323 2323 -, ca dbSNP:755229164
2328 2328 a, g dbSNP:566280780
2341 2341 -, ca dbSNP:369407323
2341 2341 a, c dbSNP:554505888
2346 2346 a, g dbSNP:28472590
2357 2357 -, ca dbSNP:58312807
2367 2367 a, g dbSNP:372916351
2369 2369 a, g dbSNP:571653867
2400 2400 -, ca dbSNP:60649995
2400 2400 -, ca dbSNP:398114950
2402 2402 a, c dbSNP:199699118
2408 2408 -, ca dbSNP:142373942
2418 2418 -, at dbSNP:200933432
2427 2427 -, ca dbSNP:200018341
2430 2430 -, caca dbSNP:374582945
2432 2432 c, t dbSNP:549876988
2435 2435 -, acac dbSNP:201879085
2444 2444 a, c, t dbSNP:58562468
2470 2470 -, ca dbSNP:762205555
2470 2470 c, t dbSNP:567611973
2508 2508 a, g dbSNP:143209706
2523 2523 c, t dbSNP:527480230
2528 2528 -, ca dbSNP:200159614
2531 2531 c, t dbSNP:559955724
2532 2532 a, g dbSNP:544886527
2542 2542 a, g dbSNP:374392622
2547 2547 a, c dbSNP:533083978
2555 2555 a, c dbSNP:79531557
2560 2560 a, g dbSNP:1065687
2608 2608 a, c dbSNP:3208122
2622 2622 a, g dbSNP:117486875
2636 2636 -, ac dbSNP:762624032
2647 2647 g, t dbSNP:555123166
2658 2658 c, g dbSNP:3168310
2686 2686 a, g dbSNP:778335820
2699 2699 c, t dbSNP:572669571
2732 2732 c, t dbSNP:554442693
2749 2749 c, t dbSNP:529166030
2771 2771 a, g dbSNP:770810653
2781 2781 c, t dbSNP:149099319
2793 2793 c, g dbSNP:561607562
2794 2794 a, t dbSNP:746965737
2829 2829 c, t dbSNP:556823779
2854 2854 a, g dbSNP:537801892
2860 2860 c, t dbSNP:567696295
2864 2864 -, a dbSNP:58527086
2873 2873 a, g dbSNP:181654351
2878 2878 a, g dbSNP:369965474
2897 2897 a, g dbSNP:566307265
2913 2913 c, t dbSNP:749731671
2932 2932 c, t dbSNP:59196953
2940 2940 c, g, t dbSNP:79275529
3064 3064 c, t dbSNP:562601781
3093 3093 a, g dbSNP:57156844
3147 3147 c, t dbSNP:3802971
3236 3236 a, g dbSNP:112863993
3307 3307 c, t dbSNP:540317644
3332 3332 a, g dbSNP:573004818
3358 3358 g, t dbSNP:117403190
3370 3370 -, ttttttttttt dbSNP:770477972
3377 3377 g, t dbSNP:545576517
3380 3380 g, t dbSNP:3180700
3381 3381 -, g dbSNP:370546130
3381 3381 g, t dbSNP:72851054
3386 3386 -, c dbSNP:143773245
3402 3402 a, t dbSNP:578217783
3411 3411 c, t dbSNP:556573980
3430 3430 -, cc dbSNP:57423851
3430 3430 -, a dbSNP:148117489
3430 3430 a, c, t dbSNP:113798050
3435 3435 a, c dbSNP:538570399
3436 3436 a, c dbSNP:573936129
3438 3438 c, g dbSNP:555759341
3440 3440 -, c dbSNP:368927765
3449 3449 a, g dbSNP:543215705
3473 3473 c, t dbSNP:375769044
3474 3474 a, g dbSNP:566593592
3482 3482 a, c dbSNP:749385462
3487 3487 a, c dbSNP:35818489
3533 3533 a, g dbSNP:551471446
3545 3545 -, c dbSNP:774865092
3564 3564 g, t dbSNP:759815269
3569 3569 a, g dbSNP:751847850
3570 3570 a, g dbSNP:531894998
3589 3589 c, g dbSNP:539200153
3627 3627 a, t dbSNP:569080826
3698 3698 c, t dbSNP:550594230
3703 3703 c, g dbSNP:529224313
3736 3736 a, g dbSNP:561506861
3787 3787 c, t dbSNP:766504615
3804 3804 a, g dbSNP:11825733
3849 3849 c, t dbSNP:528099798
3850 3850 g, t dbSNP:780201972
3857 3857 a, g dbSNP:150340979
3866 3866 a, g dbSNP:11541377
3872 3872 a, c dbSNP:545964592
3875 3875 c, g dbSNP:11541375
3891 3891 a, g dbSNP:770180341
3902 3902 a, g dbSNP:186411823
3913 3913 c, t dbSNP:11541373
3928 3928 a, g dbSNP:11541372
3998 3998 c, t dbSNP:578101955
3999 3999 a, g dbSNP:762424041
4014 4014 c, g dbSNP:563130821
4020 4020 g, t dbSNP:11541374
4061 4061 c, t dbSNP:544555994
4072 4072 a, g dbSNP:140620676
4103 4103 c, t dbSNP:750573966
4107 4107 a, g dbSNP:181296097
4118 4118 c, t dbSNP:781563957
4119 4119 a, g dbSNP:533893575
4130 4130 a, g dbSNP:572906158
4151 4151 a, g, t dbSNP:557827054
4173 4173 a, c dbSNP:3189464
4177 4177 a, c dbSNP:539585468
4180 4180 c, g dbSNP:568944971
4186 4186 c, t dbSNP:557151721
4187 4187 a, g dbSNP:189306072
4193 4193 c, t dbSNP:535313871
4194 4194 a, g dbSNP:568313093
4252 4252 a, c dbSNP:546917658
4260 4260 a, g dbSNP:367940335
4270 4270 a, g dbSNP:567572190
4273 4273 c, t dbSNP:570499894
4292 4292 c, t dbSNP:774024295
4297 4297 a, g dbSNP:552284844
4303 4303 c, t dbSNP:61745040
4304 4304 a, g dbSNP:11564732
4306 4306 c, t dbSNP:182285016
4323 4323 c, g dbSNP:11541376
4324 4324 a, g dbSNP:531452151
4341 4341 c, t dbSNP:779085863
4360 4360 a, t dbSNP:748150937
4396 4396 c, t dbSNP:528838501
4397 4397 a, g dbSNP:560032834
4398 4398 c, t dbSNP:562000081
4419 4419 c, t dbSNP:540571205
4420 4420 c, t dbSNP:572893695
4422 4422 c, g dbSNP:557767594
4432 4432 a, g dbSNP:754829205
4466 4466 c, t dbSNP:545962158
4467 4467 a, g dbSNP:575667124
4497 4497 c, t dbSNP:557192404
4498 4498 a, g dbSNP:535588189
4501 4501 c, t dbSNP:568306674
4502 4502 a, g dbSNP:7873
4511 4511 c, t dbSNP:753848645
4512 4512 a, g dbSNP:61745039
4524 4524 g, t dbSNP:570440401
4541 4541 c, t dbSNP:552174742
4551 4551 a, c dbSNP:530438878
4578 4578 c, t dbSNP:577941383
4579 4579 a, g dbSNP:777851365
4595 4595 c, t dbSNP:569692295
4615 4615 a, g dbSNP:547984204
4623 4623 a, t dbSNP:377720187
4624 4624 a, g dbSNP:143676947
4628 4628 c, t dbSNP:3177805
4640 4640 c, g dbSNP:1065715
4641 4641 c, g dbSNP:11541371
4643 4643 c, g dbSNP:561985938
4647 4647 c, t dbSNP:1049926
4662 4662 c, t dbSNP:3177946
4685 4685 c, t dbSNP:750441206
4709 4709 a, g dbSNP:765424512
4716 4716 a, g dbSNP:184965397
4721 4721 a, g dbSNP:374278108
4724 4724 c, t dbSNP:564464469
4726 4726 a, c dbSNP:1050035
4729 4729 a, t dbSNP:764594291
4737 4737 c, t dbSNP:557969372
4748 4748 c, t dbSNP:11541370
4750 4750 a, t dbSNP:776374257
4755 4755 a, g dbSNP:2585
4777 4777 c, t dbSNP:575634705
4778 4778 a, g dbSNP:549633109
4790 4790 c, t dbSNP:557421937
4793 4793 g, t dbSNP:564295484
4818 4818 c, t dbSNP:79148793
4820 4820 c, g dbSNP:1050141
4850 4850 a, t dbSNP:112372484

Target ORF information:

RefSeq Version NM_001127598
Organism Homo sapiens (human)
Definition Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28274
Accession Version NM_000612.5 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 543bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 31-JUL-2015
Organism Homo sapiens (human)
Product insulin-like growth factor II isoform 1 preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC053318.1, M17426.1, AC132217.15, AK025719.1, BC073756.1 and BQ014465.1. This sequence is a reference standard in the RefSeqGene project. On Aug 19, 2014 this sequence version replaced gi:183603939. Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. Transcript Variant: This variant (1) represents the most predominant transcript. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: J03242.1, BC000531.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2149398, SAMEA2153307 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 8385745 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)474..476(+)
Misc Feature(2)825..908(+)
Misc Feature(3)834..1025(+)
Misc Feature(4)840..905(+)
Misc Feature(5)894..953(+)
Misc Feature(6)909..944(+)
Misc Feature(7)945..1007(+)
Misc Feature(8)966..989(+)
Misc Feature(9)1008..1025(+)
Misc Feature(10)1086..1250(+)
Exon (1)1..746
Gene Synonym:
Exon (2)747..909
Gene Synonym:
Exon (3)910..1058
Gene Synonym:
Exon (4)1059..5170
Gene Synonym:
Position Chain Variation Link
38 38 a, g dbSNP:570898445
121 121 c, t dbSNP:555772508
240 240 c, g dbSNP:537523589
254 254 a, t dbSNP:112963747
316 316 a, g dbSNP:566992364
333 333 c, g dbSNP:548822663
413 413 -, c dbSNP:150408391
428 428 g, t dbSNP:536815314
557 557 g, t dbSNP:566147675
585 585 c, g dbSNP:137913580
586 586 -, c dbSNP:776260679
617 617 c, t dbSNP:548069232
676 676 a, g dbSNP:1050197
723 723 a, g dbSNP:569737096
748 748 c, t dbSNP:768906240
750 750 c, t dbSNP:201281696
751 751 c, g dbSNP:780431646
752 752 a, t dbSNP:756627422
757 757 a, g, t dbSNP:781634507
766 766 g, t dbSNP:757907236
769 769 g, t dbSNP:752191866
772 772 a, c dbSNP:764865819
773 773 g, t dbSNP:146334276
776 776 a, g dbSNP:374362537
782 782 a, c, g dbSNP:760509523
792 792 a, g dbSNP:781483443
794 794 c, t dbSNP:773291559
795 795 c, t dbSNP:767507381
806 806 c, t dbSNP:762038895
811 811 c, g, t dbSNP:142012621
812 812 a, g dbSNP:200510687
816 816 c, t dbSNP:112276039
846 846 c, t dbSNP:202212014
851 851 c, t dbSNP:553443857
854 854 c, t dbSNP:775525616
857 857 a, g dbSNP:546567293
863 863 c, g dbSNP:768579799
866 866 a, g dbSNP:770173678
881 881 c, t dbSNP:140032633
882 882 a, g dbSNP:747135996
884 884 c, t dbSNP:757757921
890 890 g, t dbSNP:747697618
895 895 g, t dbSNP:778465733
896 896 c, t dbSNP:754399358
905 905 c, t dbSNP:753561980
917 917 c, t dbSNP:199968864
925 925 a, g dbSNP:761163170
934 934 a, g dbSNP:773449505
937 937 a, g dbSNP:768105151
942 942 c, t dbSNP:762200142
943 943 a, g dbSNP:369844466
946 946 a, g dbSNP:150610908
947 947 c, t dbSNP:774947322
950 950 c, t dbSNP:377034431
970 970 a, g dbSNP:745308728
986 986 c, g dbSNP:1803647
992 992 a, g dbSNP:148165917
997 997 c, t dbSNP:746888392
998 998 a, g dbSNP:777408420
1008 1008 a, c dbSNP:758164144
1009 1009 c, t dbSNP:748117121
1011 1011 a, c, g dbSNP:755066389
1014 1014 c, g dbSNP:753904854
1022 1022 c, t dbSNP:373036890
1025 1025 a, g dbSNP:756263625
1029 1029 a, g dbSNP:750845881
1031 1031 c, t dbSNP:767792397
1037 1037 a, g dbSNP:554586231
1040 1040 c, t dbSNP:202163388
1042 1042 c, t dbSNP:775000758
1045 1045 a, c, t dbSNP:143785521
1049 1049 c, t dbSNP:776276916
1055 1055 c, t dbSNP:770667067
1057 1057 c, t dbSNP:369122420
1058 1058 a, g dbSNP:536204564
1072 1072 g, t dbSNP:771744589
1073 1073 a, g dbSNP:761665707
1077 1077 a, c dbSNP:774104462
1079 1079 c, t dbSNP:750321513
1080 1080 a, g, t dbSNP:376878619
1081 1081 c, t dbSNP:769766130
1084 1084 g, t dbSNP:745901132
1112 1112 g, t dbSNP:14367
1125 1125 c, t dbSNP:781325329
1126 1126 a, g dbSNP:757547834
1133 1133 a, c, t dbSNP:1065443
1149 1149 c, t dbSNP:530101369
1159 1159 c, g dbSNP:778304668
1164 1164 c, t dbSNP:371682005
1168 1168 g, t dbSNP:369452652
1172 1172 c, t dbSNP:765719749
1173 1173 a, c, g dbSNP:375129654
1178 1178 c, t dbSNP:372036269
1179 1179 a, g dbSNP:200836416
1182 1182 a, c dbSNP:761436263
1190 1190 c, t dbSNP:773939360
1191 1191 a, c, g dbSNP:150866176
1193 1193 a, g dbSNP:139194127
1195 1195 a, c, t dbSNP:368814253
1196 1196 a, g dbSNP:781299823
1199 1199 c, t dbSNP:771327940
1200 1200 a, t dbSNP:760894162
1203 1203 a, g dbSNP:747266091
1206 1206 c, g dbSNP:778075715
1212 1212 c, t dbSNP:758849172
1213 1213 a, c, g dbSNP:146962483
1219 1219 a, g dbSNP:61732764
1221 1221 c, t dbSNP:755482890
1224 1224 -, c dbSNP:748459239
1224 1224 c, t dbSNP:749953596
1226 1226 a, g dbSNP:767032426
1232 1232 c, t dbSNP:756720073
1241 1241 c, t dbSNP:199646294
1247 1247 c, g dbSNP:763681027
1250 1250 c, g, t dbSNP:767815580
1251 1251 a, g, t dbSNP:377316111
1256 1256 c, t dbSNP:200036157
1257 1257 a, g, t dbSNP:554804044
1260 1260 a, g dbSNP:771138084
1261 1261 a, g dbSNP:747026832
1262 1262 c, t dbSNP:138399775
1264 1264 c, t dbSNP:773624887
1269 1269 c, g, t dbSNP:11545014
1270 1270 -, c dbSNP:755455183
1270 1270 a, c, g dbSNP:1050342
1274 1274 c, g dbSNP:749836523
1288 1288 a, g dbSNP:565575035
1292 1292 g, t dbSNP:12993
1301 1301 a, c dbSNP:756776702
1306 1306 c, t dbSNP:751058590
1308 1308 c, t dbSNP:763805360
1309 1309 a, g dbSNP:9282726
1321 1321 c, g, t dbSNP:3741214
1322 1322 a, g dbSNP:759186937
1324 1324 c, t dbSNP:2230949
1325 1325 a, g dbSNP:200131466
1336 1336 a, g dbSNP:760902159
1346 1346 c, t dbSNP:773392012
1355 1355 a, g dbSNP:3213234
1380 1380 a, g dbSNP:538267300
1391 1391 a, g dbSNP:763531701
1398 1398 c, t dbSNP:570973772
1404 1404 a, c dbSNP:376978352
1405 1405 -, c dbSNP:34337549
1423 1423 -, c dbSNP:771725807
1431 1431 a, g dbSNP:549471313
1464 1464 c, t dbSNP:537604316
1475 1475 a, g dbSNP:6223
1478 1478 a, g dbSNP:570199935
1489 1489 -, g dbSNP:747707965
1497 1497 a, g dbSNP:745965335
1502 1502 a, t dbSNP:11510
1508 1508 c, t dbSNP:774620139
1510 1510 c, t dbSNP:548852860
1534 1534 a, c dbSNP:1803648
1589 1589 a, g dbSNP:530360490
1597 1597 a, c, t dbSNP:562128978
1617 1617 -, ac dbSNP:11564731
1621 1621 a, c dbSNP:559762706
1622 1622 c, t dbSNP:547785690
1623 1623 -, cc dbSNP:199644459
1623 1623 -, c dbSNP:780035316
1623 1623 c, t dbSNP:200385877
1624 1624 a, c dbSNP:778189789
1646 1646 a, c dbSNP:532566359
1656 1656 c, t dbSNP:565338594
1729 1729 a, t dbSNP:543940445
1735 1735 -, a dbSNP:771147163
1745 1745 -, a dbSNP:749164758
1747 1747 a, g dbSNP:372089802
1801 1801 c, g dbSNP:74050125
1809 1809 c, t dbSNP:15737
1814 1814 c, g dbSNP:542883456
1878 1878 a, c, g dbSNP:680
1901 1901 c, t dbSNP:74050124
1902 1902 a, g dbSNP:538203994
1908 1908 c, g dbSNP:1065685
1913 1913 c, t dbSNP:190844832
1915 1915 c, t dbSNP:779715960
1929 1929 a, g dbSNP:546968081
1930 1930 c, t dbSNP:749914198
1943 1943 a, g dbSNP:778435747
1959 1959 a, c, g dbSNP:137976914
1982 1982 g, t dbSNP:146936885
2025 2025 a, c dbSNP:187623619
2028 2028 c, g dbSNP:142713948
2032 2032 c, t dbSNP:775043119
2033 2033 c, t dbSNP:753731732
2035 2035 a, g dbSNP:763881915
2038 2038 a, g dbSNP:760416231
2073 2073 a, g dbSNP:752913287
2083 2083 c, t dbSNP:553780601
2088 2088 a, c, g dbSNP:541387272
2104 2104 a, g dbSNP:759873867
2105 2105 a, t dbSNP:566342533
2112 2112 c, t dbSNP:774565080
2170 2170 c, t dbSNP:548119140
2181 2181 a, g dbSNP:532504917
2201 2201 a, g dbSNP:56731553
2204 2204 c, t dbSNP:773884586
2207 2207 a, g dbSNP:56154171
2213 2213 -, ca dbSNP:372409298
2225 2225 -, acagcacacacacgagcat, at dbSNP:59198946
2226 2226 -, ta dbSNP:113750887
2239 2239 -, aaacgcacagcacacacagcacacagat dbSNP:538900531
2239 2239 aaacgc, gagcat dbSNP:386749759
2239 2239 a, g dbSNP:61872709
2240 2240 a, g dbSNP:112372828
2241 2241 -, ac dbSNP:558774932
2241 2241 a, g dbSNP:61872708
2242 2242 c, t dbSNP:113064670
2243 2243 a, g dbSNP:78158653
2244 2244 c, t dbSNP:80242682
2252 2252 -, cacacaaacg dbSNP:376418013
2272 2272 c, t dbSNP:201857559
2290 2290 a, g dbSNP:184016711
2298 2298 -, cacacacg dbSNP:374501941
2305 2305 -, gcacacac dbSNP:760137562
2306 2306 -, ca dbSNP:375635884
2309 2309 a, g dbSNP:371884035
2312 2312 -, ca dbSNP:766905011
2333 2333 c, t dbSNP:561453232
2334 2334 g, t dbSNP:542421321
2347 2347 -, ac dbSNP:760986052
2349 2349 a, g dbSNP:185336081
2358 2358 c, t dbSNP:61872707
2364 2364 c, t dbSNP:61872706
2371 2371 -, cacacacaaacgcacag dbSNP:374335327
2376 2376 a, g dbSNP:11042774
2377 2377 -, ca dbSNP:763795580
2397 2397 a, g dbSNP:544949131
2399 2399 a, g dbSNP:199625419
2405 2405 -, ca dbSNP:745570290
2429 2429 -, ac dbSNP:200421505
2436 2436 c, t dbSNP:111218600
2449 2449 c, t dbSNP:577208678
2460 2460 c, t dbSNP:201271948
2461 2461 a, g dbSNP:111164747
2481 2481 -, caca dbSNP:59630895
2486 2486 -, acac dbSNP:141005898
2506 2506 -, caca dbSNP:552914810
2510 2510 a, c dbSNP:193063121
2516 2516 -, ca dbSNP:745754092
2545 2545 a, g dbSNP:375588366
2547 2547 a, g dbSNP:7111331
2573 2573 a, g dbSNP:573628608
2587 2587 a, c dbSNP:11042767
2589 2589 -, ca dbSNP:776461028
2591 2591 a, c dbSNP:188024661
2592 2592 -, ga dbSNP:202059019
2595 2595 -, ca dbSNP:770911134
2604 2604 -, ca dbSNP:141204597
2619 2619 c, t dbSNP:7129583
2621 2621 a, c dbSNP:28462050
2627 2627 -, ca dbSNP:200119028
2629 2629 a, g dbSNP:538118798
2636 2636 -, ca dbSNP:755229164
2641 2641 a, g dbSNP:566280780
2654 2654 -, ca dbSNP:369407323
2654 2654 a, c dbSNP:554505888
2659 2659 a, g dbSNP:28472590
2670 2670 -, ca dbSNP:58312807
2680 2680 a, g dbSNP:372916351
2682 2682 a, g dbSNP:571653867
2713 2713 -, ca dbSNP:60649995
2713 2713 -, ca dbSNP:398114950
2715 2715 a, c dbSNP:199699118
2721 2721 -, ca dbSNP:142373942
2731 2731 -, at dbSNP:200933432
2740 2740 -, ca dbSNP:200018341
2743 2743 -, caca dbSNP:374582945
2745 2745 c, t dbSNP:549876988
2748 2748 -, acac dbSNP:201879085
2757 2757 a, c, t dbSNP:58562468
2783 2783 -, ca dbSNP:762205555
2783 2783 c, t dbSNP:567611973
2821 2821 a, g dbSNP:143209706
2836 2836 c, t dbSNP:527480230
2841 2841 -, ca dbSNP:200159614
2844 2844 c, t dbSNP:559955724
2845 2845 a, g dbSNP:544886527
2855 2855 a, g dbSNP:374392622
2860 2860 a, c dbSNP:533083978
2868 2868 a, c dbSNP:79531557
2873 2873 a, g dbSNP:1065687
2921 2921 a, c dbSNP:3208122
2935 2935 a, g dbSNP:117486875
2949 2949 -, ac dbSNP:762624032
2960 2960 g, t dbSNP:555123166
2971 2971 c, g dbSNP:3168310
2999 2999 a, g dbSNP:778335820
3012 3012 c, t dbSNP:572669571
3045 3045 c, t dbSNP:554442693
3062 3062 c, t dbSNP:529166030
3084 3084 a, g dbSNP:770810653
3094 3094 c, t dbSNP:149099319
3106 3106 c, g dbSNP:561607562
3107 3107 a, t dbSNP:746965737
3142 3142 c, t dbSNP:556823779
3167 3167 a, g dbSNP:537801892
3173 3173 c, t dbSNP:567696295
3177 3177 -, a dbSNP:58527086
3186 3186 a, g dbSNP:181654351
3191 3191 a, g dbSNP:369965474
3210 3210 a, g dbSNP:566307265
3226 3226 c, t dbSNP:749731671
3245 3245 c, t dbSNP:59196953
3253 3253 c, g, t dbSNP:79275529
3377 3377 c, t dbSNP:562601781
3406 3406 a, g dbSNP:57156844
3460 3460 c, t dbSNP:3802971
3549 3549 a, g dbSNP:112863993
3620 3620 c, t dbSNP:540317644
3645 3645 a, g dbSNP:573004818
3671 3671 g, t dbSNP:117403190
3683 3683 -, ttttttttttt dbSNP:770477972
3690 3690 g, t dbSNP:545576517
3693 3693 g, t dbSNP:3180700
3694 3694 -, g dbSNP:370546130
3694 3694 g, t dbSNP:72851054
3699 3699 -, c dbSNP:143773245
3715 3715 a, t dbSNP:578217783
3724 3724 c, t dbSNP:556573980
3743 3743 -, cc dbSNP:57423851
3743 3743 -, a dbSNP:148117489
3743 3743 a, c, t dbSNP:113798050
3748 3748 a, c dbSNP:538570399
3749 3749 a, c dbSNP:573936129
3751 3751 c, g dbSNP:555759341
3753 3753 -, c dbSNP:368927765
3762 3762 a, g dbSNP:543215705
3786 3786 c, t dbSNP:375769044
3787 3787 a, g dbSNP:566593592
3795 3795 a, c dbSNP:749385462
3800 3800 a, c dbSNP:35818489
3846 3846 a, g dbSNP:551471446
3858 3858 -, c dbSNP:774865092
3877 3877 g, t dbSNP:759815269
3882 3882 a, g dbSNP:751847850
3883 3883 a, g dbSNP:531894998
3902 3902 c, g dbSNP:539200153
3940 3940 a, t dbSNP:569080826
4011 4011 c, t dbSNP:550594230
4016 4016 c, g dbSNP:529224313
4049 4049 a, g dbSNP:561506861
4100 4100 c, t dbSNP:766504615
4117 4117 a, g dbSNP:11825733
4162 4162 c, t dbSNP:528099798
4163 4163 g, t dbSNP:780201972
4170 4170 a, g dbSNP:150340979
4179 4179 a, g dbSNP:11541377
4185 4185 a, c dbSNP:545964592
4188 4188 c, g dbSNP:11541375
4204 4204 a, g dbSNP:770180341
4215 4215 a, g dbSNP:186411823
4226 4226 c, t dbSNP:11541373
4241 4241 a, g dbSNP:11541372
4311 4311 c, t dbSNP:578101955
4312 4312 a, g dbSNP:762424041
4327 4327 c, g dbSNP:563130821
4333 4333 g, t dbSNP:11541374
4374 4374 c, t dbSNP:544555994
4385 4385 a, g dbSNP:140620676
4416 4416 c, t dbSNP:750573966
4420 4420 a, g dbSNP:181296097
4431 4431 c, t dbSNP:781563957
4432 4432 a, g dbSNP:533893575
4443 4443 a, g dbSNP:572906158
4464 4464 a, g, t dbSNP:557827054
4486 4486 a, c dbSNP:3189464
4490 4490 a, c dbSNP:539585468
4493 4493 c, g dbSNP:568944971
4499 4499 c, t dbSNP:557151721
4500 4500 a, g dbSNP:189306072
4506 4506 c, t dbSNP:535313871
4507 4507 a, g dbSNP:568313093
4565 4565 a, c dbSNP:546917658
4573 4573 a, g dbSNP:367940335
4583 4583 a, g dbSNP:567572190
4586 4586 c, t dbSNP:570499894
4605 4605 c, t dbSNP:774024295
4610 4610 a, g dbSNP:552284844
4616 4616 c, t dbSNP:61745040
4617 4617 a, g dbSNP:11564732
4619 4619 c, t dbSNP:182285016
4636 4636 c, g dbSNP:11541376
4637 4637 a, g dbSNP:531452151
4654 4654 c, t dbSNP:779085863
4673 4673 a, t dbSNP:748150937
4709 4709 c, t dbSNP:528838501
4710 4710 a, g dbSNP:560032834
4711 4711 c, t dbSNP:562000081
4732 4732 c, t dbSNP:540571205
4733 4733 c, t dbSNP:572893695
4735 4735 c, g dbSNP:557767594
4745 4745 a, g dbSNP:754829205
4779 4779 c, t dbSNP:545962158
4780 4780 a, g dbSNP:575667124
4810 4810 c, t dbSNP:557192404
4811 4811 a, g dbSNP:535588189
4814 4814 c, t dbSNP:568306674
4815 4815 a, g dbSNP:7873
4824 4824 c, t dbSNP:753848645
4825 4825 a, g dbSNP:61745039
4837 4837 g, t dbSNP:570440401
4854 4854 c, t dbSNP:552174742
4864 4864 a, c dbSNP:530438878
4891 4891 c, t dbSNP:577941383
4892 4892 a, g dbSNP:777851365
4908 4908 c, t dbSNP:569692295
4928 4928 a, g dbSNP:547984204
4936 4936 a, t dbSNP:377720187
4937 4937 a, g dbSNP:143676947
4941 4941 c, t dbSNP:3177805
4953 4953 c, g dbSNP:1065715
4954 4954 c, g dbSNP:11541371
4956 4956 c, g dbSNP:561985938
4960 4960 c, t dbSNP:1049926
4975 4975 c, t dbSNP:3177946
4998 4998 c, t dbSNP:750441206
5022 5022 a, g dbSNP:765424512
5029 5029 a, g dbSNP:184965397
5034 5034 a, g dbSNP:374278108
5037 5037 c, t dbSNP:564464469
5039 5039 a, c dbSNP:1050035
5042 5042 a, t dbSNP:764594291
5050 5050 c, t dbSNP:557969372
5061 5061 c, t dbSNP:11541370
5063 5063 a, t dbSNP:776374257
5068 5068 a, g dbSNP:2585
5090 5090 c, t dbSNP:575634705
5091 5091 a, g dbSNP:549633109
5103 5103 c, t dbSNP:557421937
5106 5106 g, t dbSNP:564295484
5131 5131 c, t dbSNP:79148793
5133 5133 c, g dbSNP:1050141
5163 5163 a, t dbSNP:112372484

Target ORF information:

RefSeq Version NM_000612
Organism Homo sapiens (human)
Definition Homo sapiens insulin-like growth factor 2 (IGF2), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28274
Accession Version NM_001291861.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 543bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 31-JUL-2015
Organism Homo sapiens (human)
Product insulin-like growth factor II isoform 1 preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK313938.1, BC000531.1, AC132217.15 and BQ014465.1. On Aug 19, 2014 this sequence version replaced gi:630044871. Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]. Transcript Variant: This variant (4) differs in the 5' UTR exon, compared to variant 1. Variants 1, 2, 4 and 5 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK291594.1, BG827308.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## imprinted gene :: PMID: 8385745 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)92..94(+)
Misc Feature(2)176..259(+)
Misc Feature(3)185..376(+)
Misc Feature(4)191..256(+)
Misc Feature(5)245..304(+)
Misc Feature(6)260..295(+)
Misc Feature(7)296..358(+)
Misc Feature(8)317..340(+)
Misc Feature(9)359..376(+)
Misc Feature(10)437..601(+)
Exon (1)1..97
Gene Synonym:
Exon (2)98..260
Gene Synonym:
Exon (3)261..409
Gene Synonym:
Exon (4)410..4521
Gene Synonym:
Position Chain Variation Link
22 22 c, t dbSNP:375711820
81 81 a, g dbSNP:577429397
99 99 c, t dbSNP:768906240
101 101 c, t dbSNP:201281696
102 102 c, g dbSNP:780431646
103 103 a, t dbSNP:756627422
108 108 a, g, t dbSNP:781634507
117 117 g, t dbSNP:757907236
120 120 g, t dbSNP:752191866
123 123 a, c dbSNP:764865819
124 124 g, t dbSNP:146334276
127 127 a, g dbSNP:374362537
133 133 a, c, g dbSNP:760509523
143 143 a, g dbSNP:781483443
145 145 c, t dbSNP:773291559
146 146 c, t dbSNP:767507381
157 157 c, t dbSNP:762038895
162 162 c, g, t dbSNP:142012621
163 163 a, g dbSNP:200510687
167 167 c, t dbSNP:112276039
197 197 c, t dbSNP:202212014
202 202 c, t dbSNP:553443857
205 205 c, t dbSNP:775525616
208 208 a, g dbSNP:546567293
214 214 c, g dbSNP:768579799
217 217 a, g dbSNP:770173678
232 232 c, t dbSNP:140032633
233 233 a, g dbSNP:747135996
235 235 c, t dbSNP:757757921
241 241 g, t dbSNP:747697618
246 246 g, t dbSNP:778465733
247 247 c, t dbSNP:754399358
256 256 c, t dbSNP:753561980
268 268 c, t dbSNP:199968864
276 276 a, g dbSNP:761163170
285 285 a, g dbSNP:773449505
288 288 a, g