Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ABCC6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 [Homo sapiens (human)]

Gene Symbol ABCC6
Entrez Gene ID 368
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms ABC34, ARA, EST349056, GACI2, MLP1, MOAT-E, MOATE, MRP6, PXE, PXE1, URG7
General protein information
Preferred Names
URG7 protein; multidrug resistance-associated protein 6
multidrug resistance-associated protein 6
ATP-binding cassette sub-family C member 6
multi-specific organic anion transporter E
anthracycline resistance-associated protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Pseudoxanthoma elasticum, 264800 (3); Pseudoxanthoma elasticum,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu56348 XM_011522479 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu56349 XM_011522480 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu56349 XM_011522481 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu56350 XM_011522482 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu56351 XM_011546696 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu56351 XM_011546697 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00
OHu16610 NM_001079528 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu18031 NM_001171 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 25 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu56348D
Sequence Information ORF Nucleotide Sequence (Length: 4479bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product multidrug resistance-associated protein 6 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)270..4703(+)
Misc Feature(2)1161..1964(+)
Misc Feature(3)2115..2684(+)
Misc Feature(4)2217..2240(+)
Misc Feature(5)2226..2633(+)
Misc Feature(6)2313..2324(+)
Misc Feature(7)2487..2516(+)
Misc Feature(8)2547..2564(+)
Misc Feature(9)2571..2582(+)
Misc Feature(10)2619..2639(+)
Misc Feature(11)3033..3845(+)
Misc Feature(12)3984..4646(+)
Position Chain Variation Link
12 12 a, c dbSNP:28529549
99 99 c, t dbSNP:565625561
104 104 c, t dbSNP:778876717
146 146 c, t dbSNP:374543396
165 165 c, t dbSNP:560426786
166 166 c, g dbSNP:370530149
265 265 a, g dbSNP:545266923
269 269 c, t dbSNP:767580449
283 283 -, ag dbSNP:776575086
296 296 c, t dbSNP:759670541
297 297 a, g, t dbSNP:371804833
311 311 c, g dbSNP:572911630
314 314 c, g, t dbSNP:770233922
326 326 a, g dbSNP:762218474
335 335 -, a dbSNP:72664223
337 337 a, g dbSNP:777330921
339 339 g, t dbSNP:557779326
343 343 c, g dbSNP:72653752
347 347 a, g, t dbSNP:771578225
348 348 a, c, g dbSNP:778544828
349 349 c, t dbSNP:757143605
351 351 c, g dbSNP:753761990
352 352 c, t dbSNP:777631658
353 353 -, c dbSNP:746531177
353 353 -, c dbSNP:768525663
354 354 -, c dbSNP:779429021
356 356 a, g dbSNP:756051632
375 375 c, g dbSNP:751588595
388 388 g, t dbSNP:766492973
392 392 a, c dbSNP:374115365
393 393 a, g dbSNP:372062746
397 397 a, g dbSNP:367832780
400 400 a, g dbSNP:374778258
401 401 c, t dbSNP:762176272
404 404 c, t dbSNP:777138361
407 407 c, t dbSNP:371336666
408 408 c, t dbSNP:761289104
409 409 -, ggggctacc dbSNP:74315110
409 409 a, g, t dbSNP:183648123
411 411 a, g dbSNP:745506209
412 412 a, g dbSNP:72657696
415 415 a, g dbSNP:774111532
420 420 a, c, t dbSNP:557180313
421 421 a, g dbSNP:777566074
427 427 c, t dbSNP:756021073
432 432 c, g dbSNP:748123458
442 442 a, c dbSNP:779991699
448 448 c, t dbSNP:758559224
450 450 -, gtg dbSNP:72664225
461 461 c, t dbSNP:745917696
462 462 a, g dbSNP:551026377
464 464 c, t dbSNP:778878232
465 465 c, t dbSNP:757533434
469 469 c, t dbSNP:754156749
475 475 c, t dbSNP:778282044
531 531 g, t dbSNP:756608278
532 532 c, g dbSNP:753016843
616 616 a, g dbSNP:72653753
622 622 a, g dbSNP:369280729
625 625 c, t dbSNP:545855341
667 667 c, t dbSNP:761526463
680 680 -, c dbSNP:387906860
680 680 a, c, g dbSNP:530448710
691 691 a, c dbSNP:563277493
693 693 a, g dbSNP:541797555
697 697 a, c dbSNP:746971185
698 698 c, t dbSNP:574395867
703 703 c, t dbSNP:2606921
704 704 a, g dbSNP:376219152
717 717 a, g dbSNP:192110266
723 723 c, g dbSNP:532499310
726 726 c, t dbSNP:201766106
727 727 a, g dbSNP:549917901
747 747 c, t dbSNP:531566232
776 776 -, g dbSNP:764710238
777 777 c, t dbSNP:775351926
779 779 a, g dbSNP:72664281
790 790 c, t dbSNP:561266462
791 791 a, g dbSNP:772153614
810 810 c, t dbSNP:749314494
826 826 -, t dbSNP:756622503
837 837 c, t dbSNP:556731532
842 842 a, g dbSNP:747414005
849 849 a, g dbSNP:72657697
870 870 a, g dbSNP:535223881
875 875 a, g dbSNP:72664282
884 884 g, t dbSNP:72653754
893 893 c, g dbSNP:776659185
898 898 c, t dbSNP:768926954
903 903 a, t dbSNP:550069568
904 904 a, g dbSNP:747292090
906 906 a, g dbSNP:72653755
909 909 c, t dbSNP:780415590
913 913 a, c, g dbSNP:746412523
928 928 c, g dbSNP:778393141
936 936 a, c dbSNP:372211360
937 937 a, t dbSNP:538065529
942 942 a, t dbSNP:753405638
943 943 c, t dbSNP:763591743
944 944 a, g dbSNP:755822656
948 948 a, g dbSNP:752492902
952 952 c, g dbSNP:767470535
954 954 g, t dbSNP:72650697
959 959 a, c dbSNP:759517670
962 962 -, ctc dbSNP:767477763
962 962 a, c dbSNP:774487251
963 963 g, t dbSNP:766352704
964 964 a, c dbSNP:761731967
969 969 -, gaa dbSNP:759848816
972 972 c, t dbSNP:72653756
977 977 g, t dbSNP:776799234
978 978 a, t dbSNP:768708445
981 981 c, t dbSNP:199645691
982 982 a, g dbSNP:548741161
984 984 a, c, t dbSNP:72653757
988 988 a, g dbSNP:779338019
995 995 a, g dbSNP:771478479
1008 1008 a, c, t dbSNP:777365579
1009 1009 a, g dbSNP:755700774
1011 1011 a, g dbSNP:752439860
1012 1012 c, g dbSNP:781119252
1018 1018 c, g, t dbSNP:751403636
1020 1020 c, g, t dbSNP:376409933
1021 1021 a, g dbSNP:753836442
1023 1023 a, g dbSNP:72657698
1024 1024 a, g dbSNP:760880587
1031 1031 a, c dbSNP:368547779
1040 1040 a, g dbSNP:766810653
1041 1041 a, g dbSNP:763368082
1044 1044 c, t dbSNP:199534175
1056 1056 a, g dbSNP:200051606
1058 1058 c, g, t dbSNP:776299480
1059 1059 a, g dbSNP:201615561
1063 1063 a, g dbSNP:746714494
1066 1066 a, g dbSNP:779707518
1070 1070 a, c, g dbSNP:371480297
1071 1071 a, g dbSNP:4780606
1074 1074 a, g dbSNP:778756902
1085 1085 c, t dbSNP:4780605
1086 1086 a, g dbSNP:752725393
1090 1090 a, c, g dbSNP:376822399
1091 1091 a, c, t dbSNP:766642486
1095 1095 -, ctacggcaagaagggagccagtggc dbSNP:74315139
1098 1098 c, t dbSNP:200330935
1099 1099 a, g, t dbSNP:765786719
1109 1109 c, g dbSNP:375066891
1119 1119 c, t dbSNP:776248626
1120 1120 a, g dbSNP:199729978
1143 1143 c, t dbSNP:746625905
1146 1146 a, g dbSNP:775152691
1148 1148 a, g dbSNP:771629401
1156 1156 c, g dbSNP:745637262
1160 1160 c, t dbSNP:536157653
1168 1168 -, t dbSNP:72664216
1172 1172 g, t dbSNP:757169047
1180 1180 a, g dbSNP:749267111
1181 1181 a, c, g dbSNP:78678589
1185 1185 a, g dbSNP:72657699
1190 1190 -, c dbSNP:72664226
1197 1197 a, g dbSNP:565924265
1199 1199 c, g, t dbSNP:766579912
1205 1205 a, g dbSNP:375845144
1212 1212 a, g dbSNP:750774345
1223 1223 g, t dbSNP:146523238
1230 1230 a, c dbSNP:777631910
1231 1231 g, t dbSNP:769647527
1234 1234 c, t dbSNP:747058720
1235 1235 c, t dbSNP:780042786
1243 1243 g, t dbSNP:758610942
1244 1244 c, t dbSNP:750740896
1246 1246 c, t dbSNP:779406291
1251 1251 c, g dbSNP:145232796
1253 1253 a, t dbSNP:757635771
1264 1264 c, t dbSNP:754261093
1268 1268 c, t dbSNP:764622792
1273 1273 a, c dbSNP:761108674
1274 1274 a, g dbSNP:752230147
1284 1284 c, t dbSNP:766980759
1286 1286 c, t dbSNP:200738286
1287 1287 a, g dbSNP:774051128
1288 1288 c, t dbSNP:369074083
1289 1289 c, t dbSNP:150016641
1290 1290 a, g dbSNP:372132926
1294 1294 g, t dbSNP:72653758
1304 1304 c, t dbSNP:139317080
1307 1307 a, g dbSNP:72664283
1311 1311 c, t dbSNP:772101560
1317 1317 -, caaacgctgtttgagcagcagaacatgtacagg dbSNP:387906353
1317 1317 c, t dbSNP:72650698
1318 1318 -, aaacgctgtttgagcagcagaacatgtacaggc dbSNP:74315156
1321 1321 c, g, t dbSNP:72653759
1322 1322 a, g dbSNP:757586544
1337 1337 c, g dbSNP:530073662
1338 1338 a, g dbSNP:72653760
1342 1342 c, t dbSNP:756614582
1347 1347 a, g dbSNP:753215042
1349 1349 -, gacagg dbSNP:761612541
1350 1350 c, g dbSNP:370022963
1356 1356 a, g dbSNP:754429280
1359 1359 c, t dbSNP:751076949
1360 1360 g, t dbSNP:765964408
1362 1362 c, t dbSNP:72650699
1367 1367 a, g dbSNP:772955656
1371 1371 c, t dbSNP:72664284
1374 1374 c, t dbSNP:72653761
1375 1375 a, g dbSNP:776373779
1379 1379 a, g dbSNP:138992331
1383 1383 a, g dbSNP:745903918
1385 1385 c, t dbSNP:774597736
1390 1390 c, g dbSNP:771256512
1400 1400 c, t dbSNP:749562556
1401 1401 a, g dbSNP:72653762
1404 1404 a, g dbSNP:756498547
1405 1405 a, g dbSNP:748562202
1406 1406 c, g, t dbSNP:72653763
1415 1415 c, t dbSNP:762876678
1420 1420 c, g dbSNP:773374784
1422 1422 a, g dbSNP:72653764
1423 1423 g, t dbSNP:769882654
1424 1424 a, c, t dbSNP:376518465
1425 1425 a, g dbSNP:368723482
1429 1429 c, t dbSNP:747386965
1430 1430 c, t dbSNP:780472669
1444 1444 c, t dbSNP:115663615
1445 1445 a, g dbSNP:576483544
1453 1453 a, g dbSNP:528670320
1462 1462 a, g, t dbSNP:756831300
1463 1463 c, g, t dbSNP:9930886
1464 1464 c, g, t dbSNP:755918422
1466 1466 c, g, t dbSNP:537017052
1467 1467 c, g dbSNP:767525456
1472 1472 c, t dbSNP:759542954
1473 1473 a, g dbSNP:200582171
1474 1474 c, t dbSNP:72653765
1475 1475 a, g dbSNP:9940825
1477 1477 a, g dbSNP:761923987
1478 1478 c, t dbSNP:143487365
1479 1479 a, g dbSNP:768869262
1483 1483 a, g dbSNP:536098094
1485 1485 c, t dbSNP:775853778
1486 1486 a, g dbSNP:772434460
1488 1488 c, g dbSNP:746428588
1493 1493 c, t dbSNP:114179357
1494 1494 a, g dbSNP:770532500
1496 1496 a, g, t dbSNP:547565680
1499 1499 c, t dbSNP:528603039
1500 1500 a, g dbSNP:747905455
1502 1502 c, t dbSNP:781169048
1505 1505 c, g dbSNP:201682224
1509 1509 c, t dbSNP:751569017
1513 1513 a, g dbSNP:201880691
1514 1514 c, t dbSNP:57499497
1527 1527 c, t dbSNP:563862970
1530 1530 c, g dbSNP:764251624
1532 1532 c, t dbSNP:760935787
1533 1533 a, g dbSNP:775802572
1541 1541 a, c, t dbSNP:150075392
1542 1542 a, g dbSNP:542502733
1544 1544 g, t dbSNP:771349496
1545 1545 c, g dbSNP:748770237
1548 1548 c, g, t dbSNP:72653766
1550 1550 c, t dbSNP:375433102
1553 1553 c, t dbSNP:200519199
1554 1554 a, g dbSNP:372059636
1558 1558 a, g dbSNP:142007498
1566 1566 c, g dbSNP:746781173
1569 1569 a, c dbSNP:751934523
1573 1573 g, t dbSNP:766697715
1574 1574 a, g dbSNP:58703366
1579 1579 c, t dbSNP:750898196
1583 1583 c, t dbSNP:57546826
1584 1584 a, g dbSNP:761364455
1591 1591 c, t dbSNP:554886514
1593 1593 c, g dbSNP:67996819
1598 1598 c, g, t dbSNP:141309818
1599 1599 a, g dbSNP:775349711
1600 1600 c, g dbSNP:771913153
1601 1601 a, t dbSNP:572266339
1604 1604 c, t dbSNP:370494121
1607 1607 c, t dbSNP:778756933
1610 1610 a, g dbSNP:770889156
1612 1612 a, g dbSNP:748212814
1616 1616 c, t dbSNP:781181816
1618 1618 a, t dbSNP:72653767
1632 1632 c, t dbSNP:755200644
1641 1641 a, c dbSNP:751783664
1642 1642 a, g dbSNP:780432555
1653 1653 c, g dbSNP:758767349
1654 1654 a, t dbSNP:151187637
1665 1665 a, g dbSNP:368746151
1668 1668 c, g dbSNP:746211393
1689 1689 c, g dbSNP:374244303
1690 1690 a, g dbSNP:72653768
1695 1695 c, t dbSNP:754360599
1703 1703 c, t dbSNP:764676656
1705 1705 a, g dbSNP:755513036
1708 1708 a, c dbSNP:752237181
1714 1714 a, t dbSNP:72653769
1717 1717 a, g dbSNP:759237396
1721 1721 a, c dbSNP:72653770
1729 1729 c, t dbSNP:372045804
1730 1730 c, t dbSNP:766232685
1731 1731 a, c, g dbSNP:772952563
1735 1735 a, t dbSNP:72653771
1741 1741 a, g dbSNP:769798621
1744 1744 a, g dbSNP:747009873
1747 1747 a, g, t dbSNP:151130276
1749 1749 c, g dbSNP:368017088
1751 1751 c, g dbSNP:561552566
1755 1755 g, t dbSNP:746159494
1756 1756 c, g dbSNP:779408186
1766 1766 c, t dbSNP:757506868
1768 1768 c, g dbSNP:749668818
1770 1770 a, g dbSNP:59157279
1782 1782 c, t dbSNP:72650700
1783 1783 a, g dbSNP:72653772
1786 1786 a, g dbSNP:767057050
1797 1797 a, g dbSNP:374546971
1799 1799 a, c, t dbSNP:145764775
1800 1800 a, g, t dbSNP:143588929
1804 1804 -, g dbSNP:72664217
1806 1806 c, t dbSNP:773079563
1807 1807 a, c, g dbSNP:761847996
1814 1814 c, t dbSNP:775706145
1815 1815 a, g dbSNP:140045277
1816 1816 a, g dbSNP:199643353
1819 1819 c, t dbSNP:774648925
1830 1830 g, t dbSNP:199634124
1833 1833 c, t dbSNP:72653773
1834 1834 c, t dbSNP:749568041
1835 1835 a, g dbSNP:778251096
1836 1836 c, g dbSNP:770172306
1839 1839 a, g dbSNP:748724484
1855 1855 c, t dbSNP:780671208
1860 1860 c, t dbSNP:754414760
1866 1866 a, g dbSNP:745373850
1869 1869 a, g dbSNP:56877937
1877 1877 c, g dbSNP:756992618
1881 1881 c, t dbSNP:532536884
1882 1882 c, t dbSNP:72653774
1887 1887 a, g dbSNP:558508305
1892 1892 c, t dbSNP:777753626
1894 1894 c, g dbSNP:769979506
1896 1896 c, t dbSNP:756119394
1901 1901 a, g dbSNP:752741312
1902 1902 a, g dbSNP:767373230
1904 1904 c, t dbSNP:758440783
1905 1905 a, g dbSNP:114149656
1914 1914 a, g dbSNP:575023438
1915 1915 c, t dbSNP:72653775
1929 1929 a, g dbSNP:143092672
1931 1931 c, g dbSNP:376767639
1933 1933 c, t dbSNP:66864704
1937 1937 a, g dbSNP:760958976
1938 1938 a, c dbSNP:369358409
1939 1939 c, g dbSNP:772487026
1954 1954 a, g dbSNP:745335274
1956 1956 a, g dbSNP:774053885
1957 1957 g, t dbSNP:770677975
1961 1961 c, t dbSNP:139771750
1965 1965 a, g dbSNP:749017755
1974 1974 c, g dbSNP:777700593
1977 1977 g, t dbSNP:541463984
1980 1980 a, c dbSNP:747904631
1990 1990 c, g dbSNP:527236047
1991 1991 c, t dbSNP:762221578
1993 1993 g, t dbSNP:750497192
1997 1997 c, t dbSNP:779024802
1999 1999 c, t dbSNP:537233133
2001 2001 c, g dbSNP:201193903
2003 2003 c, t dbSNP:764315042
2004 2004 a, c, g dbSNP:190761354
2005 2005 g, t dbSNP:753035055
2011 2011 c, t dbSNP:72653776
2013 2013 c, t dbSNP:150866831
2014 2014 a, g dbSNP:762499171
2020 2020 c, g dbSNP:772893948
2028 2028 c, t dbSNP:72653777
2029 2029 a, g dbSNP:761433545
2035 2035 -, gtctggt dbSNP:781369291
2042 2042 a, c dbSNP:776483503
2044 2044 c, t dbSNP:768271196
2045 2045 c, t dbSNP:61318127
2047 2047 c, g dbSNP:779918495
2052 2052 a, g dbSNP:772029460
2055 2055 g, t dbSNP:749334729
2065 2065 a, c dbSNP:777763168
2067 2067 a, g dbSNP:369816256
2068 2068 g, t dbSNP:72653778
2071 2071 c, t dbSNP:12931472
2072 2072 c, t dbSNP:375557810
2073 2073 a, g dbSNP:372235202
2078 2078 c, g dbSNP:751992037
2083 2083 a, g, t dbSNP:371997398
2087 2087 -, c dbSNP:72664218
2096 2096 c, t dbSNP:561150422
2097 2097 a, g dbSNP:764724652
2102 2102 c, t dbSNP:747341864
2103 2103 a, g dbSNP:780626660
2107 2107 a, g dbSNP:758972882
2111 2111 c, t dbSNP:143100448
2116 2116 c, t dbSNP:765789199
2119 2119 c, t dbSNP:756674188
2120 2120 c, g dbSNP:8058696
2122 2122 c, t dbSNP:763622746
2126 2126 a, c dbSNP:8058694
2128 2128 g, t dbSNP:775252212
2138 2138 c, t dbSNP:767365625
2139 2139 a, g dbSNP:759329140
2159 2159 c, t dbSNP:774095608
2164 2164 g, t dbSNP:763559553
2168 2168 c, t dbSNP:578241312
2174 2174 -, aataaacctcacggtgccccag dbSNP:74315158
2180 2180 c, t dbSNP:771328866
2181 2181 c, t dbSNP:749872772
2185 2185 c, t dbSNP:146936233
2186 2186 a, c, g dbSNP:141399693
2187 2187 g, t dbSNP:780781289
2191 2191 c, t dbSNP:754695089
2193 2193 a, c, t dbSNP:369410139
2194 2194 a, g dbSNP:72653779
2197 2197 -, gctgtctgctggctgttgtcggt dbSNP:74315130
2197 2197 a, g dbSNP:762665355
2202 2202 a, c dbSNP:750330150
2207 2207 a, g dbSNP:765290667
2208 2208 -, gctgttg dbSNP:760707891
2216 2216 c, t dbSNP:760798025
2217 2217 a, g, t dbSNP:72653780
2220 2220 c, t dbSNP:59002125
2223 2223 c, g dbSNP:774573071
2224 2224 c, t dbSNP:4341770
2225 2225 -, g dbSNP:72664227
2226 2226 g, t dbSNP:72653781
2229 2229 -, g dbSNP:775321637
2229 2229 -, g dbSNP:72664228
2229 2229 g, t dbSNP:771260023
2247 2247 c, t dbSNP:749625887
2248 2248 c, t dbSNP:67470842
2249 2249 a, g dbSNP:770314455
2252 2252 c, t dbSNP:747622924
2253 2253 a, g dbSNP:780726064
2260 2260 c, t dbSNP:72653782
2264 2264 a, g dbSNP:761805973
2268 2268 a, c dbSNP:746608585
2272 2272 c, t dbSNP:779590375
2275 2275 a, t dbSNP:758166222
2276 2276 a, g dbSNP:750276636
2277 2277 -, g dbSNP:758980634
2277 2277 g, t dbSNP:150128722
2279 2279 a, g dbSNP:372511255
2283 2283 c, g dbSNP:752811993
2288 2288 c, t dbSNP:57866002
2289 2289 a, g dbSNP:368806440
2293 2293 a, g dbSNP:774574107
2297 2297 a, c, t dbSNP:61266641
2298 2298 a, g dbSNP:773604010
2304 2304 a, g dbSNP:151272575
2305 2305 c, t dbSNP:766589881
2308 2308 c, t dbSNP:374763280
2309 2309 a, g dbSNP:189252048
2310 2310 a, g dbSNP:763209072
2311 2311 c, t dbSNP:199951066
2315 2315 c, t dbSNP:199913903
2316 2316 a, g dbSNP:143731811
2323 2323 a, c dbSNP:72653783
2327 2327 a, g, t dbSNP:72653784
2334 2334 -, g dbSNP:778327274
2336 2336 a, g dbSNP:557278262
2337 2337 c, g dbSNP:536095313
2348 2348 g, t dbSNP:774914077
2349 2349 a, g dbSNP:372121585
2351 2351 a, c, g dbSNP:778711523
2353 2353 c, t dbSNP:770792223
2355 2355 a, g dbSNP:114303883
2361 2361 a, c, g dbSNP:200800189
2364 2364 c, t dbSNP:140013237
2369 2369 c, t dbSNP:115546382
2370 2370 a, g dbSNP:200513114
2376 2376 c, g dbSNP:750590368
2392 2392 a, g dbSNP:72650701
2396 2396 a, g dbSNP:201193229
2397 2397 a, g dbSNP:762127969
2401 2401 a, g dbSNP:58073789
2405 2405 a, t dbSNP:59757815
2406 2406 c, t dbSNP:761145428
2407 2407 c, t dbSNP:72653785
2410 2410 a, g dbSNP:775061021
2418 2418 a, g dbSNP:771642702
2425 2425 a, g dbSNP:759130313
2432 2432 c, t dbSNP:774098410
2437 2437 a, g dbSNP:148573422
2454 2454 a, g dbSNP:59593133
2462 2462 g, t dbSNP:777474704
2466 2466 -, ggtgcagagt dbSNP:770020252
2467 2467 c, t dbSNP:769753486
2468 2468 c, t dbSNP:748098140
2472 2472 -, g dbSNP:748503108
2475 2475 c, g, t dbSNP:66616070
2481 2481 a, g dbSNP:759077182
2482 2482 a, t dbSNP:72653786
2489 2489 c, g dbSNP:774043587
2492 2492 c, t dbSNP:149822534
2493 2493 a, g dbSNP:72653787
2497 2497 g, t dbSNP:752518198
2498 2498 a, c dbSNP:116633099
2508 2508 c, t dbSNP:72653788
2509 2509 a, g dbSNP:769405586
2521 2521 c, t dbSNP:748000420
2523 2523 c, t dbSNP:776513864
2524 2524 a, g, t dbSNP:67561842
2527 2527 a, c dbSNP:72653789
2529 2529 a, g dbSNP:538408828
2534 2534 a, c dbSNP:66492417
2536 2536 a, g dbSNP:57794451
2546 2546 c, t dbSNP:757497225
2547 2547 a, g dbSNP:114185856
2552 2552 -, c dbSNP:72664229
2558 2558 a, g dbSNP:749406403
2559 2559 a, g dbSNP:72653790
2566 2566 c, t dbSNP:549658225
2572 2572 a, c, t dbSNP:72653791
2573 2573 a, g dbSNP:768106519
2586 2586 a, c dbSNP:755590289
2588 2588 c, t dbSNP:751097083
2589 2589 a, g, t dbSNP:72653792
2597 2597 a, c, g dbSNP:772679085
2598 2598 c, t dbSNP:114246406
2601 2601 a, g dbSNP:764975212
2616 2616 c, t dbSNP:72653793
2617 2617 a, g dbSNP:72653794
2624 2624 c, t dbSNP:769081280
2625 2625 a, g dbSNP:72653795
2629 2629 c, g, t dbSNP:72653796
2630 2630 a, g dbSNP:749892052
2633 2633 c, t dbSNP:374490625
2634 2634 a, g dbSNP:756766310
2639 2639 a, c dbSNP:372714722
2648 2648 a, g dbSNP:781086233
2655 2655 c, g dbSNP:72653797
2670 2670 c, g dbSNP:760420743
2671 2671 c, t dbSNP:752527142
2674 2674 c, t dbSNP:72653798
2675 2675 c, g dbSNP:138026855
2678 2678 a, g dbSNP:773156957
2679 2679 a, c, g dbSNP:181794120
2687 2687 c, t dbSNP:9924755
2688 2688 a, t dbSNP:769042480
2689 2689 a, c, t dbSNP:370039769
2691 2691 a, g dbSNP:772456820
2701 2701 a, g dbSNP:199990104
2702 2702 a, t dbSNP:779301637
2708 2708 a, c dbSNP:72650702
2709 2709 c, t dbSNP:756709738
2710 2710 a, g dbSNP:753378294
2714 2714 a, g dbSNP:777372493
2717 2717 g, t dbSNP:755811789
2718 2718 c, t dbSNP:60990156
2721 2721 c, t dbSNP:72653703
2727 2727 a, c dbSNP:201884545
2729 2729 c, g dbSNP:142701023
2733 2733 a, g dbSNP:754730506
2734 2734 c, t dbSNP:751451807
2739 2739 -, a dbSNP:67867306
2739 2739 a, g dbSNP:6416668
2741 2741 a, g dbSNP:761941142
2749 2749 c, t dbSNP:72653799
2750 2750 a, g dbSNP:563641079
2751 2751 g, t dbSNP:764401327
2762 2762 a, g dbSNP:375979955
2772 2772 c, g dbSNP:766400372
2796 2796 c, t dbSNP:376512808
2799 2799 a, g, t dbSNP:114349489
2802 2802 a, g dbSNP:747629569
2804 2804 c, g dbSNP:780854527
2806 2806 g, t dbSNP:754624352
2809 2809 c, g dbSNP:746808719
2816 2816 c, t dbSNP:780064112
2817 2817 c, g dbSNP:758275685
2819 2819 c, t dbSNP:750332089
2824 2824 a, g dbSNP:149081681
2825 2825 a, c dbSNP:115379860
2828 2828 a, c dbSNP:72664285
2832 2832 a, g dbSNP:377008733
2840 2840 g, t dbSNP:72653800
2846 2846 c, t dbSNP:373335815
2847 2847 a, g dbSNP:138049574
2856 2856 a, c, t dbSNP:59206042
2857 2857 a, g dbSNP:201334880
2858 2858 c, t dbSNP:376958386
2859 2859 a, g dbSNP:115167678
2863 2863 a, g dbSNP:776065362
2867 2867 c, t dbSNP:777202577
2868 2868 a, c dbSNP:767997301
2882 2882 c, t dbSNP:760288790
2883 2883 a, g dbSNP:775243858
2885 2885 a, g dbSNP:771892138
2889 2889 a, g, t dbSNP:778911783
2892 2892 c, g, t dbSNP:11861980
2893 2893 a, g dbSNP:116355959
2894 2894 c, t dbSNP:552531659
2898 2898 a, g dbSNP:111437625
2901 2901 g, t dbSNP:573589057
2904 2904 c, g dbSNP:60712230
2914 2914 c, g dbSNP:375890241
2918 2918 a, g dbSNP:780215689
2919 2919 a, g dbSNP:758666711
2931 2931 a, g dbSNP:539820701
2933 2933 c, t dbSNP:750784341
2935 2935 c, g dbSNP:765456179
2942 2942 a, g dbSNP:559575288
2954 2954 a, g dbSNP:140467297
2960 2960 a, c dbSNP:764693216
2966 2966 c, g dbSNP:760231794
2973 2973 c, g dbSNP:775190553
2976 2976 c, t dbSNP:767267908
2978 2978 a, c, t dbSNP:61731973
2979 2979 a, g dbSNP:142470921
2981 2981 -, cagg dbSNP:765405352
2981 2981 c, g dbSNP:749125777
2985 2985 g, t dbSNP:375196952
2993 2993 c, t dbSNP:575521072
2996 2996 a, g dbSNP:759128201
3009 3009 g, t dbSNP:557260944
3011 3011 c, g dbSNP:72653704
3016 3016 a, g dbSNP:775704936
3017 3017 -, c dbSNP:72664219
3017 3017 g, t dbSNP:72664286
3021 3021 a, g dbSNP:375592383
3028 3028 a, c, t dbSNP:72653801
3032 3032 -, cctctgcctctacgca dbSNP:74315152
3032 3032 c, t dbSNP:2856585
3033 3033 a, c dbSNP:61340537
3044 3044 c, g, t dbSNP:553008971
3045 3045 a, g dbSNP:72657689
3046 3046 c, t dbSNP:190557767
3047 3047 a, g dbSNP:778351699
3048 3048 c, g dbSNP:750835224
3052 3052 g, t dbSNP:72657690
3055 3055 a, t dbSNP:72657700
3058 3058 -, tcctct dbSNP:767359198
3060 3060 a, c dbSNP:142377854
3075 3075 a, g dbSNP:781769354
3077 3077 c, t dbSNP:754493974
3079 3079 -, cct dbSNP:759512269
3081 3081 c, t dbSNP:751120477
3083 3083 c, g dbSNP:765924261
3087 3087 c, g, t dbSNP:558710437
3088 3088 a, c, g dbSNP:72657691
3101 3101 a, g dbSNP:72664287
3106 3106 a, t dbSNP:776512349
3112 3112 c, t dbSNP:768619900
3113 3113 a, g dbSNP:759516647
3116 3116 c, t dbSNP:774551826
3118 3118 a, g dbSNP:147391297
3119 3119 a, c dbSNP:749463148
3127 3127 a, t dbSNP:778151578
3130 3130 a, g dbSNP:770232227
3131 3131 c, t dbSNP:748551497
3132 3132 c, g dbSNP:569941928
3136 3136 a, g dbSNP:755557398
3140 3140 a, g, t dbSNP:368465318
3142 3142 c, t dbSNP:757861271
3143 3143 a, g dbSNP:138410013
3151 3151 a, c dbSNP:764901693
3156 3156 a, c dbSNP:761565275
3157 3157 a, g dbSNP:374113337
3161 3161 a, c dbSNP:548522940
3162 3162 a, g dbSNP:529676674
3164 3164 c, g dbSNP:775296841
3170 3170 c, t dbSNP:375767696
3171 3171 a, c, g dbSNP:72657692
3179 3179 c, t dbSNP:113270297
3180 3180 a, g dbSNP:748500800
3189 3189 c, t dbSNP:777193567
3198 3198 a, g dbSNP:773471469
3213 3213 a, g, t dbSNP:762192080
3220 3220 c, t dbSNP:776995531
3221 3221 a, g dbSNP:372041663
3222 3222 a, g dbSNP:747365754
3226 3226 g, t dbSNP:776034467
3232 3232 a, g dbSNP:772505132
3238 3238 c, t dbSNP:150583228
3240 3240 c, g, t dbSNP:756768329
3241 3241 a, g dbSNP:373863345
3251 3251 a, g dbSNP:370805624
3260 3260 a, c dbSNP:755895436
3261 3261 c, g dbSNP:57179857
3269 3269 c, t dbSNP:767464604
3272 3272 a, g dbSNP:376087244
3285 3285 c, t dbSNP:72653705
3286 3286 a, c, g dbSNP:374451029
3296 3296 c, g dbSNP:765339542
3303 3303 -, ttt dbSNP:72664230
3303 3303 c, t dbSNP:761996195
3306 3306 a, g dbSNP:754074990
3310 3310 a, g dbSNP:371211631
3315 3315 c, t dbSNP:148064788
3317 3317 a, c dbSNP:775777175
3318 3318 a, g dbSNP:772632852
3319 3319 c, t dbSNP:759973159
3332 3332 a, g dbSNP:774855686
3334 3334 a, c dbSNP:574303164
3336 3336 c, t dbSNP:199571237
3340 3340 -, tct dbSNP:769437554
3342 3342 g, t dbSNP:72657693
3352 3352 c, t dbSNP:769376902
3356 3356 a, c, g dbSNP:780915265
3358 3358 a, c, t dbSNP:145411106
3359 3359 a, g, t dbSNP:374140753
3362 3362 g, t dbSNP:757383677
3365 3365 a, c, t dbSNP:72657694
3366 3366 a, g dbSNP:767588374
3367 3367 c, t dbSNP:759678455
3369 3369 a, g dbSNP:764365055
3372 3372 a, t dbSNP:760876912
3376 3376 c, g dbSNP:752972412
3381 3381 a, g dbSNP:377653646
3385 3385 g, t dbSNP:72657695
3387 3387 c, t dbSNP:41278174
3388 3388 c, g dbSNP:774796759
3392 3392 c, t dbSNP:771465541
3401 3401 a, g dbSNP:762424228
3404 3404 a, c, t dbSNP:60975032
3405 3405 a, g dbSNP:369518454
3416 3416 a, c dbSNP:747688307
3423 3423 g, t dbSNP:780909519
3436 3436 c, t dbSNP:374864191
3441 3441 a, g dbSNP:746841085
3447 3447 -, a dbSNP:371101978
3447 3447 -, a dbSNP:748469243
3447 3447 a, c dbSNP:780119666
3448 3448 a, c dbSNP:199637421
3452 3452 a, c dbSNP:758468125
3453 3453 c, t dbSNP:753948841
3454 3454 c, t dbSNP:777650741
3467 3467 c, t dbSNP:756236377
3468 3468 a, c dbSNP:752816345
3469 3469 c, t dbSNP:767760386
3479 3479 a, g dbSNP:755301606
3486 3486 a, c, t dbSNP:60707953
3489 3489 c, t dbSNP:377480088
3491 3491 c, t dbSNP:371889155
3492 3492 a, g dbSNP:773773146
3496 3496 a, g dbSNP:764594366
3508 3508 c, t dbSNP:755052004
3509 3509 c, g dbSNP:559504956
3516 3516 a, g dbSNP:747176430
3517 3517 c, t dbSNP:780276741
3523 3523 a, c dbSNP:758648156
3537 3537 c, t dbSNP:63749794
3538 3538 a, c, g dbSNP:63750427
3539 3539 c, t dbSNP:757849397
3540 3540 -, ttg dbSNP:72664231
3540 3540 c, t dbSNP:754402001
3542 3542 a, g dbSNP:763644344
3559 3559 c, g, t dbSNP:63750987
3560 3560 a, g, t dbSNP:145693403
3561 3561 -, t dbSNP:72664232
3572 3572 c, t dbSNP:115364698
3573 3573 c, t dbSNP:774256027
3576 3576 a, g dbSNP:770766953
3577 3577 c, t dbSNP:63749998
3578 3578 a, g dbSNP:63750758
3583 3583 a, g dbSNP:554806195
3586 3586 c, t dbSNP:63750459
3587 3587 a, g dbSNP:149775493
3594 3594 g, t dbSNP:63749807
3595 3595 c, g dbSNP:63750473
3602 3602 a, g dbSNP:780107077
3608 3608 c, g dbSNP:772396564
3609 3609 c, t dbSNP:28939701
3610 3610 a, c, g dbSNP:60791294
3612 3612 a, g dbSNP:63750146
3614 3614 a, g dbSNP:754351046
3618 3618 c, t dbSNP:72653706
3619 3619 a, c, g dbSNP:572351621
3624 3624 c, t dbSNP:72653743
3625 3625 a, t dbSNP:767060442
3628 3628 c, t dbSNP:145553069
3632 3632 -, c dbSNP:769105086
3652 3652 c, t dbSNP:751173976
3653 3653 a, t dbSNP:766135952
3654 3654 c, t dbSNP:762758350
3655 3655 a, g, t dbSNP:553479685
3656 3656 c, t dbSNP:59030767
3657 3657 a, g dbSNP:147794514
3658 3658 c, t dbSNP:775707011
3672 3672 a, g dbSNP:772050759
3674 3674 a, g dbSNP:746045818
3685 3685 c, t dbSNP:142128765
3686 3686 a, g, t dbSNP:202000035
3687 3687 c, t dbSNP:72653744
3688 3688 a, g dbSNP:63750457
3695 3695 a, g dbSNP:747602889
3699 3699 c, g dbSNP:143854720
3712 3712 c, t dbSNP:753771636
3713 3713 a, g dbSNP:763980825
3714 3714 -, g dbSNP:758506257
3721 3721 c, t dbSNP:376062004
3732 3732 c, g dbSNP:774355343
3739 3739 a, g dbSNP:114928628
3743 3743 a, g dbSNP:372578623
3745 3745 g, t dbSNP:773579765
3754 3754 a, c dbSNP:149460452
3759 3759 a, c dbSNP:572010361
3760 3760 c, t dbSNP:777163389
3761 3761 a, g dbSNP:58494932
3764 3764 c, t dbSNP:780601545
3765 3765 a, g dbSNP:779472538
3768 3768 a, g dbSNP:771584027
3772 3772 c, t dbSNP:201087449
3783 3783 c, g dbSNP:146284800
3785 3785 a, c dbSNP:778568997
3789 3789 a, g dbSNP:114920767
3790 3790 a, g dbSNP:753628351
3793 3793 c, g dbSNP:777757369
3797 3797 c, t dbSNP:200132882
3800 3800 c, t dbSNP:756077096
3801 3801 a, g dbSNP:752683023
3803 3803 a, g dbSNP:766504801
3805 3805 a, g dbSNP:63750607
3811 3811 -, ct dbSNP:745900279
3813 3813 a, g dbSNP:375983928
3819 3819 a, g dbSNP:763146137
3822 3822 c, g dbSNP:750630523
3825 3825 c, g, t dbSNP:762213485
3827 3827 c, t dbSNP:776917491
3831 3831 c, g dbSNP:765483994
3833 3833 g, t dbSNP:762007802
3836 3836 c, t dbSNP:754104618
3841 3841 c, t dbSNP:764318423
3846 3846 a, c dbSNP:371493792
3849 3849 a, t dbSNP:114017587
3851 3851 g, t dbSNP:775947674
3857 3857 c, t dbSNP:371191765
3858 3858 c, t dbSNP:63751215
3859 3859 a, g dbSNP:63751001
3865 3865 a, g dbSNP:72653745
3873 3873 a, c dbSNP:63750125
3874 3874 c, t dbSNP:770483331
3887 3887 c, t dbSNP:368931767
3888 3888 a, g dbSNP:141728905
3889 3889 -, t dbSNP:779018991
3895 3895 c, t dbSNP:769432314
3896 3896 a, g dbSNP:747993729
3900 3900 c, t dbSNP:63750402
3901 3901 a, g dbSNP:138700741
3905 3905 a, g dbSNP:745938225
3906 3906 c, t dbSNP:72653746
3908 3908 a, g dbSNP:778791988
3909 3909 c, g dbSNP:63749796
3912 3912 c, t dbSNP:63749992
3914 3914 g, t dbSNP:72653747
3915 3915 g, t dbSNP:150145577
3919 3919 a, g dbSNP:72653748
3920 3920 c, g dbSNP:72657701
3922 3922 c, t dbSNP:141449320
3929 3929 a, g dbSNP:773961518
3932 3932 a, g, t dbSNP:281865557
3934 3934 c, t dbSNP:772108097
3935 3935 c, t dbSNP:749327665
3936 3936 a, c dbSNP:199694536
3937 3937 c, g dbSNP:200242428
3948 3948 c, t dbSNP:148326870
3952 3952 a, c, g, t dbSNP:143212758
3954 3954 -, t dbSNP:764868012
3957 3957 a, g dbSNP:375647381
3966 3966 -, c dbSNP:72664220
3966 3966 a, c, g dbSNP:750897812
3967 3967 a, c dbSNP:576328904
3969 3969 c, t dbSNP:761440521
3971 3971 -, c dbSNP:72664221
3972 3972 -, t dbSNP:72664233
3975 3975 c, g dbSNP:149151337
3983 3983 c, t dbSNP:546064934
3984 3984 a, g dbSNP:760376992
3992 3992 c, g, t dbSNP:114175094
3993 3993 a, g dbSNP:771770753
3995 3995 -, g dbSNP:72664234
3999 3999 c, t dbSNP:368379895
4000 4000 a, g dbSNP:2238472
4015 4015 a, g dbSNP:63750209
4018 4018 -, accgacctgagctcccgctggctgtgcagggcgtgtccttcaagatcc dbSNP:74315128
4019 4019 c, t dbSNP:769820268
4020 4020 c, t dbSNP:72653749
4021 4021 a, g dbSNP:200010958
4023 4023 c, t dbSNP:759798432
4033 4033 c, t dbSNP:77913024
4034 4034 a, g dbSNP:61294695
4043 4043 a, g, t dbSNP:750893189
4047 4047 g, t dbSNP:779603756
4049 4049 c, t dbSNP:56982924
4050 4050 a, g dbSNP:141731889
4053 4053 c, t dbSNP:753457535
4060 4060 a, g dbSNP:751910206
4066 4066 a, g dbSNP:763831330
4067 4067 c, t dbSNP:760304927
4068 4068 a, g dbSNP:58694313
4069 4069 a, c dbSNP:369871412
4074 4074 a, g dbSNP:63750625
4077 4077 -, aag dbSNP:72664235
4079 4079 a, g dbSNP:376851894
4080 4080 a, g dbSNP:767119931
4082 4082 a, g dbSNP:754782996
4084 4084 a, g dbSNP:374086268
4088 4088 c, t dbSNP:375741855
4089 4089 a, g, t dbSNP:63751325
4092 4092 a, g dbSNP:63750446
4099 4099 c, t dbSNP:63750494
4100 4100 a, c, t dbSNP:201812902
4101 4101 a, g dbSNP:63749856
4104 4104 a, c, g dbSNP:63750410
4109 4109 a, g dbSNP:774787962
4109 4109 -, g dbSNP:72664236
4116 4116 c, t dbSNP:63751318
4126 4126 c, g dbSNP:771434033
4129 4129 a, g dbSNP:63750992
4133 4133 a, g dbSNP:749761484
4136 4136 a, g dbSNP:371122759
4137 4137 c, t dbSNP:63750759
4138 4138 a, g dbSNP:63751086
4145 4145 a, g dbSNP:747664194
4150 4150 c, g dbSNP:780887287
4158 4158 a, g dbSNP:63749823
4159 4159 a, g dbSNP:754656944
4168 4168 a, g dbSNP:72653750
4172 4172 c, t dbSNP:751220009
4173 4173 a, g dbSNP:766105758
4175 4175 c, t dbSNP:57499803
4176 4176 a, g dbSNP:79536709
4177 4177 a, g dbSNP:57695665
4185 4185 a, c, g dbSNP:58902671
4186 4186 c, t dbSNP:760794410
4189 4189 c, t dbSNP:752785718
4191 4191 a, c dbSNP:767636709
4193 4193 c, g, t dbSNP:60320257
4194 4194 a, c, g dbSNP:142505247
4196 4196 a, g dbSNP:63750235
4199 4199 c, g dbSNP:139128550
4201 4201 a, c, t dbSNP:63750414
4202 4202 a, g dbSNP:770266146
4203 4203 a, c dbSNP:376735995
4205 4205 c, t dbSNP:146265944
4207 4207 a, c dbSNP:780504422
4208 4208 a, c, g dbSNP:58259232
4212 4212 a, c, t dbSNP:28939702
4213 4213 a, g, t dbSNP:63750622
4222 4222 c, t dbSNP:63750608
4230 4230 c, g dbSNP:63749800
4233 4233 c, t dbSNP:63751112
4234 4234 c, t dbSNP:750243019
4238 4238 a, c, g dbSNP:63751111
4245 4245 a, c dbSNP:72664288
4247 4247 c, t dbSNP:141821068
4250 4250 c, g dbSNP:766707250
4253 4253 c, t dbSNP:758486813
4256 4256 c, t dbSNP:750674262
4257 4257 c, g dbSNP:63750018
4261 4261 c, t dbSNP:765472331
4266 4266 c, t dbSNP:63750428
4267 4267 a, g dbSNP:201275608
4270 4270 g, t dbSNP:764635677
4278 4278 a, g dbSNP:58695352
4283 4283 a, g dbSNP:139978668
4292 4292 a, g dbSNP:771581942
4298 4298 a, c, g dbSNP:200834294
4301 4301 a, c, t dbSNP:199668617
4301 4301 -, c dbSNP:72664237
4302 4302 a, g dbSNP:60285147
4304 4304 a, g dbSNP:375386682
4305 4305 a, g dbSNP:777835756
4320 4320 c, t dbSNP:756191351
4323 4323 g, t dbSNP:748103958
4327 4327 c, t dbSNP:371122482
4328 4328 c, g, t dbSNP:750573670
4337 4337 c, t dbSNP:368258006
4346 4346 g, t dbSNP:757540398
4348 4348 c, t dbSNP:754267653
4359 4359 c, t dbSNP:764446055
4361 4361 c, g, t dbSNP:373736094
4362 4362 a, g dbSNP:775998775
4368 4368 c, t dbSNP:766971195
4371 4371 a, c dbSNP:759123370
4373 4373 a, g dbSNP:534017491
4379 4379 c, g, t dbSNP:63750798
4379 4379 -, g dbSNP:67791546
4386 4386 a, g dbSNP:749035807
4389 4389 c, t dbSNP:66913554
4390 4390 a, g dbSNP:202080984
4394 4394 c, t dbSNP:199770983
4395 4395 a, g dbSNP:63751241
4398 4398 g, t dbSNP:772015821
4401 4401 c, g dbSNP:746009029
4406 4406 a, c dbSNP:63750700
4407 4407 a, g dbSNP:200485267
4413 4413 a, c dbSNP:387906859
4414 4414 -, a dbSNP:779044271
4415 4415 c, g dbSNP:149510465
4416 4416 -, agaa dbSNP:72664222
4421 4421 g, t dbSNP:761687550
4423 4423 a, t dbSNP:776557438
4437 4437 a, c, t dbSNP:760611511
4438 4438 c, g dbSNP:775319351
4440 4440 -, agaa dbSNP:387906352
4442 4442 c, g, t dbSNP:749415846
4444 4444 g, t dbSNP:58626288
4448 4448 c, g dbSNP:773407624
4449 4449 a, c, t dbSNP:59588658
4450 4450 a, c, g dbSNP:63751262
4451 4451 a, g dbSNP:58668703
4455 4455 a, c dbSNP:571678512
4461 4461 a, c dbSNP:549920304
4466 4466 c, t dbSNP:757960904
4468 4468 c, t dbSNP:63750295
4471 4471 c, t dbSNP:150230403
4475 4475 c, t dbSNP:376210462
4476 4476 a, g dbSNP:756910757
4480 4480 a, c, t dbSNP:763908026
4483 4483 c, t dbSNP:374236964
4486 4486 c, t dbSNP:760426231
4490 4490 c, t dbSNP:766362120
4491 4491 a, g dbSNP:531418668
4498 4498 c, t dbSNP:199950526
4499 4499 c, t dbSNP:763012366
4501 4501 a, g dbSNP:773205132
4502 4502 c, t dbSNP:72664289
4503 4503 -, acggagc dbSNP:74315109
4505 4505 a, g dbSNP:769879386
4511 4511 a, g dbSNP:61553825
4515 4515 -, a dbSNP:72664238
4524 4524 a, g dbSNP:143822047
4529 4529 c, t dbSNP:559653607
4532 4532 -, g dbSNP:72664239
4542 4542 a, g dbSNP:747383956
4552 4552 c, g dbSNP:780599196
4562 4562 c, t dbSNP:369157557
4567 4567 c, t dbSNP:759040684
4568 4568 c, g, t dbSNP:376955544
4571 4571 c, t dbSNP:371710180
4572 4572 c, t dbSNP:72547524
4573 4573 a, g dbSNP:753497739
4574 4574 c, g, t dbSNP:63750763
4579 4579 a, g dbSNP:57288618
4581 4581 g, t dbSNP:752497561
4583 4583 c, t dbSNP:767302163
4584 4584 a, g dbSNP:759407080
4588 4588 c, t dbSNP:774296589
4595 4595 c, t dbSNP:765262614
4599 4599 c, g, t dbSNP:776891665
4600 4600 a, g, t dbSNP:761098006
4602 4602 a, g dbSNP:767908367
4616 4616 a, c dbSNP:759971821
4617 4617 a, t dbSNP:72653751
4622 4622 a, g dbSNP:114099077
4631 4631 -, a dbSNP:72664280
4634 4634 a, c, g dbSNP:763316917
4637 4637 c, t dbSNP:548798705
4638 4638 a, g dbSNP:63751279
4645 4645 c, t dbSNP:63750135
4646 4646 a, g dbSNP:776255682
4650 4650 c, t dbSNP:566671584
4655 4655 c, g dbSNP:768365514
4656 4656 c, g dbSNP:746670054
4670 4670 c, t dbSNP:141860096
4671 4671 -, a dbSNP:780884882
4673 4673 a, c, g dbSNP:745761393
4674 4674 c, t dbSNP:778956327
4681 4681 c, g dbSNP:756250178
4690 4690 a, g dbSNP:752891529
4698 4698 a, g, t dbSNP:63750874
4700 4700 c, t dbSNP:368798086
4709 4709 -, agccag dbSNP:754847748
4715 4715 g, t dbSNP:755189930
4717 4717 c, t dbSNP:751851580
4719 4719 c, g dbSNP:766609974
4725 4725 c, t dbSNP:532797500
4726 4726 a, g dbSNP:3902401
4727 4727 a, t dbSNP:755791267
4734 4734 g, t dbSNP:190110936
4735 4735 c, t dbSNP:553868820
4740 4740 c, t dbSNP:761311941
4741 4741 a, c dbSNP:776054073
4743 4743 a, g dbSNP:377695659
4747 4747 a, g dbSNP:59461468
4750 4750 c, g dbSNP:775246845
4753 4753 c, t dbSNP:771739894
4809 4809 a, g dbSNP:147308589
4819 4819 a, c dbSNP:543273935
4835 4835 c, g dbSNP:781078594
4838 4838 c, g dbSNP:754884672
4861 4861 a, g dbSNP:149116500
4873 4873 g, t dbSNP:141192278
4883 4883 c, t dbSNP:545346754
4889 4889 g, t dbSNP:533911738
4903 4903 a, c dbSNP:577962491
4904 4904 a, t dbSNP:556560181
4909 4909 g, t dbSNP:537932232
4913 4913 c, t dbSNP:751435793
4929 4929 c, t dbSNP:138073543
4955 4955 c, t dbSNP:555114647
4962 4962 a, g dbSNP:148226174
4988 4988 c, t dbSNP:759538710
4999 4999 a, g dbSNP:562565973
5024 5024 a, c, g, t dbSNP:212096
5029 5029 c, g dbSNP:551388145
5063 5063 a, g dbSNP:539765825
5157 5157 c, t dbSNP:141291712
5160 5160 a, g dbSNP:750476431
5167 5167 c, g dbSNP:75141580
5192 5192 a, g dbSNP:144303704
5210 5210 a, g dbSNP:761964026
5234 5234 g, t dbSNP:776841068
5258 5258 a, g dbSNP:568182628
5265 5265 c, t dbSNP:549568055
5271 5271 a, g dbSNP:372646191

Target ORF information:

RefSeq Version XM_011522479
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 6 (ABCC6), transcript variant X6, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu56349D
Sequence Information ORF Nucleotide Sequence (Length: 4170bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product multidrug resistance-associated protein 6 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)328..4491(+)
Misc Feature(2)916..1719(+)
Misc Feature(3)1870..2472(+)
Misc Feature(4)1972..1995(+)
Misc Feature(5)1981..2421(+)
Misc Feature(6)2068..2079(+)
Misc Feature(7)2242..2271(+)
Misc Feature(8)2302..2319(+)
Misc Feature(9)2326..2337(+)
Misc Feature(10)2407..2427(+)
Misc Feature(11)2821..3633(+)
Misc Feature(12)3772..4434(+)
Position Chain Variation Link
14 14 c, g dbSNP:751588595
27 27 g, t dbSNP:766492973
31 31 a, c dbSNP:374115365
32 32 a, g dbSNP:372062746
36 36 a, g dbSNP:367832780
39 39 a, g dbSNP:374778258
40 40 c, t dbSNP:762176272
43 43 c, t dbSNP:777138361
46 46 c, t dbSNP:371336666
47 47 c, t dbSNP:761289104
48 48 -, ggggctacc dbSNP:74315110
48 48 a, g, t dbSNP:183648123
50 50 a, g dbSNP:745506209
51 51 a, g dbSNP:72657696
54 54 a, g dbSNP:774111532
59 59 a, c, t dbSNP:557180313
60 60 a, g dbSNP:777566074
66 66 c, t dbSNP:756021073
71 71 c, g dbSNP:748123458
81 81 a, c dbSNP:779991699
87 87 c, t dbSNP:758559224
189 189 a, g dbSNP:749698469
205 205 -, gtg dbSNP:72664225
216 216 c, t dbSNP:745917696
217 217 a, g dbSNP:551026377
219 219 c, t dbSNP:778878232
220 220 c, t dbSNP:757533434
224 224 c, t dbSNP:754156749
230 230 c, t dbSNP:778282044
286 286 g, t dbSNP:756608278
287 287 c, g dbSNP:753016843
371 371 a, g dbSNP:72653753
377 377 a, g dbSNP:369280729
380 380 c, t dbSNP:545855341
422 422 c, t dbSNP:761526463
435 435 -, c dbSNP:387906860
435 435 a, c, g dbSNP:530448710
446 446 a, c dbSNP:563277493
448 448 a, g dbSNP:541797555
452 452 a, c dbSNP:746971185
453 453 c, t dbSNP:574395867
458 458 c, t dbSNP:2606921
459 459 a, g dbSNP:376219152
472 472 a, g dbSNP:192110266
478 478 c, g dbSNP:532499310
481 481 c, t dbSNP:201766106
482 482 a, g dbSNP:549917901
502 502 c, t dbSNP:531566232
531 531 -, g dbSNP:764710238
532 532 c, t dbSNP:775351926
534 534 a, g dbSNP:72664281
545 545 c, t dbSNP:561266462
546 546 a, g dbSNP:772153614
565 565 c, t dbSNP:749314494
581 581 -, t dbSNP:756622503
592 592 c, t dbSNP:556731532
597 597 a, g dbSNP:747414005
604 604 a, g dbSNP:72657697
625 625 a, g dbSNP:535223881
630 630 a, g dbSNP:72664282
639 639 g, t dbSNP:72653754
648 648 c, g dbSNP:776659185
653 653 c, t dbSNP:768926954
658 658 a, t dbSNP:550069568
659 659 a, g dbSNP:747292090
661 661 a, g dbSNP:72653755
664 664 c, t dbSNP:780415590
668 668 a, c, g dbSNP:746412523
683 683 c, g dbSNP:778393141
691 691 a, c dbSNP:372211360
692 692 a, t dbSNP:538065529
697 697 a, t dbSNP:753405638
698 698 c, t dbSNP:763591743
699 699 a, g dbSNP:755822656
703 703 a, g dbSNP:752492902
707 707 c, g dbSNP:767470535
709 709 g, t dbSNP:72650697
714 714 a, c dbSNP:759517670
717 717 -, ctc dbSNP:767477763
717 717 a, c dbSNP:774487251
718 718 g, t dbSNP:766352704
719 719 a, c dbSNP:761731967
724 724 -, gaa dbSNP:759848816
727 727 c, t dbSNP:72653756
732 732 g, t dbSNP:776799234
733 733 a, t dbSNP:768708445
736 736 c, t dbSNP:199645691
737 737 a, g dbSNP:548741161
739 739 a, c, t dbSNP:72653757
743 743 a, g dbSNP:779338019
750 750 a, g dbSNP:771478479
763 763 a, c, t dbSNP:777365579
764 764 a, g dbSNP:755700774
766 766 a, g dbSNP:752439860
767 767 c, g dbSNP:781119252
773 773 c, g, t dbSNP:751403636
775 775 c, g, t dbSNP:376409933
776 776 a, g dbSNP:753836442
778 778 a, g dbSNP:72657698
779 779 a, g dbSNP:760880587
786 786 a, c dbSNP:368547779
795 795 a, g dbSNP:766810653
796 796 a, g dbSNP:763368082
799 799 c, t dbSNP:199534175
811 811 a, g dbSNP:200051606
813 813 c, g, t dbSNP:776299480
814 814 a, g dbSNP:201615561
818 818 a, g dbSNP:746714494
821 821 a, g dbSNP:779707518
825 825 a, c, g dbSNP:371480297
826 826 a, g dbSNP:4780606
829 829 a, g dbSNP:778756902
840 840 c, t dbSNP:4780605
841 841 a, g dbSNP:752725393
845 845 a, c, g dbSNP:376822399
846 846 a, c, t dbSNP:766642486
850 850 -, ctacggcaagaagggagccagtggc dbSNP:74315139
853 853 c, t dbSNP:200330935
854 854 a, g, t dbSNP:765786719
864 864 c, g dbSNP:375066891
874 874 c, t dbSNP:776248626
875 875 a, g dbSNP:199729978
898 898 c, t dbSNP:746625905
901 901 a, g dbSNP:775152691
903 903 a, g dbSNP:771629401
911 911 c, g dbSNP:745637262
915 915 c, t dbSNP:536157653
923 923 -, t dbSNP:72664216
927 927 g, t dbSNP:757169047
935 935 a, g dbSNP:749267111
936 936 a, c, g dbSNP:78678589
940 940 a, g dbSNP:72657699
945 945 -, c dbSNP:72664226
952 952 a, g dbSNP:565924265
954 954 c, g, t dbSNP:766579912
960 960 a, g dbSNP:375845144
967 967 a, g dbSNP:750774345
978 978 g, t dbSNP:146523238
985 985 a, c dbSNP:777631910
986 986 g, t dbSNP:769647527
989 989 c, t dbSNP:747058720
990 990 c, t dbSNP:780042786
998 998 g, t dbSNP:758610942
999 999 c, t dbSNP:750740896
1001 1001 c, t dbSNP:779406291
1006 1006 c, g dbSNP:145232796
1008 1008 a, t dbSNP:757635771
1019 1019 c, t dbSNP:754261093
1023 1023 c, t dbSNP:764622792
1028 1028 a, c dbSNP:761108674
1029 1029 a, g dbSNP:752230147
1039 1039 c, t dbSNP:766980759
1041 1041 c, t dbSNP:200738286
1042 1042 a, g dbSNP:774051128
1043 1043 c, t dbSNP:369074083
1044 1044 c, t dbSNP:150016641
1045 1045 a, g dbSNP:372132926
1049 1049 g, t dbSNP:72653758
1059 1059 c, t dbSNP:139317080
1062 1062 a, g dbSNP:72664283
1066 1066 c, t dbSNP:772101560
1072 1072 -, caaacgctgtttgagcagcagaacatgtacagg dbSNP:387906353
1072 1072 c, t dbSNP:72650698
1073 1073 -, aaacgctgtttgagcagcagaacatgtacaggc dbSNP:74315156
1076 1076 c, g, t dbSNP:72653759
1077 1077 a, g dbSNP:757586544
1092 1092 c, g dbSNP:530073662
1093 1093 a, g dbSNP:72653760
1097 1097 c, t dbSNP:756614582
1102 1102 a, g dbSNP:753215042
1104 1104 -, gacagg dbSNP:761612541
1105 1105 c, g dbSNP:370022963
1111 1111 a, g dbSNP:754429280
1114 1114 c, t dbSNP:751076949
1115 1115 g, t dbSNP:765964408
1117 1117 c, t dbSNP:72650699
1122 1122 a, g dbSNP:772955656
1126 1126 c, t dbSNP:72664284
1129 1129 c, t dbSNP:72653761
1130 1130 a, g dbSNP:776373779
1134 1134 a, g dbSNP:138992331
1138 1138 a, g dbSNP:745903918
1140 1140 c, t dbSNP:774597736
1145 1145 c, g dbSNP:771256512
1155 1155 c, t dbSNP:749562556
1156 1156 a, g dbSNP:72653762
1159 1159 a, g dbSNP:756498547
1160 1160 a, g dbSNP:748562202
1161 1161 c, g, t dbSNP:72653763
1170 1170 c, t dbSNP:762876678
1175 1175 c, g dbSNP:773374784
1177 1177 a, g dbSNP:72653764
1178 1178 g, t dbSNP:769882654
1179 1179 a, c, t dbSNP:376518465
1180 1180 a, g dbSNP:368723482
1184 1184 c, t dbSNP:747386965
1185 1185 c, t dbSNP:780472669
1199 1199 c, t dbSNP:115663615
1200 1200 a, g dbSNP:576483544
1208 1208 a, g dbSNP:528670320
1217 1217 a, g, t dbSNP:756831300
1218 1218 c, g, t dbSNP:9930886
1219 1219 c, g, t dbSNP:755918422
1221 1221 c, g, t dbSNP:537017052
1222 1222 c, g dbSNP:767525456
1227 1227 c, t dbSNP:759542954
1228 1228 a, g dbSNP:200582171
1229 1229 c, t dbSNP:72653765
1230 1230 a, g dbSNP:9940825
1232 1232 a, g dbSNP:761923987
1233 1233 c, t dbSNP:143487365
1234 1234 a, g dbSNP:768869262
1238 1238 a, g dbSNP:536098094
1240 1240 c, t dbSNP:775853778
1241 1241 a, g dbSNP:772434460
1243 1243 c, g dbSNP:746428588
1248 1248 c, t dbSNP:114179357
1249 1249 a, g dbSNP:770532500
1251 1251 a, g, t dbSNP:547565680
1254 1254 c, t dbSNP:528603039
1255 1255 a, g dbSNP:747905455
1257 1257 c, t dbSNP:781169048
1260 1260 c, g dbSNP:201682224
1264 1264 c, t dbSNP:751569017
1268 1268 a, g dbSNP:201880691
1269 1269 c, t dbSNP:57499497
1282 1282 c, t dbSNP:563862970
1285 1285 c, g dbSNP:764251624
1287 1287 c, t dbSNP:760935787
1288 1288 a, g dbSNP:775802572
1296 1296 a, c, t dbSNP:150075392
1297 1297 a, g dbSNP:542502733
1299 1299 g, t dbSNP:771349496
1300 1300 c, g dbSNP:748770237
1303 1303 c, g, t dbSNP:72653766
1305 1305 c, t dbSNP:375433102
1308 1308 c, t dbSNP:200519199
1309 1309 a, g dbSNP:372059636
1313 1313 a, g dbSNP:142007498
1321 1321 c, g dbSNP:746781173
1324 1324 a, c dbSNP:751934523
1328 1328 g, t dbSNP:766697715
1329 1329 a, g dbSNP:58703366
1334 1334 c, t dbSNP:750898196
1338 1338 c, t dbSNP:57546826
1339 1339 a, g dbSNP:761364455
1346 1346 c, t dbSNP:554886514
1348 1348 c, g dbSNP:67996819
1353 1353 c, g, t dbSNP:141309818
1354 1354 a, g dbSNP:775349711
1355 1355 c, g dbSNP:771913153
1356 1356 a, t dbSNP:572266339
1359 1359 c, t dbSNP:370494121
1362 1362 c, t dbSNP:778756933
1365 1365 a, g dbSNP:770889156
1367 1367 a, g dbSNP:748212814
1371 1371 c, t dbSNP:781181816
1373 1373 a, t dbSNP:72653767
1387 1387 c, t dbSNP:755200644
1396 1396 a, c dbSNP:751783664
1397 1397 a, g dbSNP:780432555
1408 1408 c, g dbSNP:758767349
1409 1409 a, t dbSNP:151187637
1420 1420 a, g dbSNP:368746151
1423 1423 c, g dbSNP:746211393
1444 1444 c, g dbSNP:374244303
1445 1445 a, g dbSNP:72653768
1450 1450 c, t dbSNP:754360599
1458 1458 c, t dbSNP:764676656
1460 1460 a, g dbSNP:755513036
1463 1463 a, c dbSNP:752237181
1469 1469 a, t dbSNP:72653769
1472 1472 a, g dbSNP:759237396
1476 1476 a, c dbSNP:72653770
1484 1484 c, t dbSNP:372045804
1485 1485 c, t dbSNP:766232685
1486 1486 a, c, g dbSNP:772952563
1490 1490 a, t dbSNP:72653771
1496 1496 a, g dbSNP:769798621
1499 1499 a, g dbSNP:747009873
1502 1502 a, g, t dbSNP:151130276
1504 1504 c, g dbSNP:368017088
1506 1506 c, g dbSNP:561552566
1510 1510 g, t dbSNP:746159494
1511 1511 c, g dbSNP:779408186
1521 1521 c, t dbSNP:757506868
1523 1523 c, g dbSNP:749668818
1525 1525 a, g dbSNP:59157279
1537 1537 c, t dbSNP:72650700
1538 1538 a, g dbSNP:72653772
1541 1541 a, g dbSNP:767057050
1552 1552 a, g dbSNP:374546971
1554 1554 a, c, t dbSNP:145764775
1555 1555 a, g, t dbSNP:143588929
1559 1559 -, g dbSNP:72664217
1561 1561 c, t dbSNP:773079563
1562 1562 a, c, g dbSNP:761847996
1569 1569 c, t dbSNP:775706145
1570 1570 a, g dbSNP:140045277
1571 1571 a, g dbSNP:199643353
1574 1574 c, t dbSNP:774648925
1585 1585 g, t dbSNP:199634124
1588 1588 c, t dbSNP:72653773
1589 1589 c, t dbSNP:749568041
1590 1590 a, g dbSNP:778251096
1591 1591 c, g dbSNP:770172306
1594 1594 a, g dbSNP:748724484
1610 1610 c, t dbSNP:780671208
1615 1615 c, t dbSNP:754414760
1621 1621 a, g dbSNP:745373850
1624 1624 a, g dbSNP:56877937
1632 1632 c, g dbSNP:756992618
1636 1636 c, t dbSNP:532536884
1637 1637 c, t dbSNP:72653774
1642 1642 a, g dbSNP:558508305
1647 1647 c, t dbSNP:777753626
1649 1649 c, g dbSNP:769979506
1651 1651 c, t dbSNP:756119394
1656 1656 a, g dbSNP:752741312
1657 1657 a, g dbSNP:767373230
1659 1659 c, t dbSNP:758440783
1660 1660 a, g dbSNP:114149656
1669 1669 a, g dbSNP:575023438
1670 1670 c, t dbSNP:72653775
1684 1684 a, g dbSNP:143092672
1686 1686 c, g dbSNP:376767639
1688 1688 c, t dbSNP:66864704
1692 1692 a, g dbSNP:760958976
1693 1693 a, c dbSNP:369358409
1694 1694 c, g dbSNP:772487026
1709 1709 a, g dbSNP:745335274
1711 1711 a, g dbSNP:774053885
1712 1712 g, t dbSNP:770677975
1716 1716 c, t dbSNP:139771750
1720 1720 a, g dbSNP:749017755
1729 1729 c, g dbSNP:777700593
1732 1732 g, t dbSNP:541463984
1735 1735 a, c dbSNP:747904631
1745 1745 c, g dbSNP:527236047
1746 1746 c, t dbSNP:762221578
1748 1748 g, t dbSNP:750497192
1752 1752 c, t dbSNP:779024802
1754 1754 c, t dbSNP:537233133
1756 1756 c, g dbSNP:201193903
1758 1758 c, t dbSNP:764315042
1759 1759 a, c, g dbSNP:190761354
1760 1760 g, t dbSNP:753035055
1766 1766 c, t dbSNP:72653776
1768 1768 c, t dbSNP:150866831
1769 1769 a, g dbSNP:762499171
1775 1775 c, g dbSNP:772893948
1783 1783 c, t dbSNP:72653777
1784 1784 a, g dbSNP:761433545
1790 1790 -, gtctggt dbSNP:781369291
1797 1797 a, c dbSNP:776483503
1799 1799 c, t dbSNP:768271196
1800 1800 c, t dbSNP:61318127
1802 1802 c, g dbSNP:779918495
1807 1807 a, g dbSNP:772029460
1810 1810 g, t dbSNP:749334729
1820 1820 a, c dbSNP:777763168
1822 1822 a, g dbSNP:369816256
1823 1823 g, t dbSNP:72653778
1826 1826 c, t dbSNP:12931472
1827 1827 c, t dbSNP:375557810
1828 1828 a, g dbSNP:372235202
1833 1833 c, g dbSNP:751992037
1838 1838 a, g, t dbSNP:371997398
1842 1842 -, c dbSNP:72664218
1851 1851 c, t dbSNP:561150422
1852 1852 a, g dbSNP:764724652
1857 1857 c, t dbSNP:747341864
1858 1858 a, g dbSNP:780626660
1862 1862 a, g dbSNP:758972882
1866 1866 c, t dbSNP:143100448
1871 1871 c, t dbSNP:765789199
1874 1874 c, t dbSNP:756674188
1875 1875 c, g dbSNP:8058696
1877 1877 c, t dbSNP:763622746
1881 1881 a, c dbSNP:8058694
1883 1883 g, t dbSNP:775252212
1893 1893 c, t dbSNP:767365625
1894 1894 a, g dbSNP:759329140
1914 1914 c, t dbSNP:774095608
1919 1919 g, t dbSNP:763559553
1923 1923 c, t dbSNP:578241312
1929 1929 -, aataaacctcacggtgccccag dbSNP:74315158
1935 1935 c, t dbSNP:771328866
1936 1936 c, t dbSNP:749872772
1940 1940 c, t dbSNP:146936233
1941 1941 a, c, g dbSNP:141399693
1942 1942 g, t dbSNP:780781289
1946 1946 c, t dbSNP:754695089
1948 1948 a, c, t dbSNP:369410139
1949 1949 a, g dbSNP:72653779
1952 1952 -, gctgtctgctggctgttgtcggt dbSNP:74315130
1952 1952 a, g dbSNP:762665355
1957 1957 a, c dbSNP:750330150
1962 1962 a, g dbSNP:765290667
1963 1963 -, gctgttg dbSNP:760707891
1971 1971 c, t dbSNP:760798025
1972 1972 a, g, t dbSNP:72653780
1975 1975 c, t dbSNP:59002125
1978 1978 c, g dbSNP:774573071
1979 1979 c, t dbSNP:4341770
1980 1980 -, g dbSNP:72664227
1981 1981 g, t dbSNP:72653781
1984 1984 -, g dbSNP:775321637
1984 1984 -, g dbSNP:72664228
1984 1984 g, t dbSNP:771260023
2002 2002 c, t dbSNP:749625887
2003 2003 c, t dbSNP:67470842
2004 2004 a, g dbSNP:770314455
2007 2007 c, t dbSNP:747622924
2008 2008 a, g dbSNP:780726064
2015 2015 c, t dbSNP:72653782
2019 2019 a, g dbSNP:761805973
2023 2023 a, c dbSNP:746608585
2027 2027 c, t dbSNP:779590375
2030 2030 a, t dbSNP:758166222
2031 2031 a, g dbSNP:750276636
2032 2032 -, g dbSNP:758980634
2032 2032 g, t dbSNP:150128722
2034 2034 a, g dbSNP:372511255
2038 2038 c, g dbSNP:752811993
2043 2043 c, t dbSNP:57866002
2044 2044 a, g dbSNP:368806440
2048 2048 a, g dbSNP:774574107
2052 2052 a, c, t dbSNP:61266641
2053 2053 a, g dbSNP:773604010
2059 2059 a, g dbSNP:151272575
2060 2060 c, t dbSNP:766589881
2063 2063 c, t dbSNP:374763280
2064 2064 a, g dbSNP:189252048
2065 2065 a, g dbSNP:763209072
2066 2066 c, t dbSNP:199951066
2070 2070 c, t dbSNP:199913903
2071 2071 a, g dbSNP:143731811
2078 2078 a, c dbSNP:72653783
2082 2082 a, g, t dbSNP:72653784
2089 2089 -, g dbSNP:778327274
2091 2091 a, g dbSNP:557278262
2092 2092 c, g dbSNP:536095313
2103 2103 g, t dbSNP:774914077
2104 2104 a, g dbSNP:372121585
2106 2106 a, c, g dbSNP:778711523
2108 2108 c, t dbSNP:770792223
2110 2110 a, g dbSNP:114303883
2116 2116 a, c, g dbSNP:200800189
2119 2119 c, t dbSNP:140013237
2124 2124 c, t dbSNP:115546382
2125 2125 a, g dbSNP:200513114
2131 2131 c, g dbSNP:750590368
2147 2147 a, g dbSNP:72650701
2151 2151 a, g dbSNP:201193229
2152 2152 a, g dbSNP:762127969
2156 2156 a, g dbSNP:58073789
2160 2160 a, t dbSNP:59757815
2161 2161 c, t dbSNP:761145428
2162 2162 c, t dbSNP:72653785
2165 2165 a, g dbSNP:775061021
2173 2173 a, g dbSNP:771642702
2180 2180 a, g dbSNP:759130313
2187 2187 c, t dbSNP:774098410
2192 2192 a, g dbSNP:148573422
2209 2209 a, g dbSNP:59593133
2217 2217 g, t dbSNP:777474704
2221 2221 -, ggtgcagagt dbSNP:770020252
2222 2222 c, t dbSNP:769753486
2223 2223 c, t dbSNP:748098140
2227 2227 -, g dbSNP:748503108
2230 2230 c, g, t dbSNP:66616070
2236 2236 a, g dbSNP:759077182
2237 2237 a, t dbSNP:72653786
2244 2244 c, g dbSNP:774043587
2247 2247 c, t dbSNP:149822534
2248 2248 a, g dbSNP:72653787
2252 2252 g, t dbSNP:752518198
2253 2253 a, c dbSNP:116633099
2263 2263 c, t dbSNP:72653788
2264 2264 a, g dbSNP:769405586
2276 2276 c, t dbSNP:748000420
2278 2278 c, t dbSNP:776513864
2279 2279 a, g, t dbSNP:67561842
2282 2282 a, c dbSNP:72653789
2284 2284 a, g dbSNP:538408828
2289 2289 a, c dbSNP:66492417
2291 2291 a, g dbSNP:57794451
2301 2301 c, t dbSNP:757497225
2302 2302 a, g dbSNP:114185856
2307 2307 -, c dbSNP:72664229
2313 2313 a, g dbSNP:749406403
2314 2314 a, g dbSNP:72653790
2321 2321 c, t dbSNP:549658225
2327 2327 a, c, t dbSNP:72653791
2328 2328 a, g dbSNP:768106519
2341 2341 a, c dbSNP:755590289
2343 2343 c, t dbSNP:751097083
2344 2344 a, g, t dbSNP:72653792
2352 2352 a, c, g dbSNP:772679085
2353 2353 c, t dbSNP:114246406
2356 2356 a, g dbSNP:764975212
2370 2370 c, t dbSNP:761484572
2372 2372 c, t dbSNP:776463091
2375 2375 a, g dbSNP:768570780
2378 2378 c, t dbSNP:142223793
2380 2380 c, g dbSNP:747017064
2381 2381 g, t dbSNP:775412517
2382 2382 g, t dbSNP:770859081
2385 2385 a, g dbSNP:7500834
2394 2394 c, g dbSNP:116898670
2396 2396 a, g dbSNP:756398303
2400 2400 a, g dbSNP:748500639
2404 2404 c, t dbSNP:72653793
2405 2405 a, g dbSNP:72653794
2412 2412 c, t dbSNP:769081280
2413 2413 a, g dbSNP:72653795
2417 2417 c, g, t dbSNP:72653796
2418 2418 a, g dbSNP:749892052
2421 2421 c, t dbSNP:374490625
2422 2422 a, g dbSNP:756766310
2427 2427 a, c dbSNP:372714722
2436 2436 a, g dbSNP:781086233
2443 2443 c, g dbSNP:72653797
2458 2458 c, g dbSNP:760420743
2459 2459 c, t dbSNP:752527142
2462 2462 c, t dbSNP:72653798
2463 2463 c, g dbSNP:138026855
2466 2466 a, g dbSNP:773156957
2467 2467 a, c, g dbSNP:181794120
2475 2475 c, t dbSNP:9924755
2476 2476 a, t dbSNP:769042480
2477 2477 a, c, t dbSNP:370039769
2479 2479 a, g dbSNP:772456820
2489 2489 a, g dbSNP:199990104
2490 2490 a, t dbSNP:779301637
2496 2496 a, c dbSNP:72650702
2497 2497 c, t dbSNP:756709738
2498 2498 a, g dbSNP:753378294
2502 2502 a, g dbSNP:777372493
2505 2505 g, t dbSNP:755811789
2506 2506 c, t dbSNP:60990156
2509 2509 c, t dbSNP:72653703
2515 2515 a, c dbSNP:201884545
2517 2517 c, g dbSNP:142701023
2521 2521 a, g dbSNP:754730506
2522 2522 c, t dbSNP:751451807
2527 2527 -, a dbSNP:67867306
2527 2527 a, g dbSNP:6416668
2529 2529 a, g dbSNP:761941142
2537 2537 c, t dbSNP:72653799
2538 2538 a, g dbSNP:563641079
2539 2539 g, t dbSNP:764401327
2550 2550 a, g dbSNP:375979955
2560 2560 c, g dbSNP:766400372
2584 2584 c, t dbSNP:376512808
2587 2587 a, g, t dbSNP:114349489
2590 2590 a, g dbSNP:747629569
2592 2592 c, g dbSNP:780854527
2594 2594 g, t dbSNP:754624352
2597 2597 c, g dbSNP:746808719
2604 2604 c, t dbSNP:780064112
2605 2605 c, g dbSNP:758275685
2607 2607 c, t dbSNP:750332089
2612 2612 a, g dbSNP:149081681
2613 2613 a, c dbSNP:115379860
2616 2616 a, c dbSNP:72664285
2620 2620 a, g dbSNP:377008733
2628 2628 g, t dbSNP:72653800
2634 2634 c, t dbSNP:373335815
2635 2635 a, g dbSNP:138049574
2644 2644 a, c, t dbSNP:59206042
2645 2645 a, g dbSNP:201334880
2646 2646 c, t dbSNP:376958386
2647 2647 a, g dbSNP:115167678
2651 2651 a, g dbSNP:776065362
2655 2655 c, t dbSNP:777202577
2656 2656 a, c dbSNP:767997301
2670 2670 c, t dbSNP:760288790
2671 2671 a, g dbSNP:775243858
2673 2673 a, g dbSNP:771892138
2677 2677 a, g, t dbSNP:778911783
2680 2680 c, g, t dbSNP:11861980
2681 2681 a, g dbSNP:116355959
2682 2682 c, t dbSNP:552531659
2686 2686 a, g dbSNP:111437625
2689 2689 g, t dbSNP:573589057
2692 2692 c, g dbSNP:60712230
2702 2702 c, g dbSNP:375890241
2706 2706 a, g dbSNP:780215689
2707 2707 a, g dbSNP:758666711
2719 2719 a, g dbSNP:539820701
2721 2721 c, t dbSNP:750784341
2723 2723 c, g dbSNP:765456179
2730 2730 a, g dbSNP:559575288
2742 2742 a, g dbSNP:140467297
2748 2748 a, c dbSNP:764693216
2754 2754 c, g dbSNP:760231794
2761 2761 c, g dbSNP:775190553
2764 2764 c, t dbSNP:767267908
2766 2766 a, c, t dbSNP:61731973
2767 2767 a, g dbSNP:142470921
2769 2769 -, cagg dbSNP:765405352
2769 2769 c, g dbSNP:749125777
2773 2773 g, t dbSNP:375196952
2781 2781 c, t dbSNP:575521072
2784 2784 a, g dbSNP:759128201
2797 2797 g, t dbSNP:557260944
2799 2799 c, g dbSNP:72653704
2804 2804 a, g dbSNP:775704936
2805 2805 -, c dbSNP:72664219
2805 2805 g, t dbSNP:72664286
2809 2809 a, g dbSNP:375592383
2816 2816 a, c, t dbSNP:72653801
2820 2820 -, cctctgcctctacgca dbSNP:74315152
2820 2820 c, t dbSNP:2856585
2821 2821 a, c dbSNP:61340537
2832 2832 c, g, t dbSNP:553008971
2833 2833 a, g dbSNP:72657689
2834 2834 c, t dbSNP:190557767
2835 2835 a, g dbSNP:778351699
2836 2836 c, g dbSNP:750835224
2840 2840 g, t dbSNP:72657690
2843 2843 a, t dbSNP:72657700
2846 2846 -, tcctct dbSNP:767359198
2848 2848 a, c dbSNP:142377854
2863 2863 a, g dbSNP:781769354
2865 2865 c, t dbSNP:754493974
2867 2867 -, cct dbSNP:759512269
2869 2869 c, t dbSNP:751120477
2871 2871 c, g dbSNP:765924261
2875 2875 c, g, t dbSNP:558710437
2876 2876 a, c, g dbSNP:72657691
2889 2889 a, g dbSNP:72664287
2894 2894 a, t dbSNP:776512349
2900 2900 c, t dbSNP:768619900
2901 2901 a, g dbSNP:759516647
2904 2904 c, t dbSNP:774551826
2906 2906 a, g dbSNP:147391297
2907 2907 a, c dbSNP:749463148
2915 2915 a, t dbSNP:778151578
2918 2918 a, g dbSNP:770232227
2919 2919 c, t dbSNP:748551497
2920 2920 c, g dbSNP:569941928
2924 2924 a, g dbSNP:755557398
2928 2928 a, g, t dbSNP:368465318
2930 2930 c, t dbSNP:757861271
2931 2931 a, g dbSNP:138410013
2939 2939 a, c dbSNP:764901693
2944 2944 a, c dbSNP:761565275
2945 2945 a, g dbSNP:374113337
2949 2949 a, c dbSNP:548522940
2950 2950 a, g dbSNP:529676674
2952 2952 c, g dbSNP:775296841
2958 2958 c, t dbSNP:375767696
2959 2959 a, c, g dbSNP:72657692
2967 2967 c, t dbSNP:113270297
2968 2968 a, g dbSNP:748500800
2977 2977 c, t dbSNP:777193567
2986 2986 a, g dbSNP:773471469
3001 3001 a, g, t dbSNP:762192080
3008 3008 c, t dbSNP:776995531
3009 3009 a, g dbSNP:372041663
3010 3010 a, g dbSNP:747365754
3014 3014 g, t dbSNP:776034467
3020 3020 a, g dbSNP:772505132
3026 3026 c, t dbSNP:150583228
3028 3028 c, g, t dbSNP:756768329
3029 3029 a, g dbSNP:373863345
3039 3039 a, g dbSNP:370805624
3048 3048 a, c dbSNP:755895436
3049 3049 c, g dbSNP:57179857
3057 3057 c, t dbSNP:767464604
3060 3060 a, g dbSNP:376087244
3073 3073 c, t dbSNP:72653705
3074 3074 a, c, g dbSNP:374451029
3084 3084 c, g dbSNP:765339542
3091 3091 -, ttt dbSNP:72664230
3091 3091 c, t dbSNP:761996195
3094 3094 a, g dbSNP:754074990
3098 3098 a, g dbSNP:371211631
3103 3103 c, t dbSNP:148064788
3105 3105 a, c dbSNP:775777175
3106 3106 a, g dbSNP:772632852
3107 3107 c, t dbSNP:759973159
3120 3120 a, g dbSNP:774855686
3122 3122 a, c dbSNP:574303164
3124 3124 c, t dbSNP:199571237
3128 3128 -, tct dbSNP:769437554
3130 3130 g, t dbSNP:72657693
3140 3140 c, t dbSNP:769376902
3144 3144 a, c, g dbSNP:780915265
3146 3146 a, c, t dbSNP:145411106
3147 3147 a, g, t dbSNP:374140753
3150 3150 g, t dbSNP:757383677
3153 3153 a, c, t dbSNP:72657694
3154 3154 a, g dbSNP:767588374
3155 3155 c, t dbSNP:759678455
3157 3157 a, g dbSNP:764365055
3160 3160 a, t dbSNP:760876912
3164 3164 c, g dbSNP:752972412
3169 3169 a, g dbSNP:377653646
3173 3173 g, t dbSNP:72657695
3175 3175 c, t dbSNP:41278174
3176 3176 c, g dbSNP:774796759
3180 3180 c, t dbSNP:771465541
3189 3189 a, g dbSNP:762424228
3192 3192 a, c, t dbSNP:60975032
3193 3193 a, g dbSNP:369518454
3204 3204 a, c dbSNP:747688307
3211 3211 g, t dbSNP:780909519
3224 3224 c, t dbSNP:374864191
3229 3229 a, g dbSNP:746841085
3235 3235 -, a dbSNP:371101978
3235 3235 -, a dbSNP:748469243
3235 3235 a, c dbSNP:780119666
3236 3236 a, c dbSNP:199637421
3240 3240 a, c dbSNP:758468125
3241 3241 c, t dbSNP:753948841
3242 3242 c, t dbSNP:777650741
3255 3255 c, t dbSNP:756236377
3256 3256 a, c dbSNP:752816345
3257 3257 c, t dbSNP:767760386
3267 3267 a, g dbSNP:755301606
3274 3274 a, c, t dbSNP:60707953
3277 3277 c, t dbSNP:377480088
3279 3279 c, t dbSNP:371889155
3280 3280 a, g dbSNP:773773146
3284 3284 a, g dbSNP:764594366
3296 3296 c, t dbSNP:755052004
3297 3297 c, g dbSNP:559504956
3304 3304 a, g dbSNP:747176430
3305 3305 c, t dbSNP:780276741
3311 3311 a, c dbSNP:758648156
3325 3325 c, t dbSNP:63749794
3326 3326 a, c, g dbSNP:63750427
3327 3327 c, t dbSNP:757849397
3328 3328 -, ttg dbSNP:72664231
3328 3328 c, t dbSNP:754402001
3330 3330 a, g dbSNP:763644344
3347 3347 c, g, t dbSNP:63750987
3348 3348 a, g, t dbSNP:145693403
3349 3349 -, t dbSNP:72664232
3360 3360 c, t dbSNP:115364698
3361 3361 c, t dbSNP:774256027
3364 3364 a, g dbSNP:770766953
3365 3365 c, t dbSNP:63749998
3366 3366 a, g dbSNP:63750758
3371 3371 a, g dbSNP:554806195
3374 3374 c, t dbSNP:63750459
3375 3375 a, g dbSNP:149775493
3382 3382 g, t dbSNP:63749807
3383 3383 c, g dbSNP:63750473
3390 3390 a, g dbSNP:780107077
3396 3396 c, g dbSNP:772396564
3397 3397 c, t dbSNP:28939701
3398 3398 a, c, g dbSNP:60791294
3400 3400 a, g dbSNP:63750146
3402 3402 a, g dbSNP:754351046
3406 3406 c, t dbSNP:72653706
3407 3407 a, c, g dbSNP:572351621
3412 3412 c, t dbSNP:72653743
3413 3413 a, t dbSNP:767060442
3416 3416 c, t dbSNP:145553069
3420 3420 -, c dbSNP:769105086
3440 3440 c, t dbSNP:751173976
3441 3441 a, t dbSNP:766135952
3442 3442 c, t dbSNP:762758350
3443 3443 a, g, t dbSNP:553479685
3444 3444 c, t dbSNP:59030767
3445 3445 a, g dbSNP:147794514
3446 3446 c, t dbSNP:775707011
3460 3460 a, g dbSNP:772050759
3462 3462 a, g dbSNP:746045818
3473 3473 c, t dbSNP:142128765
3474 3474 a, g, t dbSNP:202000035
3475 3475 c, t dbSNP:72653744
3476 3476 a, g dbSNP:63750457
3483 3483 a, g dbSNP:747602889
3487 3487 c, g dbSNP:143854720
3500 3500 c, t dbSNP:753771636
3501 3501 a, g dbSNP:763980825
3502 3502 -, g dbSNP:758506257
3509 3509 c, t dbSNP:376062004
3520 3520 c, g dbSNP:774355343
3527 3527 a, g dbSNP:114928628
3531 3531 a, g dbSNP:372578623
3533 3533 g, t dbSNP:773579765
3542 3542 a, c dbSNP:149460452
3547 3547 a, c dbSNP:572010361
3548 3548 c, t dbSNP:777163389
3549 3549 a, g dbSNP:58494932
3552 3552 c, t dbSNP:780601545
3553 3553 a, g dbSNP:779472538
3556 3556 a, g dbSNP:771584027
3560 3560 c, t dbSNP:201087449
3571 3571 c, g dbSNP:146284800
3573 3573 a, c dbSNP:778568997
3577 3577 a, g dbSNP:114920767
3578 3578 a, g dbSNP:753628351
3581 3581 c, g dbSNP:777757369
3585 3585 c, t dbSNP:200132882
3588 3588 c, t dbSNP:756077096
3589 3589 a, g dbSNP:752683023
3591 3591 a, g dbSNP:766504801
3593 3593 a, g dbSNP:63750607
3599 3599 -, ct dbSNP:745900279
3601 3601 a, g dbSNP:375983928
3607 3607 a, g dbSNP:763146137
3610 3610 c, g dbSNP:750630523
3613 3613 c, g, t dbSNP:762213485
3615 3615 c, t dbSNP:776917491
3619 3619 c, g dbSNP:765483994
3621 3621 g, t dbSNP:762007802
3624 3624 c, t dbSNP:754104618
3629 3629 c, t dbSNP:764318423
3634 3634 a, c dbSNP:371493792
3637 3637 a, t dbSNP:114017587
3639 3639 g, t dbSNP:775947674
3645 3645 c, t dbSNP:371191765
3646 3646 c, t dbSNP:63751215
3647 3647 a, g dbSNP:63751001
3653 3653 a, g dbSNP:72653745
3661 3661 a, c dbSNP:63750125
3662 3662 c, t dbSNP:770483331
3675 3675 c, t dbSNP:368931767
3676 3676 a, g dbSNP:141728905
3677 3677 -, t dbSNP:779018991
3683 3683 c, t dbSNP:769432314
3684 3684 a, g dbSNP:747993729
3688 3688 c, t dbSNP:63750402
3689 3689 a, g dbSNP:138700741
3693 3693 a, g dbSNP:745938225
3694 3694 c, t dbSNP:72653746
3696 3696 a, g dbSNP:778791988
3697 3697 c, g dbSNP:63749796
3700 3700 c, t dbSNP:63749992
3702 3702 g, t dbSNP:72653747
3703 3703 g, t dbSNP:150145577
3707 3707 a, g dbSNP:72653748
3708 3708 c, g dbSNP:72657701
3710 3710 c, t dbSNP:141449320
3717 3717 a, g dbSNP:773961518
3720 3720 a, g, t dbSNP:281865557
3722 3722 c, t dbSNP:772108097
3723 3723 c, t dbSNP:749327665
3724 3724 a, c dbSNP:199694536
3725 3725 c, g dbSNP:200242428
3736 3736 c, t dbSNP:148326870
3740 3740 a, c, g, t dbSNP:143212758
3742 3742 -, t dbSNP:764868012
3745 3745 a, g dbSNP:375647381
3754 3754 -, c dbSNP:72664220
3754 3754 a, c, g dbSNP:750897812
3755 3755 a, c dbSNP:576328904
3757 3757 c, t dbSNP:761440521
3759 3759 -, c dbSNP:72664221
3760 3760 -, t dbSNP:72664233
3763 3763 c, g dbSNP:149151337
3771 3771 c, t dbSNP:546064934
3772 3772 a, g dbSNP:760376992
3780 3780 c, g, t dbSNP:114175094
3781 3781 a, g dbSNP:771770753
3783 3783 -, g dbSNP:72664234
3787 3787 c, t dbSNP:368379895
3788 3788 a, g dbSNP:2238472
3803 3803 a, g dbSNP:63750209
3806 3806 -, accgacctgagctcccgctggctgtgcagggcgtgtccttcaagatcc dbSNP:74315128
3807 3807 c, t dbSNP:769820268
3808 3808 c, t dbSNP:72653749
3809 3809 a, g dbSNP:200010958
3811 3811 c, t dbSNP:759798432
3821 3821 c, t dbSNP:77913024
3822 3822 a, g dbSNP:61294695
3831 3831 a, g, t dbSNP:750893189
3835 3835 g, t dbSNP:779603756
3837 3837 c, t dbSNP:56982924
3838 3838 a, g dbSNP:141731889
3841 3841 c, t dbSNP:753457535
3848 3848 a, g dbSNP:751910206
3854 3854 a, g dbSNP:763831330
3855 3855 c, t dbSNP:760304927
3856 3856 a, g dbSNP:58694313
3857 3857 a, c dbSNP:369871412
3862 3862 a, g dbSNP:63750625
3865 3865 -, aag dbSNP:72664235
3867 3867 a, g dbSNP:376851894
3868 3868 a, g dbSNP:767119931
3870 3870 a, g dbSNP:754782996
3872 3872 a, g dbSNP:374086268
3876 3876 c, t dbSNP:375741855
3877 3877 a, g, t dbSNP:63751325
3880 3880 a, g dbSNP:63750446
3887 3887 c, t dbSNP:63750494
3888 3888 a, c, t dbSNP:201812902
3889 3889 a, g dbSNP:63749856
3892 3892 a, c, g dbSNP:63750410
3897 3897 a, g dbSNP:774787962
3897 3897 -, g dbSNP:72664236
3904 3904 c, t dbSNP:63751318
3914 3914 c, g dbSNP:771434033
3917 3917 a, g dbSNP:63750992
3921 3921 a, g dbSNP:749761484
3924 3924 a, g dbSNP:371122759
3925 3925 c, t dbSNP:63750759
3926 3926 a, g dbSNP:63751086
3933 3933 a, g dbSNP:747664194
3938 3938 c, g dbSNP:780887287
3946 3946 a, g dbSNP:63749823
3947 3947 a, g dbSNP:754656944
3956 3956 a, g dbSNP:72653750
3960 3960 c, t dbSNP:751220009
3961 3961 a, g dbSNP:766105758
3963 3963 c, t dbSNP:57499803
3964 3964 a, g dbSNP:79536709
3965 3965 a, g dbSNP:57695665
3973 3973 a, c, g dbSNP:58902671
3974 3974 c, t dbSNP:760794410
3977 3977 c, t dbSNP:752785718
3979 3979 a, c dbSNP:767636709
3981 3981 c, g, t dbSNP:60320257
3982 3982 a, c, g dbSNP:142505247
3984 3984 a, g dbSNP:63750235
3987 3987 c, g dbSNP:139128550
3989 3989 a, c, t dbSNP:63750414
3990 3990 a, g dbSNP:770266146
3991 3991 a, c dbSNP:376735995
3993 3993 c, t dbSNP:146265944
3995 3995 a, c dbSNP:780504422
3996 3996 a, c, g dbSNP:58259232
4000 4000 a, c, t dbSNP:28939702
4001 4001 a, g, t dbSNP:63750622
4010 4010 c, t dbSNP:63750608
4018 4018 c, g dbSNP:63749800
4021 4021 c, t dbSNP:63751112
4022 4022 c, t dbSNP:750243019
4026 4026 a, c, g dbSNP:63751111
4033 4033 a, c dbSNP:72664288
4035 4035 c, t dbSNP:141821068
4038 4038 c, g dbSNP:766707250
4041 4041 c, t dbSNP:758486813
4044 4044 c, t dbSNP:750674262
4045 4045 c, g dbSNP:63750018
4049 4049 c, t dbSNP:765472331
4054 4054 c, t dbSNP:63750428
4055 4055 a, g dbSNP:201275608
4058 4058 g, t dbSNP:764635677
4066 4066 a, g dbSNP:58695352
4071 4071 a, g dbSNP:139978668
4080 4080 a, g dbSNP:771581942
4086 4086 a, c, g dbSNP:200834294
4089 4089 a, c, t dbSNP:199668617
4089 4089 -, c dbSNP:72664237
4090 4090 a, g dbSNP:60285147
4092 4092 a, g dbSNP:375386682
4093 4093 a, g dbSNP:777835756
4108 4108 c, t dbSNP:756191351
4111 4111 g, t dbSNP:748103958
4115 4115 c, t dbSNP:371122482
4116 4116 c, g, t dbSNP:750573670
4125 4125 c, t dbSNP:368258006
4134 4134 g, t dbSNP:757540398
4136 4136 c, t dbSNP:754267653
4147 4147 c, t dbSNP:764446055
4149 4149 c, g, t dbSNP:373736094
4150 4150 a, g dbSNP:775998775
4156 4156 c, t dbSNP:766971195
4159 4159 a, c dbSNP:759123370
4161 4161 a, g dbSNP:534017491
4167 4167 c, g, t dbSNP:63750798
4167 4167 -, g dbSNP:67791546
4174 4174 a, g dbSNP:749035807
4177 4177 c, t dbSNP:66913554
4178 4178 a, g dbSNP:202080984
4182 4182 c, t dbSNP:199770983
4183 4183 a, g dbSNP:63751241
4186 4186 g, t dbSNP:772015821
4189 4189 c, g dbSNP:746009029
4194 4194 a, c dbSNP:63750700
4195 4195 a, g dbSNP:200485267
4201 4201 a, c dbSNP:387906859
4202 4202 -, a dbSNP:779044271
4203 4203 c, g dbSNP:149510465
4204 4204 -, agaa dbSNP:72664222
4209 4209 g, t dbSNP:761687550
4211 4211 a, t dbSNP:776557438
4225 4225 a, c, t dbSNP:760611511
4226 4226 c, g dbSNP:775319351
4228 4228 -, agaa dbSNP:387906352
4230 4230 c, g, t dbSNP:749415846
4232 4232 g, t dbSNP:58626288
4236 4236 c, g dbSNP:773407624
4237 4237 a, c, t dbSNP:59588658
4238 4238 a, c, g dbSNP:63751262
4239 4239 a, g dbSNP:58668703
4243 4243 a, c dbSNP:571678512
4249 4249 a, c dbSNP:549920304
4254 4254 c, t dbSNP:757960904
4256 4256 c, t dbSNP:63750295
4259 4259 c, t dbSNP:150230403
4263 4263 c, t dbSNP:376210462
4264 4264 a, g dbSNP:756910757
4268 4268 a, c, t dbSNP:763908026
4271 4271 c, t dbSNP:374236964
4274 4274 c, t dbSNP:760426231
4278 4278 c, t dbSNP:766362120
4279 4279 a, g dbSNP:531418668
4286 4286 c, t dbSNP:199950526
4287 4287 c, t dbSNP:763012366
4289 4289 a, g dbSNP:773205132
4290 4290 c, t dbSNP:72664289
4291 4291 -, acggagc dbSNP:74315109
4293 4293 a, g dbSNP:769879386
4299 4299 a, g dbSNP:61553825
4303 4303 -, a dbSNP:72664238
4312 4312 a, g dbSNP:143822047
4317 4317 c, t dbSNP:559653607
4320 4320 -, g dbSNP:72664239
4330 4330 a, g dbSNP:747383956
4340 4340 c, g dbSNP:780599196
4350 4350 c, t dbSNP:369157557
4355 4355 c, t dbSNP:759040684
4356 4356 c, g, t dbSNP:376955544
4359 4359 c, t dbSNP:371710180
4360 4360 c, t dbSNP:72547524
4361 4361 a, g dbSNP:753497739
4362 4362 c, g, t dbSNP:63750763
4367 4367 a, g dbSNP:57288618
4369 4369 g, t dbSNP:752497561
4371 4371 c, t dbSNP:767302163
4372 4372 a, g dbSNP:759407080
4376 4376 c, t dbSNP:774296589
4383 4383 c, t dbSNP:765262614
4387 4387 c, g, t dbSNP:776891665
4388 4388 a, g, t dbSNP:761098006
4390 4390 a, g dbSNP:767908367
4404 4404 a, c dbSNP:759971821
4405 4405 a, t dbSNP:72653751
4410 4410 a, g dbSNP:114099077
4419 4419 -, a dbSNP:72664280
4422 4422 a, c, g dbSNP:763316917
4425 4425 c, t dbSNP:548798705
4426 4426 a, g dbSNP:63751279
4433 4433 c, t dbSNP:63750135
4434 4434 a, g dbSNP:776255682
4438 4438 c, t dbSNP:566671584
4443 4443 c, g dbSNP:768365514
4444 4444 c, g dbSNP:746670054
4458 4458 c, t dbSNP:141860096
4459 4459 -, a dbSNP:780884882
4461 4461 a, c, g dbSNP:745761393
4462 4462 c, t dbSNP:778956327
4469 4469 c, g dbSNP:756250178
4478 4478 a, g dbSNP:752891529
4486 4486 a, g, t dbSNP:63750874
4488 4488 c, t dbSNP:368798086
4497 4497 -, agccag dbSNP:754847748
4503 4503 g, t dbSNP:755189930
4505 4505 c, t dbSNP:751851580
4507 4507 c, g dbSNP:766609974
4513 4513