
NHLRC1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol NHLRC1
Entrez Gene ID 378884
Full Name NHL repeat containing E3 ubiquitin protein ligase 1
Synonyms EPM2A, EPM2B, MALIN, bA204B7.2
General protein information
Preferred Names
E3 ubiquitin-protein ligase NHLRC1
E3 ubiquitin-protein ligase NHLRC1
NHL repeat-containing protein 1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]. lac of sum
Disorder MIM:


Disorder Html: Epilepsy, progressive myoclonic 2B (Lafora), 254780 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_198586 NP_940988 E3 ubiquitin-protein ligase NHLRC1

hsa04120 Ubiquitin mediated proteolysis
R-HSA-70326 Glucose metabolism
R-HSA-3322077 Glycogen synthesis
R-HSA-71387 Metabolism of carbohydrates
R-HSA-1430728 Metabolism

Homo sapiens (human) NHLRC1 NP_940988.2
Pan troglodytes (chimpanzee) NHLRC1 XP_001170828.1
Macaca mulatta (Rhesus monkey) NHLRC1 XP_001097330.1
Canis lupus familiaris (dog) NHLRC1 NP_001006650.1
Bos taurus (cattle) NHLRC1 XP_002697596.1
Mus musculus (house mouse) Nhlrc1 NP_780549.1
Rattus norvegicus (Norway rat) Nhlrc1 NP_954706.1
Gallus gallus (chicken) NHLRC1 XP_426034.2
Xenopus (Silurana) tropicalis (western clawed frog) nhlrc1 XP_002932735.1


ID Name Evidence
GO:0005634 nucleus IDA
GO:0005783 endoplasmic reticulum IEA
GO:0048471 perinuclear region of cytoplasm IEA


ID Name Evidence
GO:0004842 ubiquitin-protein ligase activity IDA
GO:0005515 protein binding IPI
GO:0008270 zinc ion binding IEA
GO:0016874 ligase activity IEA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0000209 protein polyubiquitination IDA
GO:0031398 positive regulation of protein ubiquitination IEA
GO:0043161 proteasomal ubiquitin-dependent protein catabolic process IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following NHLRC1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the NHLRC1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_198586 Homo sapiens NHL repeat containing E3 ubiquitin protein ligase 1 (NHLRC1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $159.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu18073
Accession Version NM_198586.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1188bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-MAY-2014
Organism Homo sapiens (human)
Product E3 ubiquitin-protein ligase NHLRC1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BK001510.1. This sequence is a reference standard in the RefSeqGene project. On Dec 20, 2003 this sequence version replaced gi:38348439. Summary: The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BK001510.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)87..239(+)
Misc Feature(2)90..227(+)
Misc Feature(3)351..485(+)
Misc Feature(4)366..1187(+)
Misc Feature(5)399..521(+)
Misc Feature(6)495..626(+)
Misc Feature(7)543..662(+)
Misc Feature(8)627..749(+)
Misc Feature(9)666..791(+)
Misc Feature(10)756..914(+)
Misc Feature(11)795..953(+)
Misc Feature(12)915..1061(+)
Misc Feature(13)975..1073(+)
Misc Feature(14)1062..1193(+)
Misc Feature(15)1104..1184(+)
Exon (1)1..2134
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:758051892
6 6 c, g dbSNP:747802378
10 10 a, g dbSNP:778360604
12 12 a, g dbSNP:754443454
24 24 a, g dbSNP:753367864
25 25 a, t dbSNP:767954855
28 28 a, c dbSNP:757771126
32 32 g, t dbSNP:751938699
38 38 c, g, t dbSNP:763202331
39 39 g, t dbSNP:775532087
41 41 a, g dbSNP:765575310
46 46 a, c dbSNP:139029314
51 51 a, c dbSNP:776850563
59 59 c, t dbSNP:770992577
60 60 a, g dbSNP:146636139
61 61 a, t dbSNP:773040817
63 63 a, c dbSNP:368134036
66 66 c, g dbSNP:771805307
77 77 a, c dbSNP:373970542
81 81 c, t dbSNP:778489271
82 82 c, t dbSNP:754640069
90 90 a, t dbSNP:28940575
93 93 a, g dbSNP:748730347
96 96 a, g dbSNP:779596932
112 112 c, t dbSNP:757759398
117 117 c, g dbSNP:752045674
121 121 c, g dbSNP:764691077
124 124 a, g dbSNP:758638029
125 125 a, g dbSNP:143893542
133 133 c, g dbSNP:765485168
136 136 a, c dbSNP:759908693
148 148 c, t dbSNP:776841950
156 156 c, t dbSNP:766421414
160 160 c, t dbSNP:760631929
163 163 g, t dbSNP:772985160
192 192 c, t dbSNP:539307365
198 198 c, t dbSNP:761458140
209 209 a, c, t dbSNP:370573413
210 210 c, t dbSNP:553900705
213 213 c, g dbSNP:779507031
218 218 a, c dbSNP:769144119
219 219 c, g dbSNP:28940576
221 221 a, g dbSNP:778080945
239 239 c, t dbSNP:758945379
241 241 a, g dbSNP:753103968
243 243 a, g dbSNP:779482781
248 248 c, g dbSNP:755232826
252 252 a, g dbSNP:754156735
253 253 c, t dbSNP:766657432
254 254 c, t dbSNP:760624567
268 268 c, g dbSNP:371218834
270 270 a, g dbSNP:750530014
279 279 c, t dbSNP:767291745
285 285 c, g dbSNP:761806425
314 314 c, g dbSNP:774110305
317 317 g, t dbSNP:187783545
320 320 c, g dbSNP:762766683
321 321 g, t dbSNP:568131096
322 322 c, t dbSNP:774955028
324 324 c, t dbSNP:769497255
326 326 c, g, t dbSNP:115931931
335 335 c, t dbSNP:772440533
346 346 c, t dbSNP:10949483
350 350 a, g dbSNP:779392254
351 351 a, g dbSNP:570505924
355 355 c, t dbSNP:113474848
374 374 c, g dbSNP:754279385
375 375 a, g dbSNP:780082503
386 386 c, g dbSNP:756365176
400 400 a, c dbSNP:750465793
404 404 c, g dbSNP:767683762
412 412 c, g dbSNP:761706418
415 415 c, t dbSNP:751457173
423 423 a, c dbSNP:764038720
428 428 c, g dbSNP:370292624
432 432 c, g, t dbSNP:148035405
436 436 c, t dbSNP:143537405
437 437 c, g dbSNP:759287189
438 438 c, g dbSNP:376655413
440 440 g, t dbSNP:770608651
449 449 a, c, g dbSNP:774953311
450 450 a, g dbSNP:769301934
452 452 c, g dbSNP:200559475
459 459 a, g dbSNP:75231955
463 463 a, g dbSNP:749599233
471 471 a, g dbSNP:780535678
472 472 g, t dbSNP:756277884
482 482 -, ag dbSNP:587776542
482 482 -, a dbSNP:757954108
483 483 a, c, g dbSNP:533620472
484 484 a, g dbSNP:781300542
492 492 c, t dbSNP:200595273
494 494 c, t dbSNP:759502412
495 495 a, g dbSNP:201476733
511 511 a, t dbSNP:763950568
513 513 a, t dbSNP:758394138
518 518 g, t dbSNP:529490452
519 519 c, g dbSNP:765124655
520 520 a, g dbSNP:759084715
527 527 c, t dbSNP:148907696
534 534 a, c dbSNP:766154920
552 552 a, g dbSNP:760207053
556 556 c, t dbSNP:772855364
557 557 c, g dbSNP:769283210
565 565 a, g dbSNP:138667242
593 593 c, t dbSNP:202217857
598 598 a, g dbSNP:367649330
599 599 -, gggctggggtgggtccctggaatcagaagcactagtgctgcca dbSNP:766829550
601 601 a, g dbSNP:770156055
607 607 a, t dbSNP:121917876
613 613 c, t dbSNP:746239356
623 623 c, t dbSNP:781332789
626 626 g, t dbSNP:201058506
628 628 a, g dbSNP:754016620
632 632 c, g dbSNP:747084695
635 635 c, t dbSNP:777885030
637 637 a, g dbSNP:557680058
639 639 c, g dbSNP:752724787
656 656 a, g, t dbSNP:754756237
657 657 c, t dbSNP:753591736
668 668 c, t dbSNP:144861349
677 677 a, g dbSNP:374108909
678 678 g, t dbSNP:794726964
680 680 a, g dbSNP:760472860
690 690 c, t dbSNP:749939720
695 695 a, t dbSNP:140850172
698 698 c, g dbSNP:761259733
709 709 c, t dbSNP:371640803
710 710 c, t dbSNP:770214773
711 711 a, g dbSNP:759875696
714 714 a, g dbSNP:777043678
715 715 a, c dbSNP:771126194
727 727 c, t dbSNP:747276703
729 729 -, c dbSNP:34551044
735 735 c, g, t dbSNP:772155104
737 737 a, c dbSNP:748203595
743 743 c, t dbSNP:146420615
754 754 c, t dbSNP:367906378
755 755 a, g, t dbSNP:571973789
756 756 a, c, g dbSNP:750055958
760 760 a, g dbSNP:767300701
765 765 c, t dbSNP:374327275
769 769 a, c, g dbSNP:371072212
772 772 c, g dbSNP:760017380
782 782 g, t dbSNP:776953775
787 787 a, g dbSNP:377025668
788 788 a, g dbSNP:761062592
790 790 a, c dbSNP:773378991
792 792 c, t dbSNP:772199816
793 793 a, c dbSNP:144043056
795 795 c, g dbSNP:778928979
797 797 a, g dbSNP:768626564
801 801 a, c dbSNP:749287999
802 802 a, g dbSNP:779965723
807 807 c, t dbSNP:121917875
808 808 a, g, t dbSNP:553814041
812 812 a, g dbSNP:780828215
813 813 a, g dbSNP:756925518
815 815 a, g dbSNP:535618322
819 819 a, g dbSNP:140164729
822 822 g, t dbSNP:755474952
834 834 c, g dbSNP:568213488
845 845 c, g, t dbSNP:556216487
851 851 a, g dbSNP:140066702
852 852 a, g dbSNP:767777371
857 857 c, t dbSNP:762001530
862 862 -, t dbSNP:756437109
869 869 c, g dbSNP:375475285
870 870 c, g dbSNP:554356127
878 878 c, g dbSNP:768659412
879 879 c, g dbSNP:201855901
888 888 a, t dbSNP:200214191
889 889 a, c, t dbSNP:745652384
893 893 a, g dbSNP:780904929
894 894 a, g dbSNP:756909945
908 908 c, t dbSNP:746676778
910 910 c, t dbSNP:777509826
919 919 a, c dbSNP:757858146
927 927 a, g dbSNP:752220824
932 932 a, c dbSNP:766807637
936 936 g, t dbSNP:756683363
937 937 a, c dbSNP:137852859
941 941 c, g dbSNP:750788641
947 947 g, t dbSNP:527299943
957 957 c, t dbSNP:762064606
964 964 c, t dbSNP:774397860
974 974 a, g dbSNP:764389649
977 977 g, t dbSNP:763060322
979 979 c, t dbSNP:775777721
983 983 a, c, t dbSNP:142941035
984 984 a, g, t dbSNP:776454075
987 987 a, g dbSNP:587780400
991 991 a, c dbSNP:770587249
994 994 g, t dbSNP:746839446
1004 1004 a, g dbSNP:148553723
1006 1006 -, g dbSNP:587776543
1021 1021 a, c dbSNP:758056041
1024 1024 a, g dbSNP:545172272
1029 1029 g, t dbSNP:376530552
1031 1031 c, t dbSNP:747655441
1035 1035 c, g dbSNP:778456340
1040 1040 c, t dbSNP:756591398
1041 1041 a, g dbSNP:750935925
1048 1048 c, g dbSNP:781739043
1067 1067 a, c, g dbSNP:377395116
1074 1074 a, g dbSNP:751956775
1075 1075 c, t dbSNP:764407367
1078 1078 c, t dbSNP:144863228
1079 1079 a, g dbSNP:752799460
1086 1086 a, g dbSNP:765443391
1090 1090 a, t dbSNP:372993582
1104 1104 a, t dbSNP:370044232
1105 1105 c, t dbSNP:78324544
1106 1106 a, g dbSNP:760322295
1132 1132 a, g dbSNP:773130728
1134 1134 c, g dbSNP:771702699
1139 1139 c, t dbSNP:747848818
1146 1146 c, g dbSNP:778364234
1156 1156 a, g dbSNP:200201752
1159 1159 c, g dbSNP:748854501
1162 1162 a, c dbSNP:781484428
1167 1167 c, t dbSNP:757847339
1179 1179 c, g, t dbSNP:541460675
1180 1180 a, t dbSNP:562100142
1181 1181 c, t dbSNP:778329369
1184 1184 a, t dbSNP:543997890
1185 1185 a, g dbSNP:758659117
1186 1186 a, t dbSNP:752924111
1188 1188 a, g dbSNP:765576968
1196 1196 c, g dbSNP:759473681
1197 1197 a, g dbSNP:753959228
1198 1198 a, g dbSNP:766225081
1199 1199 -, g dbSNP:750770846
1199 1199 a, g dbSNP:760726977
1204 1204 a, g dbSNP:531663760
1212 1212 g, t dbSNP:772972107
1214 1214 a, g dbSNP:193252025
1216 1216 c, g dbSNP:761628913
1220 1220 c, g dbSNP:773945358
1223 1223 a, g dbSNP:772460190
1237 1237 a, c dbSNP:748741304
1240 1240 c, g, t dbSNP:377500729
1257 1257 c, g dbSNP:11966789
1287 1287 a, t dbSNP:73379121
1333 1333 c, t dbSNP:554033340
1338 1338 a, g dbSNP:187756008
1342 1342 a, g dbSNP:761409459
1347 1347 -, t dbSNP:34372710
1356 1356 a, t dbSNP:574688464
1379 1379 a, c dbSNP:149060790
1384 1384 -, tg dbSNP:758211657
1401 1401 -, a dbSNP:34496612
1409 1409 c, t dbSNP:773856515
1414 1414 c, t dbSNP:768399451
1439 1439 c, t dbSNP:73379118
1450 1450 a, c dbSNP:182779486
1451 1451 -, c dbSNP:551000613
1478 1478 c, g dbSNP:11966748
1480 1480 a, c dbSNP:147601747
1522 1522 a, g dbSNP:79197160
1525 1525 c, t dbSNP:548177601
1528 1528 c, t dbSNP:369668171
1529 1529 a, g dbSNP:375143655
1534 1534 g, t dbSNP:140122442
1538 1538 a, g dbSNP:10949482
1546 1546 a, t dbSNP:147528518
1559 1559 -, aagt dbSNP:374445241
1560 1560 -, agta dbSNP:550375620
1569 1569 a, g dbSNP:564218465
1639 1639 c, g dbSNP:552302329
1644 1644 c, g dbSNP:555214908
1652 1652 c, g dbSNP:757094314
1660 1660 c, t dbSNP:149855550
1675 1675 c, t dbSNP:139669374
1676 1676 a, c dbSNP:369774419
1680 1680 c, t dbSNP:781748966
1684 1684 c, g dbSNP:114713758
1800 1800 c, t dbSNP:751058325
1823 1823 a, t dbSNP:10949481
1828 1828 c, t dbSNP:10949480
1864 1864 c, g dbSNP:150615281
1865 1865 a, g dbSNP:539295473
1866 1866 c, t dbSNP:577139562
1871 1871 a, g dbSNP:753799538
1907 1907 c, t dbSNP:191297239
1913 1913 c, t dbSNP:533831250
1922 1922 c, t dbSNP:141863990
1930 1930 -, tt dbSNP:749417240
1995 1995 a, g dbSNP:554238946
2004 2004 a, g dbSNP:756570838
2039 2039 a, g dbSNP:536257194
2077 2077 a, c, t dbSNP:72839174
2088 2088 a, g dbSNP:146342540
2102 2102 c, t dbSNP:538045433

Target ORF information:

RefSeq Version NM_198586
Organism Homo sapiens (human)
Definition Homo sapiens NHL repeat containing E3 ubiquitin protein ligase 1 (NHLRC1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Lafora disease E3 ubiquitin ligase malin is recruited to the processing bodies and regulates the microRNA-mediated gene silencing process via the decapping enzyme Dcp1a
RNA Biol 9 (12), 1440-1449 (2012)
Singh S, Singh PK, Bhadauriya P and Ganesh S.


Deciphering the role of malin in the lafora progressive myoclonus epilepsy
IUBMB Life 64 (10), 801-808 (2012)
Roma-Mateo C, Sanz P and Gentry MS.


Malin regulates Wnt signaling pathway through degradation of dishevelled2
J. Biol. Chem. 287 (9), 6830-6839 (2012)
Sharma J, Mulherkar S, Mukherjee D and Jana NR.


Four novel and two recurrent NHLRC1 (EPM2B) and EPM2A gene mutations leading to Lafora disease in six Turkish families
Epilepsy Res. 98 (2-3), 273-276 (2012)
Salar S, Yeni N, Gunduz A, Guler A, Gokcay A, Velioglu S, Gundogdu A and Hande Caglayan S.


Lafora disease E3-ubiquitin ligase malin is related to TRIM32 at both the phylogenetic and functional level
BMC Evol. Biol. 11, 225 (2011)
Roma-Mateo C, Moreno D, Vernia S, Rubio T, Bridges TM, Gentry MS and Sanz P.


Insights into Lafora disease: malin is an E3 ubiquitin ligase that ubiquitinates and promotes the degradation of laforin
Proc. Natl. Acad. Sci. U.S.A. 102 (24), 8501-8506 (2005)
Gentry MS, Worby CA and Dixon JE.


Lafora disease due to EPM2B mutations: a clinical and genetic study
Neurology 64 (6), 982-986 (2005)
Gomez-Abad C, Gomez-Garre P, Gutierrez-Delicado E, Saygi S, Michelucci R, Tassinari CA, Rodriguez de Cordoba S and Serratosa JM.


The DNA sequence and analysis of human chromosome 6
Nature 425 (6960), 805-811 (2003)
Mungall AJ, Palmer SA, Sims SK, Edwards CA, Ashurst JL, Wilming L, Jones MC, Horton R, Hunt SE, Scott CE, Gilbert JG, Clamp ME, Bethel G, Milne S, Ainscough R, Almeida JP, Ambrose KD, Andrews TD, Ashwell RI, Babbage AK, Bagguley CL, Bailey J, Banerjee R, Barker DJ, Barlow KF, Bates K, Beare DM, Beasley H, Beasley O, Bird CP, Blakey S, Bray-Allen S, Brook J, Brown AJ, Brown JY, Burford DC, Burrill W, Burton J, Carder C, Carter NP, Chapman JC, Clark SY, Clark G, Clee CM, Clegg S, Cobley V, Collier RE, Collins JE, Colman LK, Corby NR, Coville GJ, Culley KM, Dhami P, Davies J, Dunn M, Earthrowl ME, Ellington AE, Evans KA, Faulkner L, Francis MD, Frankish A, Frankland J, French L, Garner P, Garnett J, Ghori MJ, Gilby LM, Gillson CJ, Glithero RJ, Grafham DV, Grant M, Gribble S, Griffiths C, Griffiths M, Hall R, Halls KS, Hammond S, Harley JL, Hart EA, Heath PD, Heathcott R, Holmes SJ, Howden PJ, Howe KL, Howell GR, Huckle E, Humphray SJ, Humphries MD, Hunt AR, Johnson CM, Joy AA, Kay M, Keenan SJ, Kimberley AM, King A, Laird GK, Langford C, Lawlor S, Leongamornlert DA, Leversha M, Lloyd CR, Lloyd DM, Loveland JE, Lovell J, Martin S, Mashreghi-Mohammadi M, Maslen GL, Matthews L, McCann OT, McLaren SJ, McLay K, McMurray A, Moore MJ, Mullikin JC, Niblett D, Nickerson T, Novik KL, Oliver K, Overton-Larty EK, Parker A, Patel R, Pearce AV, Peck AI, Phillimore B, Phillips S, Plumb RW, Porter KM, Ramsey Y, Ranby SA, Rice CM, Ross MT, Searle SM, Sehra HK, Sheridan E, Skuce CD, Smith S, Smith M, Spraggon L, Squares SL, Steward CA, Sycamore N, Tamlyn-Hall G, Tester J, Theaker AJ, Thomas DW, Thorpe A, Tracey A, Tromans A, Tubby B, Wall M, Wallis JM, West AP, White SS, Whitehead SL, Whittaker H, Wild A, Willey DJ, Wilmer TE, Wood JM, Wray PW, Wyatt JC, Young L, Younger RM, Bentley DR, Coulson A, Durbin R, Hubbard T, Sulston JE, Dunham I, Rogers J and Beck S.


Mutations in NHLRC1 cause progressive myoclonus epilepsy
Nat. Genet. 35 (2), 125-127 (2003)
Chan EM, Young EJ, Ianzano L, Munteanu I, Zhao X, Christopoulos CC, Avanzini G, Elia M, Ackerley CA, Jovic NJ, Bohlega S, Andermann E, Rouleau GA, Delgado-Escueta AV, Minassian BA and Scherer SW.


Progressive Myoclonus Epilepsy, Lafora Type
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Jansen,A.C. and Andermann,E.
