Email to GenScript

KRT3 keratin 3, type II [Homo sapiens (human)]

Gene Symbol KRT3
Entrez Gene ID 3850
Full Name keratin 3, type II
Synonyms CK3, K3
General protein information
Preferred Names
keratin, type II cytoskeletal 3
keratin, type II cytoskeletal 3
cytokeratin 3
65 kDa cytokeratin
type-II keratin Kb3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the corneal epithelium with family member KRT12 and mutations in these genes have been associated with Meesmann's Corneal Dystrophy. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Meesmann corneal dystrophy, 122100 (3)

The following KRT3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the KRT3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu58653 XM_011538324 PREDICTED: Homo sapiens keratin 3, type II (KRT3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu17842 NM_057088 Homo sapiens keratin 3, type II (KRT3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu58653
Accession Version XM_011538324.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1527bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product keratin, type II cytoskeletal 3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)276..1223(+)
Misc Feature(2)831..1115(+)
Position Chain Variation Link
20 20 c, t dbSNP:568176561
30 30 c, t dbSNP:577049176
89 89 c, t dbSNP:113537575
104 104 c, t dbSNP:763858865
117 117 c, t dbSNP:191969299
124 124 c, t dbSNP:551586522
137 137 c, t dbSNP:187212166
145 145 c, t dbSNP:115816628
178 178 c, t dbSNP:371887543
179 179 a, g dbSNP:180905089
181 181 c, t dbSNP:535932653
187 187 c, t dbSNP:565384445
217 217 c, t dbSNP:546968025
232 232 a, c dbSNP:752720864
237 237 a, t dbSNP:373468680
238 238 a, g dbSNP:765083134
248 248 c, t dbSNP:369823813
249 249 a, g dbSNP:530962648
250 250 a, g dbSNP:766215196
251 251 a, c dbSNP:761012956
253 253 a, c dbSNP:773280213
257 257 c, g dbSNP:767671394
261 261 g, t dbSNP:761793034
274 274 c, g dbSNP:367755618
282 282 a, c, t dbSNP:138693059
283 283 a, g dbSNP:372506087
284 284 a, g dbSNP:368255227
288 288 c, t dbSNP:200301715
305 305 c, t dbSNP:777260706
308 308 a, c dbSNP:757996259
332 332 a, g dbSNP:187803154
333 333 a, g dbSNP:367741612
336 336 c, g, t dbSNP:199929228
337 337 a, g dbSNP:772977509
341 341 c, t dbSNP:771637745
347 347 a, g dbSNP:530075686
350 350 -, aca dbSNP:758088219
356 356 c, g dbSNP:200585096
368 368 a, g dbSNP:374170150
370 370 c, t dbSNP:768235565
374 374 c, g dbSNP:749273979
379 379 a, g, t dbSNP:756028659
380 380 c, t dbSNP:750195996
386 386 c, g dbSNP:780972888
393 393 c, g dbSNP:76767665
408 408 a, c dbSNP:368765001
411 411 c, t dbSNP:115512783
422 422 c, g dbSNP:762989962
433 433 c, t dbSNP:753269386
453 453 a, g dbSNP:765720975
454 454 a, g dbSNP:760032613
457 457 a, t dbSNP:776867988
458 458 c, t dbSNP:771288814
462 462 a, c, t dbSNP:201818737
463 463 a, c, g dbSNP:199804632
475 475 a, t dbSNP:779651067
476 476 c, g dbSNP:759079115
485 485 a, c, t dbSNP:745776578
486 486 c, g dbSNP:780870200
493 493 a, c, g dbSNP:377035034
498 498 c, t dbSNP:777967628
499 499 a, g dbSNP:376246180
505 505 a, g dbSNP:752789145
513 513 -, c dbSNP:778767371
518 518 a, g dbSNP:765235859
523 523 c, t dbSNP:373149040
541 541 a, g dbSNP:754325263
544 544 g, t dbSNP:766707883
563 563 g, t dbSNP:750818598
572 572 c, t dbSNP:182554932
574 574 a, c dbSNP:762715105
575 575 -, aaa dbSNP:777355637
576 576 c, t dbSNP:201121196
577 577 a, g, t dbSNP:759082203
578 578 c, t dbSNP:549689957
583 583 c, t dbSNP:369156432
585 585 g, t dbSNP:746882896
591 591 a, g dbSNP:201472315
593 593 a, t dbSNP:773024765
607 607 a, t dbSNP:191432292
615 615 a, g dbSNP:761596093
618 618 a, g dbSNP:773956344
624 624 a, g dbSNP:768922936
628 628 c, t dbSNP:199614200
638 638 c, t dbSNP:780202478
642 642 a, g dbSNP:769969871
644 644 a, g dbSNP:746415737
662 662 g, t dbSNP:114915149
666 666 a, g dbSNP:757754182
673 673 c, t dbSNP:114078275
683 683 c, t dbSNP:144405688
684 684 a, g dbSNP:754692663
704 704 c, t dbSNP:200246450
705 705 a, g dbSNP:765965552
707 707 c, t dbSNP:150031039
708 708 a, g dbSNP:750431445
714 714 a, c dbSNP:116142090
720 720 c, t dbSNP:776883053
731 731 a, c dbSNP:771087005
733 733 a, g dbSNP:369586403
736 736 c, t dbSNP:376324209
740 740 g, t dbSNP:772557576
743 743 c, t dbSNP:115678044
749 749 c, t dbSNP:779194928
750 750 g, t dbSNP:755791352
755 755 g, t dbSNP:745471703
761 761 c, t dbSNP:780726456
763 763 a, t dbSNP:780204542
765 765 g, t dbSNP:756688492
774 774 c, t dbSNP:751579090
775 775 a, g dbSNP:200973641
776 776 c, t dbSNP:4432093
787 787 a, c, t dbSNP:765075682
789 789 a, g, t dbSNP:200059777
793 793 a, g dbSNP:776960648
802 802 c, t dbSNP:766612920
803 803 c, t dbSNP:202245534
810 810 c, g, t dbSNP:3887954
819 819 c, t dbSNP:748644143
824 824 a, g dbSNP:774733153
825 825 c, g dbSNP:369084756
826 826 a, t dbSNP:766145049
828 828 a, g dbSNP:768981318
830 830 c, t dbSNP:745571194
831 831 a, g dbSNP:780811924
834 834 c, t dbSNP:756859222
835 835 a, t dbSNP:746507044
848 848 c, g, t dbSNP:374548119
849 849 a, g dbSNP:372108723
853 853 c, g dbSNP:765161937
855 855 a, g dbSNP:754796476
871 871 c, t dbSNP:754168931
876 876 c, t dbSNP:534142348
879 879 c, g dbSNP:748143077
880 880 -, ggg dbSNP:763264652
884 884 a, g dbSNP:569711834
892 892 a, c dbSNP:778979029
895 895 c, t dbSNP:200151587
896 896 a, g dbSNP:753687170
907 907 a, g dbSNP:779835862
911 911 a, g dbSNP:201333279
913 913 a, t dbSNP:750631850
914 914 a, t dbSNP:767546888
915 915 a, g dbSNP:761870119
927 927 a, g dbSNP:752128708
932 932 a, g dbSNP:764590850
935 935 c, t dbSNP:141642714
942 942 a, g dbSNP:775740479
943 943 c, t dbSNP:775629286
949 949 c, t dbSNP:770156064
952 952 a, t dbSNP:760285118
955 955 g, t dbSNP:772896965
964 964 a, g dbSNP:771537722
971 971 a, g dbSNP:148055325
972 972 c, t dbSNP:369797699
973 973 a, g dbSNP:768725246
983 983 a, c, t dbSNP:376783753
984 984 a, g dbSNP:61929765
986 986 a, g dbSNP:369576134
991 991 c, t dbSNP:781475306
1003 1003 a, g dbSNP:780794585
1005 1005 a, g dbSNP:757493731
1007 1007 c, t dbSNP:747192852
1014 1014 c, t dbSNP:148874235
1018 1018 c, t dbSNP:199625544
1019 1019 a, g, t dbSNP:373424785
1028 1028 a, c, t dbSNP:200194933
1029 1029 a, g dbSNP:371219499
1031 1031 a, g dbSNP:766797079
1033 1033 c, t dbSNP:761585201
1034 1034 a, c, t dbSNP:267603528
1035 1035 a, g dbSNP:189910350
1052 1052 a, g dbSNP:762523856
1054 1054 c, t dbSNP:774799529
1058 1058 c, t dbSNP:376658995
1066 1066 a, c dbSNP:745745104
1076 1076 a, g dbSNP:776442633
1082 1082 a, g dbSNP:770680735
1086 1086 c, t dbSNP:747280783
1088 1088 a, g dbSNP:369147846
1090 1090 a, t dbSNP:758539163
1091 1091 a, g dbSNP:748261838
1092 1092 a, g dbSNP:778798350
1097 1097 c, t dbSNP:374904266
1101 1101 c, t dbSNP:754256275
1102 1102 -, a dbSNP:750776553
1106 1106 g, t dbSNP:780618381
1108 1108 c, t dbSNP:201927015
1109 1109 a, g dbSNP:368969102
1115 1115 a, t dbSNP:763847196
1118 1118 a, c dbSNP:762457359
1122 1122 a, g dbSNP:752275565
1123 1123 c, t dbSNP:764612877
1124 1124 a, g dbSNP:201814725
1125 1125 c, t dbSNP:546099163
1126 1126 a, g dbSNP:770770484
1132 1132 c, t dbSNP:760457298
1134 1134 c, t dbSNP:372152150
1135 1135 -, gtgactac dbSNP:762376853
1135 1135 a, g dbSNP:772349450
1137 1137 a, g dbSNP:748267046
1140 1140 -, t dbSNP:765720147
1154 1154 a, g dbSNP:779076873
1156 1156 -, a dbSNP:559132133
1162 1162 a, g dbSNP:368503459
1168 1168 c, t dbSNP:749872046
1170 1170 c, g, t dbSNP:756624667
1172 1172 a, g dbSNP:376995818
1175 1175 c, t dbSNP:372122010
1176 1176 a, g dbSNP:200588015
1180 1180 a, t dbSNP:267607431
1184 1184 a, c, t dbSNP:764850228
1185 1185 a, g dbSNP:758956038
1187 1187 c, t dbSNP:753837561
1188 1188 a, t dbSNP:766306589
1194 1194 c, t dbSNP:760545335
1195 1195 a, c, g, t dbSNP:60410063
1199 1199 a, g dbSNP:771719628
1200 1200 c, t dbSNP:200542944
1202 1202 a, g, t dbSNP:375181234
1211 1211 c, t dbSNP:768851365
1212 1212 a, g dbSNP:57872071
1229 1229 a, t dbSNP:759683403
1235 1235 a, g dbSNP:776707045
1237 1237 a, g dbSNP:771353505
1240 1240 c, t dbSNP:761193909
1249 1249 c, t dbSNP:773478114
1253 1253 c, g dbSNP:370680022
1256 1256 c, g dbSNP:748984203
1259 1259 c, g dbSNP:777849989
1262 1262 a, g dbSNP:758342968
1267 1267 c, g dbSNP:752552174
1274 1274 c, t dbSNP:778801419
1278 1278 a, g dbSNP:373112698
1284 1284 g, t dbSNP:754055915
1294 1294 -, g dbSNP:35394995
1302 1302 a, c, g dbSNP:760792341
1305 1305 a, g dbSNP:369377430
1309 1309 a, g dbSNP:768028408
1314 1314 a, g dbSNP:762261001
1317 1317 a, g dbSNP:184297044
1318 1318 -, g dbSNP:768674767
1321 1321 g, t dbSNP:547164798
1327 1327 a, g dbSNP:759160741
1329 1329 g, t dbSNP:754068887
1339 1339 a, g dbSNP:770417155
1340 1340 a, g dbSNP:375197284
1344 1344 a, g dbSNP:772789743
1348 1348 g, t dbSNP:199840248
1357 1357 a, g dbSNP:367763143
1367 1367 a, g dbSNP:375768900
1375 1375 a, g dbSNP:754776557
1386 1386 c, g dbSNP:764554987
1397 1397 c, t dbSNP:372754733
1400 1400 a, c, g, t dbSNP:200112473
1406 1406 c, t dbSNP:564529238
1407 1407 a, g dbSNP:767549564
1409 1409 c, g, t dbSNP:752040729
1410 1410 -, gga dbSNP:760919182
1412 1412 a, t dbSNP:764424762
1415 1415 c, t dbSNP:763373640
1416 1416 -, a dbSNP:775731296
1416 1416 a, c, g dbSNP:766068025
1421 1421 -, ggcagcagcggtttcagcggt dbSNP:60125653
1421 1421 c, t dbSNP:756404541
1422 1422 g, t dbSNP:772879943
1430 1430 -, agc dbSNP:772316894
1430 1430 a, c dbSNP:771677354
1459 1459 c, t dbSNP:748142729
1465 1465 c, t dbSNP:552605707
1489 1489 a, g dbSNP:192685142
1493 1493 a, g dbSNP:563448110
1505 1505 a, g dbSNP:368606859
1515 1515 c, t dbSNP:574574001
1518 1518 a, g dbSNP:187547495
1520 1520 c, g dbSNP:540766728
1532 1532 a, g, t dbSNP:576534580
1589 1589 c, t dbSNP:80023802
1591 1591 c, t dbSNP:752126851
1593 1593 c, g dbSNP:764669583
1620 1620 a, t dbSNP:536664310
1635 1635 a, g dbSNP:575978168
1638 1638 a, g dbSNP:557400706
1658 1658 c, t dbSNP:182886024
1678 1678 g, t dbSNP:568713655
1725 1725 c, g dbSNP:547222330
1740 1740 a, t dbSNP:374806228
1744 1744 c, g dbSNP:772711495
1793 1793 c, t dbSNP:370099181
1825 1825 a, c dbSNP:150187400
1831 1831 a, g dbSNP:548155832
1837 1837 c, t dbSNP:140954861
1851 1851 a, g dbSNP:779944175
1868 1868 a, t dbSNP:563677613
1870 1870 c, t dbSNP:548232617
1908 1908 a, g dbSNP:190637355
1912 1912 a, g dbSNP:529990827

Target ORF information:

RefSeq Version XM_011538324
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens keratin 3, type II (KRT3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17842
Accession Version NM_057088.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1887bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product keratin, type II cytoskeletal 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff in collaboration with Michael Rogers. The reference sequence was derived from CV571376.1, AJ628418.1, AC107016.20 and BM672628.1. This sequence is a reference standard in the RefSeqGene project. On Jun 15, 2006 this sequence version replaced gi:17318571. Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the corneal epithelium with family member KRT12 and mutations in these genes have been associated with Meesmann's Corneal Dystrophy. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]. ##Evidence-Data-START## Transcript exon combination :: AJ628418.1, AK314987.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2156670 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)67..657(+)
Misc Feature(2)655..1602(+)
Misc Feature(3)658..1593(+)
Misc Feature(4)658..765(+)
Misc Feature(5)766..828(+)
Misc Feature(6)829..1104(+)
Misc Feature(7)1105..1176(+)
Misc Feature(8)1177..1593(+)
Misc Feature(9)1210..1494(+)
Misc Feature(10)1594..1950(+)
Exon (1)1..711
Gene Synonym:
Exon (2)712..932
Gene Synonym:
Exon (3)933..993
Gene Synonym:
Exon (4)994..1089
Gene Synonym:
Exon (5)1090..1254
Gene Synonym:
Exon (6)1255..1380
Gene Synonym:
Exon (7)1381..1601
Gene Synonym:
Exon (8)1602..1636
Gene Synonym:
Exon (9)1637..2310
Gene Synonym:
Position Chain Variation Link
18 18 g, t dbSNP:777166021
28 28 c, t dbSNP:766793910
43 43 c, g dbSNP:761183629
46 46 a, c dbSNP:773449878
49 49 c, t dbSNP:772439163
51 51 c, t dbSNP:146391233
52 52 a, g dbSNP:775260310
56 56 a, g dbSNP:535660288
59 59 g, t dbSNP:745366431
61 61 c, t dbSNP:781245712
71 71 a, g dbSNP:770789253
76 76 c, t dbSNP:746898698
92 92 c, t dbSNP:143951674
93 93 c, t dbSNP:758163988
99 99 c, t dbSNP:752970613
100 100 a, g dbSNP:546706676
105 105 c, g dbSNP:201738438
113 113 c, t dbSNP:753904849
115 115 c, t dbSNP:766412120
117 117 c, t dbSNP:200988929
118 118 a, g dbSNP:750889026
121 121 c, g, t dbSNP:570472655
122 122 a, g dbSNP:376108603
125 125 -, a dbSNP:755168656
132 132 a, g dbSNP:769553999
138 138 c, t dbSNP:759205102
139 139 a, g dbSNP:750421344
147 147 a, c dbSNP:770436470
157 157 c, t dbSNP:746942788
158 158 a, g dbSNP:777747344
159 159 c, t dbSNP:139995578
160 160 g, t dbSNP:747935399
161 161 a, t dbSNP:779168086
175 175 a, g dbSNP:267603529
179 179 c, g dbSNP:374910086
181 181 a, g dbSNP:202180550
182 182 a, g dbSNP:780016039
183 183 c, t dbSNP:372694149
184 184 a, g dbSNP:199902669
190 190 a, g dbSNP:768064246
194 194 a, g dbSNP:200847081
196 196 a, g dbSNP:751984274
197 197 c, g dbSNP:28721426
198 198 a, c dbSNP:759295134
199 199 g, t dbSNP:776298144
202 202 c, t dbSNP:368389807
203 203 a, g dbSNP:774042565
204 204 c, g dbSNP:377002190
207 207 c, t dbSNP:372128289
208 208 a, g dbSNP:370673258
212 212 a, c dbSNP:774159481
229 229 c, t dbSNP:768388285
230 230 a, g dbSNP:749517076
234 234 a, c dbSNP:780288321
243 243 -, ac dbSNP:746864354
248 248 a, g dbSNP:756214553
249 249 c, t dbSNP:368081511
250 250 a, g dbSNP:781360634
252 252 a, c dbSNP:757842242
264 264 a, c dbSNP:374767959
269 269 g, t dbSNP:201564104
271 271 a, g dbSNP:752074039
272 272 a, g dbSNP:199517745
273 273 c, t dbSNP:377156370
274 274 a, g dbSNP:150657845
285 285 a, c, g, t dbSNP:200878892
286 286 a, g dbSNP:557308178
290 290 c, t dbSNP:761759347
292 292 c, g, t dbSNP:762235173
293 293 a, g dbSNP:201539577
300 300 a, g dbSNP:202183688
307 307 c, g dbSNP:749103210
308 308 c, g dbSNP:552886568
309 309 a, g dbSNP:770066373
312 312 a, g dbSNP:746008638
316 316 c, t dbSNP:62617086
317 317 a, g dbSNP:757365353
318 318 a, g dbSNP:565144205
320 320 a, g dbSNP:200265010
321 321 c, t dbSNP:778394515
322 322 a, g dbSNP:758760315
323 323 c, g dbSNP:777324417
329 329 c, g dbSNP:200393349
330 330 c, t dbSNP:779092490
348 348 a, g dbSNP:755798352
349 349 a, g dbSNP:749992146
352 352 a, g dbSNP:767061040
354 354 c, t dbSNP:761277257
357 357 g, t dbSNP:751561509
358 358 g, t dbSNP:370707520
363 363 c, t dbSNP:148001170
364 364 a, g dbSNP:188384912
369 369 c, t dbSNP:376089191
371 371 -, g dbSNP:758370571
374 374 c, g dbSNP:112593469
374 374 c, g dbSNP:386420846
381 381 c, g, t dbSNP:111435734
381 381 g, t dbSNP:386420845
383 383 a, g dbSNP:759827934
394 394 g, t dbSNP:776973006
396 396 a, t dbSNP:201238000
398 398 a, g dbSNP:771174913
411 411 a, g dbSNP:747082128
417 417 c, t dbSNP:778486426
427 427 a, g dbSNP:369751855
430 430 -, gctggtggctttggaggg dbSNP:148531142
434 434 -, agctgg dbSNP:753369040
444 444 a, t dbSNP:147386788
447 447 a, g dbSNP:117364830
455 455 -, gctttgg dbSNP:763900382
462 462 -, aggggctggtggctttgg dbSNP:751183182
462 462 a, t dbSNP:142692092
463 463 c, g dbSNP:772649423
464 464 a, g dbSNP:748539153
465 465 g, t dbSNP:184322044
466 466 a, g dbSNP:779353916
467 467 a, c dbSNP:755273331
470 470 -, g dbSNP:774863763
472 472 -, gg dbSNP:763535092
473 473 a, g dbSNP:750112577
477 477 c, t dbSNP:780814236
483 483 g, t dbSNP:529558333
484 484 c, t dbSNP:568679352
487 487 c, g, t dbSNP:751083045
489 489 a, t dbSNP:376823412
492 492 c, t dbSNP:546888186
499 499 g, t dbSNP:752530123
502 502 -, tctggtggctttggtggg dbSNP:776677223
503 503 c, t dbSNP:373969603
509 509 g, t dbSNP:765130656
511 511 c, t dbSNP:759220498
515 515 g, t dbSNP:528639838
520 520 c, t dbSNP:771268574
529 529 c, t dbSNP:760924598
530 530 c, t dbSNP:773434743
531 531 a, g dbSNP:772009475
533 533 a, g dbSNP:748734269
540 540 -, t dbSNP:768932591
546 546 c, t dbSNP:373105115
551 551 g, t dbSNP:369008679
565 565 c, t dbSNP:769129039
569 569 c, g dbSNP:749636551
574 574 a, g dbSNP:780337762
576 576 g, t dbSNP:193011168
578 578 a, c dbSNP:746623368
595 595 -, ca dbSNP:747166456
604 604 c, t dbSNP:375736148
609 609 g, t dbSNP:757824527
611 611 a, c dbSNP:752720864
616 616 a, t dbSNP:373468680
617 617 a, g dbSNP:765083134
627 627 c, t dbSNP:369823813
628 628 a, g dbSNP:530962648
629 629 a, g dbSNP:766215196
630 630 a, c dbSNP:761012956
632 632 a, c dbSNP:773280213
636 636 c, g dbSNP:767671394
640 640 g, t dbSNP:761793034
653 653 c, g dbSNP:367755618
661 661 a, c, t dbSNP:138693059
662 662 a, g dbSNP:372506087
663 663 a, g dbSNP:368255227
667 667 c, t dbSNP:200301715
684 684 c, t dbSNP:777260706
687 687 a, c dbSNP:757996259
711 711 a, g dbSNP:187803154
712 712 a, g dbSNP:367741612
715 715 c, g, t dbSNP:199929228
716 716 a, g dbSNP:772977509
720 720 c, t dbSNP:771637745
726 726 a, g dbSNP:530075686
729 729 -, aca dbSNP:758088219
735 735 c, g dbSNP:200585096
747 747 a, g dbSNP:374170150
749 749 c, t dbSNP:768235565
753 753 c, g dbSNP:749273979
758 758 a, g, t dbSNP:756028659
759 759 c, t dbSNP:750195996
765 765 c, g dbSNP:780972888
772 772 c, g dbSNP:76767665
787 787 a, c dbSNP:368765001
790 790 c, t dbSNP:115512783
801 801 c, g dbSNP:762989962
812 812 c, t dbSNP:753269386
832 832 a, g dbSNP:765720975
833 833 a, g dbSNP:760032613
836 836 a, t dbSNP:776867988
837 837 c, t dbSNP:771288814
841 841 a, c, t dbSNP:201818737
842 842 a, c, g dbSNP:199804632
854 854 a, t dbSNP:779651067
855 855 c, g dbSNP:759079115
864 864 a, c, t dbSNP:745776578
865 865 c, g dbSNP:780870200
872 872 a, c, g dbSNP:377035034
877 877 c, t dbSNP:777967628
878 878 a, g dbSNP:376246180
884 884 a, g dbSNP:752789145
892 892 -, c dbSNP:778767371
897 897 a, g dbSNP:765235859
902 902 c, t dbSNP:373149040
920 920 a, g dbSNP:754325263
923 923 g, t dbSNP:766707883
942 942 g, t dbSNP:750818598
951 951 c, t dbSNP:182554932
953 953 a, c dbSNP:762715105
954 954 -, aaa dbSNP:777355637
955 955 c, t dbSNP:201121196
956 956 a, g, t dbSNP:759082203
957 957 c, t dbSNP:549689957
962 962 c, t dbSNP:369156432
964 964 g, t dbSNP:746882896
970 970 a, g dbSNP:201472315
972 972 a, t dbSNP:773024765
986 986 a, t dbSNP:191432292
994 994 a, g dbSNP:761596093
997 997 a, g dbSNP:773956344
1003 1003 a, g dbSNP:768922936
1007 1007 c, t dbSNP:199614200
1017 1017 c, t dbSNP:780202478
1021 1021 a, g dbSNP:769969871
1023 1023 a, g dbSNP:746415737
1041 1041 g, t dbSNP:114915149
1045 1045 a, g dbSNP:757754182
1052 1052 c, t dbSNP:114078275
1062 1062 c, t dbSNP:144405688
1063 1063 a, g dbSNP:754692663
1083 1083 c, t dbSNP:200246450
1084 1084 a, g dbSNP:765965552
1086 1086 c, t dbSNP:150031039
1087 1087 a, g dbSNP:750431445
1093 1093 a, c dbSNP:116142090
1099 1099 c, t dbSNP:776883053
1110 1110 a, c dbSNP:771087005
1112 1112 a, g dbSNP:369586403
1115 1115 c, t dbSNP:376324209
1119 1119 g, t dbSNP:772557576
1122 1122 c, t dbSNP:115678044
1128 1128 c, t dbSNP:779194928
1129 1129 g, t dbSNP:755791352
1134 1134 g, t dbSNP:745471703
1140 1140 c, t dbSNP:780726456
1142 1142 a, t dbSNP:780204542
1144 1144 g, t dbSNP:756688492
1153 1153 c, t dbSNP:751579090
1154 1154 a, g dbSNP:200973641
1155 1155 c, t dbSNP:4432093
1166 1166 a, c, t dbSNP:765075682
1168 1168 a, g, t dbSNP:200059777
1172 1172 a, g dbSNP:776960648
1181 1181 c, t dbSNP:766612920
1182 1182 c, t dbSNP:202245534
1189 1189 c, g, t dbSNP:3887954
1198 1198 c, t dbSNP:748644143
1203 1203 a, g dbSNP:774733153
1204 1204 c, g dbSNP:369084756
1205 1205 a, t dbSNP:766145049
1207 1207 a, g dbSNP:768981318
1209 1209 c, t dbSNP:745571194
1210 1210 a, g dbSNP:780811924
1213 1213 c, t dbSNP:756859222
1214 1214 a, t dbSNP:746507044
1227 1227 c, g, t dbSNP:374548119
1228 1228 a, g dbSNP:372108723
1232 1232 c, g dbSNP:765161937
1234 1234 a, g dbSNP:754796476
1250 1250 c, t dbSNP:754168931
1255 1255 c, t dbSNP:534142348
1258 1258 c, g dbSNP:748143077
1259 1259 -, ggg dbSNP:763264652
1263 1263 a, g dbSNP:569711834
1271 1271 a, c dbSNP:778979029
1274 1274 c, t dbSNP:200151587
1275 1275 a, g dbSNP:753687170
1286 1286 a, g dbSNP:779835862
1290 1290 a, g dbSNP:201333279
1292 1292 a, t dbSNP:750631850
1293 1293 a, t dbSNP:767546888
1294 1294 a, g dbSNP:761870119
1306 1306 a, g dbSNP:752128708
1311 1311 a, g dbSNP:764590850
1314 1314 c, t dbSNP:141642714
1321 1321 a, g dbSNP:775740479
1322 1322 c, t dbSNP:775629286
1328 1328 c, t dbSNP:770156064
1331 1331 a, t dbSNP:760285118
1334 1334 g, t dbSNP:772896965
1343 1343 a, g dbSNP:771537722
1350 1350 a, g dbSNP:148055325
1351 1351 c, t dbSNP:369797699
1352 1352 a, g dbSNP:768725246
1362 1362 a, c, t dbSNP:376783753
1363 1363 a, g dbSNP:61929765
1365 1365 a, g dbSNP:369576134
1370 1370 c, t dbSNP:781475306
1382 1382 a, g dbSNP:780794585
1384 1384 a, g dbSNP:757493731
1386 1386 c, t dbSNP:747192852
1393 1393 c, t dbSNP:148874235
1397 1397 c, t dbSNP:199625544
1398 1398 a, g, t dbSNP:373424785
1407 1407 a, c, t dbSNP:200194933
1408 1408 a, g dbSNP:371219499
1410 1410 a, g dbSNP:766797079
1412 1412 c, t dbSNP:761585201
1413 1413 a, c, t dbSNP:267603528
1414 1414 a, g dbSNP:189910350
1431 1431 a, g dbSNP:762523856
1433 1433 c, t dbSNP:774799529
1437 1437 c, t dbSNP:376658995
1445 1445 a, c dbSNP:745745104
1455 1455 a, g dbSNP:776442633
1461 1461 a, g dbSNP:770680735
1465 1465 c, t dbSNP:747280783
1467 1467 a, g dbSNP:369147846
1469 1469 a, t dbSNP:758539163
1470 1470 a, g dbSNP:748261838
1471 1471 a, g dbSNP:778798350
1476 1476 c, t dbSNP:374904266
1480 1480 c, t dbSNP:754256275
1481 1481 -, a dbSNP:750776553
1485 1485 g, t dbSNP:780618381
1487 1487 c, t dbSNP:201927015
1488 1488 a, g dbSNP:368969102
1494 1494 a, t dbSNP:763847196
1497 1497 a, c dbSNP:762457359
1501 1501 a, g dbSNP:752275565
1502 1502 c, t dbSNP:764612877
1503 1503 a, g dbSNP:201814725
1504 1504 c, t dbSNP:546099163
1505 1505 a, g dbSNP:770770484
1511 1511 c, t dbSNP:760457298
1513 1513 c, t dbSNP:372152150
1514 1514 -, gtgactac dbSNP:762376853
1514 1514 a, g dbSNP:772349450
1516 1516 a, g dbSNP:748267046
1519 1519 -, t dbSNP:765720147
1533 1533 a, g dbSNP:779076873
1535 1535 -, a dbSNP:559132133
1541 1541 a, g dbSNP:368503459
1547 1547 c, t dbSNP:749872046
1549 1549 c, g, t dbSNP:756624667
1551 1551 a, g dbSNP:376995818
1554 1554 c, t dbSNP:372122010
1555 1555 a, g dbSNP:200588015
1559 1559 a, t dbSNP:267607431
1563 1563 a, c, t dbSNP:764850228
1564 1564 a, g dbSNP:758956038
1566 1566 c, t dbSNP:753837561
1567 1567 a, t dbSNP:766306589
1573 1573 c, t dbSNP:760545335
1574 1574 a, c, g, t dbSNP:60410063
1578 1578 a, g dbSNP:771719628
1579 1579 c, t dbSNP:200542944
1581 1581 a, g, t dbSNP:375181234
1590 1590 c, t dbSNP:768851365
1591 1591 a, g dbSNP:57872071
1608 1608 a, t dbSNP:759683403
1614 1614 a, g dbSNP:776707045
1616 1616 a, g dbSNP:771353505
1619 1619 c, t dbSNP:761193909
1628 1628 c, t dbSNP:773478114
1632 1632 c, g dbSNP:370680022
1635 1635 c, g dbSNP:748984203
1638 1638 c, g dbSNP:777849989
1641 1641 a, g dbSNP:758342968
1646 1646 c, g dbSNP:752552174
1653 1653 c, t dbSNP:778801419
1657 1657 a, g dbSNP:373112698
1663 1663 g, t dbSNP:754055915
1673 1673 -, g dbSNP:35394995
1681 1681 a, c, g dbSNP:760792341
1684 1684 a, g dbSNP:369377430
1688 1688 a, g dbSNP:768028408
1693 1693 a, g dbSNP:762261001
1696 1696 a, g dbSNP:184297044
1697 1697 -, g dbSNP:768674767
1700 1700 g, t dbSNP:547164798
1706 1706 a, g dbSNP:759160741
1708 1708 g, t dbSNP:754068887
1718 1718 a, g dbSNP:770417155
1719 1719 a, g dbSNP:375197284
1723 1723 a, g dbSNP:772789743
1727 1727 g, t dbSNP:199840248
1736 1736 a, g dbSNP:367763143
1746 1746 a, g dbSNP:375768900
1754 1754 a, g dbSNP:754776557
1765 1765 c, g dbSNP:764554987
1776 1776 c, t dbSNP:372754733
1779 1779 a, c, g, t dbSNP:200112473
1785 1785 c, t dbSNP:564529238
1786 1786 a, g dbSNP:767549564
1788 1788 c, g, t dbSNP:752040729
1789 1789 -, gga dbSNP:760919182
1791 1791 a, t dbSNP:764424762
1794 1794 c, t dbSNP:763373640
1795 1795 -, a dbSNP:775731296
1795 1795 a, c, g dbSNP:766068025
1800 1800 -, ggcagcagcggtttcagcggt dbSNP:60125653
1800 1800 c, t dbSNP:756404541
1801 1801 g, t dbSNP:772879943
1809 1809 -, agc dbSNP:772316894
1809 1809 a, c dbSNP:771677354
1838 1838 c, t dbSNP:748142729
1844 1844 c, t dbSNP:552605707
1868 1868 a, g dbSNP:192685142
1872 1872 a, g dbSNP:563448110
1884 1884 a, g dbSNP:368606859
1894 1894 c, t dbSNP:574574001
1897 1897 a, g dbSNP:187547495
1899 1899 c, g dbSNP:540766728
1911 1911 a, g, t dbSNP:576534580
1968 1968 c, t dbSNP:80023802
1970 1970 c, t dbSNP:752126851
1972 1972 c, g dbSNP:764669583
1999 1999 a, t dbSNP:536664310
2014 2014 a, g dbSNP:575978168
2017 2017 a, g dbSNP:557400706
2037 2037 c, t dbSNP:182886024
2057 2057 g, t dbSNP:568713655
2104 2104 c, g dbSNP:547222330
2119 2119 a, t dbSNP:374806228
2123 2123 c, g dbSNP:772711495
2172 2172 c, t dbSNP:370099181
2204 2204 a, c dbSNP:150187400
2210 2210 a, g dbSNP:548155832
2216 2216 c, t dbSNP:140954861
2230 2230 a, g dbSNP:779944175
2247 2247 a, t dbSNP:563677613
2249 2249 c, t dbSNP:548232617
2287 2287 a, g dbSNP:190637355
2291 2291 a, g dbSNP:529990827

Target ORF information:

RefSeq Version NM_057088
Organism Homo sapiens (human)
Definition Homo sapiens keratin 3, type II (KRT3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.