
LAMA2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol LAMA2
Entrez Gene ID 3908
Full Name laminin, alpha 2
Synonyms LAMM
General protein information
Preferred Names
laminin subunit alpha-2
laminin subunit alpha-2
laminin M chain
merosin heavy chain
laminin-2 subunit alpha
laminin-4 subunit alpha
laminin-12 subunit alpha
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Muscular dystrophy, congenital merosin-deficient, 607855 (3);

mRNA and Protein(s)

mRNA Protein Name
XM_005266981 XP_005267038 laminin subunit alpha-2 isoform X1
XM_011535820 XP_011534122 laminin subunit alpha-2 isoform X2
XM_005266982 XP_005267039 laminin subunit alpha-2 isoform X3
NM_000426 NP_000417 laminin subunit alpha-2 isoform a precursor
NM_001079823 NP_001073291 laminin subunit alpha-2 isoform b precursor

hsa04510 Focal adhesion
hsa04512 ECM-receptor interaction
hsa05222 Small cell lung cancer
hsa05200 Pathways in cancer
hsa05410 Hypertrophic cardiomyopathy (HCM)
hsa05414 Dilated cardiomyopathy
hsa05412 Arrhythmogenic right ventricular cardiomyopathy (ARVC)
hsa05416 Viral myocarditis
hsa05146 Amoebiasis
hsa05145 Toxoplasmosis
hsa04151 PI3K-Akt signaling pathway
R-HSA-1474244 Extracellular matrix organization
R-HSA-3000178 ECM proteoglycans
R-HSA-3000157 Laminin interactions
R-HSA-3000171 Non-integrin membrane-ECM interactions
WP244 Alpha6-Beta4 Integrin Signaling Pathway
WP2118 Arrhythmogenic right ventricular cardiomyopathy

Homo sapiens (human) LAMA2 NP_001073291.1
Pan troglodytes (chimpanzee) LAMA2 XP_003311525.1
Macaca mulatta (Rhesus monkey) LAMA2 XP_001105600.2
Canis lupus familiaris (dog) LAMA2 XP_003432570.1
Bos taurus (cattle) LAMA2 XP_002690266.1
Mus musculus (house mouse) Lama2 NP_032507.2
Rattus norvegicus (Norway rat) Lama2 XP_219866.6
Gallus gallus (chicken) LAMA2 XP_419746.4
Danio rerio (zebrafish) lama2 NP_001265728.1
Caenorhabditis elegans lam-3 NP_492775.2
Xenopus (Silurana) tropicalis (western clawed frog) lama2 XP_002936356.2


ID Name Evidence
GO:0005576 extracellular region EXP
GO:0005604 basement membrane IDA
GO:0005605 basal lamina IEA
GO:0005606 laminin-1 complex IEA
GO:0042383 sarcolemma IEA


ID Name Evidence
GO:0005102 receptor binding IEA
GO:0005198 structural molecule activity TAS


ID Name Evidence
GO:0007517 muscle organ development TAS
GO:0030155 regulation of cell adhesion IEA
GO:0030334 regulation of cell migration IEA
GO:0032224 positive regulation of synaptic transmission, cholinergic IEA
GO:0045995 regulation of embryonic development IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following LAMA2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LAMA2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu40809 XM_005266981 PREDICTED: Homo sapiens laminin, alpha 2 (LAMA2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu58673 XM_011535820 PREDICTED: Homo sapiens laminin, alpha 2 (LAMA2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu40810 XM_005266982 PREDICTED: Homo sapiens laminin, alpha 2 (LAMA2), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu18829 NM_000426 Homo sapiens laminin, alpha 2 (LAMA2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu16313 NM_001079823 Homo sapiens laminin, alpha 2 (LAMA2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu40809
Accession Version XM_005266981.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 9633bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product laminin subunit alpha-2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530383699. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)220..960(+)
Misc Feature(2)964..1107(+)
Misc Feature(3)964..1059(+)
Misc Feature(4)1342..1500(+)
Misc Feature(5)1345..1464(+)
Misc Feature(6)1507..1650(+)
Misc Feature(7)1510..1596(+)
Misc Feature(8)1837..2235(+)
Misc Feature(9)2371..2520(+)
Misc Feature(10)2374..2460(+)
Misc Feature(11)2521..2694(+)
Misc Feature(12)2524..2637(+)
Misc Feature(13)2695..2853(+)
Misc Feature(14)2698..2799(+)
Misc Feature(15)2854..2991(+)
Misc Feature(16)2857..2949(+)
Misc Feature(17)3004..>3096(+)
Misc Feature(18)3004..3093(+)
Misc Feature(19)3265..3399(+)
Misc Feature(20)3268..3357(+)
Misc Feature(21)3406..3543(+)
Misc Feature(22)3409..3492(+)
Misc Feature(23)3544..3672(+)
Misc Feature(24)3547..3639(+)
Misc Feature(25)3685..3858(+)
Misc Feature(26)3685..3804(+)
Misc Feature(27)4054..4461(+)
Misc Feature(28)4624..4770(+)
Misc Feature(29)4627..4713(+)
Misc Feature(30)4774..4944(+)
Misc Feature(31)4774..4887(+)
Misc Feature(32)4948..5091(+)
Misc Feature(33)4948..5040(+)
Misc Feature(34)5131..5928(+)
Misc Feature(35)5419..6024(+)
Misc Feature(36)5725..5742(+)
Misc Feature(37)5737..6624(+)
Misc Feature(38)5968..6654(+)
Misc Feature(39)6478..6888(+)
Misc Feature(40)6817..7296(+)
Misc Feature(41)7387..7872(+)
Misc Feature(42)7951..8439(+)
Misc Feature(43)8665..9114(+)
Misc Feature(44)9190..9648(+)
Position Chain Variation Link
7 7 a, g dbSNP:111531732
11 11 -, gct dbSNP:568369254
21 21 g, t dbSNP:751471298
27 27 c, t dbSNP:367880792
31 31 c, t dbSNP:558347603
34 34 a, g dbSNP:10080633
36 36 c, g dbSNP:543685962
55 55 c, g dbSNP:760133406
57 57 a, c dbSNP:772211223
68 68 c, t dbSNP:556025503
75 75 c, t dbSNP:760935151
88 88 -, c dbSNP:537351244
103 103 a, g dbSNP:764267708
106 106 a, t dbSNP:753635528
107 107 c, t dbSNP:374403765
112 112 a, g dbSNP:761472320
118 118 a, g, t dbSNP:367622987
120 120 c, t dbSNP:574296023
121 121 a, g dbSNP:779529626
129 129 c, t dbSNP:751119966
133 133 c, t dbSNP:754627719
137 137 c, t dbSNP:730880252
140 140 a, t dbSNP:780670230
157 157 g, t dbSNP:747860244
162 162 a, c dbSNP:771141152
163 163 a, g dbSNP:779423546
164 164 c, t dbSNP:746372774
168 168 a, g dbSNP:772763260
179 179 a, c, t dbSNP:145310035
181 181 c, t dbSNP:768810174
187 187 c, t dbSNP:776665392
190 190 a, c dbSNP:762102801
195 195 c, g dbSNP:371739718
203 203 a, c dbSNP:750280423
204 204 a, t dbSNP:762858697
205 205 c, t dbSNP:374090280
206 206 a, g dbSNP:398123366
207 207 a, t dbSNP:751547531
214 214 a, g dbSNP:754399459
219 219 c, t dbSNP:752309873
247 247 c, t dbSNP:755805262
254 254 c, t dbSNP:191899712
256 256 c, t dbSNP:764781327
261 261 c, g, t dbSNP:1140366
263 263 c, t dbSNP:747469905
266 266 c, t dbSNP:755569689
269 269 a, g dbSNP:781113853
281 281 a, g dbSNP:748303070
289 289 g, t dbSNP:398123368
290 290 a, g dbSNP:769893713
293 293 c, t dbSNP:773374895
297 297 a, c dbSNP:77526545
302 302 a, c dbSNP:749528023
308 308 a, g dbSNP:770647752
310 310 c, t dbSNP:774268198
321 321 c, t dbSNP:376658270
324 324 c, t dbSNP:767540192
328 328 a, g dbSNP:368766845
339 339 c, g dbSNP:373941041
341 341 a, g dbSNP:760219197
342 342 a, g dbSNP:201402165
345 345 a, c, t dbSNP:201028930
347 347 -, cg dbSNP:774124300
347 347 c, t dbSNP:757039606
348 348 a, g, t dbSNP:766642494
351 351 -, cc dbSNP:748041025
356 356 a, c, g dbSNP:148607737
360 360 c, t dbSNP:142083777
363 363 a, c dbSNP:756131313
365 365 a, c dbSNP:777836126
381 381 c, t dbSNP:112120067
382 382 a, c dbSNP:530988751
386 386 a, g dbSNP:758713214
387 387 c, t dbSNP:559745161
390 390 a, g dbSNP:779996812
393 393 a, c dbSNP:34626728
397 397 c, g dbSNP:140199131
398 398 c, t dbSNP:768766369
399 399 a, g dbSNP:145752259
411 411 a, t dbSNP:146611180
412 412 a, g, t dbSNP:369978622
416 416 a, c dbSNP:762518832
426 426 c, t dbSNP:767921288
428 428 c, t dbSNP:574486340
429 429 c, t dbSNP:761146486
431 431 c, g dbSNP:764625508
440 440 a, g dbSNP:754373965
461 461 c, t dbSNP:113503324
462 462 c, t dbSNP:373866593
463 463 a, g dbSNP:778869610
468 468 a, c dbSNP:535635043
470 470 a, g dbSNP:758613047
471 471 g, t dbSNP:779976011
473 473 a, g dbSNP:746843084
479 479 c, t dbSNP:754855670
480 480 a, g dbSNP:553711868
485 485 -, ccc dbSNP:760984320
486 486 a, c dbSNP:4404787
493 493 a, t dbSNP:769282322
497 497 a, g, t dbSNP:772666610
507 507 a, c dbSNP:745528298
513 513 c, t dbSNP:145149634
514 514 a, g dbSNP:368349321
515 515 c, t dbSNP:138964034
516 516 a, g dbSNP:149347601
520 520 a, g dbSNP:372414339
532 532 a, g dbSNP:763081181
534 534 a, g dbSNP:766584334
539 539 a, g dbSNP:751765780
542 542 c, g, t dbSNP:143680577
547 547 -, g dbSNP:759516529
547 547 c, t dbSNP:752485547
548 548 a, g dbSNP:148103319
568 568 a, g, t dbSNP:756045943
572 572 a, g dbSNP:753835841
575 575 c, g, t dbSNP:756699354
584 584 a, g, t dbSNP:147398243
593 593 a, t dbSNP:201175472
597 597 a, g, t dbSNP:748424435
598 598 a, c dbSNP:773537709
603 603 a, g dbSNP:553221833
606 606 a, g dbSNP:578124003
612 612 c, t dbSNP:774632474
614 614 c, t dbSNP:545317749
623 623 a, t dbSNP:767671585
626 626 c, t dbSNP:752992990
627 627 a, g dbSNP:760338218
638 638 c, t dbSNP:148665727
647 647 a, g dbSNP:143664472
649 649 a, g dbSNP:757248849
651 651 g, t dbSNP:778378665
658 658 c, t dbSNP:777977352
659 659 a, g dbSNP:150586612
660 660 c, t dbSNP:757937666
671 671 a, c, t dbSNP:575725137
672 672 a, g dbSNP:746692025
675 675 a, c dbSNP:769991509
677 677 a, g dbSNP:778267504
697 697 a, g dbSNP:749800602
702 702 c, t dbSNP:771616248
712 712 c, t dbSNP:774542927
717 717 c, g, t dbSNP:201236591
724 724 a, c dbSNP:775513594
728 728 a, c dbSNP:183890063
729 729 c, g dbSNP:367841133
734 734 a, g dbSNP:763792139
747 747 c, t dbSNP:765031378
757 757 a, t dbSNP:773067920
765 765 c, t dbSNP:545580370
772 772 a, c dbSNP:773582066
773 773 a, c dbSNP:765797886
774 774 a, g dbSNP:557710857
778 778 a, g dbSNP:754558913
780 780 c, t dbSNP:139665175
781 781 a, g dbSNP:149654569
785 785 a, g dbSNP:757635528
792 792 c, t dbSNP:112786770
793 793 a, c dbSNP:779421508
804 804 a, g dbSNP:746351937
816 816 c, t dbSNP:369745832
817 817 a, g dbSNP:779975082
818 818 a, c, t dbSNP:398123384
820 820 c, t dbSNP:145465528
821 821 a, g, t dbSNP:776777494
823 823 c, t dbSNP:3778142
825 825 c, t dbSNP:773053547
829 829 c, t dbSNP:762781837
830 830 a, g, t dbSNP:373570586
845 845 a, g dbSNP:759035344
849 849 a, c dbSNP:767145594
850 850 c, t dbSNP:376437110
851 851 a, g dbSNP:760466683
852 852 c, t dbSNP:530082619
855 855 a, t dbSNP:750848086
881 881 c, t dbSNP:369707756
883 883 c, t dbSNP:780568352
884 884 a, g dbSNP:752023164
885 885 c, g dbSNP:754984863
886 886 a, g dbSNP:781316719
904 904 a, g dbSNP:748356668
920 920 c, g dbSNP:770055063
935 935 c, t dbSNP:398123388
936 936 a, g dbSNP:765960304
939 939 c, t dbSNP:372561300
944 944 a, g dbSNP:773934052
953 953 c, t dbSNP:376917587
962 962 g, t dbSNP:745783092
982 982 g, t dbSNP:772184574
984 984 c, t dbSNP:148419866
998 998 c, t dbSNP:760221384
1006 1006 a, g, t dbSNP:768302640
1007 1007 c, t dbSNP:144053918
1008 1008 a, c, g, t dbSNP:148655840
1011 1011 a, g dbSNP:767975386
1013 1013 a, c dbSNP:753228224
1027 1027 a, g dbSNP:146462599
1033 1033 c, g dbSNP:767885350
1041 1041 c, t dbSNP:781662483
1044 1044 a, g dbSNP:775906839
1046 1046 a, g, t dbSNP:569437197
1050 1050 c, t dbSNP:764217699
1051 1051 a, g dbSNP:141340479
1053 1053 c, t dbSNP:200841688
1056 1056 c, t dbSNP:765336655
1060 1060 a, g dbSNP:762485446
1070 1070 g, t dbSNP:530699155
1076 1076 a, g dbSNP:777086533
1082 1082 a, g dbSNP:750695625
1090 1090 a, c dbSNP:758208226
1109 1109 c, t dbSNP:372623703
1111 1111 c, g dbSNP:746932671
1127 1127 g, t dbSNP:754920448
1131 1131 a, c, g dbSNP:780723581
1132 1132 a, g dbSNP:769372458
1137 1137 c, t dbSNP:755515196
1139 1139 a, g dbSNP:777327817
1151 1151 a, g dbSNP:267600801
1153 1153 a, g dbSNP:748922842
1175 1175 a, g dbSNP:145129199
1179 1179 g, t dbSNP:770615109
1189 1189 a, t dbSNP:191912891
1190 1190 g, t dbSNP:182958473
1195 1195 c, t dbSNP:769086418
1210 1210 c, t dbSNP:776943729
1211 1211 a, g dbSNP:367649718
1215 1215 a, g dbSNP:769982089
1222 1222 a, g dbSNP:773475924
1229 1229 a, g dbSNP:763237131
1232 1232 g, t dbSNP:371822775
1234 1234 a, g dbSNP:751832504
1235 1235 c, t dbSNP:759198024
1237 1237 c, t dbSNP:767352336
1244 1244 a, g dbSNP:752575481
1245 1245 c, t dbSNP:756132239
1275 1275 c, t dbSNP:372654432
1276 1276 a, g dbSNP:753382270
1292 1292 c, g dbSNP:756788810
1304 1304 c, g, t dbSNP:567687227
1312 1312 a, c, g dbSNP:768538467
1315 1315 a, t dbSNP:764729407
1319 1319 c, t dbSNP:750038965
1320 1320 a, c dbSNP:758120956
1334 1334 c, t dbSNP:781382284
1335 1335 a, t dbSNP:748505273
1339 1339 c, g dbSNP:756571072
1340 1340 a, g dbSNP:776412628
1345 1345 c, t dbSNP:778370179
1353 1353 c, t dbSNP:371944692
1354 1354 a, g dbSNP:201009816
1357 1357 a, c dbSNP:771133988
1358 1358 c, t dbSNP:774551836
1360 1360 a, g dbSNP:746051487
1361 1361 c, t dbSNP:772375392
1367 1367 a, c dbSNP:775603569
1372 1372 a, c dbSNP:760410395
1375 1375 a, g dbSNP:763889172
1387 1387 a, g dbSNP:769655239
1391 1391 a, g dbSNP:375088386
1395 1395 a, g dbSNP:574880101
1406 1406 a, g dbSNP:200097756
1408 1408 c, t dbSNP:773209126
1413 1413 g, t dbSNP:41285286
1421 1421 c, t dbSNP:768435216
1424 1424 a, g dbSNP:776467218
1433 1433 a, g dbSNP:761708482
1468 1468 c, t dbSNP:769731295
1469 1469 a, g dbSNP:201177178
1474 1474 a, g dbSNP:542498391
1478 1478 a, g dbSNP:140604077
1481 1481 g, t dbSNP:372996805
1486 1486 a, c, g dbSNP:553518581
1494 1494 a, c dbSNP:764534352
1496 1496 c, t dbSNP:150394215
1497 1497 a, g dbSNP:757589246
1501 1501 c, t dbSNP:772485085
1505 1505 a, g dbSNP:138162760
1508 1508 c, g dbSNP:111695726
1530 1530 a, g dbSNP:758436223
1531 1531 a, g dbSNP:780173189
1540 1540 c, g dbSNP:747219273
1543 1543 c, g dbSNP:768914124
1556 1556 g, t dbSNP:781424807
1559 1559 c, t dbSNP:146522136
1565 1565 c, t dbSNP:769491509
1566 1566 c, t dbSNP:773136834
1570 1570 a, g dbSNP:762868463
1571 1571 a, t dbSNP:770464694
1596 1596 c, t dbSNP:2306220
1598 1598 g, t dbSNP:773498633
1599 1599 a, t dbSNP:763484341
1600 1600 c, t dbSNP:143626559
1601 1601 a, g dbSNP:752075358
1607 1607 a, t dbSNP:754986659
1611 1611 c, t dbSNP:560445624
1612 1612 a, g dbSNP:375232037
1618 1618 c, t dbSNP:756343242
1622 1622 a, g, t dbSNP:777597861
1623 1623 c, t dbSNP:368304359
1632 1632 c, g dbSNP:778934070
1634 1634 a, g dbSNP:772958683
1638 1638 c, t dbSNP:9492266
1650 1650 c, t dbSNP:774918437
1651 1651 c, g dbSNP:141000358
1655 1655 a, t dbSNP:372358704
1656 1656 a, g dbSNP:376727105
1667 1667 c, t dbSNP:369760070
1672 1672 g, t dbSNP:766736187
1685 1685 a, g dbSNP:121913574
1691 1691 a, g dbSNP:370691060
1694 1694 c, g dbSNP:760095810
1696 1696 c, t dbSNP:767565927
1699 1699 c, t dbSNP:373100233
1701 1701 g, t dbSNP:752763391
1706 1706 a, t dbSNP:760843515
1709 1709 a, g dbSNP:764169400
1714 1714 a, t dbSNP:148262047
1720 1720 c, g dbSNP:764236220
1721 1721 a, t dbSNP:753999155
1726 1726 a, g dbSNP:141363186
1735 1735 g, t dbSNP:200939383
1736 1736 a, g dbSNP:750282900
1738 1738 c, t dbSNP:758299856
1739 1739 a, t dbSNP:118083923
1747 1747 c, t dbSNP:751520961
1750 1750 c, t dbSNP:139070796
1755 1755 c, t dbSNP:899353
1757 1757 g, t dbSNP:747779519
1758 1758 c, t dbSNP:769480101
1761 1761 g, t dbSNP:777437499
1771 1771 c, t dbSNP:746185972
1772 1772 c, t dbSNP:772495914
1774 1774 -, cag dbSNP:775570308
1780 1780 a, c, g dbSNP:775791328
1783 1783 a, g, t dbSNP:768602307
1784 1784 a, g dbSNP:61620549
1786 1786 g, t dbSNP:765515681
1788 1788 a, g dbSNP:773590228
1791 1791 c, t dbSNP:377679162
1798 1798 c, g dbSNP:766264846
1804 1804 -, tcag dbSNP:763480874
1806 1806 c, t dbSNP:111381107
1807 1807 a, g dbSNP:754994339
1810 1810 a, c dbSNP:766909163
1811 1811 a, t dbSNP:752165636
1818 1818 c, g, t dbSNP:755646653
1820 1820 c, t dbSNP:149811988
1821 1821 a, c, g dbSNP:758682648
1823 1823 a, c, g dbSNP:747449459
1827 1827 c, t dbSNP:777308198
1833 1833 a, g dbSNP:748189857
1841 1841 c, t dbSNP:769998511
1842 1842 a, g, t dbSNP:149000261
1843 1843 c, g dbSNP:766067660
1848 1848 c, t dbSNP:774243931
1850 1850 a, g dbSNP:759283737
1851 1851 c, t dbSNP:777637457
1853 1853 a, g dbSNP:370965146
1857 1857 -, gagcgc dbSNP:764531803
1861 1861 c, g dbSNP:752648056
1862 1862 c, t dbSNP:373005444
1866 1866 -, g dbSNP:786205654
1876 1876 c, t dbSNP:142965498
1877 1877 g, t dbSNP:28384270
1884 1884 c, t dbSNP:753472202
1888 1888 c, t dbSNP:368467579
1892 1892 c, t dbSNP:781728421
1897 1897 a, g dbSNP:753232836
1899 1899 -, agg dbSNP:753417521
1903 1903 a, g dbSNP:36044314
1919 1919 c, t dbSNP:112388307
1921 1921 a, g dbSNP:113022759
1922 1922 c, t dbSNP:770926147
1925 1925 c, t dbSNP:558018507
1926 1926 -, at dbSNP:754600708
1941 1941 a, g dbSNP:746147862
1955 1955 c, t dbSNP:771845417
1960 1960 c, t dbSNP:775316325
1961 1961 a, g dbSNP:3816665
1966 1966 -, acgtgttc dbSNP:202247791
1966 1966 c, t dbSNP:139093923
1968 1968 a, c dbSNP:776457288
1972 1972 c, t dbSNP:538213957
1978 1978 a, g dbSNP:141658354
1979 1979 c, t dbSNP:766360431
1980 1980 a, t dbSNP:750076935
1995 1995 -, tgact dbSNP:746844753
2026 2026 a, g dbSNP:757757006
2028 2028 c, g dbSNP:765332791
2034 2034 a, g dbSNP:750466175
2035 2035 c, g dbSNP:35879899
2042 2042 c, g dbSNP:780193210
2052 2052 c, t dbSNP:537361106
2068 2068 c, t dbSNP:533125559
2080 2080 c, t dbSNP:754797379
2106 2106 c, t dbSNP:138600346
2114 2114 a, g dbSNP:149305108
2132 2132 a, c dbSNP:748086405
2139 2139 g, t dbSNP:769577654
2141 2141 a, c dbSNP:569768441
2142 2142 c, g dbSNP:398123369
2143 2143 a, t dbSNP:770567415
2144 2144 a, g dbSNP:774139365
2150 2150 -, ag dbSNP:751627052
2154 2154 -, ag dbSNP:202247790
2154 2154 a, g dbSNP:779638806
2157 2157 c, t dbSNP:764501944
2159 2159 g, t dbSNP:746641607
2189 2189 a, t dbSNP:762272518
2193 2193 c, t dbSNP:765615918
2194 2194 a, g dbSNP:778059153
2220 2220 g, t dbSNP:149753273
2226 2226 c, t dbSNP:145622088
2227 2227 a, g dbSNP:777765933
2233 2233 g, t dbSNP:753800266
2237 2237 a, g dbSNP:201122410
2254 2254 a, g dbSNP:369049149
2256 2256 a, t dbSNP:745324663
2258 2258 a, c dbSNP:373673505
2272 2272 -, gt dbSNP:770015133
2274 2274 g, t dbSNP:779508493
2283 2283 c, t dbSNP:746745097
2286 2286 a, c dbSNP:546362996
2289 2289 a, c dbSNP:773606064
2291 2291 g, t dbSNP:763338640
2292 2292 c, g dbSNP:142345851
2295 2295 c, t dbSNP:774851746
2296 2296 a, g dbSNP:759463827
2307 2307 g, t dbSNP:767700071
2322 2322 c, g, t dbSNP:192317605
2335 2335 c, t dbSNP:775676341
2336 2336 a, g dbSNP:760703409
2338 2338 a, g dbSNP:577936545
2343 2343 c, t dbSNP:777009603
2344 2344 a, g dbSNP:145940188
2345 2345 c, g dbSNP:139843107
2346 2346 a, c dbSNP:372654140
2347 2347 a, g dbSNP:765192334
2353 2353 a, t dbSNP:557382253
2357 2357 g, t dbSNP:750316600
2362 2362 a, t dbSNP:758410015
2376 2376 g, t dbSNP:766257849
2391 2391 c, t dbSNP:762354749
2393 2393 c, t dbSNP:141521127
2394 2394 a, g dbSNP:754496465
2397 2397 g, t dbSNP:780754955
2409 2409 c, t dbSNP:142126511
2410 2410 a, g dbSNP:150753170
2417 2417 c, g dbSNP:779380206
2423 2423 a, c, g dbSNP:746327071
2426 2426 c, t dbSNP:373595461
2430 2430 a, c dbSNP:139351727
2447 2447 a, g, t dbSNP:774255539
2463 2463 a, t dbSNP:766979256
2466 2466 a, c dbSNP:549956055
2475 2475 c, t dbSNP:760128108
2480 2480 c, t dbSNP:398123370
2481 2481 c, t dbSNP:150046431
2484 2484 c, t dbSNP:201162084
2487 2487 c, t dbSNP:147744763
2488 2488 a, g, t dbSNP:149896793
2490 2490 a, g dbSNP:758788626
2492 2492 c, t dbSNP:780342785
2496 2496 c, t dbSNP:752092413
2497 2497 a, g dbSNP:755581747
2500 2500 a, g dbSNP:781772588
2514 2514 c, t dbSNP:144580350
2520 2520 a, g dbSNP:147880506
2532 2532 c, t dbSNP:778050587
2535 2535 a, c, g dbSNP:147572139
2536 2536 a, c dbSNP:774169558
2538 2538 c, t dbSNP:760366191
2541 2541 c, t dbSNP:759353718
2543 2543 c, t dbSNP:771943959
2555 2555 a, c dbSNP:775422845
2563 2563 c, t dbSNP:770901625
2566 2566 a, c, g dbSNP:186538779
2567 2567 c, t dbSNP:117422805
2568 2568 a, g dbSNP:761420475
2570 2570 g, t dbSNP:764935081
2581 2581 c, t dbSNP:118147866
2582 2582 a, g dbSNP:759973830
2588 2588 c, t dbSNP:768051568
2590 2590 c, g dbSNP:753225553
2593 2593 c, t dbSNP:140283614
2598 2598 c, t dbSNP:201970154
2603 2603 a, g dbSNP:372905834
2608 2608 c, t dbSNP:753809778
2611 2611 a, c dbSNP:757340159
2616 2616 a, c, t dbSNP:201420653
2617 2617 a, g dbSNP:150361703
2618 2618 a, g dbSNP:779877337
2619 2619 g, t dbSNP:746935278
2624 2624 a, c dbSNP:768438747
2625 2625 a, c dbSNP:776655463
2628 2628 a, g dbSNP:747555665
2632 2632 a, c, t dbSNP:769493998
2654 2654 a, c, g, t dbSNP:34487290
2658 2658 -, t dbSNP:750731624
2669 2669 c, g, t dbSNP:754714449
2673 2673 c, g, t dbSNP:752650421
2676 2676 a, g dbSNP:777870520
2677 2677 c, t dbSNP:148749681
2680 2680 c, g dbSNP:369266370
2684 2684 g, t dbSNP:778428420
2688 2688 a, g dbSNP:745594515
2689 2689 c, t dbSNP:121913573
2703 2703 a, g dbSNP:768884356
2705 2705 g, t dbSNP:777097950
2715 2715 c, t dbSNP:777028430
2716 2716 c, t dbSNP:748544439
2725 2725 c, t dbSNP:770237084
2730 2730 a, c, t dbSNP:375932294
2731 2731 a, c dbSNP:773724438
2732 2732 c, t dbSNP:762955253
2744 2744 a, g dbSNP:766536888
2747 2747 a, g dbSNP:774412379
2759 2759 c, t dbSNP:759842632
2773 2773 a, g dbSNP:767663547
2775 2775 a, c dbSNP:201625640
2785 2785 a, g dbSNP:755981806
2791 2791 c, t dbSNP:764053957
2792 2792 a, g dbSNP:753890194
2812 2812 a, g dbSNP:756711072
2825 2825 a, g dbSNP:778537111
2831 2831 c, t dbSNP:745482329
2836 2836 a, g dbSNP:758033168
2839 2839 a, g dbSNP:779703997
2840 2840 a, c, t dbSNP:376580266
2841 2841 a, g dbSNP:142671449
2844 2844 a, g dbSNP:773706209
2846 2846 a, g dbSNP:749848434
2854 2854 a, c, t dbSNP:765699885
2860 2860 c, t dbSNP:138018456
2861 2861 a, g, t dbSNP:35277491
2863 2863 c, t dbSNP:779297500
2864 2864 a, g dbSNP:745890735
2865 2865 c, t dbSNP:772341790
2871 2871 a, c, t dbSNP:149254699
2872 2872 a, g dbSNP:144492513
2887 2887 a, g dbSNP:776531251
2899 2899 a, g dbSNP:761539740
2904 2904 a, g dbSNP:1027199
2914 2914 c, t dbSNP:750333077
2932 2932 a, g dbSNP:369724867
2933 2933 -, t dbSNP:777929370
2936 2936 a, g dbSNP:141920360
2938 2938 a, c, g dbSNP:372574661
2939 2939 c, g dbSNP:754583178
2941 2941 c, t dbSNP:375638381
2946 2946 a, g dbSNP:780844742
2959 2959 a, c dbSNP:754173965
2964 2964 c, g dbSNP:758356842
2975 2975 a, g dbSNP:553875992
3018 3018 c, t dbSNP:772452014
3035 3035 c, t dbSNP:376659162
3048 3048 a, t dbSNP:747559303
3108 3108 a, g dbSNP:546416409
3211 3211 c, t dbSNP:558028074
3226 3226 c, g dbSNP:757624702
3229 3229 a, g dbSNP:779193076
3232 3232 a, g dbSNP:750913549
3243 3243 a, g dbSNP:758936473
3246 3246 a, g dbSNP:749913236
3249 3249 a, t dbSNP:747032847
3250 3250 a, g dbSNP:147301872
3254 3254 a, g dbSNP:781473388
3255 3255 a, g dbSNP:748377624
3257 3257 a, g, t dbSNP:769611474
3261 3261 c, t dbSNP:749101711
3263 3263 c, t dbSNP:770796923
3266 3266 c, t dbSNP:774276037
3270 3270 a, c dbSNP:121913577
3274 3274 a, t dbSNP:766990977
3278 3278 a, t dbSNP:758005823
3281 3281 a, c, g dbSNP:775183456
3285 3285 g, t dbSNP:763840955
3300 3300 c, t dbSNP:750707755
3301 3301 a, g dbSNP:202050052
3311 3311 a, c dbSNP:766926617
3312 3312 c, g dbSNP:752180119
3314 3314 a, g dbSNP:755096239
3323 3323 g, t dbSNP:781179731
3331 3331 c, t dbSNP:398123371
3334 3334 c, t dbSNP:748288551
3347 3347 a, g dbSNP:140989143
3357 3357 c, t dbSNP:372637233
3360 3360 c, t dbSNP:756239416
3361 3361 c, t dbSNP:778069038
3362 3362 a, g, t dbSNP:144946631
3367 3367 c, g dbSNP:770774752
3368 3368 a, c dbSNP:774255415
3369 3369 c, t dbSNP:745851233
3371 3371 a, c dbSNP:554956654
3372 3372 a, c, t dbSNP:147964120
3373 3373 a, g dbSNP:200953311
3376 3376 c, t dbSNP:776431512
3377 3377 a, g dbSNP:781103695
3379 3379 c, t dbSNP:763410003
3383 3383 a, g dbSNP:139244736
3388 3388 c, t dbSNP:752094219
3389 3389 -, aag dbSNP:550888947
3389 3389 -, aa dbSNP:757164022
3395 3395 g, t dbSNP:755480007
3399 3399 a, c dbSNP:577228621
3404 3404 c, t dbSNP:752658943
3414 3414 a, g dbSNP:539686301
3415 3415 c, t dbSNP:367658196
3421 3421 c, t dbSNP:760657456
3426 3426 g, t dbSNP:764206794
3432 3432 c, t dbSNP:745911515
3435 3435 c, t dbSNP:757428475
3439 3439 a, g dbSNP:779130638
3448 3448 a, g dbSNP:750128766
3454 3454 a, c, t dbSNP:145420388
3455 3455 a, g dbSNP:149993931
3460 3460 a, g dbSNP:768032136
3464 3464 a, g dbSNP:780892378
3467 3467 c, g dbSNP:113957073
3468 3468 a, t dbSNP:769510446
3473 3473 -, atac dbSNP:768709391
3473 3473 a, g dbSNP:773000879
3474 3474 c, t dbSNP:759812348
3498 3498 a, g dbSNP:772541077
3502 3502 g, t dbSNP:373373855
3508 3508 a, g dbSNP:761283808
3509 3509 a, g dbSNP:764615438
3513 3513 a, c, t dbSNP:147249027
3518 3518 g, t dbSNP:761896371
3522 3522 c, t dbSNP:765377074
3523 3523 a, g dbSNP:149165006
3548 3548 g, t dbSNP:79936200
3550 3550 a, t dbSNP:766544500
3561 3561 a, g, t dbSNP:751322862
3569 3569 a, c dbSNP:767554448
3572 3572 c, t dbSNP:752736343
3582 3582 a, g dbSNP:372938168
3586 3586 a, g dbSNP:777383587
3587 3587 a, g dbSNP:748779868
3588 3588 a, t dbSNP:756883648
3600 3600 a, c, g dbSNP:376529091
3603 3603 a, g dbSNP:769077288
3608 3608 a, g dbSNP:757867264
3611 3611 a, g, t dbSNP:766029511
3613 3613 c, t dbSNP:146490004
3621 3621 a, g dbSNP:762966634
3624 3624 c, t dbSNP:200075509
3631 3631 a, g dbSNP:774501094
3642 3642 a, g dbSNP:201638947
3648 3648 c, t dbSNP:371376404
3652 3652 c, t dbSNP:376088608
3653 3653 a, g dbSNP:201518199
3658 3658 c, t dbSNP:763958524
3659 3659 a, g dbSNP:370218452
3662 3662 -, g dbSNP:764839142
3662 3662 g, t dbSNP:756726014
3665 3665 a, g dbSNP:35065563
3667 3667 c, t dbSNP:750135030
3673 3673 c, t dbSNP:755313913
3674 3674 a, g dbSNP:781580213
3675 3675 c, t dbSNP:368120033
3680 3680 a, t dbSNP:543276127
3686 3686 a, g dbSNP:371548755
3699 3699 c, t dbSNP:778158710
3707 3707 c, t dbSNP:561950953
3712 3712 c, g dbSNP:780442272
3719 3719 c, t dbSNP:749379475
3732 3732 g, t dbSNP:770971338
3748 3748 c, t dbSNP:774687955
3751 3751 a, g dbSNP:529055249
3755 3755 a, c dbSNP:772453331
3763 3763 c, g dbSNP:540973258
3772 3772 a, c dbSNP:760558443
3775 3775 a, t dbSNP:764024605
3781 3781 a, g dbSNP:2306942
3794 3794 c, g dbSNP:552630448
3797 3797 c, t dbSNP:200140103
3798 3798 a, c dbSNP:200646230
3803 3803 a, g dbSNP:772664232
3810 3810 a, g dbSNP:762465367
3814 3814 c, t dbSNP:201540948
3819 3819 c, t dbSNP:751267299
3829 3829 a, g dbSNP:756475916
3834 3834 c, t dbSNP:764402318
3835 3835 a, g dbSNP:754256231
3837 3837 c, t dbSNP:757654825
3838 3838 a, g dbSNP:575405390
3840 3840 c, t dbSNP:745874905
3859 3859 a, g dbSNP:758616365
3868 3868 c, t dbSNP:762491173
3876 3876 c, t dbSNP:780411962
3877 3877 a, g dbSNP:747246881
3882 3882 c, t dbSNP:138782094
3888 3888 c, t dbSNP:141150540
3891 3891 a, g dbSNP:776253891
3901 3901 a, g dbSNP:34505698
3902 3902 a, c dbSNP:769663336
3907 3907 a, g dbSNP:773141468
3908 3908 c, g, t dbSNP:762434314
3924 3924 c, g dbSNP:774019483
3939 3939 c, t dbSNP:373757863
3942 3942 g, t dbSNP:765747765
3947 3947 c, g dbSNP:750931031
3948 3948 c, g dbSNP:763514322
3951 3951 c, t dbSNP:137962409
3952 3952 c, t dbSNP:1063373
3953 3953 c, t dbSNP:751539960
3954 3954 a, g dbSNP:780444488
3955 3955 c, t dbSNP:781269433
3960 3960 c, g dbSNP:753009207
3962 3962 c, t dbSNP:755869696
3963 3963 a, g dbSNP:367639107
3966 3966 c, t dbSNP:199904029
3970 3970 g, t dbSNP:770796865
3973 3973 c, g dbSNP:778913439
3976 3976 a, c dbSNP:745363589
3979 3979 c, t dbSNP:771668852
3982 3982 a, g dbSNP:35889149
3984 3984 a, g dbSNP:374656305
3985 3985 a, g dbSNP:190362395
3992 3992 -, agggcattgtttttcaacatcca dbSNP:727503992
3993 3993 a, g dbSNP:773663900
3997 3997 a, g dbSNP:147291222
3998 3998 -, t dbSNP:751049992
3999 3999 -, t dbSNP:398123372
4019 4019 c, t dbSNP:763426547
4030 4030 a, g dbSNP:766732392
4031 4031 g, t dbSNP:140895872
4034 4034 a, g dbSNP:368240215
4035 4035 a, c dbSNP:373992160
4037 4037 c, t dbSNP:752801133
4043 4043 c, g dbSNP:531111148
4047 4047 a, g dbSNP:777981688
4054 4054 c, t dbSNP:143247439
4055 4055 a, c dbSNP:753562327
4063 4063 a, c, g dbSNP:201391981
4064 4064 a, c dbSNP:745866291
4071 4071 c, t dbSNP:542998514
4087 4087 c, t dbSNP:121913569
4089 4089 a, g dbSNP:779577371
4093 4093 a, g dbSNP:375043898
4097 4097 a, g dbSNP:368726141
4116 4116 c, g, t dbSNP:780154697
4119 4119 g, t dbSNP:754604600
4120 4120 g, t dbSNP:780982423
4126 4126 c, t dbSNP:747856074
4138 4138 a, g dbSNP:769358660
4146 4146 c, t dbSNP:774723745
4154 4154 a, g dbSNP:148597169
4156 4156 -, g dbSNP:35737747
4163 4163 c, t dbSNP:772561287
4172 4172 c, t dbSNP:776042035
4175 4175 c, t dbSNP:375051351
4186 4186 c, t dbSNP:200625655
4199 4199 a, g dbSNP:764206848
4201 4201 a, g dbSNP:571035066
4206 4206 g, t dbSNP:776801918
4208 4208 c, t dbSNP:142745227
4213 4213 a, c dbSNP:376886784
4230 4230 c, t dbSNP:138702650
4231 4231 a, g, t dbSNP:758134778
4232 4232 g, t dbSNP:751608288
4235 4235 a, g dbSNP:199833683
4240 4240 a, g dbSNP:780806324
4241 4241 c, t dbSNP:752166522
4242 4242 a, g dbSNP:755730974
4279 4279 a, g dbSNP:777291585
4297 4297 a, g dbSNP:755643402
4304 4304 a, t dbSNP:777467182
4305 4305 a, g dbSNP:753480807
4310 4310 a, g dbSNP:758730539
4325 4325 a, g dbSNP:780356271
4334 4334 c, g dbSNP:566723851
4336 4336 a, g dbSNP:769093977
4338 4338 a, t dbSNP:112327654
4345 4345 c, t dbSNP:398123373
4346 4346 a, g dbSNP:748257607
4350 4350 a, g dbSNP:762279924
4352 4352 a, t dbSNP:369051174
4356 4356 a, c dbSNP:773464447
4364 4364 c, t dbSNP:763128658
4366 4366 c, t dbSNP:151038492
4369 4369 c, t dbSNP:762409442
4370 4370 a, g dbSNP:771297225
4379 4379 a, g dbSNP:139739075
4382 4382 a, g dbSNP:35581247
4392 4392 c, g dbSNP:767554373
4398 4398 c, t dbSNP:752632649
4403 4403 a, g dbSNP:760208542
4405 4405 a, g dbSNP:763552119
4414 4414 a, g dbSNP:150743601
4417 4417 c, t dbSNP:756854513
4418 4418 a, g dbSNP:764883421
4420 4420 c, t dbSNP:751856350
4424 4424 a, g dbSNP:755403898
4429 4429 a, g dbSNP:143674727
4431 4431 g, t dbSNP:778344924
4444 4444 a, g dbSNP:749372185
4448 4448 a, g dbSNP:757467683
4465 4465 c, t dbSNP:779253125
4466 4466 a, g, t dbSNP:573563174
4467 4467 a, t dbSNP:540907929
4470 4470 a, g dbSNP:746835015
4477 4477 a, g dbSNP:764306823
4487 4487 c, t dbSNP:754163400
4492 4492 a, g dbSNP:146827694
4499 4499 c, t dbSNP:764778619
4519 4519 a, c dbSNP:772823668
4526 4526 a, t dbSNP:560139751
4533 4533 c, t dbSNP:766082530
4535 4535 c, t dbSNP:752934825
4548 4548 a, g, t dbSNP:141000104
4552 4552 c, t dbSNP:551074068
4556 4556 a, c, t dbSNP:539352717
4557 4557 a, g dbSNP:369076029
4567 4567 c, t dbSNP:775112258
4568 4568 a, c, g dbSNP:760541670
4573 4573 c, t dbSNP:762360002
4574 4574 a, g dbSNP:144830879
4576 4576 c, t dbSNP:750462615
4586 4586 g, t dbSNP:758571738
4591 4591 c, t dbSNP:780127363
4592 4592 a, g dbSNP:751858884
4594 4594 a, g dbSNP:754700198
4595 4595 a, c dbSNP:780928505
4597 4597 c, g dbSNP:747963781
4598 4598 c, t dbSNP:769665275
4601 4601 a, g dbSNP:727502850
4607 4607 c, t dbSNP:748730985
4608 4608 c, g dbSNP:770520233
4610 4610 g, t dbSNP:773842052
4613 4613 a, g dbSNP:759186554
4614 4614 c, t dbSNP:771871865
4616 4616 c, t dbSNP:777077267
4626 4626 a, g dbSNP:762272249
4627 4627 c, t dbSNP:145592885
4631 4631 a, c dbSNP:773828278
4632 4632 a, g dbSNP:374353607
4670 4670 c, t dbSNP:368379507
4671 4671 a, g dbSNP:751624462
4675 4675 c, t dbSNP:755182290
4677 4677 c, t dbSNP:201814504
4692 4692 a, t dbSNP:752960579
4695 4695 -, c dbSNP:375459476
4698 4698 c, t dbSNP:755884124
4707 4707 c, t dbSNP:763902373
4710 4710 c, t dbSNP:753608193
4717 4717 c, t dbSNP:200923373
4718 4718 a, g dbSNP:148905630
4735 4735 c, t dbSNP:745370327
4737 4737 c, t dbSNP:758048573
4749 4749 a, g dbSNP:779820882
4752 4752 a, g dbSNP:746706154
4756 4756 a, c dbSNP:768443697
4760 4760 a, g dbSNP:371682826
4764 4764 c, t dbSNP:749615729
4770 4770 a, g dbSNP:771407313
4782 4782 c, t dbSNP:774774975
4789 4789 a, t dbSNP:759584828
4805 4805 a, g dbSNP:772192897
4809 4809 c, g dbSNP:768910575
4819 4819 c, t dbSNP:776785855
4825 4825 a, g dbSNP:372576669
4831 4831 a, g dbSNP:200961385
4833 4833 a, t dbSNP:750264537
4839 4839 c, t dbSNP:35089085
4840 4840 a, g dbSNP:375640462
4846 4846 c, t dbSNP:751053800
4847 4847 a, g dbSNP:754501586
4848 4848 c, t dbSNP:372489296
4853 4853 a, c, t dbSNP:147987573
4854 4854 a, g dbSNP:779211391
4856 4856 c, t dbSNP:147077184
4859 4859 c, g dbSNP:772511086
4862 4862 c, t dbSNP:780597365
4864 4864 c, t dbSNP:564113854
4865 4865 a, g, t dbSNP:375100782
4867 4867 c, g dbSNP:776889674
4872 4872 c, t dbSNP:748267303
4892 4892 a, g dbSNP:770084568
4896 4896 c, t dbSNP:377192243
4901 4901 c, g dbSNP:770886363
4907 4907 a, g dbSNP:774313945
4910 4910 a, c dbSNP:759355376
4913 4913 -, g dbSNP:36123101
4913 4913 g, t dbSNP:370406703
4922 4922 a, g dbSNP:751611511
4923 4923 a, c dbSNP:767497614
4945 4945 g, t dbSNP:766296358
4960 4960 a, c dbSNP:774807922
4961 4961 c, g dbSNP:760292213
4964 4964 a, g dbSNP:763732088
4967 4967 a, g dbSNP:753529568
4971 4971 a, g dbSNP:758740309
4974 4974 c, g dbSNP:766680944
4983 4983 c, t dbSNP:751983542
4989 4989 a, c dbSNP:755373290
4992 4992 c, t dbSNP:781727788
4995 4995 c, t dbSNP:748160882
4999 4999 c, g dbSNP:374207670
5009 5009 c, t dbSNP:778106503
5010 5010 a, g dbSNP:749476549
5014 5014 c, t dbSNP:121913575
5015 5015 a, g dbSNP:778508100
5019 5019 a, t dbSNP:545186322
5023 5023 a, g dbSNP:771891309
5028 5028 a, g dbSNP:775566250
5030 5030 a, g dbSNP:760072728
5034 5034 c, g dbSNP:768204363
5035 5035 a, g dbSNP:776140105
5037 5037 a, g dbSNP:761415396
5038 5038 c, t dbSNP:764872873
5043 5043 c, t dbSNP:751812177
5044 5044 a, g dbSNP:377630412
5050 5050 a, c dbSNP:4143752
5054 5054 a, g dbSNP:767903280
5057 5057 -, gcat dbSNP:774051471
5061 5061 c, t dbSNP:753283130
5064 5064 a, c dbSNP:756236253
5065 5065 c, t dbSNP:777964192
5066 5066 a, g dbSNP:574923739
5068 5068 a, g dbSNP:371388948
5079 5079 c, g dbSNP:779255727
5080 5080 c, t dbSNP:745647209
5085 5085 c, t dbSNP:771944569
5102 5102 g, t dbSNP:779858148
5109 5109 a, c dbSNP:371629354
5118 5118 a, c, t dbSNP:754850670
5119 5119 a, c, g dbSNP:117781224
5131 5131 c, g, t dbSNP:568598684
5132 5132 a, g, t dbSNP:138765295
5137 5137 a, c, g dbSNP:143206604
5138 5138 a, g dbSNP:112172940
5141 5141 a, g dbSNP:143986011
5149 5149 a, g dbSNP:777320266
5155 5155 a, g dbSNP:774875437
5159 5159 a, g dbSNP:566008145
5163 5163 a, c dbSNP:750498322
5171 5171 c, t dbSNP:758579856
5172 5172 a, g dbSNP:766521929
5175 5175 g, t dbSNP:751340752
5176 5176 a, c dbSNP:754830528
5178 5178 a, t dbSNP:781073814
5180 5180 c, t dbSNP:748127741
5181 5181 a, g dbSNP:756024063
5186 5186 a, g dbSNP:777274086
5190 5190 a, c dbSNP:748765819
5192 5192 c, t dbSNP:539078237
5193 5193 c, g dbSNP:774217149
5200 5200 a, g dbSNP:368311687
5210 5210 a, g dbSNP:538466736
5224 5224 c, t dbSNP:769193696
5226 5226 a, g dbSNP:777158791
5227 5227 a, t dbSNP:762342110
5230 5230 -, c dbSNP:766166913
5238 5238 a, g dbSNP:147510409
5242 5242 a, c dbSNP:748473453
5245 5245 c, t dbSNP:369776766
5248 5248 c, t dbSNP:773658276
5249 5249 a, g dbSNP:763053961
5252 5252 a, c dbSNP:771044261
5257 5257 a, g dbSNP:774435152
5262 5262 a, g dbSNP:577763966
5263 5263 c, g dbSNP:767743721
5278 5278 a, c, g dbSNP:138303386
5283 5283 a, c dbSNP:764065508
5292 5292 c, t dbSNP:753770279
5295 5295 a, g dbSNP:62421010
5298 5298 c, t dbSNP:778529249
5299 5299 a, g dbSNP:182762857
5304 5304 a, c, t dbSNP:35579821
5305 5305 a, g dbSNP:748541803
5307 5307 a, g dbSNP:373116759
5313 5313 c, t dbSNP:111632017
5314 5314 a, c, g dbSNP:143215851
5321 5321 c, t dbSNP:112457889
5325 5325 c, g dbSNP:17057184
5328 5328 c, g dbSNP:759672711
5330 5330 a, c dbSNP:78642093
5333 5333 c, g dbSNP:376473961
5334 5334 c, t dbSNP:541197877
5338 5338 a, g dbSNP:370971334
5340 5340 c, g dbSNP:749664821
5342 5342 c, g dbSNP:757751668
5348 5348 a, g, t dbSNP:779466137
5352 5352 c, t dbSNP:772192888
5356 5356 c, g dbSNP:775662272
5361 5361 c, t dbSNP:143078882
5362 5362 a, g dbSNP:373997222
5374 5374 -, ga dbSNP:779085858
5375 5375 -, a dbSNP:748218196
5379 5379 c, g dbSNP:776231775
5382 5382 c, t dbSNP:761756877
5390 5390 a, g dbSNP:143333246
5405 5405 a, g dbSNP:377519984
5419 5419 a, c, g, t dbSNP:201632009
5422 5422 c, t dbSNP:751108067
5428 5428 c, t dbSNP:754518146
5429 5429 a, g dbSNP:767209477
5431 5431 g, t dbSNP:754200396
5443 5443 c, g dbSNP:567613582
5448 5448 a, c, t dbSNP:752400396
5458 5458 a, g dbSNP:193292430
5477 5477 c, t dbSNP:750792174
5485 5485 c, t dbSNP:758775001
5486 5486 a, c, g dbSNP:777116636
5490 5490 c, t dbSNP:151199929
5495 5495 a, c dbSNP:755123240
5504 5504 g, t dbSNP:781542342
5509 5509 c, t dbSNP:572008421
5512 5512 a, g dbSNP:539321303
5517 5517 a, g dbSNP:775297974
5518 5518 c, t dbSNP:749119417
5523 5523 a, g dbSNP:770758508
5527 5527 c, g dbSNP:760572086
5530 5530 a, c dbSNP:758950006
5540 5540 a, c, t dbSNP:140373926
5548 5548 a, c, g dbSNP:374201203
5553 5553 -, gag dbSNP:778205342
5559 5559 -, a dbSNP:747567057
5570 5570 a, g dbSNP:750774161
5571 5571 g, t dbSNP:550991169
5574 5574 a, g dbSNP:763443354
5587 5587 a, g dbSNP:575214111
5595 5595 c, t dbSNP:201149159
5600 5600 g, t dbSNP:755461457
5608 5608 a, g dbSNP:764391289
5616 5616 a, c, t dbSNP:149951387
5638 5638 c, t dbSNP:556074320
5640 5640 a, g dbSNP:745663593
5648 5648 a, g dbSNP:758319806
5649 5649 a, g dbSNP:376693904
5653 5653 c, g, t dbSNP:746492572
5654 5654 a, g dbSNP:138296015
5655 5655 a, g dbSNP:747795505
5656 5656 g, t dbSNP:769335993
5657 5657 a, g dbSNP:774715616
5660 5660 a, g dbSNP:141950826
5662 5662 a, g dbSNP:768131220
5666 5666 a, g dbSNP:145815606
5667 5667 a, g dbSNP:761289060
5675 5675 a, g dbSNP:764233553
5684 5684 g, t dbSNP:753871406
5686 5686 c, t dbSNP:138695453
5687 5687 a, g dbSNP:573287715
5688 5688 a, g dbSNP:201309072
5689 5689 -, a dbSNP:768458445
5696 5696 c, t dbSNP:200123250
5698 5698 g, t dbSNP:779942839
5704 5704 c, t dbSNP:746898932
5707 5707 a, g dbSNP:754937901
5716 5716 a, g dbSNP:780686763
5729 5729 c, g dbSNP:747621078
5734 5734 c, t dbSNP:769470637
5738 5738 c, t dbSNP:777353251
5743 5743 a, g dbSNP:746201268
5746 5746 a, g dbSNP:370181941
5751 5751 a, g, t dbSNP:565429072
5768 5768 c, t dbSNP:769062038
5771 5771 a, g dbSNP:776760209
5773 5773 c, t dbSNP:761866721
5774 5774 a, g, t dbSNP:141235562
5775 5775 a, c, g dbSNP:763182744
5778 5778 a, g dbSNP:751359270
5781 5781 g, t dbSNP:754852588
5795 5795 a, c dbSNP:775286908
5823 5823 a, g dbSNP:759312395
5827 5827 a, g dbSNP:767454788
5830 5830 a, g dbSNP:201172088
5835 5835 a, g dbSNP:3749877
5837 5837 a, g dbSNP:777082683
5838 5838 c, t dbSNP:753886576
5839 5839 a, g dbSNP:370150883
5840 5840 a, g dbSNP:778778914
5845 5845 c, t dbSNP:747349942
5846 5846 a, g dbSNP:373614496
5870 5870 a, g dbSNP:781638563
5871 5871 a, g dbSNP:3749878
5873 5873 a, g dbSNP:770335935
5876 5876 a, g dbSNP:753953549
5878 5878 a, g dbSNP:749423866
5881 5881 a, g dbSNP:771138153
5886 5886 c, t dbSNP:566014203
5887 5887 a, g dbSNP:759350875
5889 5889 a, t dbSNP:767179146
5898 5898 c, t dbSNP:775361763
5899 5899 a, c, t dbSNP:56173620
5900 5900 a, g dbSNP:150691000
5901 5901 c, t dbSNP:756871679
5905 5905 a, g dbSNP:764965268
5918 5918 a, g dbSNP:138983455
5921 5921 a, c dbSNP:758098650
5922 5922 c, t dbSNP:781341719
5925 5925 c, t dbSNP:748556232
5927 5927 g, t dbSNP:141911213
5931 5931 c, t dbSNP:778319385
5937 5937 c, t dbSNP:146304630
5945 5945 c, t dbSNP:754292437
5948 5948 a, c dbSNP:757768013
5962 5962 c, t dbSNP:563638833
5964 5964 a, t dbSNP:746019110
5965 5965 a, g dbSNP:772179469
5970 5970 g, t dbSNP:780368037
5974 5974 a, g dbSNP:746762473
5983 5983 g, t dbSNP:768525220
5989 5989 -, tagatgacc dbSNP:761284273
5996 5996 a, t dbSNP:776601177
5997 5997 a, c dbSNP:375298690
6002 6002 c, t dbSNP:139586720
6011 6011 c, t dbSNP:769864752
6014 6014 a, t dbSNP:772580722
6017 6017 a, g dbSNP:549790591
6024 6024 c, g dbSNP:368325295
6025 6025 c, t dbSNP:765916013
6032 6032 -, aga dbSNP:767066183
6036 6036 a, g, t dbSNP:372916842
6039 6039 g, t dbSNP:374587087
6041 6041 c, g dbSNP:754216711
6042 6042 c, t dbSNP:757749747
6044 6044 a, t dbSNP:779542581
6047 6047 c, t dbSNP:192672030
6048 6048 c, t dbSNP:750812143
6051 6051 a, g dbSNP:780024072
6057 6057 a, c, t dbSNP:573779258
6058 6058 a, g dbSNP:200518204
6066 6066 c, g dbSNP:748011930
6075 6075 -, ctcatct dbSNP:398123377
6079 6079 c, t dbSNP:566038803
6094 6094 c, g dbSNP:769846990
6095 6095 a, g dbSNP:773237240
6098 6098 c, t dbSNP:745451096
6103 6103 c, g dbSNP:771682107
6104 6104 a, t dbSNP:746876362
6106 6106 a, g dbSNP:775172799
6108 6108 g, t dbSNP:760346886
6109 6109 a, g, t dbSNP:765600723
6115 6115 a, c dbSNP:763461860
6118 6118 a, t dbSNP:727503993
6128 6128 a, g dbSNP:754865488
6134 6134 c, t dbSNP:751682186
6136 6136 a, g, t dbSNP:755144975
6138 6138 a, g dbSNP:200582139
6140 6140 c, g dbSNP:536077288
6141 6141 c, t dbSNP:777555158
6172 6172 a, g dbSNP:749049665
6182 6182 c, g, t dbSNP:376585927
6194 6194 c, g dbSNP:144318893
6196 6196 a, g dbSNP:745361072
6202 6202 a, g dbSNP:3828736
6206 6206 a, g dbSNP:775017229
6214 6214 c, g, t dbSNP:746608333
6218 6218 a, g dbSNP:144301099
6219 6219 g, t dbSNP:781116183
6227 6227 a, c dbSNP:766874168
6242 6242 a, g dbSNP:775625378
6248 6248 a, g dbSNP:375240974
6250 6250 a, g, t dbSNP:764356977
6268 6268 g, t dbSNP:762129616
6272 6272 a, g dbSNP:764948894
6278 6278 c, g dbSNP:148451013
6283 6283 c, t dbSNP:398123378
6290 6290 c, g dbSNP:758321892
6292 6292 g, t dbSNP:780030627
6295 6295 a, t dbSNP:751046931
6301 6301 a, c, t dbSNP:368316367
6306 6306 c, t dbSNP:747714599
6307 6307 a, g dbSNP:769574222
6310 6310 a, g dbSNP:779361221
6314 6314 a, g dbSNP:185009221
6318 6318 c, g dbSNP:746291076
6319 6319 c, t dbSNP:142637286
6329 6329 a, c dbSNP:775912205
6330 6330 c, t dbSNP:761267338
6331 6331 g, t dbSNP:768579735
6332 6332 g, t dbSNP:776780831
6347 6347 a, g dbSNP:752249871
6348 6348 a, c dbSNP:755735740
6349 6349 a, c dbSNP:186382094
6363 6363 a, g dbSNP:753504047
6368 6368 a, c dbSNP:756976076
6370 6370 a, g dbSNP:780228051
6371 6371 a, g dbSNP:151009169
6380 6380 -, a dbSNP:398123379
6396 6396 g, t dbSNP:570696604
6398 6398 c, g dbSNP:781744363
6401 6401 a, t dbSNP:748201053
6405 6405 c, t dbSNP:369582534
6407 6407 -, t dbSNP:398123380
6412 6412 a, c dbSNP:201248317
6416 6416 c, t dbSNP:773309064
6417 6417 a, g dbSNP:749442456
6424 6424 a, g dbSNP:771196571
6425 6425 c, g dbSNP:142276947
6430 6430 c, g dbSNP:759442502
6442 6442 a, c, g dbSNP:556367686
6443 6443 a, c dbSNP:180766121
6448 6448 a, c dbSNP:374006928
6456 6456 c, t dbSNP:760634116
6459 6459 a, c dbSNP:768774701
6463 6463 a, c, g dbSNP:776279074
6470 6470 a, t dbSNP:764778065
6481 6481 -, aag dbSNP:752953942
6491 6491 c, t dbSNP:750040135
6497 6497 a, g dbSNP:144155507
6499 6499 g, t dbSNP:767800885
6503 6503 a, g dbSNP:753070891
6504 6504 c, g, t dbSNP:756599307
6505 6505 a, c, g dbSNP:201265215
6506 6506 a, g dbSNP:778892148
6507 6507 c, t dbSNP:551256564
6509 6509 c, t dbSNP:112487709
6513 6513 c, t dbSNP:772199603
6514 6514 a, g dbSNP:774208594
6517 6517 a, g dbSNP:779984116
6519 6519 c, t dbSNP:114766691
6520 6520 a, g dbSNP:768688454
6526 6526 a, g dbSNP:752371766
6530 6530 a, g dbSNP:56035053
6536 6536 a, c dbSNP:73775407
6538 6538 c, g dbSNP:144970030
6541 6541 c, t dbSNP:772599361
6544 6544 c, t dbSNP:762605718
6546 6546 c, t dbSNP:766076921
6549 6549 a, g dbSNP:777476613
6552 6552 a, c dbSNP:775825512
6556 6556 a, g dbSNP:187633696
6564 6564 -, gaa dbSNP:758495000
6575 6575 a, g dbSNP:117884199
6576 6576 a, c dbSNP:143343647
6580 6580 a, c dbSNP:754331488
6584 6584 c, t dbSNP:757709716
6586 6586 c, g dbSNP:765304422
6588 6588 a, t dbSNP:750526928
6594 6594 c, t dbSNP:758692038
6595 6595 a, g dbSNP:767444868
6597 6597 c, t dbSNP:138994246
6598 6598 a, g dbSNP:142264176
6602 6602 a, g dbSNP:572675363
6603 6603 a, g dbSNP:56920166
6604 6604 a, t dbSNP:189718453
6605 6605 c, t dbSNP:200928844
6606 6606 a, g dbSNP:2297738
6608 6608 a, g dbSNP:770537658
6613 6613 a, g dbSNP:774039475
6615 6615 a, g dbSNP:759208547
6628 6628 c, t dbSNP:764376457
6634 6634 a, g dbSNP:776874173
6637 6637 a, c dbSNP:762370685
6639 6639 a, t dbSNP:767755286
6646 6646 a, g dbSNP:141857004
6648 6648 c, t dbSNP:141190803
6649 6649 a, g dbSNP:768846392
6651 6651 c, t dbSNP:368534834
6661 6661 a, g dbSNP:762056074
6676 6676 a, g dbSNP:764948730
6677 6677 a, g dbSNP:773077537
6678 6678 a, g dbSNP:762782062
6691 6691 c, t dbSNP:139824017
6692 6692 a, g dbSNP:750999777
6697 6697 a, t dbSNP:531424175
6701 6701 a, t dbSNP:371697379
6702 6702 -, a dbSNP:780224418
6708 6708 c, t dbSNP:752356162
6714 6714 c, t dbSNP:200364660
6717 6717 c, t dbSNP:779363244
6719 6719 a, g dbSNP:750866614
6774 6774 c, t dbSNP:376452979
6781 6781 c, t dbSNP:780662184
6787 6787 a, c dbSNP:747494566
6790 6790 a, g dbSNP:768685078
6795 6795 c, t dbSNP:150730793
6799 6799 a, c dbSNP:752034225
6805 6805 -, g dbSNP:760157054
6807 6807 a, g dbSNP:755485519
6812 6812 -, t dbSNP:770895341
6813 6813 a, g dbSNP:781231694
6819 6819 a, t dbSNP:370601545
6826 6826 a, g dbSNP:769976778
6832 6832 a, g dbSNP:369769253
6836 6836 c, g dbSNP:749496614
6838 6838 a, g dbSNP:770722239
6841 6841 g, t dbSNP:774022088
6842 6842 a, g dbSNP:759489267
6853 6853 a, g dbSNP:772194571
6860 6860 a, c dbSNP:775108859
6875 6875 a, g dbSNP:144845618
6878 6878 c, t dbSNP:763533627
6883 6883 a, g dbSNP:776304330
6887 6887 a, g dbSNP:529110314
6888 6888 c, t dbSNP:548215309
6889 6889 a, g dbSNP:566853691
6889 6889 -, g dbSNP:776548207
6894 6894 a, g dbSNP:199676897
6908 6908 a, t dbSNP:567385461
6912 6912 a, c dbSNP:373017804
6913 6913 c, t dbSNP:200550594
6916 6916 c, t dbSNP:140574226
6920 6920 c, t dbSNP:398123381
6928 6928 a, g dbSNP:756173043
6932 6932 a, g dbSNP:372592018
6936 6936 c, t dbSNP:748650667
6948 6948 c, t dbSNP:764178855
6962 6962 a, c dbSNP:753924399
6967 6967 c, t dbSNP:568648664
6968 6968 a, g dbSNP:779326725
6979 6979 c, g dbSNP:753068195
6987 6987 c, t dbSNP:746114691
6998 6998 c, t dbSNP:78880369
7001 7001 a, g dbSNP:368895765
7004 7004 c, g, t dbSNP:746883617
7016 7016 a, g dbSNP:371191809
7018 7018 a, g dbSNP:147857398
7020 7020 a, g dbSNP:139445956
7027 7027 a, c dbSNP:772807124
7028 7028 c, t dbSNP:367665458
7030 7030 c, g dbSNP:762627851
7035 7035 a, g dbSNP:772358536
7040 7040 c, t dbSNP:775847695
7050 7050 a, t dbSNP:140092288
7053 7053 c, t dbSNP:764576102
7060 7060 c, t dbSNP:374815503
7061 7061 a, g dbSNP:142536231
7066 7066 a, g dbSNP:150945378
7067 7067 c, t dbSNP:770516704
7071 7071 a, t dbSNP:372212378
7102 7102 a, g dbSNP:762385070
7105 7105 a, g dbSNP:765347938
7108 7108 c, g dbSNP:750585696
7109 7109 a, c dbSNP:763259978
7110 7110 c, g dbSNP:766743969
7121 7121 a, c dbSNP:546395293
7134 7134 g, t dbSNP:754683749
7142 7142 a, g dbSNP:781075479
7151 7151 a, g dbSNP:752512079
7153 7153 g, t dbSNP:752121048
7154 7154 c, t dbSNP:756061859
7155 7155 a, g dbSNP:398123382
7157 7157 c, t dbSNP:56209257
7158 7158 a, g dbSNP:770541414
7168 7168 a, g dbSNP:778379496
7173 7173 c, t dbSNP:745565928
7175 7175 c, t dbSNP:150237160
7176 7176 a, g dbSNP:538458745
7188 7188 c, g dbSNP:748587728
7192 7192 a, g dbSNP:770487838
7193 7193 c, g dbSNP:773390089
7201 7201 a, g dbSNP:146854942
7216 7216 g, t dbSNP:766592516
7238 7238 a, g dbSNP:781402843
7239 7239 a, g dbSNP:748561685
7244 7244 a, t dbSNP:749043823
7252 7252 c, t dbSNP:773802779
7253 7253 a, g dbSNP:142164767
7263 7263 a, g dbSNP:770846991
7267 7267 a, g dbSNP:770852976
7277 7277 c, t dbSNP:774505007
7285 7285 a, t dbSNP:759667823
7287 7287 -, at dbSNP:757404275
7287 7287 a, g dbSNP:373707295
7290 7290 c, t dbSNP:775116632
7296 7296 c, t dbSNP:575850136
7303 7303 c, t dbSNP:763907570
7316 7316 a, g dbSNP:753708601
7318 7318 a, g dbSNP:774181390
7321 7321 a, t dbSNP:757197871
7324 7324 c, t dbSNP:398123383
7325 7325 a, g, t dbSNP:750013590
7354 7354 a, g dbSNP:779800997
7365 7365 a, t dbSNP:765257252
7366 7366 c, g dbSNP:749875919
7377 7377 c, t dbSNP:762472683
7381 7381 a, g dbSNP:765834619
7385 7385 a, g dbSNP:751193296
7395 7395 a, g dbSNP:776065468
7399 7399 g, t dbSNP:778271978
7409 7409 g, t dbSNP:529981007
7420 7420 a, g dbSNP:140680416
7424 7424 c, g dbSNP:779524640
7426 7426 c, t dbSNP:145885540
7427 7427 a, g, t dbSNP:548483084
7435 7435 c, t dbSNP:747217321
7436 7436 a, g dbSNP:761365739
7438 7438 c, t dbSNP:566627612
7439 7439 a, g, t dbSNP:761714859
7442 7442 a, g dbSNP:773157433
7443 7443 a, c dbSNP:762806915
7444 7444 c, t dbSNP:535022442
7457 7457 c, t dbSNP:371403343
7459 7459 a, g dbSNP:376104852
7478 7478 c, t dbSNP:149561195
7480 7480 g, t dbSNP:150644209
7481 7481 a, c, g, t dbSNP:201274841
7487 7487 c, t dbSNP:758887080
7488 7488 a, c, g dbSNP:780101728
7490 7490 a, g dbSNP:755168390
7493 7493 a, c dbSNP:781340864
7497 7497 c, t dbSNP:748346885
7501 7501 a, t dbSNP:769562504
7508 7508 g, t dbSNP:758211853
7516 7516 a, c, t dbSNP:121913576
7517 7517 a, g dbSNP:771062387
7518 7518 a, g dbSNP:113590513
7540 7540 c, g dbSNP:760368292
7545 7545 c, g dbSNP:763694058
7549 7549 a, g dbSNP:773603352
7556 7556 a, g dbSNP:763250991
7557 7557 a, g dbSNP:766756624
7559 7559 a, g dbSNP:751993443
7566 7566 a, c dbSNP:755485562
7575 7575 c, t dbSNP:148313644
7576 7576 a, g dbSNP:141476898
7578 7578 c, t dbSNP:756332731
7579 7579 c, g dbSNP:777910444
7583 7583 a, g dbSNP:754136344
7592 7592 c, t dbSNP:371645941
7599 7599 c, t dbSNP:757077922
7600 7600 a, g dbSNP:199814707
7602 7602 c, t dbSNP:745744090
7608 7608 c, t dbSNP:147448682
7610 7610 a, g dbSNP:766375972
7613 7613 a, g dbSNP:534471045
7614 7614 a, g dbSNP:113359126
7619 7619 a, g dbSNP:147185142
7623 7623 c, t dbSNP:746548293
7642 7642 g, t dbSNP:768231787
7648 7648 -, ct dbSNP:398123385
7652 7652 c, g dbSNP:776104105
7670 7670 c, g dbSNP:769506673
7672 7672 a, g dbSNP:774669877
7684 7684 a, g, t dbSNP:759946630
7686 7686 a, c dbSNP:775822078
7689 7689 c, t dbSNP:372425108
7690 7690 a, g dbSNP:761249176
7705 7705 a, g dbSNP:764023933
7707 7707 a, g dbSNP:536825211
7713 7713 c, t dbSNP:199931560
7714 7714 a, c dbSNP:765605656
7724 7724 c, t dbSNP:750695778
7725 7725 a, g dbSNP:758085712
7726 7726 c, t dbSNP:766197313
7731 7731 a, t dbSNP:751392699
7735 7735 a, c, g dbSNP:754998274
7741 7741 -, t dbSNP:780496890
7745 7745 -, t dbSNP:749566145
7747 7747 c, t dbSNP:747699633
7760 7760 c, t dbSNP:755746372
7762 7762 a, g dbSNP:777360094
7764 7764 c, t dbSNP:140483001
7765 7765 a, g dbSNP:772258996
7774 7774 c, t dbSNP:775938293
7782 7782 c, t dbSNP:747459599
7783 7783 g, t dbSNP:769245429
7784 7784 g, t dbSNP:200921233
7785 7785 c, g dbSNP:567127715
7788 7788 c, g dbSNP:765438960
7790 7790 c, t dbSNP:773498119
7793 7793 c, t dbSNP:761500524
7798 7798 a, t dbSNP:766071796
7800 7800 a, t dbSNP:34367843
7805 7805 g, t dbSNP:754842981
7817 7817 c, g dbSNP:771227367
7821 7821 g, t dbSNP:777681212
7823 7823 c, t dbSNP:749436735
7835 7835 c, t dbSNP:774287164
7838 7838 a, c dbSNP:774596682
7846 7846 a, t dbSNP:759762587
7848 7848 c, t dbSNP:368989339
7849 7849 a, g dbSNP:775322557
7869 7869 a, g dbSNP:760602693
7883 7883 c, t dbSNP:764060943
7884 7884 a, c, g dbSNP:200364360
7886 7886 a, c dbSNP:764657750
7893 7893 a, t dbSNP:750030088
7895 7895 a, t dbSNP:578183193
7896 7896 c, t dbSNP:781685180
7898 7898 a, g dbSNP:753149303
7903 7903 -, c dbSNP:769582085
7903 7903 c, t dbSNP:756669467
7905 7905 -, c dbSNP:398123387
7905 7905 c, t dbSNP:778297793
7906 7906 a, g dbSNP:749794799
7928 7928 a, g dbSNP:770980196
7935 7935 c, t dbSNP:778872049
7936 7936 c, g dbSNP:746077104
7940 7940 a, g dbSNP:201918511
7944 7944 c, t dbSNP:754317320
7953 7953 a, c dbSNP:757763024
7957 7957 a, g dbSNP:199905856
7973 7973 a, g dbSNP:374210667
7978 7978 a, g dbSNP:540611163
7979 7979 c, t dbSNP:758599450
7983 7983 a, g dbSNP:542451891
7989 7989 a, c dbSNP:747235701
7993 7993 c, g dbSNP:768440157
7995 7995 a, g dbSNP:377631442
7999 7999 a, g dbSNP:147430700
8000 8000 c, t dbSNP:769655658
8005 8005 a, c, g dbSNP:565280107
8009 8009 a, c, g dbSNP:115488979
8013 8013 a, t dbSNP:776393787
8017 8017 a, g dbSNP:759127969
8025 8025 c, g dbSNP:764506187
8028 8028 a, g dbSNP:149867744
8037 8037 c, t dbSNP:757753192
8044 8044 a, g dbSNP:765714277
8049 8049 c, t dbSNP:750957928
8050 8050 a, c, g dbSNP:200341138
8055 8055 c, t dbSNP:201578157
8060 8060 c, t dbSNP:121913570
8062 8062 c, t dbSNP:747215316
8075 8075 g, t dbSNP:755222188
8077 8077 a, g dbSNP:144901086
8094 8094 a, g dbSNP:747941827
8096 8096 g, t dbSNP:769650593
8101 8101 c, t dbSNP:121913572
8102 8102 a, g dbSNP:530288620
8123 8123 a, g dbSNP:745422687
8129 8129 c, t dbSNP:2229848
8141 8141 a, g dbSNP:200095274
8149 8149 c, t dbSNP:546988105
8150 8150 a, g dbSNP:368311592
8162 8162 a, g dbSNP:773628741
8176 8176 g, t dbSNP:763419591
8179 8179 c, t dbSNP:766920075
8180 8180 a, g dbSNP:200853002
8181 8181 a, g dbSNP:752128135
8185 8185 a, g dbSNP:759492212
8186 8186 c, t dbSNP:767640802
8191 8191 a, g dbSNP:749353329
8195 8195 c, t dbSNP:752806166
8197 8197 a, g, t dbSNP:200710385
8199 8199 c, g dbSNP:2229849
8205 8205 a, g dbSNP:757241458
8213 8213 c, t dbSNP:771552354
8214 8214 a, g, t dbSNP:2229850
8221 8221 c, t dbSNP:757785686
8226 8226 c, t dbSNP:760441557
8229 8229 c, t dbSNP:779669979
8232 8232 a, g dbSNP:368710697
8237 8237 a, c dbSNP:188069926
8238 8238 a, g dbSNP:140658201
8239 8239 c, t dbSNP:746069321
8244 8244 c, t dbSNP:144448521
8245 8245 a, g dbSNP:749605696
8250 8250 g, t dbSNP:202247792
8257 8257 c, t dbSNP:727502851
8258 8258 a, g dbSNP:774656522
8275 8275 a, g dbSNP:2244008
8284 8284 a, g dbSNP:529243138
8301 8301 -, atacatgca dbSNP:762065775
8305 8305 -, a dbSNP:767707787
8326 8326 c, g dbSNP:748820968
8330 8330 c, t dbSNP:770609784
8332 8332 a, g dbSNP:775415222
8334 8334 a, c, t dbSNP:141101234
8338 8338 a, g dbSNP:776930004
8346 8346 a, c, g dbSNP:201597970
8347 8347 a, c dbSNP:201587923
8352 8352 c, t dbSNP:150184189
8354 8354 c, t dbSNP:138732723
8359 8359 g, t dbSNP:200094005
8362 8362 a, g dbSNP:751528737
8365 8365 c, g dbSNP:754416991
8380 8380 a, c dbSNP:780695627
8396 8396 a, g dbSNP:752334946
8397 8397 c, t dbSNP:35313209
8403 8403 c, t dbSNP:555978640
8408 8408 c, t dbSNP:74973588
8418 8418 c, t dbSNP:779116918
8421 8421 a, g dbSNP:201984588
8429 8429 c, t dbSNP:147057821
8439 8439 c, t dbSNP:564422670
8441 8441 c, g dbSNP:780669696
8489 8489 c, t dbSNP:758725194
8491 8491 c, g dbSNP:780581822
8493 8493 a, t dbSNP:34997144
8494 8494 c, t dbSNP:769324317
8495 8495 a, g, t dbSNP:199714288
8506 8506 c, t dbSNP:748206598
8514 8514 c, t dbSNP:769794867
8515 8515 c, t dbSNP:773417245
8516 8516 a, g dbSNP:142781107
8517 8517 -, tgaaga dbSNP:777540954
8517 8517 c, t dbSNP:147407422
8521 8521 a, g dbSNP:148051442
8525 8525 a, g dbSNP:141800867
8532 8532 a, g dbSNP:774200421
8539 8539 c, g dbSNP:759439358
8559 8559 a, g dbSNP:767492541
8565 8565 a, g dbSNP:752657884
8573 8573 c, t dbSNP:760196408
8574 8574 c, t dbSNP:559453268
8579 8579 a, c dbSNP:753475289
8580 8580 a, c dbSNP:369596190
8591 8591 c, t dbSNP:766816598
8592 8592 a, g dbSNP:150596964
8597 8597 c, t dbSNP:755412882
8598 8598 c, t dbSNP:80126151
8599 8599 a, c, g dbSNP:781750033
8602 8602 a, g dbSNP:756159043
8605 8605 c, t dbSNP:3189618
8607 8607 a, g dbSNP:777772973
8628 8628 a, c dbSNP:750127736
8630 8630 a, g dbSNP:139455685
8639 8639 c, t dbSNP:768006670
8641 8641 c, g dbSNP:753232104
8644 8644 c, g dbSNP:756645340
8645 8645 g, t dbSNP:201290833
8651 8651 c, t dbSNP:115650537
8667 8667 c, t dbSNP:145295628
8668 8668 a, c, g dbSNP:779071476
8670 8670 a, g dbSNP:139201047
8683 8683 a, t dbSNP:771798772
8693 8693 a, c dbSNP:144355650
8695 8695 a, g, t dbSNP:569286697
8705 8705 a, g dbSNP:202202014
8713 8713 a, c, g dbSNP:761364243
8717 8717 g, t dbSNP:772941682
8725 8725 c, t dbSNP:199806512
8726 8726 a, g, t dbSNP:767988083
8730 8730 c, t dbSNP:770540082
8742 8742 a, g dbSNP:531350653
8752 8752 a, g, t dbSNP:774076852
8754 8754 c, t dbSNP:142445491
8755 8755 a, g dbSNP:754290043
8757 8757 a, c dbSNP:184127828
8765 8765 c, g dbSNP:531496396
8766 8766 c, t dbSNP:750547682
8767 8767 a, g dbSNP:758491978
8768 8768 g, t dbSNP:749056462
8780 8780 a, c dbSNP:780096795
8782 8782 a, g dbSNP:376788876
8788 8788 c, g dbSNP:754671210
8789 8789 a, g dbSNP:781097647
8792 8792 a, t dbSNP:748093813
8795 8795 a, g dbSNP:769892018
8802 8802 c, t dbSNP:777400727
8813 8813 c, g dbSNP:748758336
8815 8815 c, g dbSNP:770507786
8833 8833 c, t dbSNP:199570699
8836 8836 c, t dbSNP:151334775
8838 8838 c, t dbSNP:768892366
8855 8855 c, t dbSNP:777051602
8856 8856 a, g dbSNP:762281061
8861 8861 c, g dbSNP:765680063
8864 8864 a, g dbSNP:140440782
8865 8865 a, g dbSNP:762872343
8874 8874 c, t dbSNP:766489982
8893 8893 a, g dbSNP:140178576
8897 8897 a, g dbSNP:73599293
8898 8898 g, t dbSNP:767388786
8922 8922 g, t dbSNP:763572005
8925 8925 -, aat dbSNP:398123389
8931 8931 a, t dbSNP:766363871
8933 8933 a, g dbSNP:774529491
8934 8934 c, t dbSNP:201276440
8938 8938 c, g dbSNP:767799742
8939 8939 a, g dbSNP:372956200
8940 8940 a, g dbSNP:188733817
8944 8944 a, g dbSNP:755908120
8945 8945 a, g dbSNP:768155936
8955 8955 c, t dbSNP:142451929
8958 8958 a, g dbSNP:200526970
8959 8959 c, g dbSNP:554254469
8960 8960 a, g dbSNP:778258870
8978 8978 c, g dbSNP:375980229
8979 8979 c, t dbSNP:199709403
8983 8983 a, g dbSNP:757873582
8986 8986 c, t dbSNP:779611273
8988 8988 -, a dbSNP:749162150
8996 8996 c, g dbSNP:746676097
8997 8997 c, t dbSNP:376119947
9003 9003 a, c dbSNP:201639153
9006 9006 c, g dbSNP:370496870
9007 9007 a, g dbSNP:146976290
9012 9012 c, t dbSNP:774742319
9013 9013 a, g dbSNP:138024644
9020 9020 c, t dbSNP:772282706
9024 9024 c, g dbSNP:775798455
9026 9026 a, g dbSNP:761037493
9030 9030 c, t dbSNP:763978489
9031 9031 g, t dbSNP:753712027
9048 9048 a, c dbSNP:761637800
9053 9053 c, g dbSNP:200705442
9058 9058 c, g dbSNP:750328754
9059 9059 a, g dbSNP:201696115
9060 9060 a, g dbSNP:2228599
9061 9061 a, c dbSNP:200718262
9067 9067 c, g dbSNP:373343822
9069 9069 c, t dbSNP:112144397
9073 9073 a, g dbSNP:754980023
9080 9080 a, g dbSNP:775781970
9083 9083 a, g dbSNP:760951115
9086 9086 c, t dbSNP:769052659
9090 9090 c, t dbSNP:144136299
9093 9093 c, g dbSNP:761598668
9096 9096 c, t dbSNP:148285711
9097 9097 a, g dbSNP:141479751
9103 9103 a, g dbSNP:762941185
9105 9105 g, t dbSNP:765843291
9109 9109 c, t dbSNP:751117756
9117 9117 a, c dbSNP:754506695
9121 9121 c, g dbSNP:780856651
9124 9124 c, t dbSNP:143026295
9128 9128 a, c dbSNP:757583844
9129 9129 c, t dbSNP:781063563
9130 9130 a, g dbSNP:139159258
9143 9143 c, t dbSNP:77113162
9151 9151 a, g dbSNP:780262871
9158 9158 a, g dbSNP:201129835
9161 9161 c, t dbSNP:747041167
9164 9164 c, g dbSNP:768618780
9168 9168 -, at dbSNP:762155745
9171 9171 -, t dbSNP:767797497
9188 9188 a, g dbSNP:776851018
9190 9190 a, g dbSNP:748373493
9204 9204 c, t dbSNP:377520412
9205 9205 a, g dbSNP:370843758
9209 9209 c, g dbSNP:762854429
9210 9210 a, c, t dbSNP:571590357
9211 9211 a, g, t dbSNP:143638361
9221 9221 a, t dbSNP:752383535
9225 9225 a, g dbSNP:755790741
9243 9243 a, g dbSNP:763608174
9244 9244 a, g dbSNP:753580084
9254 9254 g, t dbSNP:202200494
9257 9257 c, t dbSNP:139863980
9259 9259 g, t dbSNP:202159946
9263 9263 a, c dbSNP:149835486
9274 9274 c, t dbSNP:374888837
9275 9275 a, g dbSNP:748126149
9276 9276 c, t dbSNP:367622610
9279 9279 a, g dbSNP:777904253
9280 9280 a, g dbSNP:749526093
9283 9283 -, aca dbSNP:755458139
9283 9283 a, g dbSNP:770700904
9287 9287 a, c, t dbSNP:145842163
9288 9288 a, g dbSNP:771954617
9289 9289 a, c, t dbSNP:140202046
9293 9293 a, g dbSNP:564098225
9303 9303 a, g dbSNP:186155089
9308 9308 a, t dbSNP:776406561
9309 9309 a, c dbSNP:761621910
9310 9310 a, c, g dbSNP:766816458
9314 9314 g, t dbSNP:759965497
9316 9316 -, a dbSNP:765592025
9317 9317 a, c dbSNP:576128902
9325 9325 a, g dbSNP:753252236
9329 9329 c, g dbSNP:543481093
9331 9331 a, t dbSNP:777888228
9336 9336 c, t dbSNP:113885801
9339 9339 g, t dbSNP:754055398
9346 9346 a, g dbSNP:145331792
9351 9351 c, t dbSNP:79374915
9353 9353 a, g dbSNP:745604103
9356 9356 a, c dbSNP:771936475
9362 9362 a, c, t dbSNP:147928808
9369 9369 c, t dbSNP:746885546
9370 9370 c, g dbSNP:189360899
9376 9376 a, c dbSNP:371558408
9377 9377 a, g dbSNP:747619612
9378 9378 c, t dbSNP:148965119
9383 9383 a, c, t dbSNP:75048006
9384 9384 a, g dbSNP:2297739
9392 9392 c, t dbSNP:775964703
9395 9395 c, g dbSNP:761150291
9400 9400 a, g dbSNP:764537938
9403 9403 c, t dbSNP:777156120
9404 9404 a, g dbSNP:761837358
9407 9407 a, c dbSNP:765377729
9417 9417 c, t dbSNP:750584013
9423 9423 a, g dbSNP:376201708
9427 9427 c, t dbSNP:766077925
9429 9429 a, g dbSNP:368896579
9441 9441 a, g dbSNP:373092590
9446 9446 a, g dbSNP:374613653
9454 9454 a, g dbSNP:34551216
9459 9459 c, t dbSNP:371375023
9465 9465 a, g dbSNP:755664199
9466 9466 a, g dbSNP:377631865
9472 9472 c, t dbSNP:748888266
9473 9473 -, aaca dbSNP:398123390
9475 9475 c, t dbSNP:770673446
9476 9476 a, g, t dbSNP:371040858
9479 9479 c, t dbSNP:769036787
9480 9480 c, t dbSNP:777070146
9492 9492 c, t dbSNP:61749497
9493 9493 g, t dbSNP:765232205
9495 9495 a, t dbSNP:773403088
9497 9497 a, g dbSNP:762958440
9498 9498 a, g dbSNP:766559162
9507 9507 a, g dbSNP:201353206
9511 9511 a, g dbSNP:550370351
9514 9514 c, g dbSNP:146525742
9518 9518 c, g dbSNP:752650459
9525 9525 c, t dbSNP:377192371
9526 9526 c, t dbSNP:777133873
9530 9530 a, c dbSNP:151049890
9531 9531 a, g dbSNP:756723975
9532 9532 g, t dbSNP:778586094
9537 9537 a, c dbSNP:755427767
9542 9542 c, g dbSNP:768983341
9544 9544 a, g dbSNP:200255425
9548 9548 a, c dbSNP:748644783
9555 9555 c, t dbSNP:770280972
9557 9557 a, c dbSNP:151285465
9587 9587 c, t dbSNP:749809481
9592 9592 a, c dbSNP:771012835
9601 9601 c, g dbSNP:774640635
9602 9602 g, t dbSNP:368937576
9603 9603 -, aac dbSNP:768595889
9609 9609 a, c dbSNP:759819184
9614 9614 a, t dbSNP:772362189
9617 9617 c, t dbSNP:80082613
9618 9618 a, g dbSNP:761837666
9621 9621 c, t dbSNP:763815272
9622 9622 c, t dbSNP:121913571
9623 9623 a, g dbSNP:776606476
9629 9629 c, g dbSNP:761693027
9630 9630 c, t dbSNP:764718992
9631 9631 a, g dbSNP:768834542
9637 9637 a, t dbSNP:757911372
9638 9638 c, t dbSNP:765978739
9646 9646 c, t dbSNP:751194768
9663 9663 a, c, g dbSNP:756479964
9664 9664 a, t dbSNP:749797580
9670 9670 a, c dbSNP:757897157
9671 9671 a, t dbSNP:779575092
9676 9676 -, ttaat dbSNP:774309504
9688 9688 a, g dbSNP:745875024
9693 9693 c, t dbSNP:772307177
9697 9697 a, g dbSNP:140829166
9698 9698 -, a dbSNP:747934186
9700 9700 c, t dbSNP:751875013
9707 9707 a, g dbSNP:747241070
9708 9708 c, t dbSNP:182391310
9709 9709 a, g, t dbSNP:200796753
9712 9712 c, t dbSNP:765096629
9715 9715 c, t dbSNP:773168020
9717 9717 g, t dbSNP:762403764
9720 9720 a, g dbSNP:765925469
9729 9729 a, g dbSNP:751194203
9735 9735 -, taat dbSNP:772463361
9735 9735 a, c dbSNP:754654989
9738 9738 a, t dbSNP:764506272
9741 9741 -, aaat dbSNP:773563829
9754 9754 c, t dbSNP:541534425
9762 9762 -, ag, gagt dbSNP:760867800
9763 9763 a, g dbSNP:757699316
9766 9766 -, tc dbSNP:776709087
9779 9779 c, g dbSNP:779521697
9784 9784 c, t dbSNP:376934472
9785 9785 a, c dbSNP:758527299
9788 9788 a, g dbSNP:780034553
9789 9789 a, c, t dbSNP:747246486
9790 9790 -, aaac dbSNP:765687850
9791 9791 -, aaac dbSNP:759994977
9795 9795 a, c dbSNP:1049473
9798 9798 -, aaat dbSNP:140699127
9801 9801 -, taaa dbSNP:111454788
9842 9842 c, t dbSNP:770213087
9856 9856 c, t dbSNP:1049476
9861 9861 a, g dbSNP:763361790
9927 9927 -, aat dbSNP:150424940
9929 9929 -, taa dbSNP:3062450
9931 9931 -, ata dbSNP:371188338
9931 9931 a, t dbSNP:201080256
9957 9957 a, g dbSNP:113910634

Target ORF information:

RefSeq Version XM_005266981
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens laminin, alpha 2 (LAMA2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu58673
Accession Version XM_011535820.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 9627bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product laminin subunit alpha-2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_025741.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)220..960(+)
Misc Feature(2)964..1107(+)
Misc Feature(3)964..1059(+)
Misc Feature(4)1342..1500(+)
Misc Feature(5)1345..1464(+)
Misc Feature(6)1507..1650(+)
Misc Feature(7)1510..1596(+)
Misc Feature(8)1837..2235(+)
Misc Feature(9)2371..2520(+)
Misc Feature(10)2374..2460(+)
Misc Feature(11)2521..2694(+)
Misc Feature(12)2524..2637(+)
Misc Feature(13)2695..2853(+)
Misc Feature(14)2698..2799(+)
Misc Feature(15)2854..2991(+)
Misc Feature(16)2857..2949(+)
Misc Feature(17)3004..>3096(+)
Misc Feature(18)3004..3093(+)
Misc Feature(19)3265..3399(+)
Misc Feature(20)3268..3357(+)
Misc Feature(21)3406..3543(+)
Misc Feature(22)3409..3492(+)
Misc Feature(23)3544..3672(+)
Misc Feature(24)3547..3639(+)
Misc Feature(25)3685..3858(+)
Misc Feature(26)3685..3804(+)
Misc Feature(27)4054..4461(+)
Misc Feature(28)4624..4770(+)
Misc Feature(29)4627..4713(+)
Misc Feature(30)4774..4944(+)
Misc Feature(31)4774..4887(+)
Misc Feature(32)4948..5091(+)