
KIT cDNA ORF clone, Homo sapiens (human)

Gene Symbol KIT
Entrez Gene ID 3815
Full Name v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Synonyms C-Kit, CD117, PBT, SCFR
General protein information
Preferred Names
mast/stem cell growth factor receptor Kit
mast/stem cell growth factor receptor Kit
p145 c-kit
proto-oncogene c-Kit
piebald trait protein
soluble KIT variant 1
tyrosine-protein kinase Kit
proto-oncogene tyrosine-protein kinase Kit
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene-like protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Piebaldism (3); Mast cell leukemia (3); Mastocytosis with associated

The following KIT gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the KIT cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu38610 XM_005265740 PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38611 XM_005265741 PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38612 XM_005265742 PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu19293 NM_000222 Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu16002 NM_001093772 Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu38610
Accession Version XM_005265740.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2934bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mast/stem cell growth factor receptor Kit isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022853.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)188..391(+)
Misc Feature(2)716..982(+)
Misc Feature(3)746..973(+)
Misc Feature(4)992..1294(+)
Misc Feature(5)1199..1219(+)
Misc Feature(6)1337..1576(+)
Misc Feature(7)1718..2845(+)
Misc Feature(8)1826..2833(+)
Misc Feature(9)1844..2689(+)
Misc Feature(10)1844..2491(+)
Misc Feature(11)2435..2689(+)
Misc Feature(12)2486..2563(+)
Position Chain Variation Link
15 15 a, g dbSNP:547049010
16 16 c, g dbSNP:757006597
21 21 a, c dbSNP:780684303
22 22 c, g, t dbSNP:199508856
23 23 a, g dbSNP:779561271
24 24 c, t dbSNP:749855287
26 26 a, g dbSNP:769150955
27 27 a, g dbSNP:774737606
28 28 c, g dbSNP:748489564
29 29 c, g dbSNP:772435233
31 31 a, g dbSNP:368987793
34 34 c, t dbSNP:760882355
38 38 g, t dbSNP:201778132
41 41 a, c, t dbSNP:776836797
42 42 c, t dbSNP:764088627
45 45 a, t dbSNP:140909964
47 47 g, t dbSNP:761533610
54 54 c, t dbSNP:202070769
57 57 c, g dbSNP:750060266
67 67 c, g, t dbSNP:755780019
95 95 a, g dbSNP:753316557
103 103 c, t dbSNP:755527973
104 104 c, t dbSNP:779421107
108 108 a, t dbSNP:748615975
110 110 c, g, t dbSNP:370787811
114 114 a, g, t dbSNP:747253141
115 115 c, t dbSNP:776887125
118 118 c, t dbSNP:759662674
123 123 c, t dbSNP:769943127
134 134 c, g dbSNP:759129060
136 136 a, c dbSNP:764782713
139 139 a, c dbSNP:752246767
142 142 c, t dbSNP:758868843
143 143 c, g dbSNP:764636807
159 159 a, c, t dbSNP:55755457
160 160 a, g dbSNP:757725466
164 164 a, c, t dbSNP:781633384
172 172 c, t dbSNP:756403734
176 176 c, t dbSNP:780042351
177 177 a, g dbSNP:373374682
179 179 a, c dbSNP:768569749
181 181 a, t dbSNP:72549300
183 183 c, g dbSNP:746856550
185 185 a, g dbSNP:770727656
198 198 c, t dbSNP:776395578
203 203 c, t dbSNP:759250095
204 204 a, c, g dbSNP:376469897
205 205 a, c, t dbSNP:72549301
206 206 a, g, t dbSNP:200950545
211 211 c, g, t dbSNP:147363921
212 212 a, g dbSNP:121913505
213 213 a, g dbSNP:756456973
215 215 a, g dbSNP:780349712
217 217 c, g dbSNP:749431345
229 229 a, t dbSNP:755092278
232 232 c, t dbSNP:778802467
233 233 a, g dbSNP:747004948
240 240 a, c, t dbSNP:557317141
241 241 a, g dbSNP:745640513
253 253 a, g dbSNP:200121443
257 257 a, t dbSNP:139441923
258 258 c, g dbSNP:144933028
259 259 a, t dbSNP:768223628
279 279 c, t dbSNP:147943899
280 280 a, g dbSNP:762453840
288 288 a, g dbSNP:371353189
301 301 a, g dbSNP:750916458
309 309 c, t dbSNP:201872586
310 310 a, g, t dbSNP:56411694
334 334 c, t dbSNP:373066995
338 338 a, g dbSNP:146081659
343 343 c, t dbSNP:779113666
346 346 a, g dbSNP:150026676
355 355 c, t dbSNP:768599276
359 359 c, t dbSNP:781130745
361 361 c, t dbSNP:145333060
362 362 a, g dbSNP:769632130
375 375 c, t dbSNP:779652404
377 377 a, g dbSNP:749024557
378 378 g, t dbSNP:780922356
398 398 a, c, t dbSNP:772836939
403 403 c, t dbSNP:771310399
407 407 a, c dbSNP:189660852
415 415 c, t dbSNP:759839714
425 425 -, c dbSNP:35525445
426 426 c, t dbSNP:371303702
430 430 a, g dbSNP:775690281
445 445 c, g dbSNP:763100661
446 446 a, g dbSNP:764213036
448 448 c, t dbSNP:575926270
452 452 a, g dbSNP:756128407
453 453 c, t dbSNP:766253584
454 454 a, g dbSNP:149172424
461 461 c, t dbSNP:754738766
478 478 c, g dbSNP:778793243
481 481 a, c dbSNP:747868494
488 488 a, g dbSNP:758120380
496 496 c, t dbSNP:777463519
499 499 c, t dbSNP:746476450
502 502 c, t dbSNP:544555667
508 508 a, g dbSNP:776858609
512 512 c, g dbSNP:145053429
515 515 a, g dbSNP:770422212
521 521 c, t dbSNP:777031731
522 522 c, t dbSNP:367719489
530 530 a, g dbSNP:770362669
531 531 a, t dbSNP:775817289
536 536 a, t dbSNP:763226471
540 540 a, g dbSNP:764280416
542 542 g, t dbSNP:201222895
544 544 c, t dbSNP:774584792
556 556 c, g dbSNP:761831851
559 559 a, g dbSNP:767567085
560 560 a, g dbSNP:200851152
561 561 a, c, t dbSNP:149092990
562 562 a, g dbSNP:140469176
570 570 c, t dbSNP:752511532
579 579 c, g dbSNP:758171174
580 580 c, t dbSNP:145993517
586 586 a, g dbSNP:532461931
589 589 c, t dbSNP:756722358
590 590 a, g dbSNP:115585711
601 601 c, g dbSNP:746419269
620 620 c, g dbSNP:770279902
631 631 c, g dbSNP:780434119
643 643 a, g dbSNP:749677454
644 644 a, c dbSNP:768971014
649 649 a, g, t dbSNP:140839561
658 658 a, c, t dbSNP:772105682
662 662 c, t dbSNP:759589436
679 679 c, t dbSNP:771092682
698 698 a, g dbSNP:775569383
700 700 a, g dbSNP:762922034
713 713 c, g dbSNP:141679490
720 720 a, g dbSNP:763853854
730 730 a, g dbSNP:751363965
736 736 a, g dbSNP:761411033
751 751 c, g dbSNP:552937042
753 753 c, t dbSNP:767174569
754 754 a, g dbSNP:201988161
765 765 a, c dbSNP:374957554
772 772 a, g dbSNP:779482571
791 791 a, g dbSNP:754400702
792 792 c, t dbSNP:755508624
793 793 a, g dbSNP:150150449
807 807 a, g dbSNP:748527429
808 808 c, t dbSNP:758643928
818 818 a, g dbSNP:765944197
832 832 g, t dbSNP:753318751
835 835 a, g dbSNP:755490030
837 837 a, g dbSNP:200422460
838 838 c, t dbSNP:765797630
853 853 c, t dbSNP:753102574
877 877 a, g dbSNP:758792480
878 878 a, g dbSNP:769498440
882 882 c, t dbSNP:138585275
883 883 a, g dbSNP:747288547
890 890 a, c dbSNP:757547974
900 900 c, t dbSNP:386833402
901 901 a, c, g, t dbSNP:142772432
903 903 a, g dbSNP:147367441
905 905 a, g dbSNP:771961192
921 921 g, t dbSNP:775105481
934 934 c, t dbSNP:772988068
939 939 a, g dbSNP:137909416
943 943 c, t dbSNP:765997309
952 952 a, g dbSNP:776220729
963 963 c, t dbSNP:759119367
970 970 a, c dbSNP:531740394
971 971 a, g dbSNP:202052259
977 977 a, g dbSNP:753258292
989 989 a, g dbSNP:771970240
1005 1005 a, t dbSNP:377590954
1010 1010 c, t dbSNP:746831586
1012 1012 c, t dbSNP:770676368
1013 1013 a, c, g dbSNP:143388949
1015 1015 a, g dbSNP:769399180
1018 1018 a, g dbSNP:377102206
1025 1025 a, g dbSNP:147540142
1039 1039 c, t dbSNP:148594615
1040 1040 a, g dbSNP:752061752
1051 1051 c, t dbSNP:529920663
1060 1060 c, g dbSNP:767936896
1072 1072 c, t dbSNP:777287699
1102 1102 a, g dbSNP:750717279
1106 1106 a, g dbSNP:756286159
1117 1117 c, g dbSNP:372759291
1141 1141 a, c dbSNP:753844400
1147 1147 c, t dbSNP:554090824
1152 1152 a, g dbSNP:375734891
1156 1156 a, t dbSNP:142963781
1167 1167 a, g dbSNP:746884875
1180 1180 c, t dbSNP:72549293
1181 1181 a, g, t dbSNP:73137716
1196 1196 a, c dbSNP:376275305
1198 1198 a, g dbSNP:773723931
1200 1200 c, t dbSNP:760981584
1201 1201 a, g dbSNP:766702350
1214 1214 a, g dbSNP:776734905
1216 1216 a, c, g, t dbSNP:373472667
1232 1232 a, g dbSNP:757234342
1234 1234 a, t dbSNP:767377458
1238 1238 c, t dbSNP:750332587
1246 1246 c, t dbSNP:755864184
1255 1255 c, t dbSNP:376940990
1256 1256 a, g dbSNP:143707288
1260 1260 a, g dbSNP:72549294
1262 1262 a, g dbSNP:778615486
1267 1267 c, t dbSNP:747686609
1278 1278 a, g dbSNP:771574892
1288 1288 a, g dbSNP:773599038
1289 1289 a, c, t dbSNP:111646246
1291 1291 c, t dbSNP:140536677
1302 1302 a, g dbSNP:587778435
1312 1312 c, t dbSNP:765071640
1316 1316 a, g dbSNP:752354428
1322 1322 -, tcg dbSNP:587778434
1337 1337 c, g dbSNP:758061831
1339 1339 c, g dbSNP:777184855
1342 1342 a, g, t dbSNP:376889675
1348 1348 a, g dbSNP:563667772
1351 1351 a, g dbSNP:55966164
1357 1357 a, g dbSNP:781686359
1360 1360 c, t dbSNP:746304506
1363 1363 a, g dbSNP:770157148
1373 1373 a, g dbSNP:780382854
1378 1378 c, t dbSNP:144185800
1390 1390 c, t dbSNP:768900424
1392 1392 c, t dbSNP:774389709
1398 1398 c, t dbSNP:761984908
1405 1405 a, c, g dbSNP:542718349
1412 1412 c, t dbSNP:145183977
1420 1420 g, t dbSNP:769828541
1424 1424 c, t dbSNP:775239202
1430 1430 -, gtggat dbSNP:756523952
1444 1444 a, g dbSNP:151016327
1446 1446 c, t dbSNP:200783907
1455 1455 c, t dbSNP:763728676
1459 1459 a, g dbSNP:774064393
1463 1463 c, t dbSNP:761442091
1464 1464 c, t dbSNP:200518498
1465 1465 a, g dbSNP:767079772
1469 1469 a, g dbSNP:749914029
1470 1470 a, g dbSNP:755572814
1474 1474 g, t dbSNP:766943473
1492 1492 c, t dbSNP:754233899
1507 1507 a, g dbSNP:755386780
1518 1518 a, g dbSNP:779134230
1523 1523 a, c dbSNP:748451770
1524 1524 c, t dbSNP:56225530
1526 1526 a, g dbSNP:778045049
1539 1539 c, t dbSNP:371078350
1543 1543 c, t dbSNP:771092774
1546 1546 c, t dbSNP:775498908
1547 1547 a, g dbSNP:143179681
1552 1552 a, g dbSNP:768552563
1558 1558 a, g dbSNP:374432699
1560 1560 c, t dbSNP:200127012
1597 1597 c, g dbSNP:771735131
1599 1599 a, g dbSNP:772813487
1614 1614 c, t dbSNP:569408054
1616 1616 c, t dbSNP:370364842
1625 1625 g, t dbSNP:144610991
1629 1629 c, t dbSNP:772866513
1630 1630 g, t dbSNP:760310161
1648 1648 c, t dbSNP:148248559
1649 1649 a, g dbSNP:72550822
1654 1654 c, t dbSNP:760143011
1655 1655 a, g dbSNP:55792975
1659 1659 c, t dbSNP:753212327
1665 1665 c, t dbSNP:763411938
1666 1666 a, g dbSNP:764493206
1672 1672 c, g dbSNP:751886000
1675 1675 c, t dbSNP:757414947
1677 1677 c, t dbSNP:781371383
1678 1678 c, t dbSNP:750491922
1679 1679 c, g dbSNP:756179543
1682 1682 a, c, g dbSNP:3822214
1693 1693 c, g dbSNP:574083805
1696 1696 c, t dbSNP:374123328
1699 1699 a, g dbSNP:55986963
1702 1702 c, t dbSNP:746718824
1709 1709 -, aaacccatgtatgaagtacagtggaag dbSNP:121913234
1713 1713 -, ccatgtatgaagtac dbSNP:587776804
1715 1715 a, g dbSNP:777596975
1716 1716 c, t dbSNP:746805825
1730 1730 a, c, g, t dbSNP:121913235
1733 1733 -, aaggttgttgaggag dbSNP:121913510
1733 1733 -, aaggttgtt dbSNP:121913511
1735 1735 a, g dbSNP:200375589
1736 1736 -, gtt dbSNP:121913685
1736 1736 a, g dbSNP:121913520
1737 1737 -, ttgttg dbSNP:587776803
1737 1737 a, c, g, t dbSNP:121913517
1740 1740 a, g, t dbSNP:121913521
1749 1749 a, t dbSNP:780708976
1751 1751 a, t dbSNP:745463319
1752 1752 a, g dbSNP:769483857
1755 1755 g, t dbSNP:200945282
1764 1764 a, t dbSNP:749851557
1765 1765 c, t dbSNP:769263048
1769 1769 c, t dbSNP:774872724
1770 1770 a, g dbSNP:762089641
1772 1772 a, g dbSNP:587778431
1788 1788 c, t dbSNP:121913513
1798 1798 a, t dbSNP:773366034
1808 1808 a, g dbSNP:121913680
1812 1812 g, t dbSNP:28933371
1816 1816 c, t dbSNP:121913515
1842 1842 c, t dbSNP:375351432
1849 1849 g, t dbSNP:748829568
1850 1850 a, g dbSNP:768214921
1855 1855 a, t dbSNP:72549292
1861 1861 c, t dbSNP:138380197
1892 1892 c, t dbSNP:369412402
1909 1909 a, g dbSNP:148853099
1913 1913 a, c dbSNP:760939861
1914 1914 c, t dbSNP:111466688
1915 1915 a, g dbSNP:199787524
1920 1920 c, t dbSNP:387907217
1921 1921 c, t dbSNP:200814065
1924 1924 g, t dbSNP:759613218
1930 1930 a, g dbSNP:765239839
1950 1950 a, g dbSNP:373554876
1951 1951 a, t dbSNP:761703470
1954 1954 a, g dbSNP:767511834
1961 1961 c, g, t dbSNP:144369407
1962 1962 a, g dbSNP:766264502
1969 1969 c, t dbSNP:753610580
1985 1985 a, g dbSNP:121913512
2012 2012 a, g, t dbSNP:534209826
2020 2020 c, t dbSNP:752271176
2022 2022 c, t dbSNP:121913523
2032 2032 c, t dbSNP:757803641
2035 2035 a, g dbSNP:778343194
2051 2051 a, g dbSNP:121913679
2052 2052 a, g dbSNP:773340705
2060 2060 c, t dbSNP:760685128
2062 2062 c, g dbSNP:766315579
2065 2065 a, c, t dbSNP:527840468
2070 2070 c, t dbSNP:121913516
2085 2085 a, g dbSNP:764970586
2090 2090 a, g dbSNP:752221484
2117 2117 c, t dbSNP:148771698
2118 2118 a, g dbSNP:143772138
2123 2123 a, t dbSNP:752130583
2133 2133 c, g dbSNP:35200131
2136 2136 c, t dbSNP:757733297
2147 2147 a, g dbSNP:781588289
2150 2150 c, t dbSNP:763308199
2153 2153 g, t dbSNP:756394678
2154 2154 c, g dbSNP:780329057
2164 2164 a, g dbSNP:749457757
2165 2165 c, g dbSNP:768847037
2166 2166 c, t dbSNP:541585774
2168 2168 c, t dbSNP:746990067
2169 2169 a, g dbSNP:771012963
2179 2179 g, t dbSNP:766840704
2183 2183 c, t dbSNP:146337870
2193 2193 a, g dbSNP:374262491
2198 2198 -, c dbSNP:35826988
2199 2199 a, c, t dbSNP:775274159
2205 2205 a, g dbSNP:56094246
2206 2206 c, t dbSNP:192110951
2207 2207 a, g dbSNP:769701248
2213 2213 a, g dbSNP:564307874
2221 2221 a, g dbSNP:372359131
2224 2224 c, t dbSNP:139644803
2246 2246 g, t dbSNP:773953640
2251 2251 c, t dbSNP:761317949
2269 2269 c, t dbSNP:375902940
2270 2270 a, g dbSNP:751005114
2276 2276 -, agg dbSNP:773173925
2282 2282 a, t dbSNP:761055157
2292 2292 c, t dbSNP:549887751
2304 2304 c, t dbSNP:572852980
2309 2309 a, g dbSNP:541362004
2316 2316 g, t dbSNP:758665590
2320 2320 c, t dbSNP:764287169
2323 2323 c, t dbSNP:200112919
2324 2324 a, g dbSNP:201165084
2325 2325 c, t dbSNP:758252647
2327 2327 a, g dbSNP:779862483
2334 2334 a, g dbSNP:749166896
2336 2336 a, g, t dbSNP:754826149
2340 2340 a, t dbSNP:747847018
2341 2341 c, g, t dbSNP:55717477
2342 2342 a, g dbSNP:746503007
2351 2351 c, t dbSNP:770413971
2353 2353 a, g dbSNP:777058326
2354 2354 g, t dbSNP:760112920
2410 2410 c, t dbSNP:151046591
2419 2419 ga, tt dbSNP:587778432
2419 2419 g, t dbSNP:202144208
2422 2422 c, t dbSNP:140912933
2438 2438 a, g, t dbSNP:558702741
2445 2445 c, g dbSNP:760704637
2447 2447 a, g dbSNP:121913684
2455 2455 c, t dbSNP:55789615
2467 2467 c, t dbSNP:752570197
2471 2471 c, t dbSNP:145602440
2472 2472 a, g dbSNP:777616126
2476 2476 c, g dbSNP:751206924
2507 2507 c, g, t dbSNP:121913506
2508 2508 a, t dbSNP:121913507
2520 2520 a, g dbSNP:121913682
2527 2527 a, t dbSNP:121913514
2535 2535 c, t dbSNP:121913524
2545 2545 c, t dbSNP:141347955
2550 2550 a, g dbSNP:772311731
2557 2557 c, t dbSNP:773354518
2563 2563 a, g dbSNP:146992614
2576 2576 a, g dbSNP:121913509
2580 2580 a, g dbSNP:766430859
2592 2592 a, g dbSNP:147609111
2600 2600 a, c dbSNP:121913687
2601 2601 c, t dbSNP:752695117
2602 2602 a, g dbSNP:762912889
2607 2607 a, c dbSNP:763847901
2614 2614 c, t dbSNP:751396522
2615 2615 a, g dbSNP:555650901
2616 2616 c, t dbSNP:780998847
2623 2623 c, g dbSNP:750039813
2638 2638 c, t dbSNP:371058716
2645 2645 c, g dbSNP:779706462
2647 2647 c, g dbSNP:3733542
2660 2660 a, g dbSNP:761684550
2662 2662 a, c, g dbSNP:143074839
2673 2673 c, g dbSNP:755797225
2680 2680 g, t dbSNP:766036617
2682 2682 c, t dbSNP:753419764
2683 2683 a, c, g dbSNP:55817813
2686 2686 c, t dbSNP:748588125
2687 2687 a, g dbSNP:372795544
2689 2689 g, t dbSNP:778078182
2713 2713 g, t dbSNP:374440815
2722 2722 c, t dbSNP:771168804
2724 2724 a, g dbSNP:776681643
2731 2731 c, t dbSNP:745967881
2741 2741 c, t dbSNP:141126803
2744 2744 a, g dbSNP:774405431
2754 2754 a, c dbSNP:761840504
2758 2758 g, t dbSNP:769984428
2768 2768 a, g dbSNP:779966930
2789 2789 g, t dbSNP:190512512
2793 2793 a, c, t dbSNP:772159767
2797 2797 a, g dbSNP:761004820
2806 2806 a, t dbSNP:760873449
2818 2818 a, t dbSNP:770617877
2824 2824 c, t dbSNP:776411237
2851 2851 c, g dbSNP:759076549
2854 2854 c, t dbSNP:773363866
2858 2858 a, t dbSNP:764847795
2859 2859 a, g dbSNP:752222954
2862 2862 a, g dbSNP:762406098
2863 2863 c, t dbSNP:764592751
2866 2866 a, t dbSNP:72549296
2887 2887 c, g dbSNP:149932314
2888 2888 a, c, g dbSNP:756463331
2895 2895 a, g dbSNP:754097617
2897 2897 c, t dbSNP:139000082
2898 2898 c, g dbSNP:779103998
2908 2908 c, t dbSNP:56288823
2909 2909 a, g dbSNP:146374006
2911 2911 a, g dbSNP:781142513
2912 2912 a, g dbSNP:745651409
2927 2927 c, t dbSNP:587778433
2928 2928 a, g dbSNP:139694927
2930 2930 a, g dbSNP:748938919
2941 2941 c, t dbSNP:375833392
2942 2942 a, g dbSNP:773828910
2946 2946 a, g dbSNP:761339150
2947 2947 c, t dbSNP:767942133
2948 2948 a, g dbSNP:773709702
2950 2950 c, t dbSNP:200275681
2951 2951 a, g dbSNP:766845123
2953 2953 c, t dbSNP:578043962
2955 2955 c, t dbSNP:201185750
2958 2958 a, c dbSNP:765503364
2959 2959 c, t dbSNP:752748940
2960 2960 c, t dbSNP:758434265
2969 2969 c, t dbSNP:781007582
2972 2972 c, t dbSNP:745807112
2980 2980 c, t dbSNP:755974085
2981 2981 a, g dbSNP:72549297
2984 2984 a, g dbSNP:373152714
2985 2985 a, g dbSNP:768320570
2987 2987 a, g dbSNP:773955363
2989 2989 c, g dbSNP:182068450
2998 2998 a, g dbSNP:771597134
3001 3001 a, g dbSNP:773657951
3009 3009 a, g dbSNP:377596175
3012 3012 c, t dbSNP:766898265
3019 3019 c, t dbSNP:749502431
3037 3037 c, t dbSNP:777154782
3058 3058 g, t dbSNP:112972811
3077 3077 c, t dbSNP:541771331
3091 3091 a, g dbSNP:774300172
3104 3104 -, c dbSNP:141454480
3106 3106 c, t dbSNP:759680567
3122 3122 c, t dbSNP:561815817
3141 3141 c, t dbSNP:2213181
3161 3161 c, t dbSNP:540886606
3209 3209 a, g dbSNP:17084733
3228 3228 a, g dbSNP:761142396
3244 3244 g, t dbSNP:376694515
3281 3281 c, t dbSNP:569668395
3291 3291 c, g dbSNP:185479436
3306 3306 -, c dbSNP:542300014
3308 3308 -, c dbSNP:375297569
3344 3344 a, g dbSNP:149336515
3382 3382 a, g dbSNP:528891717
3418 3418 c, t dbSNP:750092746
3506 3506 a, c dbSNP:758036290
3518 3518 c, t dbSNP:779688131
3522 3522 a, g dbSNP:534199544
3589 3589 c, t dbSNP:746982052
3595 3595 c, g dbSNP:754924498
3657 3657 c, t dbSNP:566225251
3667 3667 c, t dbSNP:535289870
3668 3668 a, g dbSNP:558087775
3693 3693 a, g dbSNP:747912015
3700 3700 -, g dbSNP:772774569
3723 3723 a, g dbSNP:571459383
3726 3726 c, t dbSNP:769473001
3743 3743 c, t dbSNP:376257863
3782 3782 a, g dbSNP:189995563
3825 3825 a, g dbSNP:557023678
3831 3831 a, c, t dbSNP:183497667
3880 3880 c, t dbSNP:188598702
3903 3903 c, g dbSNP:553298726
3921 3921 a, g dbSNP:572274912
3922 3922 a, c dbSNP:547783802
3925 3925 g, t dbSNP:193129140
3934 3934 c, t dbSNP:553005135
3936 3936 c, g dbSNP:55799920
4052 4052 c, t dbSNP:747546874
4078 4078 c, t dbSNP:533152310
4079 4079 c, g dbSNP:144602457
4091 4091 a, g dbSNP:772182994
4141 4141 a, t dbSNP:577899786
4212 4212 c, t dbSNP:56372445
4226 4226 c, t dbSNP:184041614
4233 4233 a, g dbSNP:114377961
4249 4249 c, t dbSNP:761195357
4270 4270 a, g dbSNP:565640146
4294 4294 c, g dbSNP:528782307
4341 4341 c, t dbSNP:145007262
4352 4352 c, g dbSNP:571545423
4394 4394 a, g dbSNP:1799813
4420 4420 g, t dbSNP:537228504
4426 4426 c, t dbSNP:538534252
4438 4438 a, c dbSNP:147133269
4441 4441 g, t dbSNP:768670355
4447 4447 -, tacc dbSNP:765958252
4456 4456 -, aaaac dbSNP:558178243
4477 4477 -, aaaa dbSNP:374796688
4501 4501 c, t dbSNP:567439187
4502 4502 a, g dbSNP:773447284
4516 4516 a, g dbSNP:17084736
4548 4548 c, g dbSNP:779554258
4559 4559 a, g dbSNP:543517677
4567 4567 c, t dbSNP:561819471
4588 4588 a, g dbSNP:573912893
4621 4621 c, t dbSNP:748767060
4622 4622 a, g dbSNP:140416206
4656 4656 a, g dbSNP:573152330
4664 4664 a, g dbSNP:541644297
4687 4687 a, t dbSNP:534652006
4696 4696 g, t dbSNP:8022
4714 4714 c, t dbSNP:577939550
4726 4726 a, g dbSNP:776712217
4749 4749 c, t dbSNP:543627061
4758 4758 a, g dbSNP:533731213
4783 4783 a, g dbSNP:77842054
4785 4785 a, g dbSNP:576230887
4792 4792 a, g dbSNP:377361492
4797 4797 a, t dbSNP:573802115
4800 4800 a, g dbSNP:762662037
4826 4826 a, c, g dbSNP:186953545
4827 4827 c, t dbSNP:191473270
4842 4842 g, t dbSNP:528078215
4860 4860 c, t dbSNP:774038505
4886 4886 c, t dbSNP:747942024
4920 4920 -, t dbSNP:746428370
4931 4931 c, g dbSNP:754877866
4956 4956 a, g dbSNP:551832318
4961 4961 a, g dbSNP:563284298
4980 4980 c, t dbSNP:565225492
4997 4997 a, g dbSNP:531077997
5009 5009 c, t dbSNP:115028437
5048 5048 a, g dbSNP:567475861
5075 5075 c, t dbSNP:755986721
5121 5121 a, g dbSNP:777404145

Target ORF information:

RefSeq Version XM_005265740
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38611
Accession Version XM_005265741.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2931bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mast/stem cell growth factor receptor Kit isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022853.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)188..391(+)
Misc Feature(2)716..982(+)
Misc Feature(3)746..973(+)
Misc Feature(4)992..1294(+)
Misc Feature(5)1199..1219(+)
Misc Feature(6)1337..1576(+)
Misc Feature(7)1718..2842(+)
Misc Feature(8)1826..2830(+)
Misc Feature(9)1844..2686(+)
Misc Feature(10)1844..2488(+)
Misc Feature(11)2432..2686(+)
Misc Feature(12)2483..2560(+)
Position Chain Variation Link
15 15 a, g dbSNP:547049010
16 16 c, g dbSNP:757006597
21 21 a, c dbSNP:780684303
22 22 c, g, t dbSNP:199508856
23 23 a, g dbSNP:779561271
24 24 c, t dbSNP:749855287
26 26 a, g dbSNP:769150955
27 27 a, g dbSNP:774737606
28 28 c, g dbSNP:748489564
29 29 c, g dbSNP:772435233
31 31 a, g dbSNP:368987793
34 34 c, t dbSNP:760882355
38 38 g, t dbSNP:201778132
41 41 a, c, t dbSNP:776836797
42 42 c, t dbSNP:764088627
45 45 a, t dbSNP:140909964
47 47 g, t dbSNP:761533610
54 54 c, t dbSNP:202070769
57 57 c, g dbSNP:750060266
67 67 c, g, t dbSNP:755780019
95 95 a, g dbSNP:753316557
103 103 c, t dbSNP:755527973
104 104 c, t dbSNP:779421107
108 108 a, t dbSNP:748615975
110 110 c, g, t dbSNP:370787811
114 114 a, g, t dbSNP:747253141
115 115 c, t dbSNP:776887125
118 118 c, t dbSNP:759662674
123 123 c, t dbSNP:769943127
134 134 c, g dbSNP:759129060
136 136 a, c dbSNP:764782713
139 139 a, c dbSNP:752246767
142 142 c, t dbSNP:758868843
143 143 c, g dbSNP:764636807
159 159 a, c, t dbSNP:55755457
160 160 a, g dbSNP:757725466
164 164 a, c, t dbSNP:781633384
172 172 c, t dbSNP:756403734
176 176 c, t dbSNP:780042351
177 177 a, g dbSNP:373374682
179 179 a, c dbSNP:768569749
181 181 a, t dbSNP:72549300
183 183 c, g dbSNP:746856550
185 185 a, g dbSNP:770727656
198 198 c, t dbSNP:776395578
203 203 c, t dbSNP:759250095
204 204 a, c, g dbSNP:376469897
205 205 a, c, t dbSNP:72549301
206 206 a, g, t dbSNP:200950545
211 211 c, g, t dbSNP:147363921
212 212 a, g dbSNP:121913505
213 213 a, g dbSNP:756456973
215 215 a, g dbSNP:780349712
217 217 c, g dbSNP:749431345
229 229 a, t dbSNP:755092278
232 232 c, t dbSNP:778802467
233 233 a, g dbSNP:747004948
240 240 a, c, t dbSNP:557317141
241 241 a, g dbSNP:745640513
253 253 a, g dbSNP:200121443
257 257 a, t dbSNP:139441923
258 258 c, g dbSNP:144933028
259 259 a, t dbSNP:768223628
279 279 c, t dbSNP:147943899
280 280 a, g dbSNP:762453840
288 288 a, g dbSNP:371353189
301 301 a, g dbSNP:750916458
309 309 c, t dbSNP:201872586
310 310 a, g, t dbSNP:56411694
334 334 c, t dbSNP:373066995
338 338 a, g dbSNP:146081659
343 343 c, t dbSNP:779113666
346 346 a, g dbSNP:150026676
355 355 c, t dbSNP:768599276
359 359 c, t dbSNP:781130745
361 361 c, t dbSNP:145333060
362 362 a, g dbSNP:769632130
375 375 c, t dbSNP:779652404
377 377 a, g dbSNP:749024557
378 378 g, t dbSNP:780922356
398 398 a, c, t dbSNP:772836939
403 403 c, t dbSNP:771310399
407 407 a, c dbSNP:189660852
415 415 c, t dbSNP:759839714
425 425 -, c dbSNP:35525445
426 426 c, t dbSNP:371303702
430 430 a, g dbSNP:775690281
445 445 c, g dbSNP:763100661
446 446 a, g dbSNP:764213036
448 448 c, t dbSNP:575926270
452 452 a, g dbSNP:756128407
453 453 c, t dbSNP:766253584
454 454 a, g dbSNP:149172424
461 461 c, t dbSNP:754738766
478 478 c, g dbSNP:778793243
481 481 a, c dbSNP:747868494
488 488 a, g dbSNP:758120380
496 496 c, t dbSNP:777463519
499 499 c, t dbSNP:746476450
502 502 c, t dbSNP:544555667
508 508 a, g dbSNP:776858609
512 512 c, g dbSNP:145053429
515 515 a, g dbSNP:770422212
521 521 c, t dbSNP:777031731
522 522 c, t dbSNP:367719489
530 530 a, g dbSNP:770362669
531 531 a, t dbSNP:775817289
536 536 a, t dbSNP:763226471
540 540 a, g dbSNP:764280416
542 542 g, t dbSNP:201222895
544 544 c, t dbSNP:774584792
556 556 c, g dbSNP:761831851
559 559 a, g dbSNP:767567085
560 560 a, g dbSNP:200851152
561 561 a, c, t dbSNP:149092990
562 562 a, g dbSNP:140469176
570 570 c, t dbSNP:752511532
579 579 c, g dbSNP:758171174
580 580 c, t dbSNP:145993517
586 586 a, g dbSNP:532461931
589 589 c, t dbSNP:756722358
590 590 a, g dbSNP:115585711
601 601 c, g dbSNP:746419269
620 620 c, g dbSNP:770279902
631 631 c, g dbSNP:780434119
643 643 a, g dbSNP:749677454
644 644 a, c dbSNP:768971014
649 649 a, g, t dbSNP:140839561
658 658 a, c, t dbSNP:772105682
662 662 c, t dbSNP:759589436
679 679 c, t dbSNP:771092682
698 698 a, g dbSNP:775569383
700 700 a, g dbSNP:762922034
713 713 c, g dbSNP:141679490
720 720 a, g dbSNP:763853854
730 730 a, g dbSNP:751363965
736 736 a, g dbSNP:761411033
751 751 c, g dbSNP:552937042
753 753 c, t dbSNP:767174569
754 754 a, g dbSNP:201988161
765 765 a, c dbSNP:374957554
772 772 a, g dbSNP:779482571
791 791 a, g dbSNP:754400702
792 792 c, t dbSNP:755508624
793 793 a, g dbSNP:150150449
807 807 a, g dbSNP:748527429
808 808 c, t dbSNP:758643928
818 818 a, g dbSNP:765944197
832 832 g, t dbSNP:753318751
835 835 a, g dbSNP:755490030
837 837 a, g dbSNP:200422460
838 838 c, t dbSNP:765797630
853 853 c, t dbSNP:753102574
877 877 a, g dbSNP:758792480
878 878 a, g dbSNP:769498440
882 882 c, t dbSNP:138585275
883 883 a, g dbSNP:747288547
890 890 a, c dbSNP:757547974
900 900 c, t dbSNP:386833402
901 901 a, c, g, t dbSNP:142772432
903 903 a, g dbSNP:147367441
905 905 a, g dbSNP:771961192
921 921 g, t dbSNP:775105481
934 934 c, t dbSNP:772988068
939 939 a, g dbSNP:137909416
943 943 c, t dbSNP:765997309
952 952 a, g dbSNP:776220729
963 963 c, t dbSNP:759119367
970 970 a, c dbSNP:531740394
971 971 a, g dbSNP:202052259
977 977 a, g dbSNP:753258292
989 989 a, g dbSNP:771970240
1005 1005 a, t dbSNP:377590954
1010 1010 c, t dbSNP:746831586
1012 1012 c, t dbSNP:770676368
1013 1013 a, c, g dbSNP:143388949
1015 1015 a, g dbSNP:769399180
1018 1018 a, g dbSNP:377102206
1025 1025 a, g dbSNP:147540142
1039 1039 c, t dbSNP:148594615
1040 1040 a, g dbSNP:752061752
1051 1051 c, t dbSNP:529920663
1060 1060 c, g dbSNP:767936896
1072 1072 c, t dbSNP:777287699
1102 1102 a, g dbSNP:750717279
1106 1106 a, g dbSNP:756286159
1117 1117 c, g dbSNP:372759291
1141 1141 a, c dbSNP:753844400
1147 1147 c, t dbSNP:554090824
1152 1152 a, g dbSNP:375734891
1156 1156 a, t dbSNP:142963781
1167 1167 a, g dbSNP:746884875
1180 1180 c, t dbSNP:72549293
1181 1181 a, g, t dbSNP:73137716
1196 1196 a, c dbSNP:376275305
1198 1198 a, g dbSNP:773723931
1200 1200 c, t dbSNP:760981584
1201 1201 a, g dbSNP:766702350
1214 1214 a, g dbSNP:776734905
1216 1216 a, c, g, t dbSNP:373472667
1232 1232 a, g dbSNP:757234342
1234 1234 a, t dbSNP:767377458
1238 1238 c, t dbSNP:750332587
1246 1246 c, t dbSNP:755864184
1255 1255 c, t dbSNP:376940990
1256 1256 a, g dbSNP:143707288
1260 1260 a, g dbSNP:72549294
1262 1262 a, g dbSNP:778615486
1267 1267 c, t dbSNP:747686609
1278 1278 a, g dbSNP:771574892
1288 1288 a, g dbSNP:773599038
1289 1289 a, c, t dbSNP:111646246
1291 1291 c, t dbSNP:140536677
1302 1302 a, g dbSNP:587778435
1312 1312 c, t dbSNP:765071640
1316 1316 a, g dbSNP:752354428
1322 1322 -, tcg dbSNP:587778434
1337 1337 c, g dbSNP:758061831
1339 1339 c, g dbSNP:777184855
1342 1342 a, g, t dbSNP:376889675
1348 1348 a, g dbSNP:563667772
1351 1351 a, g dbSNP:55966164
1357 1357 a, g dbSNP:781686359
1360 1360 c, t dbSNP:746304506
1363 1363 a, g dbSNP:770157148
1373 1373 a, g dbSNP:780382854
1378 1378 c, t dbSNP:144185800
1390 1390 c, t dbSNP:768900424
1392 1392 c, t dbSNP:774389709
1398 1398 c, t dbSNP:761984908
1405 1405 a, c, g dbSNP:542718349
1412 1412 c, t dbSNP:145183977
1420 1420 g, t dbSNP:769828541
1424 1424 c, t dbSNP:775239202
1430 1430 -, gtggat dbSNP:756523952
1444 1444 a, g dbSNP:151016327
1446 1446 c, t dbSNP:200783907
1455 1455 c, t dbSNP:763728676
1459 1459 a, g dbSNP:774064393
1463 1463 c, t dbSNP:761442091
1464 1464 c, t dbSNP:200518498
1465 1465 a, g dbSNP:767079772
1469 1469 a, g dbSNP:749914029
1470 1470 a, g dbSNP:755572814
1474 1474 g, t dbSNP:766943473
1492 1492 c, t dbSNP:754233899
1507 1507 a, g dbSNP:755386780
1518 1518 a, g dbSNP:779134230
1523 1523 a, c dbSNP:748451770
1524 1524 c, t dbSNP:56225530
1526 1526 a, g dbSNP:778045049
1539 1539 c, t dbSNP:371078350
1543 1543 c, t dbSNP:771092774
1546 1546 c, t dbSNP:775498908
1547 1547 a, g dbSNP:143179681
1552 1552 a, g dbSNP:768552563
1558 1558 a, g dbSNP:374432699
1560 1560 c, t dbSNP:200127012
1597 1597 c, g dbSNP:771735131
1599 1599 a, g dbSNP:772813487
1614 1614 c, t dbSNP:569408054
1616 1616 c, t dbSNP:370364842
1625 1625 g, t dbSNP:144610991
1629 1629 c, t dbSNP:772866513
1630 1630 g, t dbSNP:760310161
1648 1648 c, t dbSNP:148248559
1649 1649 a, g dbSNP:72550822
1654 1654 c, t dbSNP:760143011
1655 1655 a, g dbSNP:55792975
1659 1659 c, t dbSNP:753212327
1665 1665 c, t dbSNP:763411938
1666 1666 a, g dbSNP:764493206
1672 1672 c, g dbSNP:751886000
1675 1675 c, t dbSNP:757414947
1677 1677 c, t dbSNP:781371383
1678 1678 c, t dbSNP:750491922
1679 1679 c, g dbSNP:756179543
1682 1682 a, c, g dbSNP:3822214
1693 1693 c, g dbSNP:574083805
1696 1696 c, t dbSNP:374123328
1699 1699 a, g dbSNP:55986963
1702 1702 c, t dbSNP:746718824
1709 1709 -, aaacccatgtatgaagtacagtggaag dbSNP:121913234
1713 1713 -, ccatgtatgaagtac dbSNP:587776804
1715 1715 a, g dbSNP:777596975
1716 1716 c, t dbSNP:746805825
1730 1730 a, c, g, t dbSNP:121913235
1733 1733 -, aaggttgttgaggag dbSNP:121913510
1733 1733 -, aaggttgtt dbSNP:121913511
1735 1735 a, g dbSNP:200375589
1736 1736 -, gtt dbSNP:121913685
1736 1736 a, g dbSNP:121913520
1737 1737 -, ttgttg dbSNP:587776803
1737 1737 a, c, g, t dbSNP:121913517
1740 1740 a, g, t dbSNP:121913521
1749 1749 a, t dbSNP:780708976
1751 1751 a, t dbSNP:745463319
1752 1752 a, g dbSNP:769483857
1755 1755 g, t dbSNP:200945282
1764 1764 a, t dbSNP:749851557
1765 1765 c, t dbSNP:769263048
1769 1769 c, t dbSNP:774872724
1770 1770 a, g dbSNP:762089641
1772 1772 a, g dbSNP:587778431
1788 1788 c, t dbSNP:121913513
1798 1798 a, t dbSNP:773366034
1808 1808 a, g dbSNP:121913680
1812 1812 g, t dbSNP:28933371
1816 1816 c, t dbSNP:121913515
1842 1842 c, t dbSNP:375351432
1849 1849 g, t dbSNP:748829568
1850 1850 a, g dbSNP:768214921
1855 1855 a, t dbSNP:72549292
1861 1861 c, t dbSNP:138380197
1892 1892 c, t dbSNP:369412402
1909 1909 a, g dbSNP:148853099
1913 1913 a, c dbSNP:760939861
1914 1914 c, t dbSNP:111466688
1915 1915 a, g dbSNP:199787524
1920 1920 c, t dbSNP:387907217
1921 1921 c, t dbSNP:200814065
1924 1924 g, t dbSNP:759613218
1930 1930 a, g dbSNP:765239839
1950 1950 a, g dbSNP:373554876
1951 1951 a, t dbSNP:761703470
1954 1954 a, g dbSNP:767511834
1961 1961 c, g, t dbSNP:144369407
1962 1962 a, g dbSNP:766264502
1969 1969 c, t dbSNP:753610580
1985 1985 a, g dbSNP:121913512
2012 2012 a, g, t dbSNP:534209826
2020 2020 c, t dbSNP:752271176
2022 2022 c, t dbSNP:121913523
2032 2032 c, t dbSNP:757803641
2035 2035 a, g dbSNP:778343194
2051 2051 a, g dbSNP:121913679
2052 2052 a, g dbSNP:773340705
2060 2060 c, t dbSNP:760685128
2062 2062 c, g dbSNP:766315579
2065 2065 a, c, t dbSNP:527840468
2070 2070 c, t dbSNP:121913516
2085 2085 a, g dbSNP:764970586
2090 2090 a, g dbSNP:752221484
2117 2117 c, t dbSNP:148771698
2118 2118 a, g dbSNP:143772138
2123 2123 a, t dbSNP:752130583
2133 2133 c, g dbSNP:35200131
2136 2136 c, t dbSNP:757733297
2147 2147 a, g dbSNP:781588289
2150 2150 c, t dbSNP:763308199
2153 2153 g, t dbSNP:756394678
2154 2154 c, g dbSNP:780329057
2164 2164 a, g dbSNP:749457757
2165 2165 c, g dbSNP:768847037
2166 2166 c, t dbSNP:541585774
2168 2168 c, t dbSNP:746990067
2169 2169 a, g dbSNP:771012963
2179 2179 g, t dbSNP:766840704
2183 2183 c, t dbSNP:146337870
2193 2193 a, g dbSNP:374262491
2198 2198 -, c dbSNP:35826988
2199 2199 a, c, t dbSNP:775274159
2203 2203 c, t dbSNP:192110951
2204 2204 a, g dbSNP:769701248
2210 2210 a, g dbSNP:564307874
2218 2218 a, g dbSNP:372359131
2221 2221 c, t dbSNP:139644803
2243 2243 g, t dbSNP:773953640
2248 2248 c, t dbSNP:761317949
2266 2266 c, t dbSNP:375902940
2267 2267 a, g dbSNP:751005114
2273 2273 -, agg dbSNP:773173925
2279 2279 a, t dbSNP:761055157
2289 2289 c, t dbSNP:549887751
2301 2301 c, t dbSNP:572852980
2306 2306 a, g dbSNP:541362004
2313 2313 g, t dbSNP:758665590
2317 2317 c, t dbSNP:764287169
2320 2320 c, t dbSNP:200112919
2321 2321 a, g dbSNP:201165084
2322 2322 c, t dbSNP:758252647
2324 2324 a, g dbSNP:779862483
2331 2331 a, g dbSNP:749166896
2333 2333 a, g, t dbSNP:754826149
2337 2337 a, t dbSNP:747847018
2338 2338 c, g, t dbSNP:55717477
2339 2339 a, g dbSNP:746503007
2348 2348 c, t dbSNP:770413971
2350 2350 a, g dbSNP:777058326
2351 2351 g, t dbSNP:760112920
2407 2407 c, t dbSNP:151046591
2416 2416 ga, tt dbSNP:587778432
2416 2416 g, t dbSNP:202144208
2419 2419 c, t dbSNP:140912933
2435 2435 a, g, t dbSNP:558702741
2442 2442 c, g dbSNP:760704637
2444 2444 a, g dbSNP:121913684
2452 2452 c, t dbSNP:55789615
2464 2464 c, t dbSNP:752570197
2468 2468 c, t dbSNP:145602440
2469 2469 a, g dbSNP:777616126
2473 2473 c, g dbSNP:751206924
2504 2504 c, g, t dbSNP:121913506
2505 2505 a, t dbSNP:121913507
2517 2517 a, g dbSNP:121913682
2524 2524 a, t dbSNP:121913514
2532 2532 c, t dbSNP:121913524
2542 2542 c, t dbSNP:141347955
2547 2547 a, g dbSNP:772311731
2554 2554 c, t dbSNP:773354518
2560 2560 a, g dbSNP:146992614
2573 2573 a, g dbSNP:121913509
2577 2577 a, g dbSNP:766430859
2589 2589 a, g dbSNP:147609111
2597 2597 a, c dbSNP:121913687
2598 2598 c, t dbSNP:752695117
2599 2599 a, g dbSNP:762912889
2604 2604 a, c dbSNP:763847901
2611 2611 c, t dbSNP:751396522
2612 2612 a, g dbSNP:555650901
2613 2613 c, t dbSNP:780998847
2620 2620 c, g dbSNP:750039813
2635 2635 c, t dbSNP:371058716
2642 2642 c, g dbSNP:779706462
2644 2644 c, g dbSNP:3733542
2657 2657 a, g dbSNP:761684550
2659 2659 a, c, g dbSNP:143074839
2670 2670 c, g dbSNP:755797225
2677 2677 g, t dbSNP:766036617
2679 2679 c, t dbSNP:753419764
2680 2680 a, c, g dbSNP:55817813
2683 2683 c, t dbSNP:748588125
2684 2684 a, g dbSNP:372795544
2686 2686 g, t dbSNP:778078182
2710 2710 g, t dbSNP:374440815
2719 2719 c, t dbSNP:771168804
2721 2721 a, g dbSNP:776681643
2728 2728 c, t dbSNP:745967881
2738 2738 c, t dbSNP:141126803
2741 2741 a, g dbSNP:774405431
2751 2751 a, c dbSNP:761840504
2755 2755 g, t dbSNP:769984428
2765 2765 a, g dbSNP:779966930
2786 2786 g, t dbSNP:190512512
2790 2790 a, c, t dbSNP:772159767
2794 2794 a, g dbSNP:761004820
2803 2803 a, t dbSNP:760873449
2815 2815 a, t dbSNP:770617877
2821 2821 c, t dbSNP:776411237
2848 2848 c, g dbSNP:759076549
2851 2851 c, t dbSNP:773363866
2855 2855 a, t dbSNP:764847795
2856 2856 a, g dbSNP:752222954
2859 2859 a, g dbSNP:762406098
2860 2860 c, t dbSNP:764592751
2863 2863 a, t dbSNP:72549296
2884 2884 c, g dbSNP:149932314
2885 2885 a, c, g dbSNP:756463331
2892 2892 a, g dbSNP:754097617
2894 2894 c, t dbSNP:139000082
2895 2895 c, g dbSNP:779103998
2905 2905 c, t dbSNP:56288823
2906 2906 a, g dbSNP:146374006
2908 2908 a, g dbSNP:781142513
2909 2909 a, g dbSNP:745651409
2924 2924 c, t dbSNP:587778433
2925 2925 a, g dbSNP:139694927
2927 2927 a, g dbSNP:748938919
2938 2938 c, t dbSNP:375833392
2939 2939 a, g dbSNP:773828910
2943 2943 a, g dbSNP:761339150
2944 2944 c, t dbSNP:767942133
2945 2945 a, g dbSNP:773709702
2947 2947 c, t dbSNP:200275681
2948 2948 a, g dbSNP:766845123
2950 2950 c, t dbSNP:578043962
2952 2952 c, t dbSNP:201185750
2955 2955 a, c dbSNP:765503364
2956 2956 c, t dbSNP:752748940
2957 2957 c, t dbSNP:758434265
2966 2966 c, t dbSNP:781007582
2969 2969 c, t dbSNP:745807112
2977 2977 c, t dbSNP:755974085
2978 2978 a, g dbSNP:72549297
2981 2981 a, g dbSNP:373152714
2982 2982 a, g dbSNP:768320570
2984 2984 a, g dbSNP:773955363
2986 2986 c, g dbSNP:182068450
2995 2995 a, g dbSNP:771597134
2998 2998 a, g dbSNP:773657951
3006 3006 a, g dbSNP:377596175
3009 3009 c, t dbSNP:766898265
3016 3016 c, t dbSNP:749502431
3034 3034 c, t dbSNP:777154782
3055 3055 g, t dbSNP:112972811
3074 3074 c, t dbSNP:541771331
3088 3088 a, g dbSNP:774300172
3101 3101 -, c dbSNP:141454480
3103 3103 c, t dbSNP:759680567
3119 3119 c, t dbSNP:561815817
3138 3138 c, t dbSNP:2213181
3158 3158 c, t dbSNP:540886606
3206 3206 a, g dbSNP:17084733
3225 3225 a, g dbSNP:761142396
3241 3241 g, t dbSNP:376694515
3278 3278 c, t dbSNP:569668395
3288 3288 c, g dbSNP:185479436
3303 3303 -, c dbSNP:542300014
3305 3305 -, c dbSNP:375297569
3341 3341 a, g dbSNP:149336515
3379 3379 a, g dbSNP:528891717
3415 3415 c, t dbSNP:750092746
3503 3503 a, c dbSNP:758036290
3515 3515 c, t dbSNP:779688131
3519 3519 a, g dbSNP:534199544
3586 3586 c, t dbSNP:746982052
3592 3592 c, g dbSNP:754924498
3654 3654 c, t dbSNP:566225251
3664 3664 c, t dbSNP:535289870
3665 3665 a, g dbSNP:558087775
3690 3690 a, g dbSNP:747912015
3697 3697 -, g dbSNP:772774569
3720 3720 a, g dbSNP:571459383
3723 3723 c, t dbSNP:769473001
3740 3740 c, t dbSNP:376257863
3779 3779 a, g dbSNP:189995563
3822 3822 a, g dbSNP:557023678
3828 3828 a, c, t dbSNP:183497667
3877 3877 c, t dbSNP:188598702
3900 3900 c, g dbSNP:553298726
3918 3918 a, g dbSNP:572274912
3919 3919 a, c dbSNP:547783802
3922 3922 g, t dbSNP:193129140
3931 3931 c, t dbSNP:553005135
3933 3933 c, g dbSNP:55799920
4049 4049 c, t dbSNP:747546874
4075 4075 c, t dbSNP:533152310
4076 4076 c, g dbSNP:144602457
4088 4088 a, g dbSNP:772182994
4138 4138 a, t dbSNP:577899786
4209 4209 c, t dbSNP:56372445
4223 4223 c, t dbSNP:184041614
4230 4230 a, g dbSNP:114377961
4246 4246 c, t dbSNP:761195357
4267 4267 a, g dbSNP:565640146
4291 4291 c, g dbSNP:528782307
4338 4338 c, t dbSNP:145007262
4349 4349 c, g dbSNP:571545423
4391 4391 a, g dbSNP:1799813
4417 4417 g, t dbSNP:537228504
4423 4423 c, t dbSNP:538534252
4435 4435 a, c dbSNP:147133269
4438 4438 g, t dbSNP:768670355
4444 4444 -, tacc dbSNP:765958252
4453 4453 -, aaaac dbSNP:558178243
4474 4474 -, aaaa dbSNP:374796688
4498 4498 c, t dbSNP:567439187
4499 4499 a, g dbSNP:773447284
4513 4513 a, g dbSNP:17084736
4545 4545 c, g dbSNP:779554258
4556 4556 a, g dbSNP:543517677
4564 4564 c, t dbSNP:561819471
4585 4585 a, g dbSNP:573912893
4618 4618 c, t dbSNP:748767060
4619 4619 a, g dbSNP:140416206
4653 4653 a, g dbSNP:573152330
4661 4661 a, g dbSNP:541644297
4684 4684 a, t dbSNP:534652006
4693 4693 g, t dbSNP:8022
4711 4711 c, t dbSNP:577939550
4723 4723 a, g dbSNP:776712217
4746 4746 c, t dbSNP:543627061
4755 4755 a, g dbSNP:533731213
4780 4780 a, g dbSNP:77842054
4782 4782 a, g dbSNP:576230887
4789 4789 a, g dbSNP:377361492
4794 4794 a, t dbSNP:573802115
4797 4797 a, g dbSNP:762662037
4823 4823 a, c, g dbSNP:186953545
4824 4824 c, t dbSNP:191473270
4839 4839 g, t dbSNP:528078215
4857 4857 c, t dbSNP:774038505
4883 4883 c, t dbSNP:747942024
4917 4917 -, t dbSNP:746428370
4928 4928 c, g dbSNP:754877866
4953 4953 a, g dbSNP:551832318
4958 4958 a, g dbSNP:563284298
4977 4977 c, t dbSNP:565225492
4994 4994 a, g dbSNP:531077997
5006 5006 c, t dbSNP:115028437
5045 5045 a, g dbSNP:567475861
5072 5072 c, t dbSNP:755986721
5118 5118 a, g dbSNP:777404145

Target ORF information:

RefSeq Version XM_005265741
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38612
Accession Version XM_005265742.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2922bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mast/stem cell growth factor receptor Kit isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022853.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)188..391(+)
Misc Feature(2)716..982(+)
Misc Feature(3)746..973(+)
Misc Feature(4)992..1294(+)
Misc Feature(5)1199..1219(+)
Misc Feature(6)1337..1576(+)
Misc Feature(7)1706..2833(+)
Misc Feature(8)1814..2821(+)
Misc Feature(9)1832..2677(+)
Misc Feature(10)1832..2479(+)
Misc Feature(11)2423..2677(+)
Misc Feature(12)2474..2551(+)
Position Chain Variation Link
15 15 a, g dbSNP:547049010
16 16 c, g dbSNP:757006597
21 21 a, c dbSNP:780684303
22 22 c, g, t dbSNP:199508856
23 23 a, g dbSNP:779561271
24 24 c, t dbSNP:749855287
26 26 a, g dbSNP:769150955
27 27 a, g dbSNP:774737606
28 28 c, g dbSNP:748489564
29 29 c, g dbSNP:772435233
31 31 a, g dbSNP:368987793
34 34 c, t dbSNP:760882355
38 38 g, t dbSNP:201778132
41 41 a, c, t dbSNP:776836797
42 42 c, t dbSNP:764088627
45 45 a, t dbSNP:140909964
47 47 g, t dbSNP:761533610
54 54 c, t dbSNP:202070769
57 57 c, g dbSNP:750060266
67 67 c, g, t dbSNP:755780019
95 95 a, g dbSNP:753316557
103 103 c, t dbSNP:755527973
104 104 c, t dbSNP:779421107
108 108 a, t dbSNP:748615975
110 110 c, g, t dbSNP:370787811
114 114 a, g, t dbSNP:747253141
115 115 c, t dbSNP:776887125
118 118 c, t dbSNP:759662674
123 123 c, t dbSNP:769943127
134 134 c, g dbSNP:759129060
136 136 a, c dbSNP:764782713
139 139 a, c dbSNP:752246767
142 142 c, t dbSNP:758868843
143 143 c, g dbSNP:764636807
159 159 a, c, t dbSNP:55755457
160 160 a, g dbSNP:757725466
164 164 a, c, t dbSNP:781633384
172 172 c, t dbSNP:756403734
176 176 c, t dbSNP:780042351
177 177 a, g dbSNP:373374682
179 179 a, c dbSNP:768569749
181 181 a, t dbSNP:72549300
183 183 c, g dbSNP:746856550
185 185 a, g dbSNP:770727656
198 198 c, t dbSNP:776395578
203 203 c, t dbSNP:759250095
204 204 a, c, g dbSNP:376469897
205 205 a, c, t dbSNP:72549301
206 206 a, g, t dbSNP:200950545
211 211 c, g, t dbSNP:147363921
212 212 a, g dbSNP:121913505
213 213 a, g dbSNP:756456973
215 215 a, g dbSNP:780349712
217 217 c, g dbSNP:749431345
229 229 a, t dbSNP:755092278
232 232 c, t dbSNP:778802467
233 233 a, g dbSNP:747004948
240 240 a, c, t dbSNP:557317141
241 241 a, g dbSNP:745640513
253 253 a, g dbSNP:200121443
257 257 a, t dbSNP:139441923
258 258 c, g dbSNP:144933028
259 259 a, t dbSNP:768223628
279 279 c, t dbSNP:147943899
280 280 a, g dbSNP:762453840
288 288 a, g dbSNP:371353189
301 301 a, g dbSNP:750916458
309 309 c, t dbSNP:201872586
310 310 a, g, t dbSNP:56411694
334 334 c, t dbSNP:373066995
338 338 a, g dbSNP:146081659
343 343 c, t dbSNP:779113666
346 346 a, g dbSNP:150026676
355 355 c, t dbSNP:768599276
359 359 c, t dbSNP:781130745
361 361 c, t dbSNP:145333060
362 362 a, g dbSNP:769632130
375 375 c, t dbSNP:779652404
377 377 a, g dbSNP:749024557
378 378 g, t dbSNP:780922356
398 398 a, c, t dbSNP:772836939
403 403 c, t dbSNP:771310399
407 407 a, c dbSNP:189660852
415 415 c, t dbSNP:759839714
425 425 -, c dbSNP:35525445
426 426 c, t dbSNP:371303702
430 430 a, g dbSNP:775690281
445 445 c, g dbSNP:763100661
446 446 a, g dbSNP:764213036
448 448 c, t dbSNP:575926270
452 452 a, g dbSNP:756128407
453 453 c, t dbSNP:766253584
454 454 a, g dbSNP:149172424
461 461 c, t dbSNP:754738766
478 478 c, g dbSNP:778793243
481 481 a, c dbSNP:747868494
488 488 a, g dbSNP:758120380
496 496 c, t dbSNP:777463519
499 499 c, t dbSNP:746476450
502 502 c, t dbSNP:544555667
508 508 a, g dbSNP:776858609
512 512 c, g dbSNP:145053429
515 515 a, g dbSNP:770422212
521 521 c, t dbSNP:777031731
522 522 c, t dbSNP:367719489
530 530 a, g dbSNP:770362669
531 531 a, t dbSNP:775817289
536 536 a, t dbSNP:763226471
540 540 a, g dbSNP:764280416
542 542 g, t dbSNP:201222895
544 544 c, t dbSNP:774584792
556 556 c, g dbSNP:761831851
559 559 a, g dbSNP:767567085
560 560 a, g dbSNP:200851152
561 561 a, c, t dbSNP:149092990
562 562 a, g dbSNP:140469176
570 570 c, t dbSNP:752511532
579 579 c, g dbSNP:758171174
580 580 c, t dbSNP:145993517
586 586 a, g dbSNP:532461931
589 589 c, t dbSNP:756722358
590 590 a, g dbSNP:115585711
601 601 c, g dbSNP:746419269
620 620 c, g dbSNP:770279902
631 631 c, g dbSNP:780434119
643 643 a, g dbSNP:749677454
644 644 a, c dbSNP:768971014
649 649 a, g, t dbSNP:140839561
658 658 a, c, t dbSNP:772105682
662 662 c, t dbSNP:759589436
679 679 c, t dbSNP:771092682
698 698 a, g dbSNP:775569383
700 700 a, g dbSNP:762922034
713 713 c, g dbSNP:141679490
720 720 a, g dbSNP:763853854
730 730 a, g dbSNP:751363965
736 736 a, g dbSNP:761411033
751 751 c, g dbSNP:552937042
753 753 c, t dbSNP:767174569
754 754 a, g dbSNP:201988161
765 765 a, c dbSNP:374957554
772 772 a, g dbSNP:779482571
791 791 a, g dbSNP:754400702
792 792 c, t dbSNP:755508624
793 793 a, g dbSNP:150150449
807 807 a, g dbSNP:748527429
808 808 c, t dbSNP:758643928
818 818 a, g dbSNP:765944197
832 832 g, t dbSNP:753318751
835 835 a, g dbSNP:755490030
837 837 a, g dbSNP:200422460
838 838 c, t dbSNP:765797630
853 853 c, t dbSNP:753102574
877 877 a, g dbSNP:758792480
878 878 a, g dbSNP:769498440
882 882 c, t dbSNP:138585275
883 883 a, g dbSNP:747288547
890 890 a, c dbSNP:757547974
900 900 c, t dbSNP:386833402
901 901 a, c, g, t dbSNP:142772432
903 903 a, g dbSNP:147367441
905 905 a, g dbSNP:771961192
921 921 g, t dbSNP:775105481
934 934 c, t dbSNP:772988068
939 939 a, g dbSNP:137909416
943 943 c, t dbSNP:765997309
952 952 a, g dbSNP:776220729
963 963 c, t dbSNP:759119367
970 970 a, c dbSNP:531740394
971 971 a, g dbSNP:202052259
977 977 a, g dbSNP:753258292
989 989 a, g dbSNP:771970240
1005 1005 a, t dbSNP:377590954
1010 1010 c, t dbSNP:746831586
1012 1012 c, t dbSNP:770676368
1013 1013 a, c, g dbSNP:143388949
1015 1015 a, g dbSNP:769399180
1018 1018 a, g dbSNP:377102206
1025 1025 a, g dbSNP:147540142
1039 1039 c, t dbSNP:148594615
1040 1040 a, g dbSNP:752061752
1051 1051 c, t dbSNP:529920663
1060 1060 c, g dbSNP:767936896
1072 1072 c, t dbSNP:777287699
1102 1102 a, g dbSNP:750717279
1106 1106 a, g dbSNP:756286159
1117 1117 c, g dbSNP:372759291
1141 1141 a, c dbSNP:753844400
1147 1147 c, t dbSNP:554090824
1152 1152 a, g dbSNP:375734891
1156 1156 a, t dbSNP:142963781
1167 1167 a, g dbSNP:746884875
1180 1180 c, t dbSNP:72549293
1181 1181 a, g, t dbSNP:73137716
1196 1196 a, c dbSNP:376275305
1198 1198 a, g dbSNP:773723931
1200 1200 c, t dbSNP:760981584
1201 1201 a, g dbSNP:766702350
1214 1214 a, g dbSNP:776734905
1216 1216 a, c, g, t dbSNP:373472667
1232 1232 a, g dbSNP:757234342
1234 1234 a, t dbSNP:767377458
1238 1238 c, t dbSNP:750332587
1246 1246 c, t dbSNP:755864184
1255 1255 c, t dbSNP:376940990
1256 1256 a, g dbSNP:143707288
1260 1260 a, g dbSNP:72549294
1262 1262 a, g dbSNP:778615486
1267 1267 c, t dbSNP:747686609
1278 1278 a, g dbSNP:771574892
1288 1288 a, g dbSNP:773599038
1289 1289 a, c, t dbSNP:111646246
1291 1291 c, t dbSNP:140536677
1302 1302 a, g dbSNP:587778435
1312 1312 c, t dbSNP:765071640
1316 1316 a, g dbSNP:752354428
1322 1322 -, tcg dbSNP:587778434
1337 1337 c, g dbSNP:758061831
1339 1339 c, g dbSNP:777184855
1342 1342 a, g, t dbSNP:376889675
1348 1348 a, g dbSNP:563667772
1351 1351 a, g dbSNP:55966164
1357 1357 a, g dbSNP:781686359
1360 1360 c, t dbSNP:746304506
1363 1363 a, g dbSNP:770157148
1373 1373 a, g dbSNP:780382854
1378 1378 c, t dbSNP:144185800
1390 1390 c, t dbSNP:768900424
1392 1392 c, t dbSNP:774389709
1398 1398 c, t dbSNP:761984908
1405 1405 a, c, g dbSNP:542718349
1412 1412 c, t dbSNP:145183977
1420 1420 g, t dbSNP:769828541
1424 1424 c, t dbSNP:775239202
1430 1430 -, gtggat dbSNP:756523952
1444 1444 a, g dbSNP:151016327
1446 1446 c, t dbSNP:200783907
1455 1455 c, t dbSNP:763728676
1459 1459 a, g dbSNP:774064393
1463 1463 c, t dbSNP:761442091
1464 1464 c, t dbSNP:200518498
1465 1465 a, g dbSNP:767079772
1469 1469 a, g dbSNP:749914029
1470 1470 a, g dbSNP:755572814
1474 1474 g, t dbSNP:766943473
1492 1492 c, t dbSNP:754233899
1507 1507 a, g dbSNP:755386780
1518 1518 a, g dbSNP:779134230
1523 1523 a, c dbSNP:748451770
1524 1524 c, t dbSNP:56225530
1526 1526 a, g dbSNP:778045049
1539 1539 c, t dbSNP:371078350
1543 1543 c, t dbSNP:771092774
1546 1546 c, t dbSNP:775498908
1547 1547 a, g dbSNP:143179681
1552 1552 a, g dbSNP:768552563
1558 1558 a, g dbSNP:374432699
1560 1560 c, t dbSNP:200127012
1602 1602 c, t dbSNP:569408054
1604 1604 c, t dbSNP:370364842
1613 1613 g, t dbSNP:144610991
1617 1617 c, t dbSNP:772866513
1618 1618 g, t dbSNP:760310161
1636 1636 c, t dbSNP:148248559
1637 1637 a, g dbSNP:72550822
1642 1642 c, t dbSNP:760143011
1643 1643 a, g dbSNP:55792975
1647 1647 c, t dbSNP:753212327
1653 1653 c, t dbSNP:763411938
1654 1654 a, g dbSNP:764493206
1660 1660 c, g dbSNP:751886000
1663 1663 c, t dbSNP:757414947
1665 1665 c, t dbSNP:781371383
1666 1666 c, t dbSNP:750491922
1667 1667 c, g dbSNP:756179543
1670 1670 a, c, g dbSNP:3822214
1681 1681 c, g dbSNP:574083805
1684 1684 c, t dbSNP:374123328
1687 1687 a, g dbSNP:55986963
1690 1690 c, t dbSNP:746718824
1697 1697 -, aaacccatgtatgaagtacagtggaag dbSNP:121913234
1701 1701 -, ccatgtatgaagtac dbSNP:587776804
1703 1703 a, g dbSNP:777596975
1704 1704 c, t dbSNP:746805825
1718 1718 a, c, g, t dbSNP:121913235
1721 1721 -, aaggttgttgaggag dbSNP:121913510
1721 1721 -, aaggttgtt dbSNP:121913511
1723 1723 a, g dbSNP:200375589
1724 1724 -, gtt dbSNP:121913685
1724 1724 a, g dbSNP:121913520
1725 1725 -, ttgttg dbSNP:587776803
1725 1725 a, c, g, t dbSNP:121913517
1728 1728 a, g, t dbSNP:121913521
1737 1737 a, t dbSNP:780708976
1739 1739 a, t dbSNP:745463319
1740 1740 a, g dbSNP:769483857
1743 1743 g, t dbSNP:200945282
1752 1752 a, t dbSNP:749851557
1753 1753 c, t dbSNP:769263048
1757 1757 c, t dbSNP:774872724
1758 1758 a, g dbSNP:762089641
1760 1760 a, g dbSNP:587778431
1776 1776 c, t dbSNP:121913513
1786 1786 a, t dbSNP:773366034
1796 1796 a, g dbSNP:121913680
1800 1800 g, t dbSNP:28933371
1804 1804 c, t dbSNP:121913515
1830 1830 c, t dbSNP:375351432
1837 1837 g, t dbSNP:748829568
1838 1838 a, g dbSNP:768214921
1843 1843 a, t dbSNP:72549292
1849 1849 c, t dbSNP:138380197
1880 1880 c, t dbSNP:369412402
1897 1897 a, g dbSNP:148853099
1901 1901 a, c dbSNP:760939861
1902 1902 c, t dbSNP:111466688
1903 1903 a, g dbSNP:199787524
1908 1908 c, t dbSNP:387907217
1909 1909 c, t dbSNP:200814065
1912 1912 g, t dbSNP:759613218
1918 1918 a, g dbSNP:765239839
1938 1938 a, g dbSNP:373554876
1939 1939 a, t dbSNP:761703470
1942 1942 a, g dbSNP:767511834
1949 1949 c, g, t dbSNP:144369407
1950 1950 a, g dbSNP:766264502
1957 1957 c, t dbSNP:753610580
1973 1973 a, g dbSNP:121913512
2000 2000 a, g, t dbSNP:534209826
2008 2008 c, t dbSNP:752271176
2010 2010 c, t dbSNP:121913523
2020 2020 c, t dbSNP:757803641
2023 2023 a, g dbSNP:778343194
2039 2039 a, g dbSNP:121913679
2040 2040 a, g dbSNP:773340705
2048 2048 c, t dbSNP:760685128
2050 2050 c, g dbSNP:766315579
2053 2053 a, c, t dbSNP:527840468
2058 2058 c, t dbSNP:121913516
2073 2073 a, g dbSNP:764970586
2078 2078 a, g dbSNP:752221484
2105 2105 c, t dbSNP:148771698
2106 2106 a, g dbSNP:143772138
2111 2111 a, t dbSNP:752130583
2121 2121 c, g dbSNP:35200131
2124 2124 c, t dbSNP:757733297
2135 2135 a, g dbSNP:781588289
2138 2138 c, t dbSNP:763308199
2141 2141 g, t dbSNP:756394678
2142 2142 c, g dbSNP:780329057
2152 2152 a, g dbSNP:749457757
2153 2153 c, g dbSNP:768847037
2154 2154 c, t dbSNP:541585774
2156 2156 c, t dbSNP:746990067
2157 2157 a, g dbSNP:771012963
2167 2167 g, t dbSNP:766840704
2171 2171 c, t dbSNP:146337870
2181 2181 a, g dbSNP:374262491
2186 2186 -, c dbSNP:35826988
2187 2187 a, c, t dbSNP:775274159
2193 2193 a, g dbSNP:56094246
2194 2194 c, t dbSNP:192110951
2195 2195 a, g dbSNP:769701248
2201 2201 a, g dbSNP:564307874
2209 2209 a, g dbSNP:372359131
2212 2212 c, t dbSNP:139644803
2234 2234 g, t dbSNP:773953640
2239 2239 c, t dbSNP:761317949
2257 2257 c, t dbSNP:375902940
2258 2258 a, g dbSNP:751005114
2264 2264 -, agg dbSNP:773173925
2270 2270 a, t dbSNP:761055157
2280 2280 c, t dbSNP:549887751
2292 2292 c, t dbSNP:572852980
2297 2297 a, g dbSNP:541362004
2304 2304 g, t dbSNP:758665590
2308 2308 c, t dbSNP:764287169
2311 2311 c, t dbSNP:200112919
2312 2312 a, g dbSNP:201165084
2313 2313 c, t dbSNP:758252647
2315 2315 a, g dbSNP:779862483
2322 2322 a, g dbSNP:749166896
2324 2324 a, g, t dbSNP:754826149
2328 2328 a, t dbSNP:747847018
2329 2329 c, g, t dbSNP:55717477
2330 2330 a, g dbSNP:746503007
2339 2339 c, t dbSNP:770413971
2341 2341 a, g dbSNP:777058326
2342 2342 g, t dbSNP:760112920
2398 2398 c, t dbSNP:151046591
2407 2407 ga, tt dbSNP:587778432
2407 2407 g, t dbSNP:202144208
2410 2410 c, t dbSNP:140912933
2426 2426 a, g, t dbSNP:558702741
2433 2433 c, g dbSNP:760704637
2435 2435 a, g dbSNP:121913684
2443 2443 c, t dbSNP:55789615
2455 2455 c, t dbSNP:752570197
2459 2459 c, t dbSNP:145602440
2460 2460 a, g dbSNP:777616126
2464 2464 c, g dbSNP:751206924
2495 2495 c, g, t dbSNP:121913506
2496 2496 a, t dbSNP:121913507
2508 2508 a, g dbSNP:121913682
2515 2515 a, t dbSNP:121913514
2523 2523 c, t dbSNP:121913524
2533 2533 c, t dbSNP:141347955
2538 2538 a, g dbSNP:772311731
2545 2545 c, t dbSNP:773354518
2551 2551 a, g dbSNP:146992614
2564 2564 a, g dbSNP:121913509
2568 2568 a, g dbSNP:766430859
2580 2580 a, g dbSNP:147609111
2588 2588 a, c dbSNP:121913687
2589 2589 c, t dbSNP:752695117
2590 2590 a, g dbSNP:762912889
2595 2595 a, c dbSNP:763847901
2602 2602 c, t dbSNP:751396522
2603 2603 a, g dbSNP:555650901
2604 2604 c, t dbSNP:780998847
2611 2611 c, g dbSNP:750039813
2626 2626 c, t dbSNP:371058716
2633 2633 c, g dbSNP:779706462
2635 2635 c, g dbSNP:3733542
2648 2648 a, g dbSNP:761684550
2650 2650 a, c, g dbSNP:143074839
2661 2661 c, g dbSNP:755797225
2668 2668 g, t dbSNP:766036617
2670 2670 c, t dbSNP:753419764
2671 2671 a, c, g dbSNP:55817813
2674 2674 c, t dbSNP:748588125
2675 2675 a, g dbSNP:372795544
2677 2677 g, t dbSNP:778078182
2701 2701 g, t dbSNP:374440815
2710 2710 c, t dbSNP:771168804
2712 2712 a, g dbSNP:776681643
2719 2719 c, t dbSNP:745967881
2729 2729 c, t dbSNP:141126803
2732 2732 a, g dbSNP:774405431
2742 2742 a, c dbSNP:761840504
2746 2746 g, t dbSNP:769984428
2756 2756 a, g dbSNP:779966930
2777 2777 g, t dbSNP:190512512
2781 2781 a, c, t dbSNP:772159767
2785 2785 a, g dbSNP:761004820
2794 2794 a, t dbSNP:760873449
2806 2806 a, t dbSNP:770617877
2812 2812 c, t dbSNP:776411237
2839 2839 c, g dbSNP:759076549
2842 2842 c, t dbSNP:773363866
2846 2846 a, t dbSNP:764847795
2847 2847 a, g dbSNP:752222954
2850 2850 a, g dbSNP:762406098
2851 2851 c, t dbSNP:764592751
2854 2854 a, t dbSNP:72549296
2875 2875 c, g dbSNP:149932314
2876 2876 a, c, g dbSNP:756463331
2883 2883 a, g dbSNP:754097617
2885 2885 c, t dbSNP:139000082
2886 2886 c, g dbSNP:779103998
2896 2896 c, t dbSNP:56288823
2897 2897 a, g dbSNP:146374006
2899 2899 a, g dbSNP:781142513
2900 2900 a, g dbSNP:745651409
2915 2915 c, t dbSNP:587778433
2916 2916 a, g dbSNP:139694927
2918 2918 a, g dbSNP:748938919
2929 2929 c, t dbSNP:375833392
2930 2930 a, g dbSNP:773828910
2934 2934 a, g dbSNP:761339150
2935 2935 c, t dbSNP:767942133
2936 2936 a, g dbSNP:773709702
2938 2938 c, t dbSNP:200275681
2939 2939 a, g dbSNP:766845123
2941 2941 c, t dbSNP:578043962
2943 2943 c, t dbSNP:201185750
2946 2946 a, c dbSNP:765503364
2947 2947 c, t dbSNP:752748940
2948 2948 c, t dbSNP:758434265
2957 2957 c, t dbSNP:781007582
2960 2960 c, t dbSNP:745807112
2968 2968 c, t dbSNP:755974085
2969 2969 a, g dbSNP:72549297
2972 2972 a, g dbSNP:373152714
2973 2973 a, g dbSNP:768320570
2975 2975 a, g dbSNP:773955363
2977 2977 c, g dbSNP:182068450
2986 2986 a, g dbSNP:771597134
2989 2989 a, g dbSNP:773657951
2997 2997 a, g dbSNP:377596175
3000 3000 c, t dbSNP:766898265
3007 3007 c, t dbSNP:749502431
3025 3025 c, t dbSNP:777154782
3046 3046 g, t dbSNP:112972811
3065 3065 c, t dbSNP:541771331
3079 3079 a, g dbSNP:774300172
3092 3092 -, c dbSNP:141454480
3094 3094 c, t dbSNP:759680567
3110 3110 c, t dbSNP:561815817
3129 3129 c, t dbSNP:2213181
3149 3149 c, t dbSNP:540886606
3197 3197 a, g dbSNP:17084733
3216 3216 a, g dbSNP:761142396
3232 3232 g, t dbSNP:376694515
3269 3269 c, t dbSNP:569668395
3279 3279 c, g dbSNP:185479436
3294 3294 -, c dbSNP:542300014
3296 3296 -, c dbSNP:375297569
3332 3332 a, g dbSNP:149336515
3370 3370 a, g dbSNP:528891717
3406 3406 c, t dbSNP:750092746
3494 3494 a, c dbSNP:758036290
3506 3506 c, t dbSNP:779688131
3510 3510 a, g dbSNP:534199544
3577 3577 c, t dbSNP:746982052
3583 3583 c, g dbSNP:754924498
3645 3645 c, t dbSNP:566225251
3655 3655 c, t dbSNP:535289870
3656 3656 a, g dbSNP:558087775
3681 3681 a, g dbSNP:747912015
3688 3688 -, g dbSNP:772774569
3711 3711 a, g dbSNP:571459383
3714 3714 c, t dbSNP:769473001
3731 3731 c, t dbSNP:376257863
3770 3770 a, g dbSNP:189995563
3813 3813 a, g dbSNP:557023678
3819 3819 a, c, t dbSNP:183497667
3868 3868 c, t dbSNP:188598702
3891 3891 c, g dbSNP:553298726
3909 3909 a, g dbSNP:572274912
3910 3910 a, c dbSNP:547783802
3913 3913 g, t dbSNP:193129140
3922 3922 c, t dbSNP:553005135
3924 3924 c, g dbSNP:55799920
4040 4040 c, t dbSNP:747546874
4066 4066 c, t dbSNP:533152310
4067 4067 c, g dbSNP:144602457
4079 4079 a, g dbSNP:772182994
4129 4129 a, t dbSNP:577899786
4200 4200 c, t dbSNP:56372445
4214 4214 c, t dbSNP:184041614
4221 4221 a, g dbSNP:114377961
4237 4237 c, t dbSNP:761195357
4258 4258 a, g dbSNP:565640146
4282 4282 c, g dbSNP:528782307
4329 4329 c, t dbSNP:145007262
4340 4340 c, g dbSNP:571545423
4382 4382 a, g dbSNP:1799813
4408 4408 g, t dbSNP:537228504
4414 4414 c, t dbSNP:538534252
4426 4426 a, c dbSNP:147133269
4429 4429 g, t dbSNP:768670355
4435 4435 -, tacc dbSNP:765958252
4444 4444 -, aaaac dbSNP:558178243
4465 4465 -, aaaa dbSNP:374796688
4489 4489 c, t dbSNP:567439187
4490 4490 a, g dbSNP:773447284
4504 4504 a, g dbSNP:17084736
4536 4536 c, g dbSNP:779554258
4547 4547 a, g dbSNP:543517677
4555 4555 c, t dbSNP:561819471
4576 4576 a, g dbSNP:573912893
4609 4609 c, t dbSNP:748767060
4610 4610 a, g dbSNP:140416206
4644 4644 a, g dbSNP:573152330
4652 4652 a, g dbSNP:541644297
4675 4675 a, t dbSNP:534652006
4684 4684 g, t dbSNP:8022
4702 4702 c, t dbSNP:577939550
4714 4714 a, g dbSNP:776712217
4737 4737 c, t dbSNP:543627061
4746 4746 a, g dbSNP:533731213
4771 4771 a, g dbSNP:77842054
4773 4773 a, g dbSNP:576230887
4780 4780 a, g dbSNP:377361492
4785 4785 a, t dbSNP:573802115
4788 4788 a, g dbSNP:762662037
4814 4814 a, c, g dbSNP:186953545
4815 4815 c, t dbSNP:191473270
4830 4830 g, t dbSNP:528078215
4848 4848 c, t dbSNP:774038505
4874 4874 c, t dbSNP:747942024
4908 4908 -, t dbSNP:746428370
4919 4919 c, g dbSNP:754877866
4944 4944 a, g dbSNP:551832318
4949 4949 a, g dbSNP:563284298
4968 4968 c, t dbSNP:565225492
4985 4985 a, g dbSNP:531077997
4997 4997 c, t dbSNP:115028437
5036 5036 a, g dbSNP:567475861
5063 5063 c, t dbSNP:755986721
5109 5109 a, g dbSNP:777404145

Target ORF information:

RefSeq Version XM_005265742
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence: