Email to GenScript

ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Homo sapiens (human)]

Gene Symbol ABCC6
Entrez Gene ID 368
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7
General protein information
Preferred Names
URG7 protein; multidrug resistance-associated protein 6
Names
multidrug resistance-associated protein 6
ATP-binding cassette sub-family C member 6
multi-specific organic anion transporter E
anthracycline resistance-associated protein
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

16

16p13.1

Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

603234

Disorder Html: Pseudoxanthoma elasticum, 264800 (3); Pseudoxanthoma elasticum,





The following ABCC6 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ABCC6 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu56348 XM_011522479 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56349 XM_011522480 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56349 XM_011522481 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56350 XM_011522482 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu56351 XM_011546696 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56351 XM_011546697 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu16610 NM_001079528 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu18031 NM_001171 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu56348
Accession Version XM_011522479.1
Sequence Information ORF Nucleotide Sequence (Length: 4479bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product multidrug resistance-associated protein 6 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
ATGGCCGCGC CTGCTGAGCC CTGCGCGGGG CAGGGGGTCT GGAACCAGAC AGAGCCTGAA 
CCTGCCGCCA CCAGCCTGCT GAGCCTGTGC TTCCTGAGAA CAGCAGGGGT CTGGGTACCC
CCCATGTACC TCTGGGTCCT TGGTCCCATC TACCTCCTCT TCATCCACCA CCATGGCCGG
GGCTACCTCC GGATGTCCCC ACTCTTCAAA GCCAAGATGG TGCTTGGATT CGCCCTCATA
GTCCTGTGTA CCTCCAGCGT GGCTGTCGCT CTTTGGAAAA TCCAACAGGG AACGCCTGAG
GCCCCAGAAT TCCTCATTCA TCCTACTGTG TGGCTCACCA CGATGAGCTT CGCAGTGTTC
CTGATTCACA CCGAGAGGAA AAAGGGAGTC CAGTCATCTG GAGTGCTGTT TGGTTACTGG
CTTCTCTGCT TTGTCTTGCC AGCTACCAAC GCTGCCCAGC AGGCCTCCGG AGCGGGCTTC
CAGAGCGACC CTGTCCGCCA CCTGTCCACC TACCTATGCC TGTCTCTGGT GGTGGCACAG
TTTGTGCTGT CCTGCCTGGC GGATCAACCC CCCTTCTTCC CTGAAGACCC CCAGCAGTCT
AACCCCTGTC CAGAGACTGG GGCAGCCTTC CCCTCCAAAG CCACGTTCTG GTGGGTTTCT
GGCCTGGTCT GGAGGGGATA CAGGAGGCCA CTGAGACCAA AAGACCTCTG GTCGCTTGGG
AGAGAAAACT CCTCAGAAGA ACTTGTTTCC CGGCTTGAAA AGGAGTGGAT GAGGAACCGC
AGTGCAGCCC GGAGGCACAA CAAGGCAATA GCATTTAAAA GGAAAGGCGG CAGTGGCATG
AAGGCTCCAG AGACCGAGCC CTTCCTACGG CAAGAAGGGA GCCAGTGGCG CCCACTGCTG
AAGGCCATCT GGCAGGTGTT CCATTCTACC TTCCTCCTGG GGACCCTCAG CCTCATCATC
AGTGATGTCT TCAGGTTCAC TGTCCCCAAG CTGCTCAGCC TTTTCCTGGA GTTTATTGGT
GATCCCAAGC CTCCAGCCTG GAAGGGCTAC CTCCTCGCCG TGCTGATGTT CCTCTCAGCC
TGCCTGCAAA CGCTGTTTGA GCAGCAGAAC ATGTACAGGC TCAAGGTGCT GCAGATGAGG
TTGCGGTCGG CCATCACTGG CCTGGTGTAC AGAAAGGTCC TGGCTCTGTC CAGCGGCTCC
AGAAAGGCCA GTGCGGTGGG TGATGTGGTC AATCTGGTGT CCGTGGACGT GCAGCGGCTG
ACCGAGAGCG TCCTCTACCT CAACGGGCTG TGGCTGCCTC TCGTCTGGAT CGTGGTCTGC
TTCGTCTATC TCTGGCAGCT CCTGGGGCCC TCCGCCCTCA CTGCCATCGC TGTCTTCCTG
AGCCTCCTCC CTCTGAATTT CTTCATCTCC AAGAAAAGGA ACCACCATCA GGAGGAGCAA
ATGAGGCAGA AGGACTCACG GGCACGGCTC ACCAGCTCTA TCCTCAGGAA CTCGAAGACC
ATCAAGTTCC ATGGCTGGGA GGGAGCCTTT CTGGACAGAG TCCTGGGCAT CCGAGGCCAG
GAGCTGGGCG CCTTGCGGAC CTCCGGCCTC CTCTTCTCTG TGTCGCTGGT GTCCTTCCAA
GTGTCTACAT TTCTGGTCGC ACTGGTGGTG TTTGCTGTCC ACACTCTGGT GGCCGAGAAT
GCTATGAATG CAGAGAAAGC CTTTGTGACT CTCACAGTTC TCAACATCCT CAACAAGGCC
CAGGCTTTCC TGCCCTTCTC CATCCACTCC CTCGTCCAGG CCCGGGTGTC CTTTGACCGT
CTGGTCACCT TCCTCTGCCT GGAAGAAGTT GACCCTGGTG TCGTAGACTC AAGTTCCTCT
GGAAGCGCTG CCGGGAAGGA TTGCATCACC ATACACAGTG CCACCTTCGC CTGGTCCCAG
GAAAGCCCTC CCTGCCTCCA CAGAATAAAC CTCACGGTGC CCCAGGGCTG TCTGCTGGCT
GTTGTCGGTC CAGTGGGGGC AGGGAAGTCC TCCCTGCTGT CCGCCCTCCT TGGGGAGCTG
TCAAAGGTGG AGGGGTTCGT GAGCATCGAG GGTGCTGTGG CCTACGTGCC CCAGGAGGCC
TGGGTGCAGA ACACCTCTGT GGTAGAGAAT GTGTGCTTCG GGCAGGAGCT GGACCCACCC
TGGCTGGAGA GAGTACTAGA AGCCTGTGCC CTGCAGCCAG ATGTGGACAG CTTCCCTGAG
GGAATCCACA CTTCAATTGG GGAGCAGGGC ATGAATCTCT CCGGAGGCCA GAAGCAGCGG
CTGAGCCTGG CCCGGGCTGT ATACAGAAAG GCAGCTGTGT ACCTGCTGGA TGACCCCCTG
GCGGCCCTGG ATGCCCACGT TGGCCAGCAT GTCTTCAACC AGACACGGAT TCTCGTGACG
CACGCACTCC ACATCCTGCC CCAGGCTGAT TGGATCATAG TGCTGGCAAA TGGGGCCATC
GCAGAGATGG GTTCCTACCA GGAGCTTCTG CAGAGGAAGG GGGCCCTCAT GTGTCTTCTG
GATCAAGCCA GACAGCCAGG AGATAGAGGA GAAGGAGAAA CAGAACCTGG GACCAGCACC
AAGGACCCCA GAGGCACCTC TGCAGGCAGG AGGCCCGAGC TTAGACGCGA GAGGTCCATC
AAGTCAGTCC CTGAGAAGGA CCGTACCACT TCAGAAGCCC AGACAGAGGT TCCTCTGGAT
GACCCTGACA GGGCAGGATG GCCAGCAGGA AAGGACAGCA TCCAATACGG CAGGGTGAAG
GCCACAGTGC ACCTGGCCTA CCTGCGTGCC GTGGGCACCC CCCTCTGCCT CTACGCACTC
TTCCTCTTCC TCTGCCAGCA AGTGGCCTCC TTCTGCCGGG GCTACTGGCT GAGCCTGTGG
GCGGACGACC CTGCAGTAGG TGGGCAGCAG ACGCAGGCAG CCCTGCGTGG CGGGATCTTC
GGGCTCCTCG GCTGTCTCCA AGCCATTGGG CTGTTTGCCT CCATGGCTGC GGTGCTCCTA
GGTGGGGCCC GGGCATCCAG GTTGCTCTTC CAGAGGCTCC TGTGGGATGT GGTGCGATCT
CCCATCAGCT TCTTTGAGCG GACACCCATT GGTCACCTGC TAAACCGCTT CTCCAAGGAG
ACAGACACGG TTGACGTGGA CATTCCAGAC AAACTCCGGT CCCTGCTGAT GTACGCCTTT
GGACTCCTGG AGGTCAGCCT GGTGGTGGCA GTGGCTACCC CACTGGCCAC TGTGGCCATC
CTGCCACTGT TTCTCCTCTA CGCTGGGTTT CAGAGCCTGT ATGTGGTTAG CTCATGCCAG
CTGAGACGCT TGGAGTCAGC CAGCTACTCG TCTGTCTGCT CCCACATGGC TGAGACGTTC
CAGGGCAGCA CAGTGGTCCG GGCATTCCGA ACCCAGGCCC CCTTTGTGGC TCAGAACAAT
GCTCGCGTAG ATGAAAGCCA GAGGATCAGT TTCCCGCGAC TGGTGGCTGA CAGGTGGCTT
GCGGCCAATG TGGAGCTCCT GGGGAATGGC CTGGTGTTTG CAGCTGCCAC GTGTGCTGTG
CTGAGCAAAG CCCACCTCAG TGCTGGCCTC GTGGGCTTCT CTGTCTCTGC TGCCCTCCAG
GTGACCCAGA CACTGCAGTG GGTTGTTCGC AACTGGACAG ACCTAGAGAA CAGCATCGTG
TCAGTGGAGC GGATGCAGGA CTATGCCTGG ACGCCCAAGG AGGCTCCCTG GAGGCTGCCC
ACATGTGCAG CTCAGCCCCC CTGGCCTCAG GGCGGGCAGA TCGAGTTCCG GGACTTTGGG
CTAAGATACC GACCTGAGCT CCCGCTGGCT GTGCAGGGCG TGTCCTTCAA GATCCACGCA
GGAGAGAAGG TGGGCATCGT TGGCAGGACC GGGGCAGGGA AGTCCTCCCT GGCCAGTGGG
CTGCTGCGGC TCCAGGAGGC AGCTGAGGGT GGGATCTGGA TCGACGGGGT CCCCATTGCC
CACGTGGGGC TGCACACACT GCGCTCCAGG ATCAGCATCA TCCCCCAGGA CCCCATCCTG
TTCCCTGGCT CTCTGCGGAT GAACCTCGAC CTGCTGCAGG AGCACTCGGA CGAGGCTATC
TGGGCAGCCC TGGAGACGGT GCAGCTCAAA GCCTTGGTGG CCAGCCTGCC CGGCCAGCTG
CAGTACAAGT GTGCTGACCG AGGCGAGGAC CTGAGCGTGG GCCAGAAACA GCTCCTGTGT
CTGGCACGTG CCCTTCTCCG GAAGACCCAG ATCCTCATCC TGGACGAGGC TACTGCTGCC
GTGGACCCTG GCACGGAGCT GCAGATGCAG GCCATGCTCG GGAGCTGGTT TGCACAGTGC
ACTGTGCTGC TCATTGCCCA CCGCCTGCGC TCCGTGATGG ACTGTGCCCG GGTTCTGGTC
ATGGACAAGG GGCAGGTGGC AGAGAGCGGC AGCCCGGCCC AGCTGCTGGC CCAGAAGGGC
CTGTTTTACA GACTGGCCCA GGAGTCAGGC CTGGTCTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011520781.1
CDS231..4709
Misc Feature(1)270..4703(+)
Misc Feature(2)1161..1964(+)
Misc Feature(3)2115..2684(+)
Misc Feature(4)2217..2240(+)
Misc Feature(5)2226..2633(+)
Misc Feature(6)2313..2324(+)
Misc Feature(7)2487..2516(+)
Misc Feature(8)2547..2564(+)
Misc Feature(9)2571..2582(+)
Misc Feature(10)2619..2639(+)
Misc Feature(11)3033..3845(+)
Misc Feature(12)3984..4646(+)
Translation
Position Chain Variation Link
12 12 a, c dbSNP:28529549
99 99 c, t dbSNP:565625561
104 104 c, t dbSNP:778876717
146 146 c, t dbSNP:374543396
165 165 c, t dbSNP:560426786
166 166 c, g dbSNP:370530149
265 265 a, g dbSNP:545266923
269 269 c, t dbSNP:767580449
283 283 -, ag dbSNP:776575086
296 296 c, t dbSNP:759670541
297 297 a, g, t dbSNP:371804833
311 311 c, g dbSNP:572911630
314 314 c, g, t dbSNP:770233922
326 326 a, g dbSNP:762218474
335 335 -, a dbSNP:72664223
337 337 a, g dbSNP:777330921
339 339 g, t dbSNP:557779326
343 343 c, g dbSNP:72653752
347 347 a, g, t dbSNP:771578225
348 348 a, c, g dbSNP:778544828
349 349 c, t dbSNP:757143605
351 351 c, g dbSNP:753761990
352 352 c, t dbSNP:777631658
353 353 -, c dbSNP:746531177
353 353 -, c dbSNP:768525663
354 354 -, c dbSNP:779429021
356 356 a, g dbSNP:756051632
375 375 c, g dbSNP:751588595
388 388 g, t dbSNP:766492973
392 392 a, c dbSNP:374115365
393 393 a, g dbSNP:372062746
397 397 a, g dbSNP:367832780
400 400 a, g dbSNP:374778258
401 401 c, t dbSNP:762176272
404 404 c, t dbSNP:777138361
407 407 c, t dbSNP:371336666
408 408 c, t dbSNP:761289104
409 409 -, ggggctacc dbSNP:74315110
409 409 a, g, t dbSNP:183648123
411 411 a, g dbSNP:745506209
412 412 a, g dbSNP:72657696
415 415 a, g dbSNP:774111532
420 420 a, c, t dbSNP:557180313
421 421 a, g dbSNP:777566074
427 427 c, t dbSNP:756021073
432 432 c, g dbSNP:748123458
442 442 a, c dbSNP:779991699
448 448 c, t dbSNP:758559224
450 450 -, gtg dbSNP:72664225
461 461 c, t dbSNP:745917696
462 462 a, g dbSNP:551026377
464 464 c, t dbSNP:778878232
465 465 c, t dbSNP:757533434
469 469 c, t dbSNP:754156749
475 475 c, t dbSNP:778282044
531 531 g, t dbSNP:756608278
532 532 c, g dbSNP:753016843
616 616 a, g dbSNP:72653753
622 622 a, g dbSNP:369280729
625 625 c, t dbSNP:545855341
667 667 c, t dbSNP:761526463
680 680 -, c dbSNP:387906860
680 680 a, c, g dbSNP:530448710
691 691 a, c dbSNP:563277493
693 693 a, g dbSNP:541797555
697 697 a, c dbSNP:746971185
698 698 c, t dbSNP:574395867
703 703 c, t dbSNP:2606921
704 704 a, g dbSNP:376219152
717 717 a, g dbSNP:192110266
723 723 c, g dbSNP:532499310
726 726 c, t dbSNP:201766106
727 727 a, g dbSNP:549917901
747 747 c, t dbSNP:531566232
776 776 -, g dbSNP:764710238
777 777 c, t dbSNP:775351926
779 779 a, g dbSNP:72664281
790 790 c, t dbSNP:561266462
791 791 a, g dbSNP:772153614
810 810 c, t dbSNP:749314494
826 826 -, t dbSNP:756622503
837 837 c, t dbSNP:556731532
842 842 a, g dbSNP:747414005
849 849 a, g dbSNP:72657697
870 870 a, g dbSNP:535223881
875 875 a, g dbSNP:72664282
884 884 g, t dbSNP:72653754
893 893 c, g dbSNP:776659185
898 898 c, t dbSNP:768926954
903 903 a, t dbSNP:550069568
904 904 a, g dbSNP:747292090
906 906 a, g dbSNP:72653755
909 909 c, t dbSNP:780415590
913 913 a, c, g dbSNP:746412523
928 928 c, g dbSNP:778393141
936 936 a, c dbSNP:372211360
937 937 a, t dbSNP:538065529
942 942 a, t dbSNP:753405638
943 943 c, t dbSNP:763591743
944 944 a, g dbSNP:755822656
948 948 a, g dbSNP:752492902
952 952 c, g dbSNP:767470535
954 954 g, t dbSNP:72650697
959 959 a, c dbSNP:759517670
962 962 -, ctc dbSNP:767477763
962 962 a, c dbSNP:774487251
963 963 g, t dbSNP:766352704
964 964 a, c dbSNP:761731967
969 969 -, gaa dbSNP:759848816
972 972 c, t dbSNP:72653756
977 977 g, t dbSNP:776799234
978 978 a, t dbSNP:768708445
981 981 c, t dbSNP:199645691
982 982 a, g dbSNP:548741161
984 984 a, c, t dbSNP:72653757
988 988 a, g dbSNP:779338019
995 995 a, g dbSNP:771478479
1008 1008 a, c, t dbSNP:777365579
1009 1009 a, g dbSNP:755700774
1011 1011 a, g dbSNP:752439860
1012 1012 c, g dbSNP:781119252
1018 1018 c, g, t dbSNP:751403636
1020 1020 c, g, t dbSNP:376409933
1021 1021 a, g dbSNP:753836442
1023 1023 a, g dbSNP:72657698
1024 1024 a, g dbSNP:760880587
1031 1031 a, c dbSNP:368547779
1040 1040 a, g dbSNP:766810653
1041 1041 a, g dbSNP:763368082
1044 1044 c, t dbSNP:199534175
1056 1056 a, g dbSNP:200051606
1058 1058 c, g, t dbSNP:776299480
1059 1059 a, g dbSNP:201615561
1063 1063 a, g dbSNP:746714494
1066 1066 a, g dbSNP:779707518
1070 1070 a, c, g dbSNP:371480297
1071 1071 a, g dbSNP:4780606
1074 1074 a, g dbSNP:778756902
1085 1085 c, t dbSNP:4780605
1086 1086 a, g dbSNP:752725393
1090 1090 a, c, g dbSNP:376822399
1091 1091 a, c, t dbSNP:766642486
1095 1095 -, ctacggcaagaagggagccagtggc dbSNP:74315139
1098 1098 c, t dbSNP:200330935
1099 1099 a, g, t dbSNP:765786719
1109 1109 c, g dbSNP:375066891
1119 1119 c, t dbSNP:776248626
1120 1120 a, g dbSNP:199729978
1143 1143 c, t dbSNP:746625905
1146 1146 a, g dbSNP:775152691
1148 1148 a, g dbSNP:771629401
1156 1156 c, g dbSNP:745637262
1160 1160 c, t dbSNP:536157653
1168 1168 -, t dbSNP:72664216
1172 1172 g, t dbSNP:757169047
1180 1180 a, g dbSNP:749267111
1181 1181 a, c, g dbSNP:78678589
1185 1185 a, g dbSNP:72657699
1190 1190 -, c dbSNP:72664226
1197 1197 a, g dbSNP:565924265
1199 1199 c, g, t dbSNP:766579912
1205 1205 a, g dbSNP:375845144
1212 1212 a, g dbSNP:750774345
1223 1223 g, t dbSNP:146523238
1230 1230 a, c dbSNP:777631910
1231 1231 g, t dbSNP:769647527
1234 1234 c, t dbSNP:747058720
1235 1235 c, t dbSNP:780042786
1243 1243 g, t dbSNP:758610942
1244 1244 c, t dbSNP:750740896
1246 1246 c, t dbSNP:779406291
1251 1251 c, g dbSNP:145232796
1253 1253 a, t dbSNP:757635771
1264 1264 c, t dbSNP:754261093
1268 1268 c, t dbSNP:764622792
1273 1273 a, c dbSNP:761108674
1274 1274 a, g dbSNP:752230147
1284 1284 c, t dbSNP:766980759
1286 1286 c, t dbSNP:200738286
1287 1287 a, g dbSNP:774051128
1288 1288 c, t dbSNP:369074083
1289 1289 c, t dbSNP:150016641
1290 1290 a, g dbSNP:372132926
1294 1294 g, t dbSNP:72653758
1304 1304 c, t dbSNP:139317080
1307 1307 a, g dbSNP:72664283
1311 1311 c, t dbSNP:772101560
1317 1317 -, caaacgctgtttgagcagcagaacatgtacagg dbSNP:387906353
1317 1317 c, t dbSNP:72650698
1318 1318 -, aaacgctgtttgagcagcagaacatgtacaggc dbSNP:74315156
1321 1321 c, g, t dbSNP:72653759
1322 1322 a, g dbSNP:757586544
1337 1337 c, g dbSNP:530073662
1338 1338 a, g dbSNP:72653760
1342 1342 c, t dbSNP:756614582
1347 1347 a, g dbSNP:753215042
1349 1349 -, gacagg dbSNP:761612541
1350 1350 c, g dbSNP:370022963
1356 1356 a, g dbSNP:754429280
1359 1359 c, t dbSNP:751076949
1360 1360 g, t dbSNP:765964408
1362 1362 c, t dbSNP:72650699
1367 1367 a, g dbSNP:772955656
1371 1371 c, t dbSNP:72664284
1374 1374 c, t dbSNP:72653761
1375 1375 a, g dbSNP:776373779
1379 1379 a, g dbSNP:138992331
1383 1383 a, g dbSNP:745903918
1385 1385 c, t dbSNP:774597736
1390 1390 c, g dbSNP:771256512
1400 1400 c, t dbSNP:749562556
1401 1401 a, g dbSNP:72653762
1404 1404 a, g dbSNP:756498547
1405 1405 a, g dbSNP:748562202
1406 1406 c, g, t dbSNP:72653763
1415 1415 c, t dbSNP:762876678
1420 1420 c, g dbSNP:773374784
1422 1422 a, g dbSNP:72653764
1423 1423 g, t dbSNP:769882654
1424 1424 a, c, t dbSNP:376518465
1425 1425 a, g dbSNP:368723482
1429 1429 c, t dbSNP:747386965
1430 1430 c, t dbSNP:780472669
1444 1444 c, t dbSNP:115663615
1445 1445 a, g dbSNP:576483544
1453 1453 a, g dbSNP:528670320
1462 1462 a, g, t dbSNP:756831300
1463 1463 c, g, t dbSNP:9930886
1464 1464 c, g, t dbSNP:755918422
1466 1466 c, g, t dbSNP:537017052
1467 1467 c, g dbSNP:767525456
1472 1472 c, t dbSNP:759542954
1473 1473 a, g dbSNP:200582171
1474 1474 c, t dbSNP:72653765
1475 1475 a, g dbSNP:9940825
1477 1477 a, g dbSNP:761923987
1478 1478 c, t dbSNP:143487365
1479 1479 a, g dbSNP:768869262
1483 1483 a, g dbSNP:536098094
1485 1485 c, t dbSNP:775853778
1486 1486 a, g dbSNP:772434460
1488 1488 c, g dbSNP:746428588
1493 1493 c, t dbSNP:114179357
1494 1494 a, g dbSNP:770532500
1496 1496 a, g, t dbSNP:547565680
1499 1499 c, t dbSNP:528603039
1500 1500 a, g dbSNP:747905455
1502 1502 c, t dbSNP:781169048
1505 1505 c, g dbSNP:201682224
1509 1509 c, t dbSNP:751569017
1513 1513 a, g dbSNP:201880691
1514 1514 c, t dbSNP:57499497
1527 1527 c, t dbSNP:563862970
1530 1530 c, g dbSNP:764251624
1532 1532 c, t dbSNP:760935787
1533 1533 a, g dbSNP:775802572
1541 1541 a, c, t dbSNP:150075392
1542 1542 a, g dbSNP:542502733
1544 1544 g, t dbSNP:771349496
1545 1545 c, g dbSNP:748770237
1548 1548 c, g, t dbSNP:72653766
1550 1550 c, t dbSNP:375433102
1553 1553 c, t dbSNP:200519199
1554 1554 a, g dbSNP:372059636
1558 1558 a, g dbSNP:142007498
1566 1566 c, g dbSNP:746781173
1569 1569 a, c dbSNP:751934523
1573 1573 g, t dbSNP:766697715
1574 1574 a, g dbSNP:58703366
1579 1579 c, t dbSNP:750898196
1583 1583 c, t dbSNP:57546826
1584 1584 a, g dbSNP:761364455
1591 1591 c, t dbSNP:554886514
1593 1593 c, g dbSNP:67996819
1598 1598 c, g, t dbSNP:141309818
1599 1599 a, g dbSNP:775349711
1600 1600 c, g dbSNP:771913153
1601 1601 a, t dbSNP:572266339
1604 1604 c, t dbSNP:370494121
1607 1607 c, t dbSNP:778756933
1610 1610 a, g dbSNP:770889156
1612 1612 a, g dbSNP:748212814
1616 1616 c, t dbSNP:781181816
1618 1618 a, t dbSNP:72653767
1632 1632 c, t dbSNP:755200644
1641 1641 a, c dbSNP:751783664
1642 1642 a, g dbSNP:780432555
1653 1653 c, g dbSNP:758767349
1654 1654 a, t dbSNP:151187637
1665 1665 a, g dbSNP:368746151
1668 1668 c, g dbSNP:746211393
1689 1689 c, g dbSNP:374244303
1690 1690 a, g dbSNP:72653768
1695 1695 c, t dbSNP:754360599
1703 1703 c, t dbSNP:764676656
1705 1705 a, g dbSNP:755513036
1708 1708 a, c dbSNP:752237181
1714 1714 a, t dbSNP:72653769
1717 1717 a, g dbSNP:759237396
1721 1721 a, c dbSNP:72653770
1729 1729 c, t dbSNP:372045804
1730 1730 c, t dbSNP:766232685
1731 1731 a, c, g dbSNP:772952563
1735 1735 a, t dbSNP:72653771
1741 1741 a, g dbSNP:769798621
1744 1744 a, g dbSNP:747009873
1747 1747 a, g, t dbSNP:151130276
1749 1749 c, g dbSNP:368017088
1751 1751 c, g dbSNP:561552566
1755 1755 g, t dbSNP:746159494
1756 1756 c, g dbSNP:779408186
1766 1766 c, t dbSNP:757506868
1768 1768 c, g dbSNP:749668818
1770 1770 a, g dbSNP:59157279
1782 1782 c, t dbSNP:72650700
1783 1783 a, g dbSNP:72653772
1786 1786 a, g dbSNP:767057050
1797 1797 a, g dbSNP:374546971
1799 1799 a, c, t dbSNP:145764775
1800 1800 a, g, t dbSNP:143588929
1804 1804 -, g dbSNP:72664217
1806 1806 c, t dbSNP:773079563
1807 1807 a, c, g dbSNP:761847996
1814 1814 c, t dbSNP:775706145
1815 1815 a, g dbSNP:140045277
1816 1816 a, g dbSNP:199643353
1819 1819 c, t dbSNP:774648925
1830 1830 g, t dbSNP:199634124
1833 1833 c, t dbSNP:72653773
1834 1834 c, t dbSNP:749568041
1835 1835 a, g dbSNP:778251096
1836 1836 c, g dbSNP:770172306
1839 1839 a, g dbSNP:748724484
1855 1855 c, t dbSNP:780671208
1860 1860 c, t dbSNP:754414760
1866 1866 a, g dbSNP:745373850
1869 1869 a, g dbSNP:56877937
1877 1877 c, g dbSNP:756992618
1881 1881 c, t dbSNP:532536884
1882 1882 c, t dbSNP:72653774
1887 1887 a, g dbSNP:558508305
1892 1892 c, t dbSNP:777753626
1894 1894 c, g dbSNP:769979506
1896 1896 c, t dbSNP:756119394
1901 1901 a, g dbSNP:752741312
1902 1902 a, g dbSNP:767373230
1904 1904 c, t dbSNP:758440783
1905 1905 a, g dbSNP:114149656
1914 1914 a, g dbSNP:575023438
1915 1915 c, t dbSNP:72653775
1929 1929 a, g dbSNP:143092672
1931 1931 c, g dbSNP:376767639
1933 1933 c, t dbSNP:66864704
1937 1937 a, g dbSNP:760958976
1938 1938 a, c dbSNP:369358409
1939 1939 c, g dbSNP:772487026
1954 1954 a, g dbSNP:745335274
1956 1956 a, g dbSNP:774053885
1957 1957 g, t dbSNP:770677975
1961 1961 c, t dbSNP:139771750
1965 1965 a, g dbSNP:749017755
1974 1974 c, g dbSNP:777700593
1977 1977 g, t dbSNP:541463984
1980 1980 a, c dbSNP:747904631
1990 1990 c, g dbSNP:527236047
1991 1991 c, t dbSNP:762221578
1993 1993 g, t dbSNP:750497192
1997 1997 c, t dbSNP:779024802
1999 1999 c, t dbSNP:537233133
2001 2001 c, g dbSNP:201193903
2003 2003 c, t dbSNP:764315042
2004 2004 a, c, g dbSNP:190761354
2005 2005 g, t dbSNP:753035055
2011 2011 c, t dbSNP:72653776
2013 2013 c, t dbSNP:150866831
2014 2014 a, g dbSNP:762499171
2020 2020 c, g dbSNP:772893948
2028 2028 c, t dbSNP:72653777
2029 2029 a, g dbSNP:761433545
2035 2035 -, gtctggt dbSNP:781369291
2042 2042 a, c dbSNP:776483503
2044 2044 c, t dbSNP:768271196
2045 2045 c, t dbSNP:61318127
2047 2047 c, g dbSNP:779918495
2052 2052 a, g dbSNP:772029460
2055 2055 g, t dbSNP:749334729
2065 2065 a, c dbSNP:777763168
2067 2067 a, g dbSNP:369816256
2068 2068 g, t dbSNP:72653778
2071 2071 c, t dbSNP:12931472
2072 2072 c, t dbSNP:375557810
2073 2073 a, g dbSNP:372235202
2078 2078 c, g dbSNP:751992037
2083 2083 a, g, t dbSNP:371997398
2087 2087 -, c dbSNP:72664218
2096 2096 c, t dbSNP:561150422
2097 2097 a, g dbSNP:764724652
2102 2102 c, t dbSNP:747341864
2103 2103 a, g dbSNP:780626660
2107 2107 a, g dbSNP:758972882
2111 2111 c, t dbSNP:143100448
2116 2116 c, t dbSNP:765789199
2119 2119 c, t dbSNP:756674188
2120 2120 c, g dbSNP:8058696
2122 2122 c, t dbSNP:763622746
2126 2126 a, c dbSNP:8058694
2128 2128 g, t dbSNP:775252212
2138 2138 c, t dbSNP:767365625
2139 2139 a, g dbSNP:759329140
2159 2159 c, t dbSNP:774095608
2164 2164 g, t dbSNP:763559553
2168 2168 c, t dbSNP:578241312
2174 2174 -, aataaacctcacggtgccccag dbSNP:74315158
2180 2180 c, t dbSNP:771328866
2181 2181 c, t dbSNP:749872772
2185 2185 c, t dbSNP:146936233
2186 2186 a, c, g dbSNP:141399693
2187 2187 g, t dbSNP:780781289
2191 2191 c, t dbSNP:754695089
2193 2193 a, c, t dbSNP:369410139
2194 2194 a, g dbSNP:72653779
2197 2197 -, gctgtctgctggctgttgtcggt dbSNP:74315130
2197 2197 a, g dbSNP:762665355
2202 2202 a, c dbSNP:750330150
2207 2207 a, g dbSNP:765290667
2208 2208 -, gctgttg dbSNP:760707891
2216 2216 c, t dbSNP:760798025
2217 2217 a, g, t dbSNP:72653780
2220 2220 c, t dbSNP:59002125
2223 2223 c, g dbSNP:774573071
2224 2224 c, t dbSNP:4341770
2225 2225 -, g dbSNP:72664227
2226 2226 g, t dbSNP:72653781
2229 2229 -, g dbSNP:775321637
2229 2229 -, g dbSNP:72664228
2229 2229 g, t dbSNP:771260023
2247 2247 c, t dbSNP:749625887
2248 2248 c, t dbSNP:67470842
2249 2249 a, g dbSNP:770314455
2252 2252 c, t dbSNP:747622924
2253 2253 a, g dbSNP:780726064
2260 2260 c, t dbSNP:72653782
2264 2264 a, g dbSNP:761805973
2268 2268 a, c dbSNP:746608585
2272 2272 c, t dbSNP:779590375
2275 2275 a, t dbSNP:758166222
2276 2276 a, g dbSNP:750276636
2277 2277 -, g dbSNP:758980634
2277 2277 g, t dbSNP:150128722
2279 2279 a, g dbSNP:372511255
2283 2283 c, g dbSNP:752811993
2288 2288 c, t dbSNP:57866002
2289 2289 a, g dbSNP:368806440
2293 2293 a, g dbSNP:774574107
2297 2297 a, c, t dbSNP:61266641
2298 2298 a, g dbSNP:773604010
2304 2304 a, g dbSNP:151272575
2305 2305 c, t dbSNP:766589881
2308 2308 c, t dbSNP:374763280
2309 2309 a, g dbSNP:189252048
2310 2310 a, g dbSNP:763209072
2311 2311 c, t dbSNP:199951066
2315 2315 c, t dbSNP:199913903
2316 2316 a, g dbSNP:143731811
2323 2323 a, c dbSNP:72653783
2327 2327 a, g, t dbSNP:72653784
2334 2334 -, g dbSNP:778327274
2336 2336 a, g dbSNP:557278262
2337 2337 c, g dbSNP:536095313
2348 2348 g, t dbSNP:774914077
2349 2349 a, g dbSNP:372121585
2351 2351 a, c, g dbSNP:778711523
2353 2353 c, t dbSNP:770792223
2355 2355 a, g dbSNP:114303883
2361 2361 a, c, g dbSNP:200800189
2364 2364 c, t dbSNP:140013237
2369 2369 c, t dbSNP:115546382
2370 2370 a, g dbSNP:200513114
2376 2376 c, g dbSNP:750590368
2392 2392 a, g dbSNP:72650701
2396 2396 a, g dbSNP:201193229
2397 2397 a, g dbSNP:762127969
2401 2401 a, g dbSNP:58073789
2405 2405 a, t dbSNP:59757815
2406 2406 c, t dbSNP:761145428
2407 2407 c, t dbSNP:72653785
2410 2410 a, g dbSNP:775061021
2418 2418 a, g dbSNP:771642702
2425 2425 a, g dbSNP:759130313
2432 2432 c, t dbSNP:774098410
2437 2437 a, g dbSNP:148573422
2454 2454 a, g dbSNP:59593133
2462 2462 g, t dbSNP:777474704
2466 2466 -, ggtgcagagt dbSNP:770020252
2467 2467 c, t dbSNP:769753486
2468 2468 c, t dbSNP:748098140
2472 2472 -, g dbSNP:748503108
2475 2475 c, g, t dbSNP:66616070
2481 2481 a, g dbSNP:759077182
2482 2482 a, t dbSNP:72653786
2489 2489 c, g dbSNP:774043587
2492 2492 c, t dbSNP:149822534
2493 2493 a, g dbSNP:72653787
2497 2497 g, t dbSNP:752518198
2498 2498 a, c dbSNP:116633099
2508 2508 c, t dbSNP:72653788
2509 2509 a, g dbSNP:769405586
2521 2521 c, t dbSNP:748000420
2523 2523 c, t dbSNP:776513864
2524 2524 a, g, t dbSNP:67561842
2527 2527 a, c dbSNP:72653789
2529 2529 a, g dbSNP:538408828
2534 2534 a, c dbSNP:66492417
2536 2536 a, g dbSNP:57794451
2546 2546 c, t dbSNP:757497225
2547 2547 a, g dbSNP:114185856
2552 2552 -, c dbSNP:72664229
2558 2558 a, g dbSNP:749406403
2559 2559 a, g dbSNP:72653790
2566 2566 c, t dbSNP:549658225
2572 2572 a, c, t dbSNP:72653791
2573 2573 a, g dbSNP:768106519
2586 2586 a, c dbSNP:755590289
2588 2588 c, t dbSNP:751097083
2589 2589 a, g, t dbSNP:72653792
2597 2597 a, c, g dbSNP:772679085
2598 2598 c, t dbSNP:114246406
2601 2601 a, g dbSNP:764975212
2616 2616 c, t dbSNP:72653793
2617 2617 a, g dbSNP:72653794
2624 2624 c, t dbSNP:769081280
2625 2625 a, g dbSNP:72653795
2629 2629 c, g, t dbSNP:72653796
2630 2630 a, g dbSNP:749892052
2633 2633 c, t dbSNP:374490625
2634 2634 a, g dbSNP:756766310
2639 2639 a, c dbSNP:372714722
2648 2648 a, g dbSNP:781086233
2655 2655 c, g dbSNP:72653797
2670 2670 c, g dbSNP:760420743
2671 2671 c, t dbSNP:752527142
2674 2674 c, t dbSNP:72653798
2675 2675 c, g dbSNP:138026855
2678 2678 a, g dbSNP:773156957
2679 2679 a, c, g dbSNP:181794120
2687 2687 c, t dbSNP:9924755
2688 2688 a, t dbSNP:769042480
2689 2689 a, c, t dbSNP:370039769
2691 2691 a, g dbSNP:772456820
2701 2701 a, g dbSNP:199990104
2702 2702 a, t dbSNP:779301637
2708 2708 a, c dbSNP:72650702
2709 2709 c, t dbSNP:756709738
2710 2710 a, g dbSNP:753378294
2714 2714 a, g dbSNP:777372493
2717 2717 g, t dbSNP:755811789
2718 2718 c, t dbSNP:60990156
2721 2721 c, t dbSNP:72653703
2727 2727 a, c dbSNP:201884545
2729 2729 c, g dbSNP:142701023
2733 2733 a, g dbSNP:754730506
2734 2734 c, t dbSNP:751451807
2739 2739 -, a dbSNP:67867306
2739 2739 a, g dbSNP:6416668
2741 2741 a, g dbSNP:761941142
2749 2749 c, t dbSNP:72653799
2750 2750 a, g dbSNP:563641079
2751 2751 g, t dbSNP:764401327
2762 2762 a, g dbSNP:375979955
2772 2772 c, g dbSNP:766400372
2796 2796 c, t dbSNP:376512808
2799 2799 a, g, t dbSNP:114349489
2802 2802 a, g dbSNP:747629569
2804 2804 c, g dbSNP:780854527
2806 2806 g, t dbSNP:754624352
2809 2809 c, g dbSNP:746808719
2816 2816 c, t dbSNP:780064112
2817 2817 c, g dbSNP:758275685
2819 2819 c, t dbSNP:750332089
2824 2824 a, g dbSNP:149081681
2825 2825 a, c dbSNP:115379860
2828 2828 a, c dbSNP:72664285
2832 2832 a, g dbSNP:377008733
2840 2840 g, t dbSNP:72653800
2846 2846 c, t dbSNP:373335815
2847 2847 a, g dbSNP:138049574
2856 2856 a, c, t dbSNP:59206042
2857 2857 a, g dbSNP:201334880
2858 2858 c, t dbSNP:376958386
2859 2859 a, g dbSNP:115167678
2863 2863 a, g dbSNP:776065362
2867 2867 c, t dbSNP:777202577
2868 2868 a, c dbSNP:767997301
2882 2882 c, t dbSNP:760288790
2883 2883 a, g dbSNP:775243858
2885 2885 a, g dbSNP:771892138
2889 2889 a, g, t dbSNP:778911783
2892 2892 c, g, t dbSNP:11861980
2893 2893 a, g dbSNP:116355959
2894 2894 c, t dbSNP:552531659
2898 2898 a, g dbSNP:111437625
2901 2901 g, t dbSNP:573589057
2904 2904 c, g dbSNP:60712230
2914 2914 c, g dbSNP:375890241
2918 2918 a, g dbSNP:780215689
2919 2919 a, g dbSNP:758666711
2931 2931 a, g dbSNP:539820701
2933 2933 c, t dbSNP:750784341
2935 2935 c, g dbSNP:765456179
2942 2942 a, g dbSNP:559575288
2954 2954 a, g dbSNP:140467297
2960 2960 a, c dbSNP:764693216
2966 2966 c, g dbSNP:760231794
2973 2973 c, g dbSNP:775190553
2976 2976 c, t dbSNP:767267908
2978 2978 a, c, t dbSNP:61731973
2979 2979 a, g dbSNP:142470921
2981 2981 -, cagg dbSNP:765405352
2981 2981 c, g dbSNP:749125777
2985 2985 g, t dbSNP:375196952
2993 2993 c, t dbSNP:575521072
2996 2996 a, g dbSNP:759128201
3009 3009 g, t dbSNP:557260944
3011 3011 c, g dbSNP:72653704
3016 3016 a, g dbSNP:775704936
3017 3017 -, c dbSNP:72664219
3017 3017 g, t dbSNP:72664286
3021 3021 a, g dbSNP:375592383
3028 3028 a, c, t dbSNP:72653801
3032 3032 -, cctctgcctctacgca dbSNP:74315152
3032 3032 c, t dbSNP:2856585
3033 3033 a, c dbSNP:61340537
3044 3044 c, g, t dbSNP:553008971
3045 3045 a, g dbSNP:72657689
3046 3046 c, t dbSNP:190557767
3047 3047 a, g dbSNP:778351699
3048 3048 c, g dbSNP:750835224
3052 3052 g, t dbSNP:72657690
3055 3055 a, t dbSNP:72657700
3058 3058 -, tcctct dbSNP:767359198
3060 3060 a, c dbSNP:142377854
3075 3075 a, g dbSNP:781769354
3077 3077 c, t dbSNP:754493974
3079 3079 -, cct dbSNP:759512269
3081 3081 c, t dbSNP:751120477
3083 3083 c, g dbSNP:765924261
3087 3087 c, g, t dbSNP:558710437
3088 3088 a, c, g dbSNP:72657691
3101 3101 a, g dbSNP:72664287
3106 3106 a, t dbSNP:776512349
3112 3112 c, t dbSNP:768619900
3113 3113 a, g dbSNP:759516647
3116 3116 c, t dbSNP:774551826
3118 3118 a, g dbSNP:147391297
3119 3119 a, c dbSNP:749463148
3127 3127 a, t dbSNP:778151578
3130 3130 a, g dbSNP:770232227
3131 3131 c, t dbSNP:748551497
3132 3132 c, g dbSNP:569941928
3136 3136 a, g dbSNP:755557398
3140 3140 a, g, t dbSNP:368465318
3142 3142 c, t dbSNP:757861271
3143 3143 a, g dbSNP:138410013
3151 3151 a, c dbSNP:764901693
3156 3156 a, c dbSNP:761565275
3157 3157 a, g dbSNP:374113337
3161 3161 a, c dbSNP:548522940
3162 3162 a, g dbSNP:529676674
3164 3164 c, g dbSNP:775296841
3170 3170 c, t dbSNP:375767696
3171 3171 a, c, g dbSNP:72657692
3179 3179 c, t dbSNP:113270297
3180 3180 a, g dbSNP:748500800
3189 3189 c, t dbSNP:777193567
3198 3198 a, g dbSNP:773471469
3213 3213 a, g, t dbSNP:762192080
3220 3220 c, t dbSNP:776995531
3221 3221 a, g dbSNP:372041663
3222 3222 a, g dbSNP:747365754
3226 3226 g, t dbSNP:776034467
3232 3232 a, g dbSNP:772505132
3238 3238 c, t dbSNP:150583228
3240 3240 c, g, t dbSNP:756768329
3241 3241 a, g dbSNP:373863345
3251 3251 a, g dbSNP:370805624
3260 3260 a, c dbSNP:755895436
3261 3261 c, g dbSNP:57179857
3269 3269 c, t dbSNP:767464604
3272 3272 a, g dbSNP:376087244
3285 3285 c, t dbSNP:72653705
3286 3286 a, c, g dbSNP:374451029
3296 3296 c, g dbSNP:765339542
3303 3303 -, ttt dbSNP:72664230
3303 3303 c, t dbSNP:761996195
3306 3306 a, g dbSNP:754074990
3310 3310 a, g dbSNP:371211631
3315 3315 c, t dbSNP:148064788
3317 3317 a, c dbSNP:775777175
3318 3318 a, g dbSNP:772632852
3319 3319 c, t dbSNP:759973159
3332 3332 a, g dbSNP:774855686
3334 3334 a, c dbSNP:574303164
3336 3336 c, t dbSNP:199571237
3340 3340 -, tct dbSNP:769437554
3342 3342 g, t dbSNP:72657693
3352 3352 c, t dbSNP:769376902
3356 3356 a, c, g dbSNP:780915265
3358 3358 a, c, t dbSNP:145411106
3359 3359 a, g, t dbSNP:374140753
3362 3362 g, t dbSNP:757383677
3365 3365 a, c, t dbSNP:72657694
3366 3366 a, g dbSNP:767588374
3367 3367 c, t dbSNP:759678455
3369 3369 a, g dbSNP:764365055
3372 3372 a, t dbSNP:760876912
3376 3376 c, g dbSNP:752972412
3381 3381 a, g dbSNP:377653646
3385 3385 g, t dbSNP:72657695
3387 3387 c, t dbSNP:41278174
3388 3388 c, g dbSNP:774796759
3392 3392 c, t dbSNP:771465541
3401 3401 a, g dbSNP:762424228
3404 3404 a, c, t dbSNP:60975032
3405 3405 a, g dbSNP:369518454
3416 3416 a, c dbSNP:747688307
3423 3423 g, t dbSNP:780909519
3436 3436 c, t dbSNP:374864191
3441 3441 a, g dbSNP:746841085
3447 3447 -, a dbSNP:371101978
3447 3447 -, a dbSNP:748469243
3447 3447 a, c dbSNP:780119666
3448 3448 a, c dbSNP:199637421
3452 3452 a, c dbSNP:758468125
3453 3453 c, t dbSNP:753948841
3454 3454 c, t dbSNP:777650741
3467 3467 c, t dbSNP:756236377
3468 3468 a, c dbSNP:752816345
3469 3469 c, t dbSNP:767760386
3479 3479 a, g dbSNP:755301606
3486 3486 a, c, t dbSNP:60707953
3489 3489 c, t dbSNP:377480088
3491 3491 c, t dbSNP:371889155
3492 3492 a, g dbSNP:773773146
3496 3496 a, g dbSNP:764594366
3508 3508 c, t dbSNP:755052004
3509 3509 c, g dbSNP:559504956
3516 3516 a, g dbSNP:747176430
3517 3517 c, t dbSNP:780276741
3523 3523 a, c dbSNP:758648156
3537 3537 c, t dbSNP:63749794
3538 3538 a, c, g dbSNP:63750427
3539 3539 c, t dbSNP:757849397
3540 3540 -, ttg dbSNP:72664231
3540 3540 c, t dbSNP:754402001
3542 3542 a, g dbSNP:763644344
3559 3559 c, g, t dbSNP:63750987
3560 3560 a, g, t dbSNP:145693403
3561 3561 -, t dbSNP:72664232
3572 3572 c, t dbSNP:115364698
3573 3573 c, t dbSNP:774256027
3576 3576 a, g dbSNP:770766953
3577 3577 c, t dbSNP:63749998
3578 3578 a, g dbSNP:63750758
3583 3583 a, g dbSNP:554806195
3586 3586 c, t dbSNP:63750459
3587 3587 a, g dbSNP:149775493
3594 3594 g, t dbSNP:63749807
3595 3595 c, g dbSNP:63750473
3602 3602 a, g dbSNP:780107077
3608 3608 c, g dbSNP:772396564
3609 3609 c, t dbSNP:28939701
3610 3610 a, c, g dbSNP:60791294
3612 3612 a, g dbSNP:63750146
3614 3614 a, g dbSNP:754351046
3618 3618 c, t dbSNP:72653706
3619 3619 a, c, g dbSNP:572351621
3624 3624 c, t dbSNP:72653743
3625 3625 a, t dbSNP:767060442
3628 3628 c, t dbSNP:145553069
3632 3632 -, c dbSNP:769105086
3652 3652 c, t dbSNP:751173976
3653 3653 a, t dbSNP:766135952
3654 3654 c, t dbSNP:762758350
3655 3655 a, g, t dbSNP:553479685
3656 3656 c, t dbSNP:59030767
3657 3657 a, g dbSNP:147794514
3658 3658 c, t dbSNP:775707011
3672 3672 a, g dbSNP:772050759
3674 3674 a, g dbSNP:746045818
3685 3685 c, t dbSNP:142128765
3686 3686 a, g, t dbSNP:202000035
3687 3687 c, t dbSNP:72653744
3688 3688 a, g dbSNP:63750457
3695 3695 a, g dbSNP:747602889
3699 3699 c, g dbSNP:143854720
3712 3712 c, t dbSNP:753771636
3713 3713 a, g dbSNP:763980825
3714 3714 -, g dbSNP:758506257
3721 3721 c, t dbSNP:376062004
3732 3732 c, g dbSNP:774355343
3739 3739 a, g dbSNP:114928628
3743 3743 a, g dbSNP:372578623
3745 3745 g, t dbSNP:773579765
3754 3754 a, c dbSNP:149460452
3759 3759 a, c dbSNP:572010361
3760 3760 c, t dbSNP:777163389
3761 3761 a, g dbSNP:58494932
3764 3764 c, t dbSNP:780601545
3765 3765 a, g dbSNP:779472538
3768 3768 a, g dbSNP:771584027
3772 3772 c, t dbSNP:201087449
3783 3783 c, g dbSNP:146284800
3785 3785 a, c dbSNP:778568997
3789 3789 a, g dbSNP:114920767
3790 3790 a, g dbSNP:753628351
3793 3793 c, g dbSNP:777757369
3797 3797 c, t dbSNP:200132882
3800 3800 c, t dbSNP:756077096
3801 3801 a, g dbSNP:752683023
3803 3803 a, g dbSNP:766504801
3805 3805 a, g dbSNP:63750607
3811 3811 -, ct dbSNP:745900279
3813 3813 a, g dbSNP:375983928
3819 3819 a, g dbSNP:763146137
3822 3822 c, g dbSNP:750630523
3825 3825 c, g, t dbSNP:762213485
3827 3827 c, t dbSNP:776917491
3831 3831 c, g dbSNP:765483994
3833 3833 g, t dbSNP:762007802
3836 3836 c, t dbSNP:754104618
3841 3841 c, t dbSNP:764318423
3846 3846 a, c dbSNP:371493792
3849 3849 a, t dbSNP:114017587
3851 3851 g, t dbSNP:775947674
3857 3857 c, t dbSNP:371191765
3858 3858 c, t dbSNP:63751215
3859 3859 a, g dbSNP:63751001
3865 3865 a, g dbSNP:72653745
3873 3873 a, c dbSNP:63750125
3874 3874 c, t dbSNP:770483331
3887 3887 c, t dbSNP:368931767
3888 3888 a, g dbSNP:141728905
3889 3889 -, t dbSNP:779018991
3895 3895 c, t dbSNP:769432314
3896 3896 a, g dbSNP:747993729
3900 3900 c, t dbSNP:63750402
3901 3901 a, g dbSNP:138700741
3905 3905 a, g dbSNP:745938225
3906 3906 c, t dbSNP:72653746
3908 3908 a, g dbSNP:778791988
3909 3909 c, g dbSNP:63749796
3912 3912 c, t dbSNP:63749992
3914 3914 g, t dbSNP:72653747
3915 3915 g, t dbSNP:150145577
3919 3919 a, g dbSNP:72653748
3920 3920 c, g dbSNP:72657701
3922 3922 c, t dbSNP:141449320
3929 3929 a, g dbSNP:773961518
3932 3932 a, g, t dbSNP:281865557
3934 3934 c, t dbSNP:772108097
3935 3935 c, t dbSNP:749327665
3936 3936 a, c dbSNP:199694536
3937 3937 c, g dbSNP:200242428
3948 3948 c, t dbSNP:148326870
3952 3952 a, c, g, t dbSNP:143212758
3954 3954 -, t dbSNP:764868012
3957 3957 a, g dbSNP:375647381
3966 3966 -, c dbSNP:72664220
3966 3966 a, c, g dbSNP:750897812
3967 3967 a, c dbSNP:576328904
3969 3969 c, t dbSNP:761440521
3971 3971 -, c dbSNP:72664221
3972 3972 -, t dbSNP:72664233
3975 3975 c, g dbSNP:149151337
3983 3983 c, t dbSNP:546064934
3984 3984 a, g dbSNP:760376992
3992 3992 c, g, t dbSNP:114175094
3993 3993 a, g dbSNP:771770753
3995 3995 -, g dbSNP:72664234
3999 3999 c, t dbSNP:368379895
4000 4000 a, g dbSNP:2238472
4015 4015 a, g dbSNP:63750209
4018 4018 -, accgacctgagctcccgctggctgtgcagggcgtgtccttcaagatcc dbSNP:74315128
4019 4019 c, t dbSNP:769820268
4020 4020 c, t dbSNP:72653749
4021 4021 a, g dbSNP:200010958
4023 4023 c, t dbSNP:759798432
4033 4033 c, t dbSNP:77913024
4034 4034 a, g dbSNP:61294695
4043 4043 a, g, t dbSNP:750893189
4047 4047 g, t dbSNP:779603756
4049 4049 c, t dbSNP:56982924
4050 4050 a, g dbSNP:141731889
4053 4053 c, t dbSNP:753457535
4060 4060 a, g dbSNP:751910206
4066 4066 a, g dbSNP:763831330
4067 4067 c, t dbSNP:760304927
4068 4068 a, g dbSNP:58694313
4069 4069 a, c dbSNP:369871412
4074 4074 a, g dbSNP:63750625
4077 4077 -, aag dbSNP:72664235
4079 4079 a, g dbSNP:376851894
4080 4080 a, g dbSNP:767119931
4082 4082 a, g dbSNP:754782996
4084 4084 a, g dbSNP:374086268
4088 4088 c, t dbSNP:375741855
4089 4089 a, g, t dbSNP:63751325
4092 4092 a, g dbSNP:63750446
4099 4099 c, t dbSNP:63750494
4100 4100 a, c, t dbSNP:201812902
4101 4101 a, g dbSNP:63749856
4104 4104 a, c, g dbSNP:63750410
4109 4109 a, g dbSNP:774787962
4109 4109 -, g dbSNP:72664236
4116 4116 c, t dbSNP:63751318
4126 4126 c, g dbSNP:771434033
4129 4129 a, g dbSNP:63750992
4133 4133 a, g dbSNP:749761484
4136 4136 a, g dbSNP:371122759
4137 4137 c, t dbSNP:63750759
4138 4138 a, g dbSNP:63751086
4145 4145 a, g dbSNP:747664194
4150 4150 c, g dbSNP:780887287
4158 4158 a, g dbSNP:63749823
4159 4159 a, g dbSNP:754656944
4168 4168 a, g dbSNP:72653750
4172 4172 c, t dbSNP:751220009
4173 4173 a, g dbSNP:766105758
4175 4175 c, t dbSNP:57499803
4176 4176 a, g dbSNP:79536709
4177 4177 a, g dbSNP:57695665
4185 4185 a, c, g dbSNP:58902671
4186 4186 c, t dbSNP:760794410
4189 4189 c, t dbSNP:752785718
4191 4191 a, c dbSNP:767636709
4193 4193 c, g, t dbSNP:60320257
4194 4194 a, c, g dbSNP:142505247
4196 4196 a, g dbSNP:63750235
4199 4199 c, g dbSNP:139128550
4201 4201 a, c, t dbSNP:63750414
4202 4202 a, g dbSNP:770266146
4203 4203 a, c dbSNP:376735995
4205 4205 c, t dbSNP:146265944
4207 4207 a, c dbSNP:780504422
4208 4208 a, c, g dbSNP:58259232
4212 4212 a, c, t dbSNP:28939702
4213 4213 a, g, t dbSNP:63750622
4222 4222 c, t dbSNP:63750608
4230 4230 c, g dbSNP:63749800
4233 4233 c, t dbSNP:63751112
4234 4234 c, t dbSNP:750243019
4238 4238 a, c, g dbSNP:63751111
4245 4245 a, c dbSNP:72664288
4247 4247 c, t dbSNP:141821068
4250 4250 c, g dbSNP:766707250
4253 4253 c, t dbSNP:758486813
4256 4256 c, t dbSNP:750674262
4257 4257 c, g dbSNP:63750018
4261 4261 c, t dbSNP:765472331
4266 4266 c, t dbSNP:63750428
4267 4267 a, g dbSNP:201275608
4270 4270 g, t dbSNP:764635677
4278 4278 a, g dbSNP:58695352
4283 4283 a, g dbSNP:139978668
4292 4292 a, g dbSNP:771581942
4298 4298 a, c, g dbSNP:200834294
4301 4301 a, c, t dbSNP:199668617
4301 4301 -, c dbSNP:72664237
4302 4302 a, g dbSNP:60285147
4304 4304 a, g dbSNP:375386682
4305 4305 a, g dbSNP:777835756
4320 4320 c, t dbSNP:756191351
4323 4323 g, t dbSNP:748103958
4327 4327 c, t dbSNP:371122482
4328 4328 c, g, t dbSNP:750573670
4337 4337 c, t dbSNP:368258006
4346 4346 g, t dbSNP:757540398
4348 4348 c, t dbSNP:754267653
4359 4359 c, t dbSNP:764446055
4361 4361 c, g, t dbSNP:373736094
4362 4362 a, g dbSNP:775998775
4368 4368 c, t dbSNP:766971195
4371 4371 a, c dbSNP:759123370
4373 4373 a, g dbSNP:534017491
4379 4379 c, g, t dbSNP:63750798
4379 4379 -, g dbSNP:67791546
4386 4386 a, g dbSNP:749035807
4389 4389 c, t dbSNP:66913554
4390 4390 a, g dbSNP:202080984
4394 4394 c, t dbSNP:199770983
4395 4395 a, g dbSNP:63751241
4398 4398 g, t dbSNP:772015821
4401 4401 c, g dbSNP:746009029
4406 4406 a, c dbSNP:63750700
4407 4407 a, g dbSNP:200485267
4413 4413 a, c dbSNP:387906859
4414 4414 -, a dbSNP:779044271
4415 4415 c, g dbSNP:149510465
4416 4416 -, agaa dbSNP:72664222
4421 4421 g, t dbSNP:761687550
4423 4423 a, t dbSNP:776557438
4437 4437 a, c, t dbSNP:760611511
4438 4438 c, g dbSNP:775319351
4440 4440 -, agaa dbSNP:387906352
4442 4442 c, g, t dbSNP:749415846
4444 4444 g, t dbSNP:58626288
4448 4448 c, g dbSNP:773407624
4449 4449 a, c, t dbSNP:59588658
4450 4450 a, c, g dbSNP:63751262
4451 4451 a, g dbSNP:58668703
4455 4455 a, c dbSNP:571678512
4461 4461 a, c dbSNP:549920304
4466 4466 c, t dbSNP:757960904
4468 4468 c, t dbSNP:63750295
4471 4471 c, t dbSNP:150230403
4475 4475 c, t dbSNP:376210462
4476 4476 a, g dbSNP:756910757
4480 4480 a, c, t dbSNP:763908026
4483 4483 c, t dbSNP:374236964
4486 4486 c, t dbSNP:760426231
4490 4490 c, t dbSNP:766362120
4491 4491 a, g dbSNP:531418668
4498 4498 c, t dbSNP:199950526
4499 4499 c, t dbSNP:763012366
4501 4501 a, g dbSNP:773205132
4502 4502 c, t dbSNP:72664289
4503 4503 -, acggagc dbSNP:74315109
4505 4505 a, g dbSNP:769879386
4511 4511 a, g dbSNP:61553825
4515 4515 -, a dbSNP:72664238
4524 4524 a, g dbSNP:143822047
4529 4529 c, t dbSNP:559653607
4532 4532 -, g dbSNP:72664239
4542 4542 a, g dbSNP:747383956
4552 4552 c, g dbSNP:780599196
4562 4562 c, t dbSNP:369157557
4567 4567 c, t dbSNP:759040684
4568 4568 c, g, t dbSNP:376955544
4571 4571 c, t dbSNP:371710180
4572 4572 c, t dbSNP:72547524
4573 4573 a, g dbSNP:753497739
4574 4574 c, g, t dbSNP:63750763
4579 4579 a, g dbSNP:57288618
4581 4581 g, t dbSNP:752497561
4583 4583 c, t dbSNP:767302163
4584 4584 a, g dbSNP:759407080
4588 4588 c, t dbSNP:774296589
4595 4595 c, t dbSNP:765262614
4599 4599 c, g, t dbSNP:776891665
4600 4600 a, g, t dbSNP:761098006
4602 4602 a, g dbSNP:767908367
4616 4616 a, c dbSNP:759971821
4617 4617 a, t dbSNP:72653751
4622 4622 a, g dbSNP:114099077
4631 4631 -, a dbSNP:72664280
4634 4634 a, c, g dbSNP:763316917
4637 4637 c, t dbSNP:548798705
4638 4638 a, g dbSNP:63751279
4645 4645 c, t dbSNP:63750135
4646 4646 a, g dbSNP:776255682
4650 4650 c, t dbSNP:566671584
4655 4655 c, g dbSNP:768365514
4656 4656 c, g dbSNP:746670054
4670 4670 c, t dbSNP:141860096
4671 4671 -, a dbSNP:780884882
4673 4673 a, c, g dbSNP:745761393
4674 4674 c, t dbSNP:778956327
4681 4681 c, g dbSNP:756250178
4690 4690 a, g dbSNP:752891529
4698 4698 a, g, t dbSNP:63750874
4700 4700 c, t dbSNP:368798086
4709 4709 -, agccag dbSNP:754847748
4715 4715 g, t dbSNP:755189930
4717 4717 c, t dbSNP:751851580
4719 4719 c, g dbSNP:766609974
4725 4725 c, t dbSNP:532797500
4726 4726 a, g dbSNP:3902401
4727 4727 a, t dbSNP:755791267
4734 4734 g, t dbSNP:190110936
4735 4735 c, t dbSNP:553868820
4740 4740 c, t dbSNP:761311941
4741 4741 a, c dbSNP:776054073
4743 4743 a, g dbSNP:377695659
4747 4747 a, g dbSNP:59461468
4750 4750 c, g dbSNP:775246845
4753 4753 c, t dbSNP:771739894
4809 4809 a, g dbSNP:147308589
4819 4819 a, c dbSNP:543273935
4835 4835 c, g dbSNP:781078594
4838 4838 c, g dbSNP:754884672
4861 4861 a, g dbSNP:149116500
4873 4873 g, t dbSNP:141192278
4883 4883 c, t dbSNP:545346754
4889 4889 g, t dbSNP:533911738
4903 4903 a, c dbSNP:577962491
4904 4904 a, t dbSNP:556560181
4909 4909 g, t dbSNP:537932232
4913 4913 c, t dbSNP:751435793
4929 4929 c, t dbSNP:138073543
4955 4955 c, t dbSNP:555114647
4962 4962 a, g dbSNP:148226174
4988 4988 c, t dbSNP:759538710
4999 4999 a, g dbSNP:562565973
5024 5024 a, c, g, t dbSNP:212096
5029 5029 c, g dbSNP:551388145
5063 5063 a, g dbSNP:539765825
5157 5157 c, t dbSNP:141291712
5160 5160 a, g dbSNP:750476431
5167 5167 c, g dbSNP:75141580
5192 5192 a, g dbSNP:144303704
5210 5210 a, g dbSNP:761964026
5234 5234 g, t dbSNP:776841068
5258 5258 a, g dbSNP:568182628
5265 5265 c, t dbSNP:549568055
5271 5271 a, g dbSNP:372646191

Target ORF information:

RefSeq Version XM_011522479
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X6, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011522479

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
ATGGCCGCGC CTGCTGAGCC CTGCGCGGGG CAGGGGGTCT GGAACCAGAC AGAGCCTGAA 
CCTGCCGCCA CCAGCCTGCT GAGCCTGTGC TTCCTGAGAA CAGCAGGGGT CTGGGTACCC
CCCATGTACC TCTGGGTCCT TGGTCCCATC TACCTCCTCT TCATCCACCA CCATGGCCGG
GGCTACCTCC GGATGTCCCC ACTCTTCAAA GCCAAGATGG TGCTTGGATT CGCCCTCATA
GTCCTGTGTA CCTCCAGCGT GGCTGTCGCT CTTTGGAAAA TCCAACAGGG AACGCCTGAG
GCCCCAGAAT TCCTCATTCA TCCTACTGTG TGGCTCACCA CGATGAGCTT CGCAGTGTTC
CTGATTCACA CCGAGAGGAA AAAGGGAGTC CAGTCATCTG GAGTGCTGTT TGGTTACTGG
CTTCTCTGCT TTGTCTTGCC AGCTACCAAC GCTGCCCAGC AGGCCTCCGG AGCGGGCTTC
CAGAGCGACC CTGTCCGCCA CCTGTCCACC TACCTATGCC TGTCTCTGGT GGTGGCACAG
TTTGTGCTGT CCTGCCTGGC GGATCAACCC CCCTTCTTCC CTGAAGACCC CCAGCAGTCT
AACCCCTGTC CAGAGACTGG GGCAGCCTTC CCCTCCAAAG CCACGTTCTG GTGGGTTTCT
GGCCTGGTCT GGAGGGGATA CAGGAGGCCA CTGAGACCAA AAGACCTCTG GTCGCTTGGG
AGAGAAAACT CCTCAGAAGA ACTTGTTTCC CGGCTTGAAA AGGAGTGGAT GAGGAACCGC
AGTGCAGCCC GGAGGCACAA CAAGGCAATA GCATTTAAAA GGAAAGGCGG CAGTGGCATG
AAGGCTCCAG AGACCGAGCC CTTCCTACGG CAAGAAGGGA GCCAGTGGCG CCCACTGCTG
AAGGCCATCT GGCAGGTGTT CCATTCTACC TTCCTCCTGG GGACCCTCAG CCTCATCATC
AGTGATGTCT TCAGGTTCAC TGTCCCCAAG CTGCTCAGCC TTTTCCTGGA GTTTATTGGT
GATCCCAAGC CTCCAGCCTG GAAGGGCTAC CTCCTCGCCG TGCTGATGTT CCTCTCAGCC
TGCCTGCAAA CGCTGTTTGA GCAGCAGAAC ATGTACAGGC TCAAGGTGCT GCAGATGAGG
TTGCGGTCGG CCATCACTGG CCTGGTGTAC AGAAAGGTCC TGGCTCTGTC CAGCGGCTCC
AGAAAGGCCA GTGCGGTGGG TGATGTGGTC AATCTGGTGT CCGTGGACGT GCAGCGGCTG
ACCGAGAGCG TCCTCTACCT CAACGGGCTG TGGCTGCCTC TCGTCTGGAT CGTGGTCTGC
TTCGTCTATC TCTGGCAGCT CCTGGGGCCC TCCGCCCTCA CTGCCATCGC TGTCTTCCTG
AGCCTCCTCC CTCTGAATTT CTTCATCTCC AAGAAAAGGA ACCACCATCA GGAGGAGCAA
ATGAGGCAGA AGGACTCACG GGCACGGCTC ACCAGCTCTA TCCTCAGGAA CTCGAAGACC
ATCAAGTTCC ATGGCTGGGA GGGAGCCTTT CTGGACAGAG TCCTGGGCAT CCGAGGCCAG
GAGCTGGGCG CCTTGCGGAC CTCCGGCCTC CTCTTCTCTG TGTCGCTGGT GTCCTTCCAA
GTGTCTACAT TTCTGGTCGC ACTGGTGGTG TTTGCTGTCC ACACTCTGGT GGCCGAGAAT
GCTATGAATG CAGAGAAAGC CTTTGTGACT CTCACAGTTC TCAACATCCT CAACAAGGCC
CAGGCTTTCC TGCCCTTCTC CATCCACTCC CTCGTCCAGG CCCGGGTGTC CTTTGACCGT
CTGGTCACCT TCCTCTGCCT GGAAGAAGTT GACCCTGGTG TCGTAGACTC AAGTTCCTCT
GGAAGCGCTG CCGGGAAGGA TTGCATCACC ATACACAGTG CCACCTTCGC CTGGTCCCAG
GAAAGCCCTC CCTGCCTCCA CAGAATAAAC CTCACGGTGC CCCAGGGCTG TCTGCTGGCT
GTTGTCGGTC CAGTGGGGGC AGGGAAGTCC TCCCTGCTGT CCGCCCTCCT TGGGGAGCTG
TCAAAGGTGG AGGGGTTCGT GAGCATCGAG GGTGCTGTGG CCTACGTGCC CCAGGAGGCC
TGGGTGCAGA ACACCTCTGT GGTAGAGAAT GTGTGCTTCG GGCAGGAGCT GGACCCACCC
TGGCTGGAGA GAGTACTAGA AGCCTGTGCC CTGCAGCCAG ATGTGGACAG CTTCCCTGAG
GGAATCCACA CTTCAATTGG GGAGCAGGGC ATGAATCTCT CCGGAGGCCA GAAGCAGCGG
CTGAGCCTGG CCCGGGCTGT ATACAGAAAG GCAGCTGTGT ACCTGCTGGA TGACCCCCTG
GCGGCCCTGG ATGCCCACGT TGGCCAGCAT GTCTTCAACC AGACACGGAT TCTCGTGACG
CACGCACTCC ACATCCTGCC CCAGGCTGAT TGGATCATAG TGCTGGCAAA TGGGGCCATC
GCAGAGATGG GTTCCTACCA GGAGCTTCTG CAGAGGAAGG GGGCCCTCAT GTGTCTTCTG
GATCAAGCCA GACAGCCAGG AGATAGAGGA GAAGGAGAAA CAGAACCTGG GACCAGCACC
AAGGACCCCA GAGGCACCTC TGCAGGCAGG AGGCCCGAGC TTAGACGCGA GAGGTCCATC
AAGTCAGTCC CTGAGAAGGA CCGTACCACT TCAGAAGCCC AGACAGAGGT TCCTCTGGAT
GACCCTGACA GGGCAGGATG GCCAGCAGGA AAGGACAGCA TCCAATACGG CAGGGTGAAG
GCCACAGTGC ACCTGGCCTA CCTGCGTGCC GTGGGCACCC CCCTCTGCCT CTACGCACTC
TTCCTCTTCC TCTGCCAGCA AGTGGCCTCC TTCTGCCGGG GCTACTGGCT GAGCCTGTGG
GCGGACGACC CTGCAGTAGG TGGGCAGCAG ACGCAGGCAG CCCTGCGTGG CGGGATCTTC
GGGCTCCTCG GCTGTCTCCA AGCCATTGGG CTGTTTGCCT CCATGGCTGC GGTGCTCCTA
GGTGGGGCCC GGGCATCCAG GTTGCTCTTC CAGAGGCTCC TGTGGGATGT GGTGCGATCT
CCCATCAGCT TCTTTGAGCG GACACCCATT GGTCACCTGC TAAACCGCTT CTCCAAGGAG
ACAGACACGG TTGACGTGGA CATTCCAGAC AAACTCCGGT CCCTGCTGAT GTACGCCTTT
GGACTCCTGG AGGTCAGCCT GGTGGTGGCA GTGGCTACCC CACTGGCCAC TGTGGCCATC
CTGCCACTGT TTCTCCTCTA CGCTGGGTTT CAGAGCCTGT ATGTGGTTAG CTCATGCCAG
CTGAGACGCT TGGAGTCAGC CAGCTACTCG TCTGTCTGCT CCCACATGGC TGAGACGTTC
CAGGGCAGCA CAGTGGTCCG GGCATTCCGA ACCCAGGCCC CCTTTGTGGC TCAGAACAAT
GCTCGCGTAG ATGAAAGCCA GAGGATCAGT TTCCCGCGAC TGGTGGCTGA CAGGTGGCTT
GCGGCCAATG TGGAGCTCCT GGGGAATGGC CTGGTGTTTG CAGCTGCCAC GTGTGCTGTG
CTGAGCAAAG CCCACCTCAG TGCTGGCCTC GTGGGCTTCT CTGTCTCTGC TGCCCTCCAG
GTGACCCAGA CACTGCAGTG GGTTGTTCGC AACTGGACAG ACCTAGAGAA CAGCATCGTG
TCAGTGGAGC GGATGCAGGA CTATGCCTGG ACGCCCAAGG AGGCTCCCTG GAGGCTGCCC
ACATGTGCAG CTCAGCCCCC CTGGCCTCAG GGCGGGCAGA TCGAGTTCCG GGACTTTGGG
CTAAGATACC GACCTGAGCT CCCGCTGGCT GTGCAGGGCG TGTCCTTCAA GATCCACGCA
GGAGAGAAGG TGGGCATCGT TGGCAGGACC GGGGCAGGGA AGTCCTCCCT GGCCAGTGGG
CTGCTGCGGC TCCAGGAGGC AGCTGAGGGT GGGATCTGGA TCGACGGGGT CCCCATTGCC
CACGTGGGGC TGCACACACT GCGCTCCAGG ATCAGCATCA TCCCCCAGGA CCCCATCCTG
TTCCCTGGCT CTCTGCGGAT GAACCTCGAC CTGCTGCAGG AGCACTCGGA CGAGGCTATC
TGGGCAGCCC TGGAGACGGT GCAGCTCAAA GCCTTGGTGG CCAGCCTGCC CGGCCAGCTG
CAGTACAAGT GTGCTGACCG AGGCGAGGAC CTGAGCGTGG GCCAGAAACA GCTCCTGTGT
CTGGCACGTG CCCTTCTCCG GAAGACCCAG ATCCTCATCC TGGACGAGGC TACTGCTGCC
GTGGACCCTG GCACGGAGCT GCAGATGCAG GCCATGCTCG GGAGCTGGTT TGCACAGTGC
ACTGTGCTGC TCATTGCCCA CCGCCTGCGC TCCGTGATGG ACTGTGCCCG GGTTCTGGTC
ATGGACAAGG GGCAGGTGGC AGAGAGCGGC AGCCCGGCCC AGCTGCTGGC CCAGAAGGGC
CTGTTTTACA GACTGGCCCA GGAGTCAGGC CTGGTCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56349
Accession Version XM_011522480.1
Sequence Information ORF Nucleotide Sequence (Length: 4170bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product multidrug resistance-associated protein 6 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
ATGAGCTTCG CAGTGTTCCT GATTCACACC GAGAGGAAAA AGGGAGTCCA GTCATCTGGA 
GTGCTGTTTG GTTACTGGCT TCTCTGCTTT GTCTTGCCAG CTACCAACGC TGCCCAGCAG
GCCTCCGGAG CGGGCTTCCA GAGCGACCCT GTCCGCCACC TGTCCACCTA CCTATGCCTG
TCTCTGGTGG TGGCACAGTT TGTGCTGTCC TGCCTGGCGG ATCAACCCCC CTTCTTCCCT
GAAGACCCCC AGCAGTCTAA CCCCTGTCCA GAGACTGGGG CAGCCTTCCC CTCCAAAGCC
ACGTTCTGGT GGGTTTCTGG CCTGGTCTGG AGGGGATACA GGAGGCCACT GAGACCAAAA
GACCTCTGGT CGCTTGGGAG AGAAAACTCC TCAGAAGAAC TTGTTTCCCG GCTTGAAAAG
GAGTGGATGA GGAACCGCAG TGCAGCCCGG AGGCACAACA AGGCAATAGC ATTTAAAAGG
AAAGGCGGCA GTGGCATGAA GGCTCCAGAG ACCGAGCCCT TCCTACGGCA AGAAGGGAGC
CAGTGGCGCC CACTGCTGAA GGCCATCTGG CAGGTGTTCC ATTCTACCTT CCTCCTGGGG
ACCCTCAGCC TCATCATCAG TGATGTCTTC AGGTTCACTG TCCCCAAGCT GCTCAGCCTT
TTCCTGGAGT TTATTGGTGA TCCCAAGCCT CCAGCCTGGA AGGGCTACCT CCTCGCCGTG
CTGATGTTCC TCTCAGCCTG CCTGCAAACG CTGTTTGAGC AGCAGAACAT GTACAGGCTC
AAGGTGCTGC AGATGAGGTT GCGGTCGGCC ATCACTGGCC TGGTGTACAG AAAGGTCCTG
GCTCTGTCCA GCGGCTCCAG AAAGGCCAGT GCGGTGGGTG ATGTGGTCAA TCTGGTGTCC
GTGGACGTGC AGCGGCTGAC CGAGAGCGTC CTCTACCTCA ACGGGCTGTG GCTGCCTCTC
GTCTGGATCG TGGTCTGCTT CGTCTATCTC TGGCAGCTCC TGGGGCCCTC CGCCCTCACT
GCCATCGCTG TCTTCCTGAG CCTCCTCCCT CTGAATTTCT TCATCTCCAA GAAAAGGAAC
CACCATCAGG AGGAGCAAAT GAGGCAGAAG GACTCACGGG CACGGCTCAC CAGCTCTATC
CTCAGGAACT CGAAGACCAT CAAGTTCCAT GGCTGGGAGG GAGCCTTTCT GGACAGAGTC
CTGGGCATCC GAGGCCAGGA GCTGGGCGCC TTGCGGACCT CCGGCCTCCT CTTCTCTGTG
TCGCTGGTGT CCTTCCAAGT GTCTACATTT CTGGTCGCAC TGGTGGTGTT TGCTGTCCAC
ACTCTGGTGG CCGAGAATGC TATGAATGCA GAGAAAGCCT TTGTGACTCT CACAGTTCTC
AACATCCTCA ACAAGGCCCA GGCTTTCCTG CCCTTCTCCA TCCACTCCCT CGTCCAGGCC
CGGGTGTCCT TTGACCGTCT GGTCACCTTC CTCTGCCTGG AAGAAGTTGA CCCTGGTGTC
GTAGACTCAA GTTCCTCTGG AAGCGCTGCC GGGAAGGATT GCATCACCAT ACACAGTGCC
ACCTTCGCCT GGTCCCAGGA AAGCCCTCCC TGCCTCCACA GAATAAACCT CACGGTGCCC
CAGGGCTGTC TGCTGGCTGT TGTCGGTCCA GTGGGGGCAG GGAAGTCCTC CCTGCTGTCC
GCCCTCCTTG GGGAGCTGTC AAAGGTGGAG GGGTTCGTGA GCATCGAGGG TGCTGTGGCC
TACGTGCCCC AGGAGGCCTG GGTGCAGAAC ACCTCTGTGG TAGAGAATGT GTGCTTCGGG
CAGGAGCTGG ACCCACCCTG GCTGGAGAGA GTACTAGAAG CCTGTGCCCT GCAGCCAGAT
GTGGACAGCT TCCCTGAGGG AATCCACACT TCAATTGGGG AGCAGGGCAT GAATCTCTCC
GGAGGCCAGA AGCAGCGGCT GAGCCTGGCC CGGGCTGTAT ACAGAAAGGC AGCTGTGTAC
CTGCTGGATG ACCCCCTGGC GGCCCTGGAT GCCCACGTTG GCCAGCATGT CTTCAACCAG
GTCATTGGGC CTGGTGGACT ACTCCAGGGA ACAACACGGA TTCTCGTGAC GCACGCACTC
CACATCCTGC CCCAGGCTGA TTGGATCATA GTGCTGGCAA ATGGGGCCAT CGCAGAGATG
GGTTCCTACC AGGAGCTTCT GCAGAGGAAG GGGGCCCTCA TGTGTCTTCT GGATCAAGCC
AGACAGCCAG GAGATAGAGG AGAAGGAGAA ACAGAACCTG GGACCAGCAC CAAGGACCCC
AGAGGCACCT CTGCAGGCAG GAGGCCCGAG CTTAGACGCG AGAGGTCCAT CAAGTCAGTC
CCTGAGAAGG ACCGTACCAC TTCAGAAGCC CAGACAGAGG TTCCTCTGGA TGACCCTGAC
AGGGCAGGAT GGCCAGCAGG AAAGGACAGC ATCCAATACG GCAGGGTGAA GGCCACAGTG
CACCTGGCCT ACCTGCGTGC CGTGGGCACC CCCCTCTGCC TCTACGCACT CTTCCTCTTC
CTCTGCCAGC AAGTGGCCTC CTTCTGCCGG GGCTACTGGC TGAGCCTGTG GGCGGACGAC
CCTGCAGTAG GTGGGCAGCA GACGCAGGCA GCCCTGCGTG GCGGGATCTT CGGGCTCCTC
GGCTGTCTCC AAGCCATTGG GCTGTTTGCC TCCATGGCTG CGGTGCTCCT AGGTGGGGCC
CGGGCATCCA GGTTGCTCTT CCAGAGGCTC CTGTGGGATG TGGTGCGATC TCCCATCAGC
TTCTTTGAGC GGACACCCAT TGGTCACCTG CTAAACCGCT TCTCCAAGGA GACAGACACG
GTTGACGTGG ACATTCCAGA CAAACTCCGG TCCCTGCTGA TGTACGCCTT TGGACTCCTG
GAGGTCAGCC TGGTGGTGGC AGTGGCTACC CCACTGGCCA CTGTGGCCAT CCTGCCACTG
TTTCTCCTCT ACGCTGGGTT TCAGAGCCTG TATGTGGTTA GCTCATGCCA GCTGAGACGC
TTGGAGTCAG CCAGCTACTC GTCTGTCTGC TCCCACATGG CTGAGACGTT CCAGGGCAGC
ACAGTGGTCC GGGCATTCCG AACCCAGGCC CCCTTTGTGG CTCAGAACAA TGCTCGCGTA
GATGAAAGCC AGAGGATCAG TTTCCCGCGA CTGGTGGCTG ACAGGTGGCT TGCGGCCAAT
GTGGAGCTCC TGGGGAATGG CCTGGTGTTT GCAGCTGCCA CGTGTGCTGT GCTGAGCAAA
GCCCACCTCA GTGCTGGCCT CGTGGGCTTC TCTGTCTCTG CTGCCCTCCA GGTGACCCAG
ACACTGCAGT GGGTTGTTCG CAACTGGACA GACCTAGAGA ACAGCATCGT GTCAGTGGAG
CGGATGCAGG ACTATGCCTG GACGCCCAAG GAGGCTCCCT GGAGGCTGCC CACATGTGCA
GCTCAGCCCC CCTGGCCTCA GGGCGGGCAG ATCGAGTTCC GGGACTTTGG GCTAAGATAC
CGACCTGAGC TCCCGCTGGC TGTGCAGGGC GTGTCCTTCA AGATCCACGC AGGAGAGAAG
GTGGGCATCG TTGGCAGGAC CGGGGCAGGG AAGTCCTCCC TGGCCAGTGG GCTGCTGCGG
CTCCAGGAGG CAGCTGAGGG TGGGATCTGG ATCGACGGGG TCCCCATTGC CCACGTGGGG
CTGCACACAC TGCGCTCCAG GATCAGCATC ATCCCCCAGG ACCCCATCCT GTTCCCTGGC
TCTCTGCGGA TGAACCTCGA CCTGCTGCAG GAGCACTCGG ACGAGGCTAT CTGGGCAGCC
CTGGAGACGG TGCAGCTCAA AGCCTTGGTG GCCAGCCTGC CCGGCCAGCT GCAGTACAAG
TGTGCTGACC GAGGCGAGGA CCTGAGCGTG GGCCAGAAAC AGCTCCTGTG TCTGGCACGT
GCCCTTCTCC GGAAGACCCA GATCCTCATC CTGGACGAGG CTACTGCTGC CGTGGACCCT
GGCACGGAGC TGCAGATGCA GGCCATGCTC GGGAGCTGGT TTGCACAGTG CACTGTGCTG
CTCATTGCCC ACCGCCTGCG CTCCGTGATG GACTGTGCCC GGGTTCTGGT CATGGACAAG
GGGCAGGTGG CAGAGAGCGG CAGCCCGGCC CAGCTGCTGG CCCAGAAGGG CCTGTTTTAC
AGACTGGCCC AGGAGTCAGG CCTGGTCTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011520782.1
CDS328..4497
Misc Feature(1)328..4491(+)
Misc Feature(2)916..1719(+)
Misc Feature(3)1870..2472(+)
Misc Feature(4)1972..1995(+)
Misc Feature(5)1981..2421(+)
Misc Feature(6)2068..2079(+)
Misc Feature(7)2242..2271(+)
Misc Feature(8)2302..2319(+)
Misc Feature(9)2326..2337(+)
Misc Feature(10)2407..2427(+)
Misc Feature(11)2821..3633(+)
Misc Feature(12)3772..4434(+)
Translation
Position Chain Variation Link
14 14 c, g dbSNP:751588595
27 27 g, t dbSNP:766492973
31 31 a, c dbSNP:374115365
32 32 a, g dbSNP:372062746
36 36 a, g dbSNP:367832780
39 39 a, g dbSNP:374778258
40 40 c, t dbSNP:762176272
43 43 c, t dbSNP:777138361
46 46 c, t dbSNP:371336666
47 47 c, t dbSNP:761289104
48 48 -, ggggctacc dbSNP:74315110
48 48 a, g, t dbSNP:183648123
50 50 a, g dbSNP:745506209
51 51 a, g dbSNP:72657696
54 54 a, g dbSNP:774111532
59 59 a, c, t dbSNP:557180313
60 60 a, g dbSNP:777566074
66 66 c, t dbSNP:756021073
71 71 c, g dbSNP:748123458
81 81 a, c dbSNP:779991699
87 87 c, t dbSNP:758559224
189 189 a, g dbSNP:749698469
205 205 -, gtg dbSNP:72664225
216 216 c, t dbSNP:745917696
217 217 a, g dbSNP:551026377
219 219 c, t dbSNP:778878232
220 220 c, t dbSNP:757533434
224 224 c, t dbSNP:754156749
230 230 c, t dbSNP:778282044
286 286 g, t dbSNP:756608278
287 287 c, g dbSNP:753016843
371 371 a, g dbSNP:72653753
377 377 a, g dbSNP:369280729
380 380 c, t dbSNP:545855341
422 422 c, t dbSNP:761526463
435 435 -, c dbSNP:387906860
435 435 a, c, g dbSNP:530448710
446 446 a, c dbSNP:563277493
448 448 a, g dbSNP:541797555
452 452 a, c dbSNP:746971185
453 453 c, t dbSNP:574395867
458 458 c, t dbSNP:2606921
459 459 a, g dbSNP:376219152
472 472 a, g dbSNP:192110266
478 478 c, g dbSNP:532499310
481 481 c, t dbSNP:201766106
482 482 a, g dbSNP:549917901
502 502 c, t dbSNP:531566232
531 531 -, g dbSNP:764710238
532 532 c, t dbSNP:775351926
534 534 a, g dbSNP:72664281
545 545 c, t dbSNP:561266462
546 546 a, g dbSNP:772153614
565 565 c, t dbSNP:749314494
581 581 -, t dbSNP:756622503
592 592 c, t dbSNP:556731532
597 597 a, g dbSNP:747414005
604 604 a, g dbSNP:72657697
625 625 a, g dbSNP:535223881
630 630 a, g dbSNP:72664282
639 639 g, t dbSNP:72653754
648 648 c, g dbSNP:776659185
653 653 c, t dbSNP:768926954
658 658 a, t dbSNP:550069568
659 659 a, g dbSNP:747292090
661 661 a, g dbSNP:72653755
664 664 c, t dbSNP:780415590
668 668 a, c, g dbSNP:746412523
683 683 c, g dbSNP:778393141
691 691 a, c dbSNP:372211360
692 692 a, t dbSNP:538065529
697 697 a, t dbSNP:753405638
698 698 c, t dbSNP:763591743
699 699 a, g dbSNP:755822656
703 703 a, g dbSNP:752492902
707 707 c, g dbSNP:767470535
709 709 g, t dbSNP:72650697
714 714 a, c dbSNP:759517670
717 717 -, ctc dbSNP:767477763
717 717 a, c dbSNP:774487251
718 718 g, t dbSNP:766352704
719 719 a, c dbSNP:761731967
724 724 -, gaa dbSNP:759848816
727 727 c, t dbSNP:72653756
732 732 g, t dbSNP:776799234
733 733 a, t dbSNP:768708445
736 736 c, t dbSNP:199645691
737 737 a, g dbSNP:548741161
739 739 a, c, t dbSNP:72653757
743 743 a, g dbSNP:779338019
750 750 a, g dbSNP:771478479
763 763 a, c, t dbSNP:777365579
764 764 a, g dbSNP:755700774
766 766 a, g dbSNP:752439860
767 767 c, g dbSNP:781119252
773 773 c, g, t dbSNP:751403636
775 775 c, g, t dbSNP:376409933
776 776 a, g dbSNP:753836442
778 778 a, g dbSNP:72657698
779 779 a, g dbSNP:760880587
786 786 a, c dbSNP:368547779
795 795 a, g dbSNP:766810653
796 796 a, g dbSNP:763368082
799 799 c, t dbSNP:199534175
811 811 a, g dbSNP:200051606
813 813 c, g, t dbSNP:776299480
814 814 a, g dbSNP:201615561
818 818 a, g dbSNP:746714494
821 821 a, g dbSNP:779707518
825 825 a, c, g dbSNP:371480297
826 826 a, g dbSNP:4780606
829 829 a, g dbSNP:778756902
840 840 c, t dbSNP:4780605
841 841 a, g dbSNP:752725393
845 845 a, c, g dbSNP:376822399
846 846 a, c, t dbSNP:766642486
850 850 -, ctacggcaagaagggagccagtggc dbSNP:74315139
853 853 c, t dbSNP:200330935
854 854 a, g, t dbSNP:765786719
864 864 c, g dbSNP:375066891
874 874 c, t dbSNP:776248626
875 875 a, g dbSNP:199729978
898 898 c, t dbSNP:746625905
901 901 a, g dbSNP:775152691
903 903 a, g dbSNP:771629401
911 911 c, g dbSNP:745637262
915 915 c, t dbSNP:536157653
923 923 -, t dbSNP:72664216
927 927 g, t dbSNP:757169047
935 935 a, g dbSNP:749267111
936 936 a, c, g dbSNP:78678589
940 940 a, g dbSNP:72657699
945 945 -, c dbSNP:72664226
952 952 a, g dbSNP:565924265
954 954 c, g, t dbSNP:766579912
960 960 a, g dbSNP:375845144
967 967 a, g dbSNP:750774345
978 978 g, t dbSNP:146523238
985 985 a, c dbSNP:777631910
986 986 g, t dbSNP:769647527
989 989 c, t dbSNP:747058720
990 990 c, t dbSNP:780042786
998 998 g, t dbSNP:758610942
999 999 c, t dbSNP:750740896
1001 1001 c, t dbSNP:779406291
1006 1006 c, g dbSNP:145232796
1008 1008 a, t dbSNP:757635771
1019 1019 c, t dbSNP:754261093
1023 1023 c, t dbSNP:764622792
1028 1028 a, c dbSNP:761108674
1029 1029 a, g dbSNP:752230147
1039 1039 c, t dbSNP:766980759
1041 1041 c, t dbSNP:200738286
1042 1042 a, g dbSNP:774051128
1043 1043 c, t dbSNP:369074083
1044 1044 c, t dbSNP:150016641
1045 1045 a, g dbSNP:372132926
1049 1049 g, t dbSNP:72653758
1059 1059 c, t dbSNP:139317080
1062 1062 a, g dbSNP:72664283
1066 1066 c, t dbSNP:772101560
1072 1072 -, caaacgctgtttgagcagcagaacatgtacagg dbSNP:387906353
1072 1072 c, t dbSNP:72650698
1073 1073 -, aaacgctgtttgagcagcagaacatgtacaggc dbSNP:74315156
1076 1076 c, g, t dbSNP:72653759
1077 1077 a, g dbSNP:757586544
1092 1092 c, g dbSNP:530073662
1093 1093 a, g dbSNP:72653760
1097 1097 c, t dbSNP:756614582
1102 1102 a, g dbSNP:753215042
1104 1104 -, gacagg dbSNP:761612541
1105 1105 c, g dbSNP:370022963
1111 1111 a, g dbSNP:754429280
1114 1114 c, t dbSNP:751076949
1115 1115 g, t dbSNP:765964408
1117 1117 c, t dbSNP:72650699
1122 1122 a, g dbSNP:772955656
1126 1126 c, t dbSNP:72664284
1129 1129 c, t dbSNP:72653761
1130 1130 a, g dbSNP:776373779
1134 1134 a, g dbSNP:138992331
1138 1138 a, g dbSNP:745903918
1140 1140 c, t dbSNP:774597736
1145 1145 c, g dbSNP:771256512
1155 1155 c, t dbSNP:749562556
1156 1156 a, g dbSNP:72653762
1159 1159 a, g dbSNP:756498547
1160 1160 a, g dbSNP:748562202
1161 1161 c, g, t dbSNP:72653763
1170 1170 c, t dbSNP:762876678
1175 1175 c, g dbSNP:773374784
1177 1177 a, g dbSNP:72653764
1178 1178 g, t dbSNP:769882654
1179 1179 a, c, t dbSNP:376518465
1180 1180 a, g dbSNP:368723482
1184 1184 c, t dbSNP:747386965
1185 1185 c, t dbSNP:780472669
1199 1199 c, t dbSNP:115663615
1200 1200 a, g dbSNP:576483544
1208 1208 a, g dbSNP:528670320
1217 1217 a, g, t dbSNP:756831300
1218 1218 c, g, t dbSNP:9930886
1219 1219 c, g, t dbSNP:755918422
1221 1221 c, g, t dbSNP:537017052
1222 1222 c, g dbSNP:767525456
1227 1227 c, t dbSNP:759542954
1228 1228 a, g dbSNP:200582171
1229 1229 c, t dbSNP:72653765
1230 1230 a, g dbSNP:9940825
1232 1232 a, g dbSNP:761923987
1233 1233 c, t dbSNP:143487365
1234 1234 a, g dbSNP:768869262
1238 1238 a, g dbSNP:536098094
1240 1240 c, t dbSNP:775853778
1241 1241 a, g dbSNP:772434460
1243 1243 c, g dbSNP:746428588
1248 1248 c, t dbSNP:114179357
1249 1249 a, g dbSNP:770532500
1251 1251 a, g, t dbSNP:547565680
1254 1254 c, t dbSNP:528603039
1255 1255 a, g dbSNP:747905455
1257 1257 c, t dbSNP:781169048
1260 1260 c, g dbSNP:201682224
1264 1264 c, t dbSNP:751569017
1268 1268 a, g dbSNP:201880691
1269 1269 c, t dbSNP:57499497
1282 1282 c, t dbSNP:563862970
1285 1285 c, g dbSNP:764251624
1287 1287 c, t dbSNP:760935787
1288 1288 a, g dbSNP:775802572
1296 1296 a, c, t dbSNP:150075392
1297 1297 a, g dbSNP:542502733
1299 1299 g, t dbSNP:771349496
1300 1300 c, g dbSNP:748770237
1303 1303 c, g, t dbSNP:72653766
1305 1305 c, t dbSNP:375433102
1308 1308 c, t dbSNP:200519199
1309 1309 a, g dbSNP:372059636
1313 1313 a, g dbSNP:142007498
1321 1321 c, g dbSNP:746781173
1324 1324 a, c dbSNP:751934523
1328 1328 g, t dbSNP:766697715
1329 1329 a, g dbSNP:58703366
1334 1334 c, t dbSNP:750898196
1338 1338 c, t dbSNP:57546826
1339 1339 a, g dbSNP:761364455
1346 1346 c, t dbSNP:554886514
1348 1348 c, g dbSNP:67996819
1353 1353 c, g, t dbSNP:141309818
1354 1354 a, g dbSNP:775349711
1355 1355 c, g dbSNP:771913153
1356 1356 a, t dbSNP:572266339
1359 1359 c, t dbSNP:370494121
1362 1362 c, t dbSNP:778756933
1365 1365 a, g dbSNP:770889156
1367 1367 a, g dbSNP:748212814
1371 1371 c, t dbSNP:781181816
1373 1373 a, t dbSNP:72653767
1387 1387 c, t dbSNP:755200644
1396 1396 a, c dbSNP:751783664
1397 1397 a, g dbSNP:780432555
1408 1408 c, g dbSNP:758767349
1409 1409 a, t dbSNP:151187637
1420 1420 a, g dbSNP:368746151
1423 1423 c, g dbSNP:746211393
1444 1444 c, g dbSNP:374244303
1445 1445 a, g dbSNP:72653768
1450 1450 c, t dbSNP:754360599
1458 1458 c, t dbSNP:764676656
1460 1460 a, g dbSNP:755513036
1463 1463 a, c dbSNP:752237181
1469 1469 a, t dbSNP:72653769
1472 1472 a, g dbSNP:759237396
1476 1476 a, c dbSNP:72653770
1484 1484 c, t dbSNP:372045804
1485 1485 c, t dbSNP:766232685
1486 1486 a, c, g dbSNP:772952563
1490 1490 a, t dbSNP:72653771
1496 1496 a, g dbSNP:769798621
1499 1499 a, g dbSNP:747009873
1502 1502 a, g, t dbSNP:151130276
1504 1504 c, g dbSNP:368017088
1506 1506 c, g dbSNP:561552566
1510 1510 g, t dbSNP:746159494
1511 1511 c, g dbSNP:779408186
1521 1521 c, t dbSNP:757506868
1523 1523 c, g dbSNP:749668818
1525 1525 a, g dbSNP:59157279
1537 1537 c, t dbSNP:72650700
1538 1538 a, g dbSNP:72653772
1541 1541 a, g dbSNP:767057050
1552 1552 a, g dbSNP:374546971
1554 1554 a, c, t dbSNP:145764775
1555 1555 a, g, t dbSNP:143588929
1559 1559 -, g dbSNP:72664217
1561 1561 c, t dbSNP:773079563
1562 1562 a, c, g dbSNP:761847996
1569 1569 c, t dbSNP:775706145
1570 1570 a, g dbSNP:140045277
1571 1571 a, g dbSNP:199643353
1574 1574 c, t dbSNP:774648925
1585 1585 g, t dbSNP:199634124
1588 1588 c, t dbSNP:72653773
1589 1589 c, t dbSNP:749568041
1590 1590 a, g dbSNP:778251096
1591 1591 c, g dbSNP:770172306
1594 1594 a, g dbSNP:748724484
1610 1610 c, t dbSNP:780671208
1615 1615 c, t dbSNP:754414760
1621 1621 a, g dbSNP:745373850
1624 1624 a, g dbSNP:56877937
1632 1632 c, g dbSNP:756992618
1636 1636 c, t dbSNP:532536884
1637 1637 c, t dbSNP:72653774
1642 1642 a, g dbSNP:558508305
1647 1647 c, t dbSNP:777753626
1649 1649 c, g dbSNP:769979506
1651 1651 c, t dbSNP:756119394
1656 1656 a, g dbSNP:752741312
1657 1657 a, g dbSNP:767373230
1659 1659 c, t dbSNP:758440783
1660 1660 a, g dbSNP:114149656
1669 1669 a, g dbSNP:575023438
1670 1670 c, t dbSNP:72653775
1684 1684 a, g dbSNP:143092672
1686 1686 c, g dbSNP:376767639
1688 1688 c, t dbSNP:66864704
1692 1692 a, g dbSNP:760958976
1693 1693 a, c dbSNP:369358409
1694 1694 c, g dbSNP:772487026
1709 1709 a, g dbSNP:745335274
1711 1711 a, g dbSNP:774053885
1712 1712 g, t dbSNP:770677975
1716 1716 c, t dbSNP:139771750
1720 1720 a, g dbSNP:749017755
1729 1729 c, g dbSNP:777700593
1732 1732 g, t dbSNP:541463984
1735 1735 a, c dbSNP:747904631
1745 1745 c, g dbSNP:527236047
1746 1746 c, t dbSNP:762221578
1748 1748 g, t dbSNP:750497192
1752 1752 c, t dbSNP:779024802
1754 1754 c, t dbSNP:537233133
1756 1756 c, g dbSNP:201193903
1758 1758 c, t dbSNP:764315042
1759 1759 a, c, g dbSNP:190761354
1760 1760 g, t dbSNP:753035055
1766 1766 c, t dbSNP:72653776
1768 1768 c, t dbSNP:150866831
1769 1769 a, g dbSNP:762499171
1775 1775 c, g dbSNP:772893948
1783 1783 c, t dbSNP:72653777
1784 1784 a, g dbSNP:761433545
1790 1790 -, gtctggt dbSNP:781369291
1797 1797 a, c dbSNP:776483503
1799 1799 c, t dbSNP:768271196
1800 1800 c, t dbSNP:61318127
1802 1802 c, g dbSNP:779918495
1807 1807 a, g dbSNP:772029460
1810 1810 g, t dbSNP:749334729
1820 1820 a, c dbSNP:777763168
1822 1822 a, g dbSNP:369816256
1823 1823 g, t dbSNP:72653778
1826 1826 c, t dbSNP:12931472
1827 1827 c, t dbSNP:375557810
1828 1828 a, g dbSNP:372235202
1833 1833 c, g dbSNP:751992037
1838 1838 a, g, t dbSNP:371997398
1842 1842 -, c dbSNP:72664218
1851 1851 c, t dbSNP:561150422
1852 1852 a, g dbSNP:764724652
1857 1857 c, t dbSNP:747341864
1858 1858 a, g dbSNP:780626660
1862 1862 a, g dbSNP:758972882
1866 1866 c, t dbSNP:143100448
1871 1871 c, t dbSNP:765789199
1874 1874 c, t dbSNP:756674188
1875 1875 c, g dbSNP:8058696
1877 1877 c, t dbSNP:763622746
1881 1881 a, c dbSNP:8058694
1883 1883 g, t dbSNP:775252212
1893 1893 c, t dbSNP:767365625
1894 1894 a, g dbSNP:759329140
1914 1914 c, t dbSNP:774095608
1919 1919 g, t dbSNP:763559553
1923 1923 c, t dbSNP:578241312
1929 1929 -, aataaacctcacggtgccccag dbSNP:74315158
1935 1935 c, t dbSNP:771328866
1936 1936 c, t dbSNP:749872772
1940 1940 c, t dbSNP:146936233
1941 1941 a, c, g dbSNP:141399693
1942 1942 g, t dbSNP:780781289
1946 1946 c, t dbSNP:754695089
1948 1948 a, c, t dbSNP:369410139
1949 1949 a, g dbSNP:72653779
1952 1952 -, gctgtctgctggctgttgtcggt dbSNP:74315130
1952 1952 a, g dbSNP:762665355
1957 1957 a, c dbSNP:750330150
1962 1962 a, g dbSNP:765290667
1963 1963 -, gctgttg dbSNP:760707891
1971 1971 c, t dbSNP:760798025
1972 1972 a, g, t dbSNP:72653780
1975 1975 c, t dbSNP:59002125
1978 1978 c, g dbSNP:774573071
1979 1979 c, t dbSNP:4341770
1980 1980 -, g dbSNP:72664227
1981 1981 g, t dbSNP:72653781
1984 1984 -, g dbSNP:775321637
1984 1984 -, g dbSNP:72664228
1984 1984 g, t dbSNP:771260023
2002 2002 c, t dbSNP:749625887
2003 2003 c, t dbSNP:67470842
2004 2004 a, g dbSNP:770314455
2007 2007 c, t dbSNP:747622924
2008 2008 a, g dbSNP:780726064
2015 2015 c, t dbSNP:72653782
2019 2019 a, g dbSNP:761805973
2023 2023 a, c dbSNP:746608585
2027 2027 c, t dbSNP:779590375
2030 2030 a, t dbSNP:758166222
2031 2031 a, g dbSNP:750276636
2032 2032 -, g dbSNP:758980634
2032 2032 g, t dbSNP:150128722
2034 2034 a, g dbSNP:372511255
2038 2038 c, g dbSNP:752811993
2043 2043 c, t dbSNP:57866002
2044 2044 a, g dbSNP:368806440
2048 2048 a, g dbSNP:774574107
2052 2052 a, c, t dbSNP:61266641
2053 2053 a, g dbSNP:773604010
2059 2059 a, g dbSNP:151272575
2060 2060 c, t dbSNP:766589881
2063 2063 c, t dbSNP:374763280
2064 2064 a, g dbSNP:189252048
2065 2065 a, g dbSNP:763209072
2066 2066 c, t dbSNP:199951066
2070 2070 c, t dbSNP:199913903
2071 2071 a, g dbSNP:143731811
2078 2078 a, c dbSNP:72653783
2082 2082 a, g, t dbSNP:72653784
2089 2089 -, g dbSNP:778327274
2091 2091 a, g dbSNP:557278262
2092 2092 c, g dbSNP:536095313
2103 2103 g, t dbSNP:774914077
2104 2104 a, g dbSNP:372121585
2106 2106 a, c, g dbSNP:778711523
2108 2108 c, t dbSNP:770792223
2110 2110 a, g dbSNP:114303883
2116 2116 a, c, g dbSNP:200800189
2119 2119 c, t dbSNP:140013237
2124 2124 c, t dbSNP:115546382
2125 2125 a, g dbSNP:200513114
2131 2131 c, g dbSNP:750590368
2147 2147 a, g dbSNP:72650701
2151 2151 a, g dbSNP:201193229
2152 2152 a, g dbSNP:762127969
2156 2156 a, g dbSNP:58073789
2160 2160 a, t dbSNP:59757815
2161 2161 c, t dbSNP:761145428
2162 2162 c, t dbSNP:72653785
2165 2165 a, g dbSNP:775061021
2173 2173 a, g dbSNP:771642702
2180 2180 a, g dbSNP:759130313
2187 2187 c, t dbSNP:774098410
2192 2192 a, g dbSNP:148573422
2209 2209 a, g dbSNP:59593133
2217 2217 g, t dbSNP:777474704
2221 2221 -, ggtgcagagt dbSNP:770020252
2222 2222 c, t dbSNP:769753486
2223 2223 c, t dbSNP:748098140
2227 2227 -, g dbSNP:748503108
2230 2230 c, g, t dbSNP:66616070
2236 2236 a, g dbSNP:759077182
2237 2237 a, t dbSNP:72653786
2244 2244 c, g dbSNP:774043587
2247 2247 c, t dbSNP:149822534
2248 2248 a, g dbSNP:72653787
2252 2252 g, t dbSNP:752518198
2253 2253 a, c dbSNP:116633099
2263 2263 c, t dbSNP:72653788
2264 2264 a, g dbSNP:769405586
2276 2276 c, t dbSNP:748000420
2278 2278 c, t dbSNP:776513864
2279 2279 a, g, t dbSNP:67561842
2282 2282 a, c dbSNP:72653789
2284 2284 a, g dbSNP:538408828
2289 2289 a, c dbSNP:66492417
2291 2291 a, g dbSNP:57794451
2301 2301 c, t dbSNP:757497225
2302 2302 a, g dbSNP:114185856
2307 2307 -, c dbSNP:72664229
2313 2313 a, g dbSNP:749406403
2314 2314 a, g dbSNP:72653790
2321 2321 c, t dbSNP:549658225
2327 2327 a, c, t dbSNP:72653791
2328 2328 a, g dbSNP:768106519
2341 2341 a, c dbSNP:755590289
2343 2343 c, t dbSNP:751097083
2344 2344 a, g, t dbSNP:72653792
2352 2352 a, c, g dbSNP:772679085
2353 2353 c, t dbSNP:114246406
2356 2356 a, g dbSNP:764975212
2370 2370 c, t dbSNP:761484572
2372 2372 c, t dbSNP:776463091
2375 2375 a, g dbSNP:768570780
2378 2378 c, t dbSNP:142223793
2380 2380 c, g dbSNP:747017064
2381 2381 g, t dbSNP:775412517
2382 2382 g, t dbSNP:770859081
2385 2385 a, g dbSNP:7500834
2394 2394 c, g dbSNP:116898670
2396 2396 a, g dbSNP:756398303
2400 2400 a, g dbSNP:748500639
2404 2404 c, t dbSNP:72653793
2405 2405 a, g dbSNP:72653794
2412 2412 c, t dbSNP:769081280
2413 2413 a, g dbSNP:72653795
2417 2417 c, g, t dbSNP:72653796
2418 2418 a, g dbSNP:749892052
2421 2421 c, t dbSNP:374490625
2422 2422 a, g dbSNP:756766310
2427 2427 a, c dbSNP:372714722
2436 2436 a, g dbSNP:781086233
2443 2443 c, g dbSNP:72653797
2458 2458 c, g dbSNP:760420743
2459 2459 c, t dbSNP:752527142
2462 2462 c, t dbSNP:72653798
2463 2463 c, g dbSNP:138026855
2466 2466 a, g dbSNP:773156957
2467 2467 a, c, g dbSNP:181794120
2475 2475 c, t dbSNP:9924755
2476 2476 a, t dbSNP:769042480
2477 2477 a, c, t dbSNP:370039769
2479 2479 a, g dbSNP:772456820
2489 2489 a, g dbSNP:199990104
2490 2490 a, t dbSNP:779301637
2496 2496 a, c dbSNP:72650702
2497 2497 c, t dbSNP:756709738
2498 2498 a, g dbSNP:753378294
2502 2502 a, g dbSNP:777372493
2505 2505 g, t dbSNP:755811789
2506 2506 c, t dbSNP:60990156
2509 2509 c, t dbSNP:72653703
2515 2515 a, c dbSNP:201884545
2517 2517 c, g dbSNP:142701023
2521 2521 a, g dbSNP:754730506
2522 2522 c, t dbSNP:751451807
2527 2527 -, a dbSNP:67867306
2527 2527 a, g dbSNP:6416668
2529 2529 a, g dbSNP:761941142
2537 2537 c, t dbSNP:72653799
2538 2538 a, g dbSNP:563641079
2539 2539 g, t dbSNP:764401327
2550 2550 a, g dbSNP:375979955
2560 2560 c, g dbSNP:766400372
2584 2584 c, t dbSNP:376512808
2587 2587 a, g, t dbSNP:114349489
2590 2590 a, g dbSNP:747629569
2592 2592 c, g dbSNP:780854527
2594 2594 g, t dbSNP:754624352
2597 2597 c, g dbSNP:746808719
2604 2604 c, t dbSNP:780064112
2605 2605 c, g dbSNP:758275685
2607 2607 c, t dbSNP:750332089
2612 2612 a, g dbSNP:149081681
2613 2613 a, c dbSNP:115379860
2616 2616 a, c dbSNP:72664285
2620 2620 a, g dbSNP:377008733
2628 2628 g, t dbSNP:72653800
2634 2634 c, t dbSNP:373335815
2635 2635 a, g dbSNP:138049574
2644 2644 a, c, t dbSNP:59206042
2645 2645 a, g dbSNP:201334880
2646 2646 c, t dbSNP:376958386
2647 2647 a, g dbSNP:115167678
2651 2651 a, g dbSNP:776065362
2655 2655 c, t dbSNP:777202577
2656 2656 a, c dbSNP:767997301
2670 2670 c, t dbSNP:760288790
2671 2671 a, g dbSNP:775243858
2673 2673 a, g dbSNP:771892138
2677 2677 a, g, t dbSNP:778911783
2680 2680 c, g, t dbSNP:11861980
2681 2681 a, g dbSNP:116355959
2682 2682 c, t dbSNP:552531659
2686 2686 a, g dbSNP:111437625
2689 2689 g, t dbSNP:573589057
2692 2692 c, g dbSNP:60712230
2702 2702 c, g dbSNP:375890241
2706 2706 a, g dbSNP:780215689
2707 2707 a, g dbSNP:758666711
2719 2719 a, g dbSNP:539820701
2721 2721 c, t dbSNP:750784341
2723 2723 c, g dbSNP:765456179
2730 2730 a, g dbSNP:559575288
2742 2742 a, g dbSNP:140467297
2748 2748 a, c dbSNP:764693216
2754 2754 c, g dbSNP:760231794
2761 2761 c, g dbSNP:775190553
2764 2764 c, t dbSNP:767267908
2766 2766 a, c, t dbSNP:61731973
2767 2767 a, g dbSNP:142470921
2769 2769 -, cagg dbSNP:765405352
2769 2769 c, g dbSNP:749125777
2773 2773 g, t dbSNP:375196952
2781 2781 c, t dbSNP:575521072
2784 2784 a, g dbSNP:759128201
2797 2797 g, t dbSNP:557260944
2799 2799 c, g dbSNP:72653704
2804 2804 a, g dbSNP:775704936
2805 2805 -, c dbSNP:72664219
2805 2805 g, t dbSNP:72664286
2809 2809 a, g dbSNP:375592383
2816 2816 a, c, t dbSNP:72653801
2820 2820 -, cctctgcctctacgca dbSNP:74315152
2820 2820 c, t dbSNP:2856585
2821 2821 a, c dbSNP:61340537
2832 2832 c, g, t dbSNP:553008971
2833 2833 a, g dbSNP:72657689
2834 2834 c, t dbSNP:190557767
2835 2835 a, g dbSNP:778351699
2836 2836 c, g dbSNP:750835224
2840 2840 g, t dbSNP:72657690
2843 2843 a, t dbSNP:72657700
2846 2846 -, tcctct dbSNP:767359198
2848 2848 a, c dbSNP:142377854
2863 2863 a, g dbSNP:781769354
2865 2865 c, t dbSNP:754493974
2867 2867 -, cct dbSNP:759512269
2869 2869 c, t dbSNP:751120477
2871 2871 c, g dbSNP:765924261
2875 2875 c, g, t dbSNP:558710437
2876 2876 a, c, g dbSNP:72657691
2889 2889 a, g dbSNP:72664287
2894 2894 a, t dbSNP:776512349
2900 2900 c, t dbSNP:768619900
2901 2901 a, g dbSNP:759516647
2904 2904 c, t dbSNP:774551826
2906 2906 a, g dbSNP:147391297
2907 2907 a, c dbSNP:749463148
2915 2915 a, t dbSNP:778151578
2918 2918 a, g dbSNP:770232227
2919 2919 c, t dbSNP:748551497
2920 2920 c, g dbSNP:569941928
2924 2924 a, g dbSNP:755557398
2928 2928 a, g, t dbSNP:368465318
2930 2930 c, t dbSNP:757861271
2931 2931 a, g dbSNP:138410013
2939 2939 a, c dbSNP:764901693
2944 2944 a, c dbSNP:761565275
2945 2945 a, g dbSNP:374113337
2949 2949 a, c dbSNP:548522940
2950 2950 a, g dbSNP:529676674
2952 2952 c, g dbSNP:775296841
2958 2958 c, t dbSNP:375767696
2959 2959 a, c, g dbSNP:72657692
2967 2967 c, t dbSNP:113270297
2968 2968 a, g dbSNP:748500800
2977 2977 c, t dbSNP:777193567
2986 2986 a, g dbSNP:773471469
3001 3001 a, g, t dbSNP:762192080
3008 3008 c, t dbSNP:776995531
3009 3009 a, g dbSNP:372041663
3010 3010 a, g dbSNP:747365754
3014 3014 g, t dbSNP:776034467
3020 3020 a, g dbSNP:772505132
3026 3026 c, t dbSNP:150583228
3028 3028 c, g, t dbSNP:756768329
3029 3029 a, g dbSNP:373863345
3039 3039 a, g dbSNP:370805624
3048 3048 a, c dbSNP:755895436
3049 3049 c, g dbSNP:57179857
3057 3057 c, t dbSNP:767464604
3060 3060 a, g dbSNP:376087244
3073 3073 c, t dbSNP:72653705
3074 3074 a, c, g dbSNP:374451029
3084 3084 c, g dbSNP:765339542
3091 3091 -, ttt dbSNP:72664230
3091 3091 c, t dbSNP:761996195
3094 3094 a, g dbSNP:754074990
3098 3098 a, g dbSNP:371211631
3103 3103 c, t dbSNP:148064788
3105 3105 a, c dbSNP:775777175
3106 3106 a, g dbSNP:772632852
3107 3107 c, t dbSNP:759973159
3120 3120 a, g dbSNP:774855686
3122 3122 a, c dbSNP:574303164
3124 3124 c, t dbSNP:199571237
3128 3128 -, tct dbSNP:769437554
3130 3130 g, t dbSNP:72657693
3140 3140 c, t dbSNP:769376902
3144 3144 a, c, g dbSNP:780915265
3146 3146 a, c, t dbSNP:145411106
3147 3147 a, g, t dbSNP:374140753
3150 3150 g, t dbSNP:757383677
3153 3153 a, c, t dbSNP:72657694
3154 3154 a, g dbSNP:767588374
3155 3155 c, t dbSNP:759678455
3157 3157 a, g dbSNP:764365055
3160 3160 a, t dbSNP:760876912
3164 3164 c, g dbSNP:752972412
3169 3169 a, g dbSNP:377653646
3173 3173 g, t dbSNP:72657695
3175 3175 c, t dbSNP:41278174
3176 3176 c, g dbSNP:774796759
3180 3180 c, t dbSNP:771465541
3189 3189 a, g dbSNP:762424228
3192 3192 a, c, t dbSNP:60975032
3193 3193 a, g dbSNP:369518454
3204 3204 a, c dbSNP:747688307
3211 3211 g, t dbSNP:780909519
3224 3224 c, t dbSNP:374864191
3229 3229 a, g dbSNP:746841085
3235 3235 -, a dbSNP:371101978
3235 3235 -, a dbSNP:748469243
3235 3235 a, c dbSNP:780119666
3236 3236 a, c dbSNP:199637421
3240 3240 a, c dbSNP:758468125
3241 3241 c, t dbSNP:753948841
3242 3242 c, t dbSNP:777650741
3255 3255 c, t dbSNP:756236377
3256 3256 a, c dbSNP:752816345
3257 3257 c, t dbSNP:767760386
3267 3267 a, g dbSNP:755301606
3274 3274 a, c, t dbSNP:60707953
3277 3277 c, t dbSNP:377480088
3279 3279 c, t dbSNP:371889155
3280 3280 a, g dbSNP:773773146
3284 3284 a, g dbSNP:764594366
3296 3296 c, t dbSNP:755052004
3297 3297 c, g dbSNP:559504956
3304 3304 a, g dbSNP:747176430
3305 3305 c, t dbSNP:780276741
3311 3311 a, c dbSNP:758648156
3325 3325 c, t dbSNP:63749794
3326 3326 a, c, g dbSNP:63750427
3327 3327 c, t dbSNP:757849397
3328 3328 -, ttg dbSNP:72664231
3328 3328 c, t dbSNP:754402001
3330 3330 a, g dbSNP:763644344
3347 3347 c, g, t dbSNP:63750987
3348 3348 a, g, t dbSNP:145693403
3349 3349 -, t dbSNP:72664232
3360 3360 c, t dbSNP:115364698
3361 3361 c, t dbSNP:774256027
3364 3364 a, g dbSNP:770766953
3365 3365 c, t dbSNP:63749998
3366 3366 a, g dbSNP:63750758
3371 3371 a, g dbSNP:554806195
3374 3374 c, t dbSNP:63750459
3375 3375 a, g dbSNP:149775493
3382 3382 g, t dbSNP:63749807
3383 3383 c, g dbSNP:63750473
3390 3390 a, g dbSNP:780107077
3396 3396 c, g dbSNP:772396564
3397 3397 c, t dbSNP:28939701
3398 3398 a, c, g dbSNP:60791294
3400 3400 a, g dbSNP:63750146
3402 3402 a, g dbSNP:754351046
3406 3406 c, t dbSNP:72653706
3407 3407 a, c, g dbSNP:572351621
3412 3412 c, t dbSNP:72653743
3413 3413 a, t dbSNP:767060442
3416 3416 c, t dbSNP:145553069
3420 3420 -, c dbSNP:769105086
3440 3440 c, t dbSNP:751173976
3441 3441 a, t dbSNP:766135952
3442 3442 c, t dbSNP:762758350
3443 3443 a, g, t dbSNP:553479685
3444 3444 c, t dbSNP:59030767
3445 3445 a, g dbSNP:147794514
3446 3446 c, t dbSNP:775707011
3460 3460 a, g dbSNP:772050759
3462 3462 a, g dbSNP:746045818
3473 3473 c, t dbSNP:142128765
3474 3474 a, g, t dbSNP:202000035
3475 3475 c, t dbSNP:72653744
3476 3476 a, g dbSNP:63750457
3483 3483 a, g dbSNP:747602889
3487 3487 c, g dbSNP:143854720
3500 3500 c, t dbSNP:753771636
3501 3501 a, g dbSNP:763980825
3502 3502 -, g dbSNP:758506257
3509 3509 c, t dbSNP:376062004
3520 3520 c, g dbSNP:774355343
3527 3527 a, g dbSNP:114928628
3531 3531 a, g dbSNP:372578623
3533 3533 g, t dbSNP:773579765
3542 3542 a, c dbSNP:149460452
3547 3547 a, c dbSNP:572010361
3548 3548 c, t dbSNP:777163389
3549 3549 a, g dbSNP:58494932
3552 3552 c, t dbSNP:780601545
3553 3553 a, g dbSNP:779472538
3556 3556 a, g dbSNP:771584027
3560 3560 c, t dbSNP:201087449
3571 3571 c, g dbSNP:146284800
3573 3573 a, c dbSNP:778568997
3577 3577 a, g dbSNP:114920767
3578 3578 a, g dbSNP:753628351
3581 3581 c, g dbSNP:777757369
3585 3585 c, t dbSNP:200132882
3588 3588 c, t dbSNP:756077096
3589 3589 a, g dbSNP:752683023
3591 3591 a, g dbSNP:766504801
3593 3593 a, g dbSNP:63750607
3599 3599 -, ct dbSNP:745900279
3601 3601 a, g dbSNP:375983928
3607 3607 a, g dbSNP:763146137
3610 3610 c, g dbSNP:750630523
3613 3613 c, g, t dbSNP:762213485
3615 3615 c, t dbSNP:776917491
3619 3619 c, g dbSNP:765483994
3621 3621 g, t dbSNP:762007802
3624 3624 c, t dbSNP:754104618
3629 3629 c, t dbSNP:764318423
3634 3634 a, c dbSNP:371493792
3637 3637 a, t dbSNP:114017587
3639 3639 g, t dbSNP:775947674
3645 3645 c, t dbSNP:371191765
3646 3646 c, t dbSNP:63751215
3647 3647 a, g dbSNP:63751001
3653 3653 a, g dbSNP:72653745
3661 3661 a, c dbSNP:63750125
3662 3662 c, t dbSNP:770483331
3675 3675 c, t dbSNP:368931767
3676 3676 a, g dbSNP:141728905
3677 3677 -, t dbSNP:779018991
3683 3683 c, t dbSNP:769432314
3684 3684 a, g dbSNP:747993729
3688 3688 c, t dbSNP:63750402
3689 3689 a, g dbSNP:138700741
3693 3693 a, g dbSNP:745938225
3694 3694 c, t dbSNP:72653746
3696 3696 a, g dbSNP:778791988
3697 3697 c, g dbSNP:63749796
3700 3700 c, t dbSNP:63749992
3702 3702 g, t dbSNP:72653747
3703 3703 g, t dbSNP:150145577
3707 3707 a, g dbSNP:72653748
3708 3708 c, g dbSNP:72657701
3710 3710 c, t dbSNP:141449320
3717 3717 a, g dbSNP:773961518
3720 3720 a, g, t dbSNP:281865557
3722 3722 c, t dbSNP:772108097
3723 3723 c, t dbSNP:749327665
3724 3724 a, c dbSNP:199694536
3725 3725 c, g dbSNP:200242428
3736 3736 c, t dbSNP:148326870
3740 3740 a, c, g, t dbSNP:143212758
3742 3742 -, t dbSNP:764868012
3745 3745 a, g dbSNP:375647381
3754 3754 -, c dbSNP:72664220
3754 3754 a, c, g dbSNP:750897812
3755 3755 a, c dbSNP:576328904
3757 3757 c, t dbSNP:761440521
3759 3759 -, c dbSNP:72664221
3760 3760 -, t dbSNP:72664233
3763 3763 c, g dbSNP:149151337
3771 3771 c, t dbSNP:546064934
3772 3772 a, g dbSNP:760376992
3780 3780 c, g, t dbSNP:114175094
3781 3781 a, g dbSNP:771770753
3783 3783 -, g dbSNP:72664234
3787 3787 c, t dbSNP:368379895
3788 3788 a, g dbSNP:2238472
3803 3803 a, g dbSNP:63750209
3806 3806 -, accgacctgagctcccgctggctgtgcagggcgtgtccttcaagatcc dbSNP:74315128
3807 3807 c, t dbSNP:769820268
3808 3808 c, t dbSNP:72653749
3809 3809 a, g dbSNP:200010958
3811 3811 c, t dbSNP:759798432
3821 3821 c, t dbSNP:77913024
3822 3822 a, g dbSNP:61294695
3831 3831 a, g, t dbSNP:750893189
3835 3835 g, t dbSNP:779603756
3837 3837 c, t dbSNP:56982924
3838 3838 a, g dbSNP:141731889
3841 3841 c, t dbSNP:753457535
3848 3848 a, g dbSNP:751910206
3854 3854 a, g dbSNP:763831330
3855 3855 c, t dbSNP:760304927
3856 3856 a, g dbSNP:58694313
3857 3857 a, c dbSNP:369871412
3862 3862 a, g dbSNP:63750625
3865 3865 -, aag dbSNP:72664235
3867 3867 a, g dbSNP:376851894
3868 3868 a, g dbSNP:767119931
3870 3870 a, g dbSNP:754782996
3872 3872 a, g dbSNP:374086268
3876 3876 c, t dbSNP:375741855
3877 3877 a, g, t dbSNP:63751325
3880 3880 a, g dbSNP:63750446
3887 3887 c, t dbSNP:63750494
3888 3888 a, c, t dbSNP:201812902
3889 3889 a, g dbSNP:63749856
3892 3892 a, c, g dbSNP:63750410
3897 3897 a, g dbSNP:774787962
3897 3897 -, g dbSNP:72664236
3904 3904 c, t dbSNP:63751318
3914 3914 c, g dbSNP:771434033
3917 3917 a, g dbSNP:63750992
3921 3921 a, g dbSNP:749761484
3924 3924 a, g dbSNP:371122759
3925 3925 c, t dbSNP:63750759
3926 3926 a, g dbSNP:63751086
3933 3933 a, g dbSNP:747664194
3938 3938 c, g dbSNP:780887287
3946 3946 a, g dbSNP:63749823
3947 3947 a, g dbSNP:754656944
3956 3956 a, g dbSNP:72653750
3960 3960 c, t dbSNP:751220009
3961 3961 a, g dbSNP:766105758
3963 3963 c, t dbSNP:57499803
3964 3964 a, g dbSNP:79536709
3965 3965 a, g dbSNP:57695665
3973 3973 a, c, g dbSNP:58902671
3974 3974 c, t dbSNP:760794410
3977 3977 c, t dbSNP:752785718
3979 3979 a, c dbSNP:767636709
3981 3981 c, g, t dbSNP:60320257
3982 3982 a, c, g dbSNP:142505247
3984 3984 a, g dbSNP:63750235
3987 3987 c, g dbSNP:139128550
3989 3989 a, c, t dbSNP:63750414
3990