Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


KRT1 keratin 1, type II [Homo sapiens (human)]

Gene Symbol KRT1
Entrez Gene ID 3848
Full Name keratin 1, type II
Synonyms CK1, EHK, EHK1, EPPK, K1, KRT1A, NEPPK
General protein information
Preferred Names
keratin, type II cytoskeletal 1
Names
keratin, type II cytoskeletal 1
CK-1
cytokeratin 1
cytokeratin-1
67 kDa cytokeratin
hair alpha protein
type-II keratin Kb1
epidermolytic hyperkeratosis 1
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

12

12q13.13

Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

139350

Disorder Html: Epidermolytic hyperkeratosis, 113800 (3); Ichthyosis, cyclic, with
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu19449 NM_006121 Homo sapiens keratin 1, type II (KRT1), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu19449D
Sequence Information ORF Nucleotide Sequence (Length: 1935bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product keratin, type II cytoskeletal 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff in collaboration with Michael Rogers. The reference sequence was derived from DB112126.1, BC063697.1 and AC055716.24. This sequence is a reference standard in the RefSeqGene project. On Dec 14, 2006 this sequence version replaced gi:17318568. Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the spinous and granular layers of the epidermis with family member KRT10 and mutations in these genes have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC063697.1, M10938.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2145893, SAMEA2147596 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
ATGAGTCGAC AGTTTAGTTC CAGGTCTGGG TACCGAAGTG GAGGGGGCTT CAGCTCTGGC 
TCTGCTGGGA TCATCAACTA CCAGCGCAGG ACCACCAGCA GCTCCACACG CCGCAGTGGA
GGAGGTGGTG GGAGATTTTC AAGCTGTGGT GGTGGTGGTG GTAGCTTTGG TGCTGGTGGT
GGATTTGGAA GTCGGAGTCT TGTTAACCTT GGTGGCAGTA AAAGCATCTC CATAAGTGTG
GCTAGAGGAG GTGGACGTGG TAGTGGCTTT GGTGGTGGTT ATGGTGGTGG TGGCTTTGGT
GGTGGTGGCT TTGGTGGTGG TGGCTTTGGT GGAGGTGGCA TTGGGGGTGG TGGCTTTGGT
GGTTTTGGCA GTGGTGGTGG TGGTTTTGGT GGAGGTGGCT TTGGGGGTGG TGGATATGGG
GGTGGTTATG GTCCTGTCTG CCCTCCTGGT GGCATACAAG AAGTCACTAT CAACCAGAGC
CTTCTTCAGC CCCTCAATGT GGAGATTGAC CCTGAGATCC AAAAGGTGAA GTCTCGAGAA
AGGGAGCAAA TCAAGTCACT CAACAACCAA TTTGCCTCCT TCATTGACAA GGTGAGGTTC
CTGGAGCAGC AGAACCAGGT ACTGCAAACA AAATGGGAGC TGCTGCAGCA GGTAGATACC
TCCACTAGAA CCCATAATTT AGAGCCCTAC TTTGAGTCAT TCATCAACAA TCTCCGAAGG
AGAGTGGACC AACTGAAGAG TGATCAATCT CGGTTGGATT CGGAACTGAA GAACATGCAG
GACATGGTGG AGGATTACCG GAACAAGTAT GAGGATGAAA TCAACAAGCG GACAAATGCA
GAGAATGAAT TTGTGACCAT CAAGAAGGAT GTGGATGGTG CTTATATGAC CAAGGTGGAC
CTTCAGGCCA AACTTGACAA CTTGCAGCAG GAAATTGATT TCCTTACAGC ACTCTACCAA
GCAGAGTTGT CTCAGATGCA GACTCAAATC AGTGAAACTA ATGTCATCCT CTCTATGGAC
AACAACCGCA GTCTCGACCT GGACAGCATC ATTGCTGAGG TCAAGGCCCA GTACGAGGAT
ATAGCCCAGA AGAGCAAAGC TGAGGCCGAG TCCTTGTACC AGAGCAAGTA TGAAGAGCTG
CAGATCACTG CTGGCAGACA TGGGGATAGT GTGAGAAATT CAAAGATAGA AATTTCTGAG
CTGAATCGTG TGATCCAGAG ACTTAGATCT GAAATCGACA ATGTCAAGAA GCAGATCTCC
AACTTGCAGC AGTCCATCAG TGATGCAGAG CAGCGTGGCG AGAATGCCCT CAAGGATGCC
AAGAACAAGC TGAATGACCT GGAGGATGCC CTGCAGCAGG CCAAGGAAGA CCTGGCCCGC
CTGCTGCGCG ACTACCAGGA GCTGATGAAC ACCAAGCTGG CCCTGGATCT GGAGATTGCC
ACCTACAGGA CCCTCCTGGA GGGAGAAGAA AGCAGGATGT CTGGAGAATG TGCCCCGAAC
GTGAGTGTGT CTGTGAGCAC AAGCCACACC ACCATCAGTG GAGGTGGCAG CCGAGGAGGT
GGCGGCGGTG GCTACGGCTC TGGAGGTAGC AGCTATGGCT CCGGAGGTGG TAGCTATGGT
TCTGGAGGTG GCGGCGGCGG CGGCCGTGGC AGCTATGGCT CCGGAGGTAG CAGCTACGGC
TCCGGAGGTG GCAGCTATGG CTCTGGAGGT GGCGGCGGCG GCCATGGCAG CTACGGCTCC
GGAAGCAGCA GTGGGGGCTA CAGAGGTGGC TCTGGAGGCG GCGGCGGCGG CAGCTCTGGC
GGCCGGGGCT CTGGCGGCGG GAGCTCTGGA GGCTCCATAG GAGGCCGGGG ATCCAGCTCT
GGGGGTGTCA AGTCCTCTGG TGGCAGTTCC AGCGTGAAGT TTGTTTCTAC CACTTATTCC
GGAGTAACCA GATAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_006112.3
CDS60..1994
Misc Feature(1)51..53(+)
Misc Feature(2)63..596(+)
Misc Feature(3)120..122(+)
Misc Feature(4)120..122(+)
Misc Feature(5)255..257(+)
Misc Feature(6)303..305(+)
Misc Feature(7)597..1535(+)
Misc Feature(8)597..1526(+)
Misc Feature(9)597..704(+)
Misc Feature(10)705..761(+)
Misc Feature(11)762..1037(+)
Misc Feature(12)885..887(+)
Misc Feature(13)1038..1109(+)
Misc Feature(14)1089..1091(+)
Misc Feature(15)1110..1526(+)
Misc Feature(16)1248..1463(+)
Misc Feature(17)1356..1358(+)
Misc Feature(18)1527..1991(+)
Exon (1)1..650
Gene:KRT1
Gene Synonym:
Exon (2)651..865
Gene:KRT1
Gene Synonym:
Exon (3)866..926
Gene:KRT1
Gene Synonym:
Exon (4)927..1022
Gene:KRT1
Gene Synonym:
Exon (5)1023..1187
Gene:KRT1
Gene Synonym:
Exon (6)1188..1313
Gene:KRT1
Gene Synonym:
Exon (7)1314..1534
Gene:KRT1
Gene Synonym:
Exon (8)1535..1569
Gene:KRT1
Gene Synonym:
Exon (9)1570..2451
Gene:KRT1
Gene Synonym:
Translation
Position Chain Variation Link
21 21 c, t dbSNP:765732197
22 22 c, t dbSNP:755336645
25 25 c, t dbSNP:754206965
31 31 a, g dbSNP:181130130
39 39 c, t dbSNP:189087382
42 42 a, g dbSNP:773926929
59 59 c, t dbSNP:763609085
66 66 a, c dbSNP:762401934
67 67 a, g dbSNP:775323304
69 69 c, g dbSNP:201712128
70 70 a, g dbSNP:745702313
76 76 a, g dbSNP:776478134
85 85 a, c dbSNP:770778354
86 86 c, t dbSNP:755364139
94 94 a, g dbSNP:747243738
95 95 a, g dbSNP:111907110
104 104 a, g dbSNP:549917182
105 105 a, g dbSNP:748686918
118 118 a, g dbSNP:368821072
118 118 -, g dbSNP:764160619
122 122 a, t dbSNP:142164771
134 134 c, t dbSNP:828367
137 137 c, t dbSNP:184313837
140 140 c, t dbSNP:780472245
141 141 a, c dbSNP:146155769
142 142 a, t dbSNP:536680291
144 144 c, t dbSNP:201494492
145 145 a, c, g dbSNP:752232489
148 148 c, g dbSNP:765150249
162 162 a, t dbSNP:759518011
163 163 a, c dbSNP:776371326
165 165 a, g dbSNP:770868243
166 166 c, t dbSNP:760503522
168 168 a, c, t dbSNP:769301639
169 169 a, c, g dbSNP:780600291
171 171 c, t dbSNP:779045977
172 172 a, g dbSNP:34787940
176 176 c, t dbSNP:749815868
181 181 a, g dbSNP:780491184
184 184 a, g, t dbSNP:750757560
191 191 c, g dbSNP:192498048
202 202 a, g dbSNP:750662698
203 203 c, t dbSNP:758035884
207 207 a, g dbSNP:549115760
208 208 a, g dbSNP:752219630
211 211 a, g dbSNP:137920159
217 217 a, g dbSNP:531100926
219 219 -, ggt dbSNP:774997021
221 221 -, ggt dbSNP:760465118
240 240 a, g dbSNP:753842056
242 242 a, g dbSNP:766385141
250 250 a, g dbSNP:760593492
252 252 c, t dbSNP:116444444
253 253 a, g dbSNP:552006414
257 257 c, t dbSNP:762098926
262 262 a, t dbSNP:774379558
280 280 a, t dbSNP:57977969
291 291 a, g dbSNP:149480015
311 311 g, t dbSNP:749289058
313 313 a, g dbSNP:138041295
315 315 a, c, t dbSNP:145256530
319 319 g, t dbSNP:781535448
324 324 a, g dbSNP:757500946
329 329 c, t dbSNP:747854771
338 338 c, t dbSNP:2741151
340 340 -, atg dbSNP:759221049
340 340 a, t dbSNP:2741152
341 341 c, t dbSNP:376901079
342 342 a, g dbSNP:778385632
343 343 a, g dbSNP:754553875
345 345 g, t dbSNP:753373623
361 361 c, g dbSNP:147840212
364 364 a, g dbSNP:756115415
368 368 c, t dbSNP:529661171
373 373 g, t dbSNP:146169155
377 377 a, t dbSNP:750491207
379 379 c, g dbSNP:767433585
389 389 g, t dbSNP:543980536
398 398 c, t dbSNP:761466372
406 406 -, g dbSNP:781403016
422 422 c, t dbSNP:575349300
429 429 a, t dbSNP:564926977
430 430 g, t dbSNP:545263441
435 435 g, t dbSNP:763145084
441 441 -, ggt dbSNP:747414857
441 441 g, t dbSNP:573159240
442 442 -, g dbSNP:145463787
443 443 -, ggt dbSNP:769208793
446 446 c, t dbSNP:553332826
447 447 g, t dbSNP:770355673
450 450 a, g dbSNP:746382167
453 453 c, g dbSNP:776744794
455 455 a, t dbSNP:527772807
458 458 c, t dbSNP:1050870
465 465 c, g dbSNP:771157757
466 466 a, g dbSNP:536619673
468 468 a, g, t dbSNP:573966604
474 474 c, t dbSNP:754745006
481 481 a, g dbSNP:749171770
485 485 c, t dbSNP:780136225
489 489 g, t dbSNP:557388955
492 492 c, t dbSNP:190219749
503 503 g, t dbSNP:575995078
511 511 a, g dbSNP:376128876
523 523 a, g, t dbSNP:57959072
530 530 c, t dbSNP:751192331
537 537 a, g dbSNP:764459131
541 541 c, t dbSNP:57695159
548 548 a, g dbSNP:763309701
551 551 c, t dbSNP:142821486
554 554 c, g dbSNP:775896673
555 555 a, t dbSNP:765714875
556 556 a, g dbSNP:148526002
558 558 a, g dbSNP:776654873
561 561 -, gagattgaccct dbSNP:267607423
567 567 -, gaccctgagatc dbSNP:267607426
586 586 c, t dbSNP:770940768
589 589 a, g dbSNP:146820668
590 590 g, t dbSNP:58381018
592 592 a, c dbSNP:757213853
594 594 c, t dbSNP:751668925
595 595 a, c, g dbSNP:59044845
603 603 a, c, g dbSNP:780043647
604 604 a, t dbSNP:769822663
606 606 a, c dbSNP:745830309
615 615 c, t dbSNP:60022878
618 618 c, t dbSNP:59151464
622 622 a, c, g dbSNP:58928370
623 623 a, c dbSNP:59429455
625 625 a, g dbSNP:765106863
630 630 a, t dbSNP:59022806
631 631 g, t dbSNP:58008716
632 632 g, t dbSNP:59208902
636 636 c, t dbSNP:60937700
647 647 c, t dbSNP:370368914
650 650 a, g dbSNP:756729273
655 655 c, g dbSNP:755344168
680 680 a, g dbSNP:543421466
682 682 c, t dbSNP:61616632
693 693 c, t dbSNP:766783845
696 696 a, g dbSNP:761610111
700 700 c, t dbSNP:61549035
707 707 a, g dbSNP:761294081
710 710 c, g dbSNP:201584652
712 712 c, t dbSNP:376472255
713 713 a, g dbSNP:143756169
714 714 g, t dbSNP:750248505
723 723 a, g dbSNP:774726631
740 740 a, g dbSNP:765055643
752 752 g, t dbSNP:267607429
757 757 c, t dbSNP:60297570
774 774 c, t dbSNP:759244867
775 775 a, g dbSNP:542753485
779 779 a, g dbSNP:1050871
788 788 c, t dbSNP:201069649
800 800 c, t dbSNP:56895471
810 810 c, g, t dbSNP:771587972
812 812 g, t dbSNP:747734601
816 816 g, t dbSNP:193921116
820 820 c, t dbSNP:372121916
821 821 a, g dbSNP:2741155
825 825 c, g dbSNP:749594645
830 830 g, t dbSNP:780507238
832 832 a, t dbSNP:75711771
836 836 a, g dbSNP:756537688
837 837 a, c dbSNP:149638013
838 838 a, g dbSNP:767646106
841 841 a, g dbSNP:757414670
846 846 g, t dbSNP:751753610
858 858 c, t dbSNP:369367702
859 859 a, g dbSNP:60359468
860 860 a, g dbSNP:763280898
862 862 a, g dbSNP:776254130
863 863 c, g dbSNP:766223854
868 868 a, c dbSNP:553703802
872 872 a, g, t dbSNP:767422813
875 875 c, t dbSNP:761779879
899 899 a, g dbSNP:773812331
923 923 a, g dbSNP:768234041
937 937 c, g dbSNP:772034356
938 938 g, t dbSNP:772515524
940 940 c, t dbSNP:377333980
949 949 a, c dbSNP:199852766
954 954 a, g dbSNP:755152518
956 956 a, g dbSNP:144631643
973 973 c, t dbSNP:754081965
980 980 a, c, t dbSNP:202173344
983 983 a, g dbSNP:200891005
984 984 a, c dbSNP:751420569
985 985 a, t dbSNP:374523527
990 990 c, g dbSNP:137853224
994 994 c, t dbSNP:758313016
1015 1015 a, g dbSNP:371171252
1024 1024 a, t dbSNP:754534920
1041 1041 a, t dbSNP:139428176
1045 1045 a, g dbSNP:369049651
1053 1053 g, t dbSNP:760448027
1060 1060 a, g dbSNP:773587262
1074 1074 a, g dbSNP:767794650
1075 1075 g, t dbSNP:762323767
1076 1076 g, t dbSNP:774724076
1078 1078 a, g, t dbSNP:58062863
1090 1090 a, g dbSNP:769218372
1094 1094 c, t dbSNP:192365492
1095 1095 a, g dbSNP:775594296
1105 1105 a, g dbSNP:769968882
1131 1131 a, t dbSNP:1050872
1133 1133 a, c, t dbSNP:150503977
1134 1134 a, c, g dbSNP:765763232
1137 1137 a, c, g dbSNP:267603525
1143 1143 a, g dbSNP:756951677
1147 1147 a, g dbSNP:374690429
1158 1158 a, g dbSNP:371260991
1160 1160 c, t dbSNP:755016557
1166 1166 c, t dbSNP:183980482
1167 1167 a, g dbSNP:779743242
1178 1178 c, t dbSNP:755745001
1179 1179 c, g dbSNP:539036763
1181 1181 a, g dbSNP:751317668
1183 1183 a, g dbSNP:767857580
1190 1190 c, t dbSNP:370545890
1196 1196 a, g dbSNP:141641507
1197 1197 c, t dbSNP:765291884
1203 1203 a, c dbSNP:759524757
1212 1212 a, g dbSNP:267603524
1222 1222 a, g dbSNP:752274562
1232 1232 a, g dbSNP:776823744
1246 1246 c, t dbSNP:771032423
1263 1263 a, g dbSNP:760991653
1264 1264 a, g dbSNP:774240159
1266 1266 c, t dbSNP:554536645
1274 1274 c, t dbSNP:534574954
1288 1288 a, c dbSNP:780136294
1293 1293 a, g dbSNP:769826994
1295 1295 c, t dbSNP:137978741
1299 1299 a, c dbSNP:780795028
1300 1300 a, g dbSNP:756819077
1309 1309 a, g dbSNP:746682524
1340 1340 c, t dbSNP:758099039
1343 1343 c, g, t dbSNP:117108628
1348 1348 a, t dbSNP:755394068
1352 1352 c, g, t dbSNP:369800756
1353 1353 c, t dbSNP:142781300
1354 1354 a, g dbSNP:373780324
1358 1358 c, t dbSNP:540928638
1362 1362 a, g, t dbSNP:767824181
1363 1363 a, t dbSNP:575075676
1364 1364 c, t dbSNP:775108154
1369 1369 c, t dbSNP:267607428
1373 1373 a, g dbSNP:757188013
1375 1375 a, g dbSNP:370833984
1377 1377 g, t dbSNP:759330692
1387 1387 a, t dbSNP:776631213
1405 1405 a, t dbSNP:770919748
1408 1408 c, g dbSNP:199877663
1409 1409 c, t dbSNP:772752175
1410 1410 c, t dbSNP:771675813
1419 1419 g, t dbSNP:17678945
1421 1421 c, t dbSNP:779092761
1428 1428 g, t dbSNP:377282465
1435 1435 -, cccgcctgctgcgcgactaccagg dbSNP:60447237
1435 1435 c, g dbSNP:749682564
1437 1437 c, g, t dbSNP:756735090
1438 1438 a, g, t dbSNP:777516621
1440 1440 c, t dbSNP:576064216
1446 1446 c, t dbSNP:757504428
1447 1447 a, g dbSNP:200254456
1448 1448 c, t dbSNP:936958
1449 1449 a, g dbSNP:372937607
1456 1456 a, g dbSNP:753630553
1458 1458 c, g dbSNP:766275736
1465 1465 c, t dbSNP:760639465
1467 1467 a, g dbSNP:772664250
1472 1472 a, c dbSNP:698170
1475 1475 g, t dbSNP:761306590
1482 1482 c, t dbSNP:774048256
1483 1483 c, t dbSNP:137853225
1491 1491 a, c, g dbSNP:59089201
1493 1493 g, t dbSNP:58949162
1494 1494 a, g, t dbSNP:61218439
1495 1495 c, t dbSNP:57837128
1500 1500 a, c dbSNP:59431558
1502 1502 a, c dbSNP:749643681
1504 1504 a, g dbSNP:58420087
1513 1513 c, t dbSNP:267607430
1516 1516 c, g, t dbSNP:56914602
1524 1524 a, g dbSNP:58773503
1527 1527 a, c, g dbSNP:60279707
1528 1528 a, g dbSNP:58453920
1541 1541 c, t dbSNP:181516749
1547 1547 -, a dbSNP:752594720
1548 1548 c, t dbSNP:758600681
1549 1549 g, t dbSNP:748334745
1552 1552 c, t dbSNP:779762831
1556 1556 a, g dbSNP:145112157
1559 1559 c, g, t dbSNP:767422677
1560 1560 a, g dbSNP:757184812
1565 1565 c, t dbSNP:34154891
1566 1566 c, g dbSNP:763533681
1568 1568 a, g dbSNP:140449947
1570 1570 c, t dbSNP:751464239
1571 1571 g, t dbSNP:763592514
1573 1573 g, t dbSNP:757838499
1576 1576 a, c, g, t dbSNP:759299240
1579 1579 a, c dbSNP:75007002
1586 1586 c, t dbSNP:371428130
1587 1587 a, g dbSNP:761181439
1594 1594 -, tca dbSNP:773834793
1597 1597 c, g dbSNP:201825026
1602 1602 a, g dbSNP:773592554
1603 1603 g, t dbSNP:772694214
1606 1606 c, g dbSNP:761859748
1615 1615 -, g dbSNP:58373389
1622 1622 c, g, t dbSNP:531290655
1626 1626 a, c, g dbSNP:749532294
1629 1629 -, ggctacggctctggaggtagcagctat dbSNP:58193503
1630 1630 c, g dbSNP:562141868
1633 1633 a, c dbSNP:570756048
1634 1634 c, t dbSNP:780981259
1635 1635 a, g dbSNP:770635994
1636 1636 g, t dbSNP:746888434
1639 1639 a, c dbSNP:777554472
1650 1650 a, g dbSNP:371732143
1652 1652 c, t dbSNP:560224672
1661 1661 c, t dbSNP:545434207
1662 1662 a, g dbSNP:752221066
1668 1668 a, gg dbSNP:59169454
1670 1670 c, g, t dbSNP:778594975
1676 1676 c, t dbSNP:754622806
1677 1677 a, g, t dbSNP:766125642
1679 1679 c, t dbSNP:750650700
1682 1682 c, t dbSNP:576516680
1687 1687 -, g dbSNP:57650413
1687 1687 g, t dbSNP:760938474
1691 1691 c, t dbSNP:750849977
1692 1692 a, g dbSNP:553480869
1695 1695 a, g dbSNP:762340514
1697 1697 c, t dbSNP:774367908
1698 1698 a, g, t dbSNP:763093448
1701 1701 -, ggc dbSNP:777065481
1701 1701 a, g dbSNP:775570636
1703 1703 -, ggcggc dbSNP:762443372
1704 1704 c, t dbSNP:770107423
1708 1708 a, g dbSNP:746754557
1709 1709 c, t dbSNP:11556631
1714 1714 a, t dbSNP:777661087
1715 1715 c, t dbSNP:772092407
1716 1716 -, ggctccggaggtagcagctac dbSNP:267607656
1719 1719 c, t dbSNP:748112160
1721 1721 c, t dbSNP:778502873
1722 1722 a, g dbSNP:754534861
1725 1725 a, c, g dbSNP:371843007
1728 1728 a, g dbSNP:77846840
1736 1736 -, cggctccg dbSNP:757513367
1736 1736 c, t dbSNP:11170232
1741 1741 -, cc dbSNP:779067226
1742 1742 c, t dbSNP:779551366
1746 1746 a, g dbSNP:370799361
1747 1747 -, g dbSNP:777651240
1752 1752 a, g dbSNP:199947827
1754 1754 c, t dbSNP:750715624
1762 1762 c, t dbSNP:554811847
1765 1765 a, g dbSNP:757702443
1775 1775 c, t dbSNP:752065084
1776 1776 a, c, g dbSNP:763002437
1783 1783 a, g dbSNP:775688638
1784 1784 c, t dbSNP:765344887
1794 1794 a, g dbSNP:772832274
1799 1799 c, t dbSNP:771998586
1800 1800 a, g dbSNP:748024312
1803 1803 a, g dbSNP:774418013
1810 1810 -, g dbSNP:267607425
1812 1812 g, t dbSNP:768764062
1821 1821 a, g dbSNP:60526003
1823 1823 a, c dbSNP:748720674
1825 1825 a, g dbSNP:537744449
1837 1837 a, g dbSNP:755676117
1838 1838 c, t dbSNP:745549570
1842 1842 a, c, g dbSNP:575648870
1848 1848 -, ggc dbSNP:762691398
1850 1850 -, ggc dbSNP:772701521
1852 1852 g, t dbSNP:757610672
1853 1853 c, t dbSNP:751974882
1858 1858 a, g dbSNP:764558253
1859 1859 c, t dbSNP:758984107
1860 1860 a, g dbSNP:558974183
1889 1889 a, g dbSNP:765379773
1893 1893 g, t dbSNP:539061896
1894 1894 c, g dbSNP:566942079
1896 1896 a, g, t dbSNP:547130332
1897 1897 g, t dbSNP:536813177
1898 1898 a, c dbSNP:567761398
1901 1901 a, c dbSNP:551202996
1902 1902 a, g, t dbSNP:531102420
1903 1903 -, g dbSNP:775992378
1905 1905 c, t dbSNP:766766361
1906 1906 a, g dbSNP:565272443
1909 1909 a, g dbSNP:773681302
1911 1911 a, t dbSNP:774332167
1912 1912 c, t dbSNP:768678476
1916 1916 c, g dbSNP:749274100
1919 1919 c, t dbSNP:774275654
1922 1922 a, g dbSNP:267603523
1924 1924 g, t dbSNP:774807927
1928 1928 c, g dbSNP:769349684
1935 1935 a, t dbSNP:200190157
1949 1949 a, c dbSNP:780806002
1953 1953 a, g dbSNP:532003323
1955 1955 a, g dbSNP:756948472
1957 1957 a, g dbSNP:14024
1962 1962 a, g dbSNP:778141439
1969 1969 c, t dbSNP:376915013
1971 1971 a, g, t dbSNP:140098565
1986 1986 a, g dbSNP:755073937
1988 1988 a, c dbSNP:754021727
2001 2001 a, g dbSNP:766678229
2018 2018 a, c dbSNP:761013022
2023 2023 c, g dbSNP:751354477
2026 2026 a, c dbSNP:763965680
2032 2032 -, c dbSNP:772710102
2032 2032 c, g dbSNP:762734951
2034 2034 g, t dbSNP:2741161
2069 2069 c, g dbSNP:781120307
2080 2080 a, g dbSNP:190720388
2085 2085 c, t dbSNP:560913567
2089 2089 a, g dbSNP:144520865
2111 2111 c, t dbSNP:185664060
2131 2131 c, t dbSNP:575585873
2159 2159 c, t dbSNP:771011268
2161 2161 a, g dbSNP:558912213
2195 2195 c, t dbSNP:1050886
2199 2199 c, t dbSNP:538998792
2201 2201 a, g dbSNP:573283510
2205 2205 c, t dbSNP:370272283
2206 2206 c, g dbSNP:553384515
2215 2215 c, t dbSNP:112275575
2224 2224 -, t dbSNP:35022771
2274 2274 a, c, t dbSNP:1050890
2290 2290 a, g dbSNP:567789290
2309 2309 a, t dbSNP:550879646
2326 2326 c, t dbSNP:746758950
2337 2337 a, t dbSNP:1050893
2338 2338 c, t dbSNP:11170231
2339 2339 a, t dbSNP:1050895
2346 2346 c, t dbSNP:556078160
2359 2359 g, t dbSNP:752451295
2377 2377 c, g dbSNP:571583064
2397 2397 a, t dbSNP:1050897
2400 2400 a, t dbSNP:778282944
2440 2440 c, t dbSNP:537759618

Target ORF information:

RefSeq Version NM_006121
Organism Homo sapiens (human)
Definition Homo sapiens keratin 1, type II (KRT1), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_006121

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
ATGAGTCGAC AGTTTAGTTC CAGGTCTGGG TACCGAAGTG GAGGGGGCTT CAGCTCTGGC 
TCTGCTGGGA TCATCAACTA CCAGCGCAGG ACCACCAGCA GCTCCACACG CCGCAGTGGA
GGAGGTGGTG GGAGATTTTC AAGCTGTGGT GGTGGTGGTG GTAGCTTTGG TGCTGGTGGT
GGATTTGGAA GTCGGAGTCT TGTTAACCTT GGTGGCAGTA AAAGCATCTC CATAAGTGTG
GCTAGAGGAG GTGGACGTGG TAGTGGCTTT GGTGGTGGTT ATGGTGGTGG TGGCTTTGGT
GGTGGTGGCT TTGGTGGTGG TGGCTTTGGT GGAGGTGGCA TTGGGGGTGG TGGCTTTGGT
GGTTTTGGCA GTGGTGGTGG TGGTTTTGGT GGAGGTGGCT TTGGGGGTGG TGGATATGGG
GGTGGTTATG GTCCTGTCTG CCCTCCTGGT GGCATACAAG AAGTCACTAT CAACCAGAGC
CTTCTTCAGC CCCTCAATGT GGAGATTGAC CCTGAGATCC AAAAGGTGAA GTCTCGAGAA
AGGGAGCAAA TCAAGTCACT CAACAACCAA TTTGCCTCCT TCATTGACAA GGTGAGGTTC
CTGGAGCAGC AGAACCAGGT ACTGCAAACA AAATGGGAGC TGCTGCAGCA GGTAGATACC
TCCACTAGAA CCCATAATTT AGAGCCCTAC TTTGAGTCAT TCATCAACAA TCTCCGAAGG
AGAGTGGACC AACTGAAGAG TGATCAATCT CGGTTGGATT CGGAACTGAA GAACATGCAG
GACATGGTGG AGGATTACCG GAACAAGTAT GAGGATGAAA TCAACAAGCG GACAAATGCA
GAGAATGAAT TTGTGACCAT CAAGAAGGAT GTGGATGGTG CTTATATGAC CAAGGTGGAC
CTTCAGGCCA AACTTGACAA CTTGCAGCAG GAAATTGATT TCCTTACAGC ACTCTACCAA
GCAGAGTTGT CTCAGATGCA GACTCAAATC AGTGAAACTA ATGTCATCCT CTCTATGGAC
AACAACCGCA GTCTCGACCT GGACAGCATC ATTGCTGAGG TCAAGGCCCA GTACGAGGAT
ATAGCCCAGA AGAGCAAAGC TGAGGCCGAG TCCTTGTACC AGAGCAAGTA TGAAGAGCTG
CAGATCACTG CTGGCAGACA TGGGGATAGT GTGAGAAATT CAAAGATAGA AATTTCTGAG
CTGAATCGTG TGATCCAGAG ACTTAGATCT GAAATCGACA ATGTCAAGAA GCAGATCTCC
AACTTGCAGC AGTCCATCAG TGATGCAGAG CAGCGTGGCG AGAATGCCCT CAAGGATGCC
AAGAACAAGC TGAATGACCT GGAGGATGCC CTGCAGCAGG CCAAGGAAGA CCTGGCCCGC
CTGCTGCGCG ACTACCAGGA GCTGATGAAC ACCAAGCTGG CCCTGGATCT GGAGATTGCC
ACCTACAGGA CCCTCCTGGA GGGAGAAGAA AGCAGGATGT CTGGAGAATG TGCCCCGAAC
GTGAGTGTGT CTGTGAGCAC AAGCCACACC ACCATCAGTG GAGGTGGCAG CCGAGGAGGT
GGCGGCGGTG GCTACGGCTC TGGAGGTAGC AGCTATGGCT CCGGAGGTGG TAGCTATGGT
TCTGGAGGTG GCGGCGGCGG CGGCCGTGGC AGCTATGGCT CCGGAGGTAG CAGCTACGGC
TCCGGAGGTG GCAGCTATGG CTCTGGAGGT GGCGGCGGCG GCCATGGCAG CTACGGCTCC
GGAAGCAGCA GTGGGGGCTA CAGAGGTGGC TCTGGAGGCG GCGGCGGCGG CAGCTCTGGC
GGCCGGGGCT CTGGCGGCGG GAGCTCTGGA GGCTCCATAG GAGGCCGGGG ATCCAGCTCT
GGGGGTGTCA AGTCCTCTGG TGGCAGTTCC AGCGTGAAGT TTGTTTCTAC CACTTATTCC
GGAGTAACCA GATAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.