
KRT10 cDNA ORF clone, Homo sapiens (human)

Gene Symbol KRT10
Entrez Gene ID 3858
Full Name keratin 10, type I
Synonyms BCIE, BIE, CK10, EHK, K10, KPP
General protein information
Preferred Names
keratin, type I cytoskeletal 10
keratin, type I cytoskeletal 10
cytokeratin 10
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Epidermolytic hyperkeratosis, 113800 (3); Ichthyosis, cyclic, with

mRNA and Protein(s)

mRNA Protein Name
XM_005257343 XP_005257400 keratin, type I cytoskeletal 10 isoform X1
NM_000421 NP_000412 keratin, type I cytoskeletal 10

hsa05150 Staphylococcus aureus infection


ID Name Evidence
GO:0005882 intermediate filament NAS
GO:0045095 keratin filament IEA


ID Name Evidence
GO:0005198 structural molecule activity TAS
GO:0005515 protein binding IPI
GO:0030280 structural constituent of epidermis NAS


ID Name Evidence
GO:0008544 epidermis development TAS
GO:0030855 epithelial cell differentiation IEA
GO:0071277 cellular response to calcium ion IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following KRT10 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the KRT10 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu50364 XM_005257343 PREDICTED: Homo sapiens keratin 10, type I (KRT10), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00
OHu19931 NM_000421 Homo sapiens keratin 10, type I (KRT10), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $439.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu50364
Accession Version XM_005257343.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1875bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product keratin, type I cytoskeletal 10 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530412175. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)466..1395(+)
Position Chain Variation Link
1 1 a, g, t dbSNP:112217004
2 2 a, g, t dbSNP:113279600
4 4 c, g dbSNP:112290614
15 15 c, t dbSNP:757830825
16 16 a, g dbSNP:564032826
32 32 c, t dbSNP:372303962
44 44 a, c, g dbSNP:142158041
77 77 a, g dbSNP:28411890
80 80 a, g dbSNP:146957992
81 81 c, t dbSNP:759837260
82 82 a, g dbSNP:754010566
87 87 a, c dbSNP:766349835
97 97 -, ggaggagga dbSNP:776957789
100 100 -, ggagga dbSNP:764555347
100 100 c, g dbSNP:761851864
102 102 -, gga dbSNP:766721577
103 103 -, gga dbSNP:148510452
104 104 a, g dbSNP:556262610
105 105 -, atg dbSNP:774072560
105 105 -, gga, ggagga dbSNP:544201299
105 105 a, c dbSNP:768461937
107 107 g, t dbSNP:544264740
112 112 a, g dbSNP:775260580
122 122 -, gag dbSNP:769845011
124 124 -, gag dbSNP:772927416
130 130 a, t dbSNP:141187850
131 131 c, t dbSNP:151149062
144 144 c, t dbSNP:776242983
149 149 a, g dbSNP:770303156
151 151 a, c dbSNP:747571094
153 153 a, t dbSNP:778362078
158 158 c, t dbSNP:142050024
161 161 c, t dbSNP:748594551
162 162 c, t dbSNP:149227921
163 163 c, g dbSNP:145403476
168 168 a, g dbSNP:150048434
176 176 c, g dbSNP:766514106
178 178 a, t dbSNP:772718519
181 181 a, g dbSNP:751529374
183 183 a, g dbSNP:534188261
186 186 g, t dbSNP:151143129
191 191 a, g dbSNP:146835683
194 194 a, g dbSNP:764984381
195 195 a, t dbSNP:200567513
196 196 a, g dbSNP:759260763
203 203 g, t dbSNP:776096107
207 207 c, t dbSNP:770483430
209 209 a, g dbSNP:374581207
212 212 c, g dbSNP:772848992
213 213 a, g dbSNP:772769268
217 217 a, t dbSNP:748627169
220 220 g, t dbSNP:779464426
223 223 a, g dbSNP:755259243
233 233 a, c, t dbSNP:780082291
248 248 a, g dbSNP:756224291
253 253 c, t dbSNP:750559702
255 255 c, t dbSNP:201089561
290 290 a, g dbSNP:117610737
297 297 c, t dbSNP:752590384
300 300 c, t dbSNP:765099902
302 302 -, g dbSNP:748149243
306 306 a, t dbSNP:759192704
335 335 c, g, t dbSNP:4261597
338 338 c, t dbSNP:114467326
339 339 c, t dbSNP:760366080
345 345 a, g dbSNP:141830953
348 348 a, c dbSNP:373769724
354 354 c, t dbSNP:762441858
355 355 a, g dbSNP:774951544
360 360 g, t dbSNP:769078179
369 369 c, t dbSNP:568147205
371 371 a, g dbSNP:371456379
372 372 c, t dbSNP:144138576
379 379 a, g dbSNP:546321678
381 381 a, c dbSNP:781280510
387 387 c, t dbSNP:757275527
390 390 a, g, t dbSNP:752641828
394 394 a, g dbSNP:568226045
397 397 c, t dbSNP:201879590
400 400 c, g dbSNP:754935101
404 404 g, t dbSNP:200060640
406 406 a, g dbSNP:267604859
408 408 c, t dbSNP:71371451
408 408 c, t dbSNP:386421210
409 409 -, ca dbSNP:780337653
409 409 a, g dbSNP:77919366
415 415 a, g dbSNP:750064098
419 419 a, g dbSNP:767159695
420 420 -, agg dbSNP:750486566
422 422 a, g dbSNP:761352015
424 424 a, t dbSNP:775004391
427 427 a, g dbSNP:769111194
434 434 -, tgg dbSNP:757729391
438 438 c, t dbSNP:1132252
447 447 c, t dbSNP:1132253
450 450 c, t dbSNP:1132254
458 458 c, t dbSNP:763494250
461 461 a, c dbSNP:563178579
462 462 c, t dbSNP:770154440
463 463 a, g dbSNP:146976249
482 482 c, g, t dbSNP:58901407
490 490 c, g dbSNP:61460100
493 493 a, c dbSNP:57784225
498 498 aa, cc dbSNP:60712939
498 498 a, c dbSNP:781330644
499 499 a, c, g, t dbSNP:58852768
500 500 a, c, g, t dbSNP:58075662
501 501 c, t dbSNP:747156157
502 502 c, t dbSNP:1132255
505 505 c, g dbSNP:59175042
507 507 c, t dbSNP:1132256
509 509 c, g dbSNP:754922060
511 511 g, t dbSNP:58414354
512 512 a, c dbSNP:58735429
514 514 -, ttggac dbSNP:56809156
514 514 c, t dbSNP:1132257
515 515 c, t dbSNP:60118264
516 516 a, g dbSNP:753787009
526 526 c, t dbSNP:779748369
527 527 a, g dbSNP:755924637
534 534 a, g dbSNP:750113513
547 547 c, t dbSNP:376239738
555 555 a, g dbSNP:761554643
568 568 a, g dbSNP:751078173
569 569 a, c dbSNP:542004758
574 574 c, t dbSNP:1132258
599 599 a, g dbSNP:1132259
603 603 a, c, g dbSNP:200118465
607 607 a, g dbSNP:142767279
608 608 a, g dbSNP:776973897
613 613 c, t dbSNP:771197683
614 614 a, g dbSNP:373319671
624 624 c, t dbSNP:200665804
630 630 c, t dbSNP:772155246
642 642 c, t dbSNP:757208661
643 643 a, c, g dbSNP:781203180
655 655 a, t dbSNP:755977583
659 659 a, c dbSNP:745725994
669 669 c, t dbSNP:773438081
672 672 a, g dbSNP:772058779
676 676 a, g dbSNP:748192517
677 677 c, g dbSNP:375333087
678 678 a, t dbSNP:1132260
684 684 c, t dbSNP:138435395
686 686 c, t dbSNP:200239146
693 693 c, g dbSNP:745768608
706 706 a, c, g dbSNP:532545866
708 708 c, t dbSNP:757069403
711 711 c, t dbSNP:746654245
713 713 a, c dbSNP:777413527
718 718 c, t dbSNP:371503347
723 723 a, g dbSNP:752306254
726 726 g, t dbSNP:368893029
737 737 c, g dbSNP:755521798
746 746 a, g dbSNP:559532458
749 749 a, g dbSNP:751780283
757 757 g, t dbSNP:764282663
758 758 c, t dbSNP:763058569
766 766 a, c dbSNP:775704094
767 767 a, g dbSNP:369473843
771 771 a, g dbSNP:373213430
772 772 a, t dbSNP:773096095
774 774 c, t dbSNP:185881153
775 775 a, g dbSNP:201691005
789 789 c, t dbSNP:150098320
792 792 c, t dbSNP:746058184
798 798 c, g dbSNP:781286801
800 800 a, g dbSNP:748865279
807 807 a, g dbSNP:779416729
809 809 c, t dbSNP:756695109
822 822 c, t dbSNP:140700628
834 834 c, t dbSNP:1132262
835 835 c, g dbSNP:781635464
840 840 a, g dbSNP:1132263
841 841 a, g dbSNP:373366688
842 842 a, c dbSNP:751835228
843 843 g, t dbSNP:764477110
845 845 c, t dbSNP:546231467
847 847 a, c dbSNP:201788518
851 851 c, t dbSNP:747004729
860 860 g, t dbSNP:752869217
863 863 c, g dbSNP:765197483
869 869 a, g dbSNP:200397191
875 875 c, g dbSNP:760695518
876 876 c, t dbSNP:201038946
879 879 c, t dbSNP:772976848
880 880 c, t dbSNP:767360709
881 881 a, t dbSNP:201886561
890 890 a, c dbSNP:61735162
892 892 c, t dbSNP:150918499
893 893 a, g dbSNP:1132264
897 897 a, g dbSNP:774132657
898 898 c, g dbSNP:768355740
901 901 a, g dbSNP:762627487
910 910 c, g dbSNP:1132265
916 916 c, t dbSNP:774945021
917 917 a, g dbSNP:752448327
930 930 c, t dbSNP:1132266
939 939 g, t dbSNP:145899611
959 959 c, t dbSNP:776191574
963 963 a, g dbSNP:771610197
968 968 c, t dbSNP:778720995
978 978 c, t dbSNP:747484535
987 987 a, g dbSNP:778310699
988 988 a, g dbSNP:758784021
990 990 c, t dbSNP:748417456
998 998 a, g dbSNP:778939209
1006 1006 c, t dbSNP:755227431
1008 1008 c, t dbSNP:753928278
1030 1030 c, t dbSNP:780085592
1033 1033 a, c, g dbSNP:371899202
1037 1037 a, g dbSNP:200563139
1039 1039 a, g dbSNP:140697702
1041 1041 c, t dbSNP:576538778
1044 1044 a, g dbSNP:752531072
1047 1047 c, g dbSNP:558183226
1048 1048 c, t dbSNP:759199635
1054 1054 a, t dbSNP:776041016
1078 1078 a, g dbSNP:749495943
1113 1113 c, t dbSNP:368573436
1125 1125 c, g dbSNP:563065404
1128 1128 g, t dbSNP:375113624
1140 1140 a, g dbSNP:536668934
1142 1142 a, g dbSNP:777754147
1148 1148 c, t dbSNP:758342043
1159 1159 c, g dbSNP:752483481
1163 1163 c, t dbSNP:765046809
1167 1167 a, c, g dbSNP:753489811
1172 1172 -, a dbSNP:762755782
1173 1173 c, g dbSNP:146855016
1179 1179 a, g dbSNP:768038386
1182 1182 a, g dbSNP:760198943
1185 1185 c, g dbSNP:371654347
1191 1191 a, c dbSNP:748075726
1213 1213 a, g dbSNP:778591878
1215 1215 a, g dbSNP:754741926
1225 1225 c, g dbSNP:753547366
1229 1229 a, g dbSNP:370955521
1236 1236 c, t dbSNP:368784181
1242 1242 c, g dbSNP:755819413
1245 1245 c, g dbSNP:750006944
1261 1261 c, g dbSNP:143780054
1269 1269 c, t dbSNP:762259235
1271 1271 c, t dbSNP:774876624
1278 1278 a, g dbSNP:140096582
1283 1283 a, t dbSNP:764382068
1287 1287 c, g dbSNP:763439214
1290 1290 a, g dbSNP:775815286
1291 1291 a, c, g dbSNP:1132268
1293 1293 c, g dbSNP:575691290
1297 1297 cg, ga dbSNP:59075499
1312 1312 g, t dbSNP:746054540
1313 1313 a, g dbSNP:763471840
1314 1314 aa, cc dbSNP:267607377
1314 1314 a, c dbSNP:387906640
1327 1327 g, t dbSNP:776722275
1331 1331 a, g dbSNP:770992466
1333 1333 c, t dbSNP:60035576
1338 1338 c, t dbSNP:748048161
1342 1342 a, g dbSNP:778841680
1347 1347 -, c dbSNP:267607379
1348 1348 a, g, t dbSNP:61434181
1358 1358 a, t dbSNP:58026994
1360 1360 a, g dbSNP:375567467
1365 1365 g, t dbSNP:779973990
1366 1366 a, g, t dbSNP:267607380
1370 1370 c, t dbSNP:62651994
1373 1373 a, c dbSNP:267607378
1374 1374 a, t dbSNP:750064320
1379 1379 a, g dbSNP:267607383
1381 1381 c, t dbSNP:370667058
1382 1382 a, g dbSNP:756736481
1384 1384 a, g dbSNP:1132269
1388 1388 c, t dbSNP:62651995
1389 1389 a, g dbSNP:775752746
1391 1391 c, t dbSNP:62652043
1397 1397 a, c, g dbSNP:764717506
1401 1401 c, g dbSNP:373723131
1403 1403 a, g dbSNP:775868370
1404 1404 a, g dbSNP:765546797
1412 1412 a, g dbSNP:773382605
1426 1426 a, g dbSNP:201994123
1427 1427 a, g dbSNP:763011311
1428 1428 a, c dbSNP:775514131
1430 1430 -, acgcggcgg dbSNP:776653814
1444 1444 c, g dbSNP:565976410
1446 1446 a, c dbSNP:745745648
1451 1451 a, c dbSNP:201343749
1455 1455 a, c dbSNP:553516730
1459 1459 a, g dbSNP:770653100
1466 1466 c, t dbSNP:746598944
1475 1475 a, g dbSNP:554064245
1476 1476 -, aag dbSNP:778345104
1481 1481 -, c dbSNP:587776817
1481 1481 a, c dbSNP:777365322
1483 1483 -, c dbSNP:267607382
1492 1492 c, t dbSNP:17855579
1493 1493 -, acggcggcg dbSNP:776367566
1501 1501 a, g dbSNP:753205769
1502 1502 g, t dbSNP:779461895
1504 1504 -, cac dbSNP:775234020
1505 1505 a, g dbSNP:747094685
1515 1515 -, agc dbSNP:746037860
1524 1524 a, c dbSNP:755466898
1525 1525 a, g dbSNP:754280270
1528 1528 c, t dbSNP:571434577
1531 1531 a, g dbSNP:766622228
1538 1538 -, gaag dbSNP:756625071
1540 1540 a, g dbSNP:760989177
1542 1542 c, t dbSNP:549985767
1544 1544 a, c, g dbSNP:767721911
1545 1545 c, t dbSNP:761920455
1546 1546 a, g dbSNP:774571151
1548 1548 -, c dbSNP:781659630
1548 1548 c, g dbSNP:765311191
1553 1553 a, g dbSNP:759357431
1554 1554 -, aagct dbSNP:755416862
1554 1554 a, c dbSNP:531054820
1557 1557 c, g, t dbSNP:770578877
1561 1561 -, ggcggcggct dbSNP:750039767
1561 1561 a, g dbSNP:746687989
1572 1572 c, t dbSNP:772784673
1575 1575 c, g dbSNP:771706679
1578 1578 c, t dbSNP:747712277
1579 1579 ggaagc, t dbSNP:267607385
1588 1588 a, g dbSNP:199819272
1593 1593 -, cg dbSNP:267607384
1602 1602 c, t dbSNP:755521518
1603 1603 a, g dbSNP:749719417
1608 1608 c, t dbSNP:780490580
1612 1612 a, g dbSNP:201576759
1621 1621 c, t dbSNP:756380270
1626 1626 g, t dbSNP:750666264
1630 1630 a, g dbSNP:184159044
1634 1634 g, t dbSNP:548605061
1635 1635 c, t dbSNP:751727025
1639 1639 a, g dbSNP:764225659
1642 1642 g, t dbSNP:759536459
1643 1643 a, g dbSNP:776373755
1645 1645 g, t dbSNP:766199650
1646 1646 c, g dbSNP:760452803
1647 1647 -, tacggg dbSNP:767238841
1647 1647 a, c, g dbSNP:771762056
1648 1648 -, ggcggcggc dbSNP:774196166
1650 1650 c, t dbSNP:529995365
1651 1651 a, g dbSNP:747769259
1654 1654 -, ggc dbSNP:759327325
1654 1654 a, g dbSNP:773883770
1655 1655 g, t dbSNP:768003171
1656 1656 a, c dbSNP:749819865
1658 1658 a, c dbSNP:780363296
1662 1662 a, c, g dbSNP:370288912
1665 1665 a, c, t dbSNP:368733857
1666 1666 a, g dbSNP:757582440
1668 1668 -, c dbSNP:769795211
1670 1670 -, gc dbSNP:781768887
1671 1671 -, agc dbSNP:748644147
1671 1671 a, c, t dbSNP:758343254
1673 1673 a, c dbSNP:752817112
1677 1677 c, t dbSNP:766282533
1679 1679 c, g dbSNP:760637749
1680 1680 a, c dbSNP:750260006
1683 1683 -, ggc dbSNP:763606740
1685 1685 g, t dbSNP:767261543
1689 1689 -, agc dbSNP:570343417
1692 1692 c, g dbSNP:761476507
1693 1693 a, g dbSNP:773935322
1696 1696 a, g dbSNP:768219717
1700 1700 a, g dbSNP:762441213
1707 1707 c, t dbSNP:775054659
1709 1709 g, t dbSNP:541291647
1712 1712 -, ggg dbSNP:376206308
1716 1716 -, agc, agctccggcggcggatacggcggcggcagc dbSNP:776920005
1717 1717 c, t dbSNP:746333926
1720 1720 a, g dbSNP:781705339
1721 1721 a, g dbSNP:771360650
1725 1725 a, c dbSNP:747237640
1730 1730 a, g dbSNP:777924779
1731 1731 c, t dbSNP:758631225
1733 1733 a, g dbSNP:752767462
1737 1737 c, g dbSNP:779021500
1739 1739 c, t dbSNP:756038496
1740 1740 c, t dbSNP:750311246
1741 1741 c, t dbSNP:767314552
1742 1742 c, g dbSNP:112018671
1746 1746 c, g dbSNP:761534405
1757 1757 g, t dbSNP:199785115
1760 1760 a, g dbSNP:763714641
1762 1762 -, gagt dbSNP:769261149
1767 1767 a, g dbSNP:762648481
1768 1768 c, t dbSNP:774891561
1769 1769 c, t dbSNP:769296740
1771 1771 a, g dbSNP:760129489
1772 1772 a, g dbSNP:372831544
1782 1782 a, g dbSNP:112189169
1787 1787 c, t dbSNP:771559057
1790 1790 a, g dbSNP:747435637
1793 1793 c, g dbSNP:778175365
1800 1800 g, t dbSNP:772222128
1803 1803 c, t dbSNP:199646609
1811 1811 a, g dbSNP:765945741
1815 1815 c, t dbSNP:79174420
1816 1816 a, g dbSNP:773713629
1823 1823 c, t dbSNP:767778057
1824 1824 c, g dbSNP:762305484
1829 1829 a, c dbSNP:774570582
1831 1831 a, g dbSNP:768920029
1846 1846 -, g dbSNP:758707466
1848 1848 a, g dbSNP:373917637
1850 1850 c, t dbSNP:71371449
1852 1852 a, g dbSNP:753614465
1857 1857 -, t dbSNP:748913729
1871 1871 c, t dbSNP:372649886
1873 1873 a, g dbSNP:12231
1902 1902 c, t dbSNP:117588718
1924 1924 a, g dbSNP:1132367
1934 1934 c, g dbSNP:141815199
1936 1936 c, t dbSNP:111849607
1955 1955 a, c dbSNP:112791986
1957 1957 a, g dbSNP:570136616
1967 1967 a, c dbSNP:538043316
1979 1979 c, t dbSNP:536665430
1985 1985 a, c dbSNP:763406735
1989 1989 c, t dbSNP:201389981
2007 2007 a, g dbSNP:547362688
2008 2008 g, t dbSNP:765574818
2056 2056 c, t dbSNP:570541533
2063 2063 c, t dbSNP:192578662
2119 2119 c, t dbSNP:112000562

Target ORF information:

RefSeq Version XM_005257343
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens keratin 10, type I (KRT10), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19931
Accession Version NM_000421.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1755bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product keratin, type I cytoskeletal 10
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CU455823.1, BC034697.1 and M77663.1. This sequence is a reference standard in the RefSeqGene project. On Aug 9, 2008 this sequence version replaced gi:40354191. Summary: This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC034697.1, M19156.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2145893, SAMEA2147596 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)27..461(+)
Misc Feature(2)72..74(+)
Misc Feature(3)150..152(+)
Misc Feature(4)459..1388(+)
Misc Feature(5)462..1394(+)
Misc Feature(6)462..569(+)
Misc Feature(7)570..632(+)
Misc Feature(8)633..908(+)
Misc Feature(9)909..977(+)
Misc Feature(10)978..1394(+)
Misc Feature(11)1395..1778(+)
Exon (1)1..653
Gene Synonym:
Exon (2)654..736
Gene Synonym:
Exon (3)737..893
Gene Synonym:
Exon (4)894..1055
Gene Synonym:
Exon (5)1056..1181
Gene Synonym:
Exon (6)1182..1399
Gene Synonym:
Exon (7)1400..1774
Gene Synonym:
Exon (8)1775..2140
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:757830825
9 9 a, g dbSNP:564032826
25 25 c, t dbSNP:372303962
37 37 a, c, g dbSNP:142158041
70 70 a, g dbSNP:28411890
73 73 a, g dbSNP:146957992
74 74 c, t dbSNP:759837260
75 75 a, g dbSNP:754010566
80 80 a, c dbSNP:766349835
90 90 -, ggaggagga dbSNP:776957789
93 93 -, ggagga dbSNP:764555347
93 93 c, g dbSNP:761851864
95 95 -, gga dbSNP:766721577
96 96 -, gga dbSNP:148510452
97 97 a, g dbSNP:556262610
98 98 -, atg dbSNP:774072560
98 98 -, gga, ggagga dbSNP:544201299
98 98 a, c dbSNP:768461937
100 100 g, t dbSNP:544264740
105 105 a, g dbSNP:775260580
115 115 -, gag dbSNP:769845011
117 117 -, gag dbSNP:772927416
123 123 a, t dbSNP:141187850
124 124 c, t dbSNP:151149062
137 137 c, t dbSNP:776242983
142 142 a, g dbSNP:770303156
144 144 a, c dbSNP:747571094
146 146 a, t dbSNP:778362078
151 151 c, t dbSNP:142050024
154 154 c, t dbSNP:748594551
155 155 c, t dbSNP:149227921
156 156 c, g dbSNP:145403476
161 161 a, g dbSNP:150048434
169 169 c, g dbSNP:766514106
171 171 a, t dbSNP:772718519
174 174 a, g dbSNP:751529374
176 176 a, g dbSNP:534188261
179 179 g, t dbSNP:151143129
184 184 a, g dbSNP:146835683
187 187 a, g dbSNP:764984381
188 188 a, t dbSNP:200567513
189 189 a, g dbSNP:759260763
196 196 g, t dbSNP:776096107
200 200 c, t dbSNP:770483430
202 202 a, g dbSNP:374581207
205 205 c, g dbSNP:772848992
206 206 a, g dbSNP:772769268
210 210 a, t dbSNP:748627169
213 213 g, t dbSNP:779464426
216 216 a, g dbSNP:755259243
226 226 a, c, t dbSNP:780082291
241 241 a, g dbSNP:756224291
246 246 c, t dbSNP:750559702
248 248 c, t dbSNP:201089561
283 283 a, g dbSNP:117610737
290 290 c, t dbSNP:752590384
293 293 c, t dbSNP:765099902
295 295 -, g dbSNP:748149243
299 299 a, t dbSNP:759192704
328 328 c, g, t dbSNP:4261597
331 331 c, t dbSNP:114467326
332 332 c, t dbSNP:760366080
338 338 a, g dbSNP:141830953
341 341 a, c dbSNP:373769724
347 347 c, t dbSNP:762441858
348 348 a, g dbSNP:774951544
353 353 g, t dbSNP:769078179
362 362 c, t dbSNP:568147205
364 364 a, g dbSNP:371456379
365 365 c, t dbSNP:144138576
372 372 a, g dbSNP:546321678
374 374 a, c dbSNP:781280510
380 380 c, t dbSNP:757275527
383 383 a, g, t dbSNP:752641828
387 387 a, g dbSNP:568226045
390 390 c, t dbSNP:201879590
393 393 c, g dbSNP:754935101
397 397 g, t dbSNP:200060640
399 399 a, g dbSNP:267604859
401 401 c, t dbSNP:71371451
401 401 c, t dbSNP:386421210
402 402 -, ca dbSNP:780337653
402 402 a, g dbSNP:77919366
408 408 a, g dbSNP:750064098
412 412 a, g dbSNP:767159695
413 413 -, agg dbSNP:750486566
415 415 a, g dbSNP:761352015
417 417 a, t dbSNP:775004391
420 420 a, g dbSNP:769111194
427 427 -, tgg dbSNP:757729391
431 431 c, t dbSNP:1132252
440 440 c, t dbSNP:1132253
443 443 c, t dbSNP:1132254
451 451 c, t dbSNP:763494250
454 454 a, c dbSNP:563178579
455 455 c, t dbSNP:770154440
456 456 a, g dbSNP:146976249
475 475 c, g, t dbSNP:58901407
483 483 c, g dbSNP:61460100
486 486 a, c dbSNP:57784225
491 491 aa, cc dbSNP:60712939
491 491 a, c dbSNP:781330644
492 492 a, c, g, t dbSNP:58852768
493 493 a, c, g, t dbSNP:58075662
494 494 c, t dbSNP:747156157
495 495 c, t dbSNP:1132255
498 498 c, g dbSNP:59175042
500 500 c, t dbSNP:1132256
502 502 c, g dbSNP:754922060
504 504 g, t dbSNP:58414354
505 505 a, c dbSNP:58735429
507 507 -, ttggac dbSNP:56809156
507 507 c, t dbSNP:1132257
508 508 c, t dbSNP:60118264
509 509 a, g dbSNP:753787009
519 519 c, t dbSNP:779748369
520 520 a, g dbSNP:755924637
527 527 a, g dbSNP:750113513
540 540 c, t dbSNP:376239738
548 548 a, g dbSNP:761554643
561 561 a, g dbSNP:751078173
562 562 a, c dbSNP:542004758
567 567 c, t dbSNP:1132258
592 592 a, g dbSNP:1132259
596 596 a, c, g dbSNP:200118465
600 600 a, g dbSNP:142767279
601 601 a, g dbSNP:776973897
606 606 c, t dbSNP:771197683
607 607 a, g dbSNP:373319671
617 617 c, t dbSNP:200665804
623 623 c, t dbSNP:772155246
635 635 c, t dbSNP:757208661
636 636 a, c, g dbSNP:781203180
648 648 a, t dbSNP:755977583
652 652 a, c dbSNP:745725994
662 662 c, t dbSNP:773438081
665 665 a, g dbSNP:772058779
669 669 a, g dbSNP:748192517
670 670 c, g dbSNP:375333087
671 671 a, t dbSNP:1132260
677 677 c, t dbSNP:138435395
679 679 c, t dbSNP:200239146
686 686 c, g dbSNP:745768608
699 699 a, c, g dbSNP:532545866
701 701 c, t dbSNP:757069403
704 704 c, t dbSNP:746654245
706 706 a, c dbSNP:777413527
711 711 c, t dbSNP:371503347
716 716 a, g dbSNP:752306254
719 719 g, t dbSNP:368893029
730 730 c, g dbSNP:755521798
739 739 a, g dbSNP:559532458
742 742 a, g dbSNP:751780283
750 750 g, t dbSNP:764282663
751 751 c, t dbSNP:763058569
759 759 a, c dbSNP:775704094
760 760 a, g dbSNP:369473843
764 764 a, g dbSNP:373213430
765 765 a, t dbSNP:773096095
767 767 c, t dbSNP:185881153
768 768 a, g dbSNP:201691005
782 782 c, t dbSNP:150098320
785 785 c, t dbSNP:746058184
791 791 c, g dbSNP:781286801
793 793 a, g dbSNP:748865279
800 800 a, g dbSNP:779416729
802 802 c, t dbSNP:756695109
815 815 c, t dbSNP:140700628
827 827 c, t dbSNP:1132262
828 828 c, g dbSNP:781635464
833 833 a, g dbSNP:1132263
834 834 a, g dbSNP:373366688
835 835 a, c dbSNP:751835228
836 836 g, t dbSNP:764477110
838 838 c, t dbSNP:546231467
840 840 a, c dbSNP:201788518
844 844 c, t dbSNP:747004729
853 853 g, t dbSNP:752869217
856 856 c, g dbSNP:765197483
862 862 a, g dbSNP:200397191
868 868 c, g dbSNP:760695518
869 869 c, t dbSNP:201038946
872 872 c, t dbSNP:772976848
873 873 c, t dbSNP:767360709
874 874 a, t dbSNP:201886561
883 883 a, c dbSNP:61735162
885 885 c, t dbSNP:150918499
886 886 a, g dbSNP:1132264
890 890 a, g dbSNP:774132657
891 891 c, g dbSNP:768355740
894 894 a, g dbSNP:762627487
903 903 c, g dbSNP:1132265
909 909 c, t dbSNP:774945021
910 910 a, g dbSNP:752448327
923 923 c, t dbSNP:1132266
932 932 g, t dbSNP:145899611
952 952 c, t dbSNP:776191574
956 956 a, g dbSNP:771610197
961 961 c, t dbSNP:778720995
971 971 c, t dbSNP:747484535
980 980 a, g dbSNP:778310699
981 981 a, g dbSNP:758784021
983 983 c, t dbSNP:748417456
991 991 a, g dbSNP:778939209
999 999 c, t dbSNP:755227431
1001 1001 c, t dbSNP:753928278
1023 1023 c, t dbSNP:780085592
1026 1026 a, c, g dbSNP:371899202
1030 1030 a, g dbSNP:200563139
1032 1032 a, g dbSNP:140697702
1034 1034 c, t dbSNP:576538778
1037 1037 a, g dbSNP:752531072
1040 1040 c, g dbSNP:558183226
1041 1041 c, t dbSNP:759199635
1047 1047 a, t dbSNP:776041016
1071 1071 a, g dbSNP:749495943
1106 1106 c, t dbSNP:368573436
1118 1118 c, g dbSNP:563065404
1121 1121 g, t dbSNP:375113624
1133 1133 a, g dbSNP:536668934
1135 1135 a, g dbSNP:777754147
1141 1141 c, t dbSNP:758342043
1152 1152 c, g dbSNP:752483481
1156 1156 c, t dbSNP:765046809
1160 1160 a, c, g dbSNP:753489811
1165 1165 -, a dbSNP:762755782
1166 1166 c, g dbSNP:146855016
1172 1172 a, g dbSNP:768038386
1175 1175 a, g dbSNP:760198943
1178 1178 c, g dbSNP:371654347
1184 1184 a, c dbSNP:748075726
1206 1206 a, g dbSNP:778591878
1208 1208 a, g dbSNP:754741926
1218 1218 c, g dbSNP:753547366
1222 1222 a, g dbSNP:370955521
1229 1229 c, t dbSNP:368784181
1235 1235 c, g dbSNP:755819413
1238 1238 c, g dbSNP:750006944
1254 1254 c, g dbSNP:143780054
1262 1262 c, t dbSNP:762259235
1264 1264 c, t dbSNP:774876624
1271 1271 a, g dbSNP:140096582
1276 1276 a, t dbSNP:764382068
1280 1280 c, g dbSNP:763439214
1283 1283 a, g dbSNP:775815286
1284 1284 a, c, g dbSNP:1132268
1286 1286 c, g dbSNP:575691290
1290 1290 cg, ga dbSNP:59075499
1305 1305 g, t dbSNP:746054540
1306 1306 a, g dbSNP:763471840
1307 1307 aa, cc dbSNP:267607377
1307 1307 a, c dbSNP:387906640
1320 1320 g, t dbSNP:776722275
1324 1324 a, g dbSNP:770992466
1326 1326 c, t dbSNP:60035576
1331 1331 c, t dbSNP:748048161
1335 1335 a, g dbSNP:778841680
1340 1340 -, c dbSNP:267607379
1341 1341 a, g, t dbSNP:61434181
1351 1351 a, t dbSNP:58026994
1353 1353 a, g dbSNP:375567467
1358 1358 g, t dbSNP:779973990
1359 1359 a, g, t dbSNP:267607380
1363 1363 c, t dbSNP:62651994
1366 1366 a, c dbSNP:267607378
1367 1367 a, t dbSNP:750064320
1372 1372 a, g dbSNP:267607383
1374 1374 c, t dbSNP:370667058
1375 1375 a, g dbSNP:756736481
1377 1377 a, g dbSNP:1132269
1381 1381 c, t dbSNP:62651995
1382 1382 a, g dbSNP:775752746
1384 1384 c, t dbSNP:62652043
1390 1390 a, c, g dbSNP:764717506
1394 1394 c, g dbSNP:373723131
1396 1396 a, g dbSNP:775868370
1397 1397 a, g dbSNP:765546797
1405 1405 a, g dbSNP:773382605
1419 1419 a, g dbSNP:201994123
1420 1420 a, g dbSNP:763011311
1421 1421 a, c dbSNP:775514131
1423 1423 -, acgcggcgg dbSNP:776653814
1437 1437 c, g dbSNP:565976410
1439 1439 a, c dbSNP:745745648
1444 1444 a, c dbSNP:201343749
1448 1448 a, c dbSNP:553516730
1452 1452 a, g dbSNP:770653100
1459 1459 c, t dbSNP:746598944
1468 1468 a, g dbSNP:554064245
1469 1469 -, aag dbSNP:778345104
1474 1474 -, c dbSNP:587776817
1474 1474 a, c dbSNP:777365322
1476 1476 -, c dbSNP:267607382
1485 1485 c, t dbSNP:17855579
1486 1486 -, acggcggcg dbSNP:776367566
1494 1494 a, g dbSNP:753205769
1495 1495 g, t dbSNP:779461895
1497 1497 -, cac dbSNP:775234020
1498 1498 a, g dbSNP:747094685
1508 1508 -, agc dbSNP:746037860
1517 1517 a, c dbSNP:755466898
1518 1518 a, g dbSNP:754280270
1521 1521 c, t dbSNP:571434577
1524 1524 a, g dbSNP:766622228
1531 1531 -, gaag dbSNP:756625071
1533 1533 a, g dbSNP:760989177
1535 1535 c, t dbSNP:549985767
1537 1537 a, c, g dbSNP:767721911
1538 1538 c, t dbSNP:761920455
1539 1539 a, g dbSNP:774571151
1541 1541 -, c dbSNP:781659630
1541 1541 c, g dbSNP:765311191
1546 1546 a, g dbSNP:759357431
1547 1547 -, aagct dbSNP:755416862
1547 1547 a, c dbSNP:531054820
1550 1550 c, g, t dbSNP:770578877
1554 1554 -, ggcggcggct dbSNP:750039767
1554 1554 a, g dbSNP:746687989
1565 1565 c, t dbSNP:772784673
1568 1568 c, g dbSNP:771706679
1571 1571 c, t dbSNP:747712277
1572 1572 ggaagc, t dbSNP:267607385
1581 1581 a, g dbSNP:199819272
1586 1586 -, cg dbSNP:267607384
1595 1595 c, t dbSNP:755521518
1596 1596 a, g dbSNP:749719417
1601 1601 c, t dbSNP:780490580
1605 1605 a, g dbSNP:201576759
1614 1614 c, t dbSNP:756380270
1619 1619 g, t dbSNP:750666264
1623 1623 a, g dbSNP:184159044
1627 1627 g, t dbSNP:548605061
1628 1628 c, t dbSNP:751727025
1632 1632 a, g dbSNP:764225659
1635 1635 g, t dbSNP:759536459
1636 1636 a, g dbSNP:776373755
1638 1638 g, t dbSNP:766199650
1639 1639 c, g dbSNP:760452803
1640 1640 -, tacggg dbSNP:767238841
1640 1640 a, c, g dbSNP:771762056
1641 1641 -, ggcggcggc dbSNP:774196166
1643 1643 c, t dbSNP:529995365
1644 1644 a, g dbSNP:747769259
1647 1647 -, ggc dbSNP:759327325
1647 1647 a, g dbSNP:773883770
1648 1648 g, t dbSNP:768003171
1649 1649 a, c dbSNP:749819865
1651 1651 a, c dbSNP:780363296
1655 1655 a, c, g dbSNP:370288912
1658 1658 a, c, t dbSNP:368733857
1659 1659 a, g dbSNP:757582440
1661 1661 -, c dbSNP:769795211
1663 1663 -, gc dbSNP:781768887
1664 1664 -, agc dbSNP:748644147
1664 1664 a, c, t dbSNP:758343254
1666 1666 a, c dbSNP:752817112
1670 1670 c, t dbSNP:766282533
1672 1672 c, g dbSNP:760637749
1673 1673 a, c dbSNP:750260006
1676 1676 -, ggc dbSNP:763606740
1678 1678 g, t dbSNP:767261543
1682 1682 -, agc dbSNP:570343417
1685 1685 c, g dbSNP:761476507
1686 1686 a, g dbSNP:773935322
1689 1689 a, g dbSNP:768219717
1693 1693 a, g dbSNP:762441213
1700 1700 c, t dbSNP:775054659
1702 1702 g, t dbSNP:541291647
1705 1705 -, ggg dbSNP:376206308
1709 1709 -, agc, agctccggcggcggatacggcggcggcagc dbSNP:776920005
1710 1710 c, t dbSNP:746333926
1713 1713 a, g dbSNP:781705339
1714 1714 a, g dbSNP:771360650
1718 1718 a, c dbSNP:747237640
1723 1723 a, g dbSNP:777924779
1724 1724 c, t dbSNP:758631225
1726 1726 a, g dbSNP:752767462
1730 1730 c, g dbSNP:779021500
1732 1732 c, t dbSNP:756038496
1733 1733 c, t dbSNP:750311246
1734 1734 c, t dbSNP:767314552
1735 1735 c, g dbSNP:112018671
1739 1739 c, g dbSNP:761534405
1750 1750 g, t dbSNP:199785115
1753 1753 a, g dbSNP:763714641
1755 1755 -, gagt dbSNP:769261149
1760 1760 a, g dbSNP:762648481
1761 1761 c, t dbSNP:774891561
1762 1762 c, t dbSNP:769296740
1764 1764 a, g dbSNP:760129489
1765 1765 a, g dbSNP:372831544
1776 1776 c, t dbSNP:199646609
1784 1784 a, g dbSNP:765945741
1788 1788 c, t dbSNP:79174420
1789 1789 a, g dbSNP:773713629
1796 1796 c, t dbSNP:767778057
1797 1797 c, g dbSNP:762305484
1802 1802 a, c dbSNP:774570582
1804 1804 a, g dbSNP:768920029
1819 1819 -, g dbSNP:758707466
1821 1821 a, g dbSNP:373917637
1823 1823 c, t dbSNP:71371449
1825 1825 a, g dbSNP:753614465
1830 1830 -, t dbSNP:748913729
1844 1844 c, t dbSNP:372649886
1846 1846 a, g dbSNP:12231
1875 1875 c, t dbSNP:117588718
1897 1897 a, g dbSNP:1132367
1907 1907 c, g dbSNP:141815199
1909 1909 c, t dbSNP:111849607
1928 1928 a, c dbSNP:112791986
1930 1930 a, g dbSNP:570136616
1940 1940 a, c dbSNP:538043316
1952 1952 c, t dbSNP:536665430
1958 1958 a, c dbSNP:763406735
1962 1962 c, t dbSNP:201389981
1980 1980 a, g dbSNP:547362688
1981 1981 g, t dbSNP:765574818
2029 2029 c, t dbSNP:570541533
2036 2036 c, t dbSNP:192578662
2092 2092 c, t dbSNP:112000562

Target ORF information:

RefSeq Version NM_000421
Organism Homo sapiens (human)
Definition Homo sapiens keratin 10, type I (KRT10), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
