
KRT18 cDNA ORF clone, Homo sapiens (human)

Gene Symbol KRT18
Entrez Gene ID 3875
Full Name keratin 18, type I
Synonyms CK-18, CYK18, K18
General protein information
Preferred Names
keratin, type I cytoskeletal 18
keratin, type I cytoskeletal 18
cytokeratin 18
cell proliferation-inducing protein 46
cell proliferation-inducing gene 46 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cirrhosis, cryptogenic (3); {Cirrhosis, noncryptogenic,

The following KRT18 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the KRT18 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26902 NM_199187 Homo sapiens keratin 18, type I (KRT18), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu26902 NM_000224 Homo sapiens keratin 18, type I (KRT18), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26902
Accession Version NM_199187.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1293bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 28-JUL-2015
Organism Homo sapiens (human)
Product keratin, type I cytoskeletal 18
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BG753529.1, CD106591.1, X12881.1 and BC000180.2. Summary: KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC000180.2, BC072017.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)73..306(+)
Misc Feature(2)73..75(+)
Misc Feature(3)88..90(+)
Misc Feature(4)97..99(+)
Misc Feature(5)106..108(+)
Misc Feature(6)112..114(+)
Misc Feature(7)121..123(+)
Misc Feature(8)157..159(+)
Misc Feature(9)157..159(+)
Misc Feature(10)160..162(+)
Misc Feature(11)160..162(+)
Misc Feature(12)169..171(+)
Misc Feature(13)169..171(+)
Misc Feature(14)193..195(+)
Misc Feature(15)214..216(+)
Misc Feature(16)220..222(+)
Misc Feature(17)226..228(+)
Misc Feature(18)226..228(+)
Misc Feature(19)226..228(+)
Misc Feature(20)226..228(+)
Misc Feature(21)226..228(+)
Misc Feature(22)247..249(+)
Misc Feature(23)262..264(+)
Misc Feature(24)262..264(+)
Misc Feature(25)277..1188(+)
Misc Feature(26)298..453(+)
Misc Feature(27)304..1236(+)
Misc Feature(28)307..1230(+)
Misc Feature(29)307..414(+)
Misc Feature(30)367..369(+)
Misc Feature(31)415..465(+)
Misc Feature(32)460..462(+)
Misc Feature(33)466..741(+)
Misc Feature(34)511..>939(+)
Misc Feature(35)598..600(+)
Misc Feature(36)742..813(+)
Misc Feature(37)781..786(+)
Misc Feature(38)781..783(+)
Misc Feature(39)781..783(+)
Misc Feature(40)781..783(+)
Misc Feature(41)796..1242(+)
Misc Feature(42)814..1230(+)
Misc Feature(43)880..882(+)
Misc Feature(44)973..975(+)
Misc Feature(45)982..984(+)
Misc Feature(46)1024..1026(+)
Misc Feature(47)1036..1038(+)
Misc Feature(48)1060..1062(+)
Misc Feature(49)1231..1359(+)
Misc Feature(50)1258..1260(+)
Misc Feature(51)1261..1263(+)
Misc Feature(52)1264..1266(+)
Misc Feature(53)1264..1266(+)
Misc Feature(54)1270..1272(+)
Misc Feature(55)1279..1281(+)
Misc Feature(56)1345..1347(+)
Exon (1)1..68
Gene Synonym:
Exon (2)69..486
Gene Synonym:
Exon (3)487..569
Gene Synonym:
Exon (4)570..726
Gene Synonym:
Exon (5)727..891
Gene Synonym:
Exon (6)892..1017
Gene Synonym:
Exon (7)1018..1241
Gene Synonym:
Exon (8)1242..1421
Gene Synonym:
Position Chain Variation Link
26 26 g, t dbSNP:115941399
64 64 c, g dbSNP:79477652
74 74 c, g dbSNP:369198778
75 75 c, t dbSNP:141170056
77 77 g, t dbSNP:756991398
80 80 c, g, t dbSNP:76301931
81 81 a, c dbSNP:769641289
89 89 a, c dbSNP:775547844
100 100 a, g dbSNP:748718547
102 102 a, c, t dbSNP:768280963
108 108 c, t dbSNP:761560727
109 109 c, t dbSNP:766809169
110 110 a, g dbSNP:777157164
111 111 a, c, g dbSNP:760023196
112 112 c, t dbSNP:753311520
117 117 a, g dbSNP:80354424
119 119 a, g dbSNP:79476176
120 120 a, c dbSNP:751717313
122 122 c, g dbSNP:147350452
126 126 a, c dbSNP:780920567
138 138 c, t dbSNP:141066547
142 142 c, g dbSNP:750200705
145 145 a, g dbSNP:78514003
146 146 c, t dbSNP:11551634
147 147 c, t dbSNP:755980643
148 148 c, t dbSNP:77825282
152 152 a, c, g dbSNP:74379840
153 153 a, g dbSNP:528903225
161 161 g, t dbSNP:374064321
163 163 g, t dbSNP:74953757
165 165 a, g dbSNP:778594717
171 171 a, c, t dbSNP:78343594
181 181 g, t dbSNP:77999286
183 183 c, t dbSNP:75380684
185 185 c, t dbSNP:771828609
186 186 c, t dbSNP:75174163
187 187 a, g dbSNP:773038025
190 190 a, g dbSNP:759814479
193 193 c, t dbSNP:770250195
196 196 a, c, g dbSNP:75441140
199 199 g, t dbSNP:763522746
203 203 c, g dbSNP:200221269
205 205 a, c, t dbSNP:760412718
210 210 c, t dbSNP:80004568
212 212 c, t dbSNP:761933454
217 217 c, t dbSNP:78479490
218 218 g, t dbSNP:11551633
229 229 c, t dbSNP:750714548
232 232 a, c dbSNP:78718957
233 233 c, g dbSNP:755849994
236 236 a, g dbSNP:76183244
238 238 g, t dbSNP:753674663
246 246 g, t dbSNP:76187914
249 249 c, t dbSNP:186267053
250 250 c, g dbSNP:779038487
253 253 a, g dbSNP:747629868
255 255 c, g dbSNP:771773665
262 262 -, accgggatagccgggggtctggca dbSNP:267607417
264 264 c, g dbSNP:79913669
265 265 c, g dbSNP:777553435
267 267 c, g dbSNP:562275591
270 270 a, g dbSNP:77364359
273 273 c, t dbSNP:769987846
274 274 a, g dbSNP:11551624
275 275 c, g dbSNP:532875586
276 276 a, g dbSNP:763320997
307 307 a, g dbSNP:199572098
309 309 a, g dbSNP:769130435
313 313 a, g dbSNP:774882680
321 321 a, g dbSNP:79346135
338 338 a, g dbSNP:11551641
344 344 c, t dbSNP:11551623
345 345 c, t dbSNP:761880219
346 346 c, t dbSNP:551257529
351 351 c, t dbSNP:386834224
363 363 g, t dbSNP:750541227
366 366 g, t dbSNP:760985349
374 374 a, t dbSNP:144926827
376 376 a, g dbSNP:61136606
378 378 c, g dbSNP:373362435
385 385 c, t dbSNP:11551638
386 386 g, t dbSNP:765260052
398 398 c, g dbSNP:752738391
399 399 c, t dbSNP:11551621
405 405 c, t dbSNP:757921931
406 406 c, t dbSNP:777429135
411 411 c, g dbSNP:11551637
412 412 c, t dbSNP:544079943
414 414 c, t dbSNP:746603354
415 415 c, t dbSNP:756957250
417 417 a, g dbSNP:780757814
423 423 a, c, g dbSNP:749637522
425 425 a, g dbSNP:147945345
436 436 g, t dbSNP:11551629
437 437 c, t dbSNP:748671089
439 439 a, g dbSNP:11551632
442 442 c, g dbSNP:772097116
447 447 g, t dbSNP:140324943
452 452 a, t dbSNP:57758506
456 456 c, t dbSNP:766588095
465 465 c, t dbSNP:776785712
478 478 a, t dbSNP:759391099
481 481 a, g dbSNP:766333046
492 492 a, c dbSNP:745911935
493 493 a, g dbSNP:770066827
498 498 c, t dbSNP:780414092
505 505 a, g dbSNP:749538159
506 506 a, g dbSNP:768434116
507 507 c, t dbSNP:370728079
515 515 a, g dbSNP:200694483
517 517 a, g dbSNP:59979366
519 519 c, g dbSNP:771870687
525 525 a, g dbSNP:773196623
536 536 a, g dbSNP:760161076
537 537 c, t dbSNP:765886766
538 538 a, g dbSNP:776198491
541 541 c, g, t dbSNP:553275094
542 542 a, g dbSNP:369948432
543 543 c, t dbSNP:78791501
550 550 a, g dbSNP:11551626
558 558 c, t dbSNP:77832070
561 561 c, t dbSNP:751029615
571 571 c, t dbSNP:17856017
581 581 a, t dbSNP:11551625
586 586 c, g dbSNP:758121818
587 587 c, g dbSNP:777576325
592 592 c, t dbSNP:746898922
594 594 c, t dbSNP:369743947
596 596 a, g dbSNP:781231306
600 600 c, t dbSNP:560230776
609 609 c, t dbSNP:769404929
612 612 c, t dbSNP:774948895
614 614 c, t dbSNP:762675185
625 625 c, t dbSNP:772530106
626 626 a, g dbSNP:773737254
636 636 c, t dbSNP:761174253
645 645 c, t dbSNP:11551628
646 646 a, g dbSNP:11170343
654 654 a, g dbSNP:115544685
668 668 a, g dbSNP:146788536
672 672 a, c dbSNP:11551622
677 677 g, t dbSNP:770760404
678 678 c, t dbSNP:752822458
689 689 a, g dbSNP:542816796
702 702 c, t dbSNP:758640175
720 720 c, t dbSNP:372594060
721 721 a, g dbSNP:375823747
725 725 a, g dbSNP:531597374
733 733 a, g dbSNP:760118857
736 736 a, g dbSNP:765181291
737 737 a, g dbSNP:752798433
745 745 a, g dbSNP:763059508
752 752 c, t dbSNP:764298430
758 758 c, g dbSNP:58472472
759 759 c, t dbSNP:756989570
768 768 a, g dbSNP:746247808
771 771 c, g, t dbSNP:781046733
772 772 a, g dbSNP:756101711
783 783 c, t dbSNP:779909524
789 789 a, c dbSNP:1049159
805 805 a, g dbSNP:748780372
816 816 a, g dbSNP:191325805
817 817 a, g dbSNP:778646111
827 827 a, g dbSNP:747804954
830 830 c, g, t dbSNP:11551642
831 831 c, t dbSNP:145578755
834 834 a, g dbSNP:777075457
840 840 c, t dbSNP:529125152
846 846 a, g dbSNP:770303417
850 850 c, t dbSNP:776044211
851 851 a, g dbSNP:57354642
858 858 c, g, t dbSNP:11551643
859 859 c, t dbSNP:774491952
860 860 a, g dbSNP:762129501
864 864 c, g dbSNP:767170853
867 867 a, g dbSNP:750214150
872 872 a, g dbSNP:755905707
876 876 a, g dbSNP:766324065
879 879 c, t dbSNP:753836752
893 893 c, t dbSNP:565940319
896 896 a, g dbSNP:61696408
910 910 c, g dbSNP:766276909
912 912 c, g dbSNP:753784493
913 913 g, t dbSNP:754985586
923 923 a, g dbSNP:59112368
945 945 g, t dbSNP:141750671
949 949 a, g dbSNP:757912166
951 951 a, g dbSNP:150137089
953 953 c, t dbSNP:267607418
954 954 a, g dbSNP:756436730
959 959 c, t dbSNP:115810585
968 968 c, g dbSNP:749749094
969 969 a, t dbSNP:11551636
974 974 c, t dbSNP:769132516
982 982 c, t dbSNP:779439842
991 991 a, t dbSNP:748258071
993 993 c, t dbSNP:149270992
994 994 a, g dbSNP:199930351
1003 1003 c, t dbSNP:760836025
1017 1017 a, g dbSNP:548315492
1039 1039 a, c dbSNP:569786087
1043 1043 a, g dbSNP:554733127
1056 1056 c, t dbSNP:371513958
1057 1057 c, t dbSNP:147365823
1058 1058 a, g dbSNP:755405944
1062 1062 c, t dbSNP:58138700
1063 1063 a, g dbSNP:748604274
1066 1066 c, t dbSNP:772147091
1071 1071 c, g dbSNP:11542066
1073 1073 g, t dbSNP:777734597
1081 1081 c, t dbSNP:11551635
1086 1086 c, t dbSNP:372449912
1087 1087 a, g dbSNP:57370769
1105 1105 a, g dbSNP:143380812
1107 1107 a, g dbSNP:576288276
1125 1125 c, g dbSNP:759391003
1127 1127 a, g dbSNP:769726300
1130 1130 a, c dbSNP:543607490
1142 1142 a, g dbSNP:762831521
1148 1148 c, t dbSNP:763612705
1155 1155 a, g dbSNP:144702029
1173 1173 c, t dbSNP:761354945
1179 1179 a, g dbSNP:767157107
1186 1186 c, g dbSNP:17467
1190 1190 a, g dbSNP:750137340
1194 1194 g, t dbSNP:755264854
1200 1200 a, c dbSNP:765547912
1201 1201 a, g dbSNP:753197079
1211 1211 a, g dbSNP:147541172
1213 1213 a, c, t dbSNP:11551627
1214 1214 a, g dbSNP:770506633
1218 1218 a, g dbSNP:747053055
1229 1229 a, g dbSNP:757469736
1230 1230 c, t dbSNP:781505728
1231 1231 a, g dbSNP:746093574
1240 1240 a, c dbSNP:769672516
1256 1256 c, t dbSNP:781454348
1273 1273 a, g dbSNP:746040565
1296 1296 c, g dbSNP:756269928
1297 1297 a, c dbSNP:1063607
1298 1298 c, t dbSNP:780366176
1299 1299 c, g dbSNP:386834225
1300 1300 c, t dbSNP:768557036
1301 1301 a, g dbSNP:148580152
1303 1303 c, t dbSNP:774101880
1304 1304 a, g dbSNP:146080391
1305 1305 a, g, t dbSNP:142940942
1316 1316 a, g dbSNP:771518602
1321 1321 g, t dbSNP:772684603
1323 1323 g, t dbSNP:760216239
1325 1325 a, t dbSNP:765942310
1337 1337 a, g dbSNP:200552337
1351 1351 a, c, t dbSNP:709170
1352 1352 c, t dbSNP:763169289
1359 1359 c, t dbSNP:764524275
1362 1362 a, g dbSNP:752072208
1364 1364 c, g dbSNP:762433427
1365 1365 c, t dbSNP:768188540
1376 1376 -, g dbSNP:764567917
1377 1377 g, t dbSNP:750501631
1384 1384 c, t dbSNP:756285868
1387 1387 g, t dbSNP:780129356
1389 1389 a, g dbSNP:377238570
1390 1390 a, g dbSNP:754667202
1392 1392 a, g dbSNP:754273472
1403 1403 a, g dbSNP:778697666

Target ORF information:

RefSeq Version NM_199187
Organism Homo sapiens (human)
Definition Homo sapiens keratin 18, type I (KRT18), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26902
Accession Version NM_000224.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1293bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 28-JUL-2015
Organism Homo sapiens (human)
Product keratin, type I cytoskeletal 18
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CD106591.1, X12881.1 and BC000180.2. This sequence is a reference standard in the RefSeqGene project. On Dec 24, 2003 this sequence version replaced gi:4557887. Summary: KRT18 encodes the type I intermediate filament chain keratin 18. Keratin 18, together with its filament partner keratin 8, are perhaps the most commonly found members of the intermediate filament gene family. They are expressed in single layer epithelial tissues of the body. Mutations in this gene have been linked to cryptogenic cirrhosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 both encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK223093.1, BC072017.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)119..352(+)
Misc Feature(2)119..121(+)
Misc Feature(3)134..136(+)
Misc Feature(4)143..145(+)
Misc Feature(5)152..154(+)
Misc Feature(6)158..160(+)
Misc Feature(7)167..169(+)
Misc Feature(8)203..205(+)
Misc Feature(9)203..205(+)
Misc Feature(10)206..208(+)
Misc Feature(11)206..208(+)
Misc Feature(12)215..217(+)
Misc Feature(13)215..217(+)
Misc Feature(14)239..241(+)
Misc Feature(15)260..262(+)
Misc Feature(16)266..268(+)
Misc Feature(17)272..274(+)
Misc Feature(18)272..274(+)
Misc Feature(19)272..274(+)
Misc Feature(20)272..274(+)
Misc Feature(21)272..274(+)
Misc Feature(22)293..295(+)
Misc Feature(23)308..310(+)
Misc Feature(24)308..310(+)
Misc Feature(25)323..1234(+)
Misc Feature(26)344..499(+)
Misc Feature(27)350..1282(+)
Misc Feature(28)353..1276(+)
Misc Feature(29)353..460(+)
Misc Feature(30)413..415(+)
Misc Feature(31)461..511(+)
Misc Feature(32)506..508(+)
Misc Feature(33)512..787(+)
Misc Feature(34)557..>985(+)
Misc Feature(35)644..646(+)
Misc Feature(36)788..859(+)
Misc Feature(37)827..832(+)
Misc Feature(38)827..829(+)
Misc Feature(39)827..829(+)
Misc Feature(40)827..829(+)
Misc Feature(41)842..1288(+)
Misc Feature(42)860..1276(+)
Misc Feature(43)926..928(+)
Misc Feature(44)1019..1021(+)
Misc Feature(45)1028..1030(+)
Misc Feature(46)1070..1072(+)
Misc Feature(47)1082..1084(+)
Misc Feature(48)1106..1108(+)
Misc Feature(49)1277..1405(+)
Misc Feature(50)1304..1306(+)
Misc Feature(51)1307..1309(+)
Misc Feature(52)1310..1312(+)
Misc Feature(53)1310..1312(+)
Misc Feature(54)1316..1318(+)
Misc Feature(55)1325..1327(+)
Misc Feature(56)1391..1393(+)
Exon (1)1..532
Gene Synonym:
Exon (2)533..615
Gene Synonym:
Exon (3)616..772
Gene Synonym:
Exon (4)773..937
Gene Synonym:
Exon (5)938..1063
Gene Synonym:
Exon (6)1064..1287
Gene Synonym:
Exon (7)1288..1467
Gene Synonym:
Position Chain Variation Link
2 2 c, t dbSNP:574125666
30 30 g, t dbSNP:7978102
62 62 a, c dbSNP:368939913
65 65 c, t dbSNP:372353986
68 68 c, t dbSNP:758566910
75 75 c, t dbSNP:545237524
76 76 a, g dbSNP:376817240
80 80 a, g dbSNP:200298277
84 84 c, t dbSNP:199517515
89 89 c, t dbSNP:745822356
90 90 c, t dbSNP:373418568
91 91 a, t dbSNP:774897980
92 92 a, g dbSNP:762618085
93 93 c, t dbSNP:763632933
94 94 -, ctttct dbSNP:779623179
95 95 c, g dbSNP:774095001
97 97 c, t dbSNP:201934812
98 98 -, tctc dbSNP:751255280
100 100 a, t dbSNP:200362147
101 101 c, g, t dbSNP:267607653
104 104 c, t dbSNP:11551630
105 105 a, c, t dbSNP:376727372
108 108 c, g dbSNP:765308206
109 109 a, g dbSNP:201179094
111 111 a, c dbSNP:758542679
113 113 -, agcatg dbSNP:754487715
120 120 c, g dbSNP:369198778
121 121 c, t dbSNP:141170056
123 123 g, t dbSNP:756991398
126 126 c, g, t dbSNP:76301931
127 127 a, c dbSNP:769641289
135 135 a, c dbSNP:775547844
146 146 a, g dbSNP:748718547
148 148 a, c, t dbSNP:768280963
154 154 c, t dbSNP:761560727
155 155 c, t dbSNP:766809169
156 156 a, g dbSNP:777157164
157 157 a, c, g dbSNP:760023196
158 158 c, t dbSNP:753311520
163 163 a, g dbSNP:80354424
165 165 a, g dbSNP:79476176
166 166 a, c dbSNP:751717313
168 168 c, g dbSNP:147350452
172 172 a, c dbSNP:780920567
184 184 c, t dbSNP:141066547
188 188 c, g dbSNP:750200705
191 191 a, g dbSNP:78514003
192 192 c, t dbSNP:11551634
193 193 c, t dbSNP:755980643
194 194 c, t dbSNP:77825282
198 198 a, c, g dbSNP:74379840
199 199 a, g dbSNP:528903225
207 207 g, t dbSNP:374064321
209 209 g, t dbSNP:74953757
211 211 a, g dbSNP:778594717
217 217 a, c, t dbSNP:78343594
227 227 g, t dbSNP:77999286
229 229 c, t dbSNP:75380684
231 231 c, t dbSNP:771828609
232 232 c, t dbSNP:75174163
233 233 a, g dbSNP:773038025
236 236 a, g dbSNP:759814479
239 239 c, t dbSNP:770250195
242 242 a, c, g dbSNP:75441140
245 245 g, t dbSNP:763522746
249 249 c, g dbSNP:200221269
251 251 a, c, t dbSNP:760412718
256 256 c, t dbSNP:80004568
258 258 c, t dbSNP:761933454
263 263 c, t dbSNP:78479490
264 264 g, t dbSNP:11551633
275 275 c, t dbSNP:750714548
278 278 a, c dbSNP:78718957
279 279 c, g dbSNP:755849994
282 282 a, g dbSNP:76183244
284 284 g, t dbSNP:753674663
292 292 g, t dbSNP:76187914
295 295 c, t dbSNP:186267053
296 296 c, g dbSNP:779038487
299 299 a, g dbSNP:747629868
301 301 c, g dbSNP:771773665
308 308 -, accgggatagccgggggtctggca dbSNP:267607417
310 310 c, g dbSNP:79913669
311 311 c, g dbSNP:777553435
313 313 c, g dbSNP:562275591
316 316 a, g dbSNP:77364359
319 319 c, t dbSNP:769987846
320 320 a, g dbSNP:11551624
321 321 c, g dbSNP:532875586
322 322 a, g dbSNP:763320997
353 353 a, g dbSNP:199572098
355 355 a, g dbSNP:769130435
359 359 a, g dbSNP:774882680
367 367 a, g dbSNP:79346135
384 384 a, g dbSNP:11551641
390 390 c, t dbSNP:11551623
391 391 c, t dbSNP:761880219
392 392 c, t dbSNP:551257529
397 397 c, t dbSNP:386834224
409 409 g, t dbSNP:750541227
412 412 g, t dbSNP:760985349
420 420 a, t dbSNP:144926827
422 422 a, g dbSNP:61136606
424 424 c, g dbSNP:373362435
431 431 c, t dbSNP:11551638
432 432 g, t dbSNP:765260052
444 444 c, g dbSNP:752738391
445 445 c, t dbSNP:11551621
451 451 c, t dbSNP:757921931
452 452 c, t dbSNP:777429135
457 457 c, g dbSNP:11551637
458 458 c, t dbSNP:544079943
460 460 c, t dbSNP:746603354
461 461 c, t dbSNP:756957250
463 463 a, g dbSNP:780757814
469 469 a, c, g dbSNP:749637522
471 471 a, g dbSNP:147945345
482 482 g, t dbSNP:11551629
483 483 c, t dbSNP:748671089
485 485 a, g dbSNP:11551632
488 488 c, g dbSNP:772097116
493 493 g, t dbSNP:140324943
498 498 a, t dbSNP:57758506
502 502 c, t dbSNP:766588095
511 511 c, t dbSNP:776785712
524 524 a, t dbSNP:759391099
527 527 a, g dbSNP:766333046
538 538 a, c dbSNP:745911935
539 539 a, g dbSNP:770066827
544 544 c, t dbSNP:780414092
551 551 a, g dbSNP:749538159
552 552 a, g dbSNP:768434116
553 553 c, t dbSNP:370728079
561 561 a, g dbSNP:200694483
563 563 a, g dbSNP:59979366
565 565 c, g dbSNP:771870687
571 571 a, g dbSNP:773196623
582 582 a, g dbSNP:760161076
583 583 c, t dbSNP:765886766
584 584 a, g dbSNP:776198491
587 587 c, g, t dbSNP:553275094
588 588 a, g dbSNP:369948432
589 589 c, t dbSNP:78791501
596 596 a, g dbSNP:11551626
604 604 c, t dbSNP:77832070
607 607 c, t dbSNP:751029615
617 617 c, t dbSNP:17856017
627 627 a, t dbSNP:11551625
632 632 c, g dbSNP:758121818
633 633 c, g dbSNP:777576325
638 638 c, t dbSNP:746898922
640 640 c, t dbSNP:369743947
642 642 a, g dbSNP:781231306
646 646 c, t dbSNP:560230776
655 655 c, t dbSNP:769404929
658 658 c, t dbSNP:774948895
660 660 c, t dbSNP:762675185
671 671 c, t dbSNP:772530106
672 672 a, g dbSNP:773737254
682 682 c, t dbSNP:761174253
691 691 c, t dbSNP:11551628
692 692 a, g dbSNP:11170343
700 700 a, g dbSNP:115544685
714 714 a, g dbSNP:146788536
718 718 a, c dbSNP:11551622
723 723 g, t dbSNP:770760404
724 724 c, t dbSNP:752822458
735 735 a, g dbSNP:542816796
748 748 c, t dbSNP:758640175
766 766 c, t dbSNP:372594060
767 767 a, g dbSNP:375823747
771 771 a, g dbSNP:531597374
779 779 a, g dbSNP:760118857
782 782 a, g dbSNP:765181291
783 783 a, g dbSNP:752798433
791 791 a, g dbSNP:763059508
798 798 c, t dbSNP:764298430
804 804 c, g dbSNP:58472472
805 805 c, t dbSNP:756989570
814 814 a, g dbSNP:746247808
817 817 c, g, t dbSNP:781046733
818 818 a, g dbSNP:756101711
829 829 c, t dbSNP:779909524
835 835 a, c dbSNP:1049159
851 851 a, g dbSNP:748780372
862 862 a, g dbSNP:191325805
863 863 a, g dbSNP:778646111
873 873 a, g dbSNP:747804954
876 876 c, g, t dbSNP:11551642
877 877 c, t dbSNP:145578755
880 880 a, g dbSNP:777075457
886 886 c, t dbSNP:529125152
892 892 a, g dbSNP:770303417
896 896 c, t dbSNP:776044211
897 897 a, g dbSNP:57354642
904 904 c, g, t dbSNP:11551643
905 905 c, t dbSNP:774491952
906 906 a, g dbSNP:762129501
910 910 c, g dbSNP:767170853
913 913 a, g dbSNP:750214150
918 918 a, g dbSNP:755905707
922 922 a, g dbSNP:766324065
925 925 c, t dbSNP:753836752
939 939 c, t dbSNP:565940319
942 942 a, g dbSNP:61696408
956 956 c, g dbSNP:766276909
958 958 c, g dbSNP:753784493
959 959 g, t dbSNP:754985586
969 969 a, g dbSNP:59112368
991 991 g, t dbSNP:141750671
995 995 a, g dbSNP:757912166
997 997 a, g dbSNP:150137089
999 999 c, t dbSNP:267607418
1000 1000 a, g dbSNP:756436730
1005 1005 c, t dbSNP:115810585
1014 1014 c, g dbSNP:749749094
1015 1015 a, t dbSNP:11551636
1020 1020 c, t dbSNP:769132516
1028 1028 c, t dbSNP:779439842
1037 1037 a, t dbSNP:748258071
1039 1039 c, t dbSNP:149270992
1040 1040 a, g dbSNP:199930351
1049 1049 c, t dbSNP:760836025
1063 1063 a, g dbSNP:548315492
1085 1085 a, c dbSNP:569786087
1089 1089 a, g dbSNP:554733127
1102 1102 c, t dbSNP:371513958
1103 1103 c, t dbSNP:147365823
1104 1104 a, g dbSNP:755405944
1108 1108 c, t dbSNP:58138700
1109 1109 a, g dbSNP:748604274
1112 1112 c, t dbSNP:772147091
1117 1117 c, g dbSNP:11542066
1119 1119 g, t dbSNP:777734597
1127 1127 c, t dbSNP:11551635
1132 1132 c, t dbSNP:372449912
1133 1133 a, g dbSNP:57370769
1151 1151 a, g dbSNP:143380812
1153 1153 a, g dbSNP:576288276
1171 1171 c, g dbSNP:759391003
1173 1173 a, g dbSNP:769726300
1176 1176 a, c dbSNP:543607490
1188 1188 a, g dbSNP:762831521
1194 1194 c, t dbSNP:763612705
1201 1201 a, g dbSNP:144702029
1219 1219 c, t dbSNP:761354945
1225 1225 a, g dbSNP:767157107
1232 1232 c, g dbSNP:17467
1236 1236 a, g dbSNP:750137340
1240 1240 g, t dbSNP:755264854
1246 1246 a, c dbSNP:765547912
1247 1247 a, g dbSNP:753197079
1257 1257 a, g dbSNP:147541172
1259 1259 a, c, t dbSNP:11551627
1260 1260 a, g dbSNP:770506633
1264 1264 a, g dbSNP:747053055
1275 1275 a, g dbSNP:757469736
1276 1276 c, t dbSNP:781505728
1277 1277 a, g dbSNP:746093574
1286 1286 a, c dbSNP:769672516
1302 1302 c, t dbSNP:781454348
1319 1319 a, g dbSNP:746040565
1342 1342 c, g dbSNP:756269928
1343 1343 a, c dbSNP:1063607
1344 1344 c, t dbSNP:780366176
1345 1345 c, g dbSNP:386834225
1346 1346 c, t dbSNP:768557036
1347 1347 a, g dbSNP:148580152
1349 1349 c, t dbSNP:774101880
1350 1350 a, g dbSNP:146080391
1351 1351 a, g, t dbSNP:142940942
1362 1362 a, g dbSNP:771518602
1367 1367 g, t dbSNP:772684603
1369 1369 g, t dbSNP:760216239
1371 1371 a, t dbSNP:765942310
1383 1383 a, g dbSNP:200552337
1397 1397 a, c, t dbSNP:709170
1398 1398 c, t dbSNP:763169289
1405 1405 c, t dbSNP:764524275
1408 1408 a, g dbSNP:752072208
1410 1410 c, g dbSNP:762433427
1411 1411 c, t dbSNP:768188540
1422 1422 -, g dbSNP:764567917
1423 1423 g, t dbSNP:750501631
1430 1430 c, t dbSNP:756285868
1433 1433 g, t dbSNP:780129356
1435 1435 a, g dbSNP:377238570
1436 1436 a, g dbSNP:754667202
1438 1438 a, g dbSNP:754273472
1449 1449 a, g dbSNP:778697666

Target ORF information:

RefSeq Version NM_000224
Organism Homo sapiens (human)
Definition Homo sapiens keratin 18, type I (KRT18), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
