
LAMB3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol LAMB3
Entrez Gene ID 3914
Full Name laminin, beta 3
Synonyms AI1A, BM600-125KDA, LAM5, LAMNB1
General protein information
Preferred Names
laminin subunit beta-3
laminin subunit beta-3
kalinin B1 chain
laminin B1k chain
laminin S B3 chain
nicein subunit beta
kalinin subunit beta
epiligrin subunit bata
laminin-5 subunit beta
laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Epidermolysis bullosa, junctional, Herlitz type, 226700 (3);

The following LAMB3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LAMB3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu17378 XM_005273124 PREDICTED: Homo sapiens laminin, beta 3 (LAMB3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu17378 NM_001127641 Homo sapiens laminin, beta 3 (LAMB3), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu17378 NM_000228 Homo sapiens laminin, beta 3 (LAMB3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu17378 NM_001017402 Homo sapiens laminin, beta 3 (LAMB3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu17378
Accession Version XM_005273124.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3519bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product laminin subunit beta-3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_004487.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578800921. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)380..1066(+)
Misc Feature(2)1067..1234(+)
Misc Feature(3)1070..1192(+)
Misc Feature(4)1265..1429(+)
Misc Feature(5)1268..1387(+)
Misc Feature(6)1454..1609(+)
Misc Feature(7)1457..1552(+)
Misc Feature(8)1610..1759(+)
Misc Feature(9)1613..1708(+)
Misc Feature(10)1760..1918(+)
Misc Feature(11)1763..1855(+)
Misc Feature(12)1919..2068(+)
Misc Feature(13)1922..2014(+)
Misc Feature(14)2852..3535(+)
Misc Feature(15)2906..3550(+)
Misc Feature(16)2939..3550(+)
Misc Feature(17)3197..3313(+)
Position Chain Variation Link
11 11 a, t dbSNP:10779510
36 36 c, t dbSNP:529445525
58 58 a, c dbSNP:141535940
60 60 a, c dbSNP:182732990
80 80 a, g dbSNP:139385236
90 90 c, t dbSNP:189786385
91 91 a, g dbSNP:560478488
95 95 g, t dbSNP:545707069
102 102 a, g dbSNP:572041580
117 117 c, t dbSNP:553758995
162 162 a, g dbSNP:772546177
194 194 c, t dbSNP:776076638
250 250 a, g dbSNP:186529075
268 268 c, t dbSNP:574535102
280 280 c, t dbSNP:116693308
287 287 a, t dbSNP:757463127
290 290 a, g dbSNP:547771685
308 308 c, t dbSNP:764990667
309 309 a, c dbSNP:369316294
315 315 c, g dbSNP:369518861
316 316 a, g dbSNP:753697952
325 325 a, g dbSNP:766177957
330 330 a, c dbSNP:760672832
332 332 c, t dbSNP:116218572
337 337 c, t dbSNP:140470350
338 338 c, t dbSNP:113185295
352 352 c, t dbSNP:114304155
353 353 -, c dbSNP:777672897
360 360 g, t dbSNP:746335563
374 374 c, t dbSNP:777231178
377 377 a, c, g dbSNP:200672750
383 383 a, t dbSNP:751818569
387 387 a, c, t dbSNP:147620922
389 389 c, t dbSNP:115191959
390 390 a, g, t dbSNP:139480015
392 392 g, t dbSNP:750218343
396 396 c, t dbSNP:781227957
401 401 -, t dbSNP:751141486
401 401 c, t dbSNP:757278127
404 404 c, t dbSNP:751050188
407 407 c, t dbSNP:763767212
411 411 c, t dbSNP:116643086
418 418 c, t dbSNP:752440951
426 426 c, t dbSNP:765484485
437 437 c, t dbSNP:759900167
438 438 a, g dbSNP:146125956
446 446 c, t dbSNP:80356680
447 447 a, g dbSNP:761173046
460 460 c, t dbSNP:2228339
490 490 c, t dbSNP:772245138
492 492 c, t dbSNP:748289290
496 496 a, g dbSNP:779157351
502 502 c, t dbSNP:114295238
503 503 a, g dbSNP:765935706
505 505 a, g dbSNP:745623000
506 506 a, t dbSNP:753545651
513 513 a, t dbSNP:201830202
516 516 a, c, g dbSNP:375522351
534 534 c, t dbSNP:756431966
535 535 -, c dbSNP:765981678
535 535 c, t dbSNP:566813980
538 538 a, g dbSNP:765883028
539 539 c, t dbSNP:762234799
541 541 a, g dbSNP:774488682
589 589 a, c, t dbSNP:143833060
590 590 a, g dbSNP:775892223
591 591 a, g dbSNP:770169154
593 593 a, c dbSNP:371036275
597 597 c, t dbSNP:746748625
599 599 c, t dbSNP:772891857
600 600 a, g dbSNP:771977502
604 604 a, g dbSNP:748099677
613 613 a, c dbSNP:2076356
628 628 a, c dbSNP:376274555
629 629 c, g, t dbSNP:200105150
636 636 c, g dbSNP:768605252
644 644 c, g dbSNP:748738681
654 654 a, g dbSNP:55824996
655 655 c, t dbSNP:769435295
657 657 a, g dbSNP:745569387
659 659 a, c, g dbSNP:371231587
661 661 a, t dbSNP:199599061
662 662 g, t dbSNP:372620941
664 664 c, t dbSNP:758983287
667 667 a, g dbSNP:752754551
681 681 c, t dbSNP:765479137
694 694 a, g dbSNP:759819148
696 696 c, g dbSNP:574291969
697 697 c, g dbSNP:776214216
701 701 a, c dbSNP:202025705
706 706 c, t dbSNP:1130667
709 709 c, t dbSNP:374988953
710 710 a, g, t dbSNP:769334793
724 724 a, g dbSNP:183509078
725 725 c, t dbSNP:372985506
726 726 a, g dbSNP:148603717
731 731 a, t dbSNP:780249357
739 739 c, t dbSNP:201554705
740 740 a, g, t dbSNP:749618741
747 747 c, t dbSNP:758154155
751 751 a, c, g dbSNP:369555024
752 752 c, t dbSNP:759518184
753 753 a, c, g dbSNP:375668443
754 754 a, g dbSNP:760221702
766 766 c, t dbSNP:200607251
767 767 c, t dbSNP:372787389
768 768 -, acct dbSNP:746705740
775 775 c, t dbSNP:369986809
776 776 a, g dbSNP:748466087
781 781 c, t dbSNP:565416040
784 784 a, c dbSNP:375815552
785 785 -, t dbSNP:776537364
793 793 c, t dbSNP:749866341
794 794 c, t dbSNP:779979101
797 797 c, t dbSNP:116472735
798 798 a, g, t dbSNP:528873916
801 801 g, t dbSNP:192538322
804 804 a, g dbSNP:752418863
812 812 c, t dbSNP:764027121
813 813 a, g dbSNP:754855375
814 814 c, g dbSNP:753862334
817 817 c, t dbSNP:765773474
818 818 c, t dbSNP:121912483
823 823 c, g dbSNP:772869809
836 836 c, t dbSNP:767212880
837 837 a, g, t dbSNP:550005240
842 842 c, t dbSNP:769114930
843 843 a, g, t dbSNP:776028142
863 863 a, g dbSNP:2235542
869 869 c, t dbSNP:116124880
870 870 a, g dbSNP:150895872
871 871 a, c dbSNP:771134182
878 878 c, g dbSNP:747286969
879 879 a, g, t dbSNP:200501999
881 881 a, g dbSNP:375282891
882 882 a, g dbSNP:779991209
883 883 g, t dbSNP:756125849
898 898 c, t dbSNP:765643345
900 900 g, t dbSNP:760011884
904 904 g, t dbSNP:75876132
905 905 g, t dbSNP:748912418
912 912 a, t dbSNP:766901705
918 918 c, g dbSNP:121912486
919 919 g, t dbSNP:373068469
933 933 a, g dbSNP:773179112
934 934 a, g dbSNP:772335033
936 936 c, g dbSNP:748377271
938 938 c, t dbSNP:775405524
941 941 a, c dbSNP:121912487
944 944 -, a dbSNP:768303931
950 950 a, g dbSNP:121912482
951 951 a, g dbSNP:761090321
952 952 a, g dbSNP:773329364
957 957 c, g dbSNP:767543203
963 963 c, t dbSNP:372806619
964 964 c, t dbSNP:774677423
972 972 c, t dbSNP:769024097
973 973 g, t dbSNP:369436088
975 975 a, c, g dbSNP:770902074
988 988 c, t dbSNP:746973120
991 991 a, g dbSNP:200235429
993 993 c, t dbSNP:138986366
994 994 g, t dbSNP:747721994
1000 1000 c, t dbSNP:778486899
1011 1011 c, g dbSNP:61734502
1014 1014 g, t dbSNP:143725782
1019 1019 -, c dbSNP:774418654
1023 1023 a, c dbSNP:766795526
1027 1027 c, t dbSNP:554528737
1029 1029 c, g dbSNP:750934724
1030 1030 c, t dbSNP:768102929
1031 1031 a, g dbSNP:761752478
1037 1037 -, tatgctgt dbSNP:771217575
1043 1043 a, g dbSNP:751706367
1049 1049 c, t dbSNP:80356681
1052 1052 c, t dbSNP:763338054
1055 1055 c, t dbSNP:776549945
1056 1056 a, g dbSNP:114886812
1066 1066 a, c, g dbSNP:772980989
1069 1069 c, t dbSNP:772067391
1077 1077 g, t dbSNP:747598160
1081 1081 c, t dbSNP:778399071
1086 1086 a, c dbSNP:768293920
1087 1087 c, t dbSNP:748990020
1093 1093 c, t dbSNP:780435765
1094 1094 c, t dbSNP:145575474
1095 1095 a, g dbSNP:568932560
1099 1099 c, t dbSNP:146529524
1100 1100 a, g dbSNP:113063967
1103 1103 c, g, t dbSNP:537985381
1134 1134 a, c dbSNP:115812503
1135 1135 c, g, t dbSNP:146690433
1136 1136 a, g, t dbSNP:371543476
1137 1137 a, c dbSNP:771836143
1138 1138 c, t dbSNP:761804631
1139 1139 c, g dbSNP:201231089
1142 1142 c, g dbSNP:773837164
1146 1146 c, t dbSNP:758985269
1150 1150 c, g dbSNP:182105392
1151 1151 a, g dbSNP:369999185
1154 1154 c, g dbSNP:554334415
1180 1180 a, c, t dbSNP:200006309
1181 1181 a, g dbSNP:144788254
1184 1184 c, t dbSNP:149420629
1189 1189 c, t dbSNP:115579649
1193 1193 a, g dbSNP:763950597
1196 1196 c, t dbSNP:762942741
1197 1197 a, g, t dbSNP:12091253
1199 1199 a, t dbSNP:759084687
1201 1201 g, t dbSNP:776310420
1202 1202 a, g dbSNP:770733108
1205 1205 c, t dbSNP:747323019
1213 1213 c, t dbSNP:371462192
1215 1215 a, g dbSNP:772703970
1220 1220 c, t dbSNP:368834085
1221 1221 a, g dbSNP:376688965
1224 1224 c, t dbSNP:577878087
1226 1226 -, t dbSNP:786205094
1232 1232 c, t dbSNP:768740994
1233 1233 c, t dbSNP:114394307
1234 1234 a, g dbSNP:371979667
1236 1236 c, t dbSNP:756331697
1237 1237 a, g dbSNP:751348872
1242 1242 a, g, t dbSNP:758243149
1244 1244 a, c dbSNP:752716711
1249 1249 a, c, t dbSNP:141059189
1250 1250 a, g dbSNP:140216548
1251 1251 c, t dbSNP:199755124
1258 1258 a, g dbSNP:760472886
1261 1261 c, t dbSNP:773700438
1263 1263 -, t dbSNP:770449058
1263 1263 a, c dbSNP:772614360
1270 1270 c, t dbSNP:779681550
1272 1272 -, ac dbSNP:746735166
1274 1274 -, t dbSNP:779588133
1275 1275 -, tga dbSNP:758005073
1276 1276 c, t dbSNP:755645935
1277 1277 -, t dbSNP:749956696
1278 1278 a, g dbSNP:749966322
1279 1279 -, t dbSNP:764704766
1281 1281 -, aggtgtgtgtgacaagg dbSNP:757224556
1285 1285 c, g dbSNP:371132145
1290 1290 a, g dbSNP:185105348
1293 1293 c, t dbSNP:756925528
1299 1299 -, a dbSNP:753711190
1300 1300 -, c dbSNP:763559509
1300 1300 c, t dbSNP:145473444
1306 1306 a, c, t dbSNP:764412477
1308 1308 c, t dbSNP:567822076
1310 1310 a, g, t dbSNP:555662201
1329 1329 a, g dbSNP:759558086
1330 1330 a, g dbSNP:114404740
1337 1337 c, t dbSNP:52814161
1338 1338 a, g dbSNP:747255131
1339 1339 g, t dbSNP:774174881
1356 1356 a, c dbSNP:768377367
1360 1360 c, t dbSNP:749126992
1361 1361 c, g, t dbSNP:375680175
1362 1362 a, g dbSNP:745366407
1372 1372 c, t dbSNP:76690225
1373 1373 a, g dbSNP:114875539
1378 1378 c, g dbSNP:373815949
1385 1385 c, t dbSNP:532875477
1391 1391 c, t dbSNP:548096567
1392 1392 g, t dbSNP:149360787
1394 1394 c, t dbSNP:758709728
1402 1402 a, g dbSNP:116607807
1407 1407 a, g dbSNP:765669683
1412 1412 c, t dbSNP:370699820
1413 1413 a, g dbSNP:776762253
1418 1418 c, t dbSNP:142542174
1421 1421 a, c, t dbSNP:140336145
1422 1422 a, g dbSNP:772446912
1425 1425 c, t dbSNP:549692468
1426 1426 a, g dbSNP:376561409
1441 1441 a, g dbSNP:769838988
1443 1443 a, g dbSNP:544881628
1446 1446 a, c dbSNP:565286176
1459 1459 c, t dbSNP:762182152
1462 1462 a, g dbSNP:372967322
1465 1465 a, t dbSNP:769748910
1470 1470 c, t dbSNP:759403991
1471 1471 a, g dbSNP:2076351
1472 1472 a, g dbSNP:267598351
1473 1473 a, g dbSNP:115433823
1476 1476 g, t dbSNP:746441639
1490 1490 g, t dbSNP:370805844
1493 1493 c, t dbSNP:541302403
1499 1499 a, g dbSNP:189196778
1508 1508 a, g dbSNP:771702350
1510 1510 c, t dbSNP:115883756
1511 1511 a, g dbSNP:779219301
1516 1516 a, g dbSNP:116602483
1520 1520 c, g dbSNP:550298199
1523 1523 -, tg dbSNP:775285992
1534 1534 c, t dbSNP:780367752
1537 1537 a, g dbSNP:756709484
1544 1544 c, g dbSNP:145170416
1547 1547 a, c dbSNP:750455797
1558 1558 a, g dbSNP:202113091
1566 1566 c, t dbSNP:755841333
1567 1567 a, g dbSNP:572149945
1573 1573 c, t dbSNP:764431791
1580 1580 c, g dbSNP:376412573
1585 1585 -, ctac dbSNP:766741809
1586 1586 a, t dbSNP:776493641
1588 1588 c, t dbSNP:766227083
1589 1589 a, g dbSNP:139404117
1596 1596 c, t dbSNP:150917125
1597 1597 a, g, t dbSNP:148726330
1606 1606 c, t dbSNP:142876683
1610 1610 c, g, t dbSNP:767490741
1623 1623 a, g dbSNP:746254246
1624 1624 c, t dbSNP:781740513
1625 1625 a, g dbSNP:757840096
1626 1626 a, t dbSNP:747084268
1634 1634 a, t dbSNP:2229468
1637 1637 c, t dbSNP:758529827
1641 1641 g, t dbSNP:753007019
1650 1650 c, t dbSNP:202096620
1651 1651 a, g dbSNP:371309063
1652 1652 c, t dbSNP:199952752
1657 1657 c, g, t dbSNP:374430633
1658 1658 a, g dbSNP:749069550
1662 1662 a, t dbSNP:370106489
1665 1665 a, g dbSNP:763698625
1669 1669 a, g dbSNP:762400142
1670 1670 c, t dbSNP:200895463
1679 1679 g, t dbSNP:769342279
1687 1687 -, ca dbSNP:769967565
1691 1691 a, g dbSNP:370089561
1695 1695 c, t dbSNP:201559735
1709 1709 -, g dbSNP:748758397
1721 1721 c, t dbSNP:777199704
1735 1735 a, g dbSNP:112316651
1745 1745 a, g dbSNP:147986178
1751 1751 a, g dbSNP:375152403
1753 1753 c, t dbSNP:376505059
1755 1755 a, g dbSNP:748199854
1761 1761 -, cgtgt dbSNP:786205095
1761 1761 c, t dbSNP:61734494
1762 1762 a, g dbSNP:779846779
1768 1768 c, t dbSNP:750215205
1771 1771 c, t dbSNP:781012508
1772 1772 a, g dbSNP:372654158
1776 1776 c, t dbSNP:751474007
1784 1784 g, t dbSNP:763960179
1799 1799 c, t dbSNP:762462819
1802 1802 a, c dbSNP:752148248
1804 1804 a, c dbSNP:764935884
1806 1806 a, g dbSNP:114315478
1815 1815 a, g, t dbSNP:770003713
1823 1823 c, t dbSNP:746810833
1824 1824 c, t dbSNP:777484868
1829 1829 c, t dbSNP:758331576
1830 1830 a, g dbSNP:202095584
1838 1838 a, t dbSNP:145548817
1839 1839 g, t dbSNP:754492217
1844 1844 a, g dbSNP:753412479
1848 1848 a, t dbSNP:570482366
1858 1858 c, t dbSNP:375260663
1863 1863 a, c dbSNP:750788587
1868 1868 a, g dbSNP:148988085
1871 1871 c, t dbSNP:78788119
1877 1877 a, t dbSNP:774790556
1880 1880 c, t dbSNP:764597128
1883 1883 g, t dbSNP:149855893
1886 1886 c, t dbSNP:775608853
1887 1887 a, g dbSNP:144249951
1888 1888 c, g dbSNP:746121545
1893 1893 a, g dbSNP:773032458
1896 1896 c, g dbSNP:771727419
1900 1900 c, t dbSNP:567151867
1901 1901 a, g dbSNP:2076349
1908 1908 c, t dbSNP:754971420
1909 1909 -, ag dbSNP:769151482
1916 1916 c, t dbSNP:757145297
1917 1917 a, g dbSNP:748803172
1923 1923 c, g dbSNP:749288167
1925 1925 a, g dbSNP:141723352
1927 1927 c, t dbSNP:769135594
1928 1928 c, t dbSNP:745396663
1931 1931 a, g dbSNP:780641517
1933 1933 c, t dbSNP:756997937
1937 1937 c, t dbSNP:200300715
1938 1938 a, g dbSNP:530692211
1941 1941 a, g dbSNP:758869121
1944 1944 c, g dbSNP:753165127
1949 1949 a, g dbSNP:765797641
1950 1950 -, g dbSNP:747341006
1953 1953 c, t dbSNP:563186752
1954 1954 a, g dbSNP:753960912
1960 1960 c, t dbSNP:555155357
1961 1961 a, g dbSNP:761037344
1963 1963 a, c dbSNP:774266864
1967 1967 a, g dbSNP:768613245
1973 1973 a, g dbSNP:762860854
1976 1976 c, t dbSNP:767004520
1977 1977 a, g dbSNP:201154610
1980 1980 a, g dbSNP:375264939
1988 1988 c, t dbSNP:745365535
1989 1989 a, g, t dbSNP:371013768
1990 1990 c, t dbSNP:777689673
1992 1992 c, t dbSNP:746700898
1999 1999 g, t dbSNP:114274965
2002 2002 c, t dbSNP:376183751
2003 2003 a, g dbSNP:748528323
2009 2009 c, t dbSNP:779224166
2010 2010 a, c, g dbSNP:753850608
2018 2018 c, g dbSNP:766530868
2023 2023 c, t dbSNP:756375245
2025 2025 a, g dbSNP:540286145
2027 2027 c, t dbSNP:201551805
2028 2028 a, c, g dbSNP:368764676
2031 2031 g, t dbSNP:200027100
2038 2038 c, t dbSNP:2179402
2040 2040 a, g dbSNP:373642074
2043 2043 a, g dbSNP:370280436
2049 2049 c, g, t dbSNP:202063530
2050 2050 a, g dbSNP:771720883
2056 2056 c, t dbSNP:138710333
2057 2057 a, g dbSNP:779392542
2075 2075 c, t dbSNP:755418511
2078 2078 c, t dbSNP:749842554
2080 2080 a, g dbSNP:780457747
2083 2083 a, c dbSNP:185451408
2085 2085 a, g dbSNP:750534260
2086 2086 c, t dbSNP:2229465
2089 2089 c, t dbSNP:757611041
2091 2091 c, t dbSNP:143370006
2092 2092 a, g dbSNP:143594988
2099 2099 c, t dbSNP:146647886
2100 2100 a, g dbSNP:546638996
2104 2104 c, g dbSNP:766320452
2108 2108 a, g, t dbSNP:374016408
2109 2109 c, t dbSNP:370897270
2114 2114 c, t dbSNP:139547896
2115 2115 a, g dbSNP:139555809
2116 2116 -, t dbSNP:35794952
2116 2116 c, t dbSNP:377645754
2117 2117 c, t dbSNP:749625880
2129 2129 c, t dbSNP:374239232
2130 2130 a, g, t dbSNP:114651102
2140 2140 c, t dbSNP:781466716
2141 2141 a, g dbSNP:150564174
2143 2143 c, t dbSNP:751762651
2151 2151 c, g dbSNP:371154345
2152 2152 a, g dbSNP:121912484
2159 2159 c, t dbSNP:147438032
2164 2164 a, g dbSNP:753583338
2174 2174 c, t dbSNP:200108885
2175 2175 a, g dbSNP:760667887
2182 2182 a, g dbSNP:749913780
2183 2183 c, g dbSNP:767055039
2184 2184 c, t dbSNP:142689095
2186 2186 c, t dbSNP:774009013
2189 2189 a, c, t dbSNP:763369856
2190 2190 a, g dbSNP:145841733
2195 2195 c, t dbSNP:563197235
2198 2198 a, g dbSNP:746413547
2200 2200 g, t dbSNP:377744457
2206 2206 g, t dbSNP:770992053
2210 2210 a, g dbSNP:747071130
2211 2211 a, g dbSNP:777987443
2213 2213 a, t dbSNP:544814940
2218 2218 a, g dbSNP:753621603
2225 2225 c, t dbSNP:80356682
2226 2226 a, g dbSNP:756014878
2232 2232 c, t dbSNP:750321453
2239 2239 c, t dbSNP:767466042
2243 2243 c, t dbSNP:761318412
2245 2245 c, t dbSNP:751096261
2246 2246 a, g dbSNP:767931599
2267 2267 -, g dbSNP:780346237
2274 2274 c, t dbSNP:533116129
2290 2290 c, t dbSNP:140478941
2300 2300 c, t dbSNP:146794392
2301 2301 a, g dbSNP:375951428
2308 2308 c, t dbSNP:763548088
2311 2311 c, g dbSNP:570007388
2317 2317 a, g dbSNP:752347905
2328 2328 a, t dbSNP:3180385
2335 2335 a, g dbSNP:147801427
2340 2340 a, c dbSNP:764993973
2346 2346 c, t dbSNP:372853075
2347 2347 a, g, t dbSNP:766896825
2348 2348 a, t dbSNP:761135286
2357 2357 c, g dbSNP:773311125
2358 2358 c, t dbSNP:201223111
2359 2359 a, c, g dbSNP:774502087
2373 2373 a, g dbSNP:768930489
2385 2385 a, g dbSNP:551762609
2388 2388 c, t dbSNP:149161589
2391 2391 a, g dbSNP:2229466
2393 2393 a, g dbSNP:144538210
2394 2394 a, g dbSNP:777788000
2398 2398 c, t dbSNP:140248040
2404 2404 c, t dbSNP:752258026
2405 2405 a, g dbSNP:113725466
2406 2406 c, t dbSNP:764979701
2407 2407 a, g dbSNP:754737309
2416 2416 a, g dbSNP:115704192
2420 2420 a, g dbSNP:375139399
2430 2430 c, t dbSNP:761136720
2432 2432 c, g dbSNP:750850607
2438 2438 -, a dbSNP:756743929
2439 2439 a, t dbSNP:371974580
2440 2440 a, g, t dbSNP:761816760
2444 2444 a, c dbSNP:774469551
2446 2446 c, t dbSNP:2072937
2447 2447 g, t dbSNP:184108671
2448 2448 c, t dbSNP:763198922
2455 2455 g, t dbSNP:192846348
2456 2456 g, t dbSNP:770582807
2461 2461 a, g dbSNP:755864689
2468 2468 c, t dbSNP:377692281
2469 2469 a, g dbSNP:114174766
2475 2475 c, t dbSNP:199517693
2479 2479 c, t dbSNP:757647232
2480 2480 a, g dbSNP:752009807
2481 2481 c, t dbSNP:764597310
2485 2485 c, t dbSNP:758343266
2486 2486 a, t dbSNP:752888285
2488 2488 c, g, t dbSNP:552611500
2498 2498 g, t dbSNP:374547902
2516 2516 c, g dbSNP:371634132
2517 2517 a, t dbSNP:761724022
2519 2519 c, t dbSNP:547378825
2520 2520 c, t dbSNP:768646871
2521 2521 c, t dbSNP:748747266
2522 2522 a, g dbSNP:376093933
2524 2524 c, t dbSNP:140720448
2527 2527 c, t dbSNP:745490136
2529 2529 c, t dbSNP:780840750
2530 2530 a, g dbSNP:757559545
2531 2531 a, c, t dbSNP:778247685
2532 2532 a, g dbSNP:759000432
2534 2534 a, c dbSNP:746964803
2540 2540 c, g, t dbSNP:765400469
2542 2542 c, t dbSNP:755044487
2558 2558 c, t dbSNP:754065029
2559 2559 a, g dbSNP:373170122
2563 2563 a, c dbSNP:199758152
2564 2564 a, g dbSNP:369131781
2566 2566 a, g dbSNP:774356902
2572 2572 a, g dbSNP:151058440
2575 2575 c, g dbSNP:762984555
2578 2578 a, g dbSNP:151334148
2579 2579 -, gggttggg dbSNP:753327892
2580 2580 g, t dbSNP:202068754
2582 2582 c, g, t dbSNP:62637710
2585 2585 a, c, t dbSNP:747358627
2586 2586 -, a dbSNP:763940102
2587 2587 g, t dbSNP:778248763
2589 2589 -, a dbSNP:756035853
2589 2589 a, c, t dbSNP:748650288
2590 2590 a, g dbSNP:779309922
2593 2593 a, g dbSNP:755028905
2596 2596 a, g dbSNP:753974556
2597 2597 a, g dbSNP:780424034
2599 2599 a, g dbSNP:756465011
2601 2601 a, g dbSNP:751380979
2602 2602 -, agg dbSNP:767400914
2603 2603 a, g dbSNP:763906242
2604 2604 -, agg dbSNP:752460751
2605 2605 a, c dbSNP:762673892
2608 2608 a, c, t dbSNP:11555726
2609 2609 a, g dbSNP:759042889
2610 2610 a, g dbSNP:776174778
2613 2613 a, g dbSNP:770547607
2620 2620 a, g dbSNP:113745536
2624 2624 a, g dbSNP:772773088
2645 2645 a, t dbSNP:772433385
2649 2649 c, t dbSNP:748475714
2650 2650 a, g dbSNP:139058862
2659 2659 c, t dbSNP:769358854
2666 2666 c, t dbSNP:749368326
2671 2671 a, c dbSNP:150736643
2694 2694 c, t dbSNP:781471338
2697 2697 a, g dbSNP:757478374
2704 2704 a, g dbSNP:747951188
2709 2709 a, g dbSNP:370177518
2710 2710 c, t dbSNP:754799781
2719 2719 a, g dbSNP:114544692
2725 2725 c, t dbSNP:115279528
2726 2726 a, c dbSNP:755556227
2732 2732 a, g dbSNP:749971678
2733 2733 a, t dbSNP:764622148
2734 2734 a, g dbSNP:535416687
2736 2736 c, t dbSNP:761423349
2738 2738 a, t dbSNP:774750062
2741 2741 a, c dbSNP:764501504
2742 2742 c, t dbSNP:763420482
2745 2745 a, t dbSNP:776068228
2754 2754 a, g, t dbSNP:144275374
2759 2759 c, g dbSNP:745946333
2769 2769 c, t dbSNP:568428420
2772 2772 a, c, g dbSNP:747157392
2777 2777 a, g dbSNP:754706586
2779 2779 a, c, g dbSNP:61734500
2780 2780 a, g dbSNP:374815499
2781 2781 g, t dbSNP:371726915
2786 2786 c, t dbSNP:779963397
2792 2792 a, g dbSNP:756068828
2794 2794 a, g dbSNP:749931743
2795 2795 g, t dbSNP:766978893
2796 2796 a, c dbSNP:756826356
2797 2797 c, t dbSNP:550033087
2798 2798 a, g, t dbSNP:763401881
2799 2799 a, g dbSNP:532009786
2817 2817 c, t dbSNP:765817202
2818 2818 a, g dbSNP:759999121
2819 2819 a, g dbSNP:777225131
2822 2822 a, c dbSNP:770868939
2837 2837 c, g dbSNP:35310684
2840 2840 c, t dbSNP:747126025
2841 2841 a, g dbSNP:142191279
2842 2842 c, g dbSNP:772348603
2851 2851 g, t dbSNP:749072083
2860 2860 c, t dbSNP:564556671
2862 2862 a, g dbSNP:769743596
2864 2864 c, t dbSNP:59260335
2865 2865 a, g dbSNP:781198655
2871 2871 a, g dbSNP:756651445
2876 2876 a, g, t dbSNP:12748250
2886 2886 c, g, t dbSNP:151006337
2890 2890 c, g, t dbSNP:148395967
2891 2891 a, g dbSNP:774367298
2899 2899 c, t dbSNP:568142745
2900 2900 g, t dbSNP:759236601
2903 2903 a, t dbSNP:776535209
2904 2904 c, t dbSNP:145464247
2907 2907 a, g dbSNP:746900366
2909 2909 a, g dbSNP:773304144
2910 2910 g, t dbSNP:539752226
2913 2913 a, t dbSNP:771649114
2920 2920 c, t dbSNP:747666767
2927 2927 a, c, t dbSNP:11555728
2928 2928 a, c, g dbSNP:145977001
2937 2937 a, c dbSNP:756505234
2943 2943 g, t dbSNP:750884568
2947 2947 c, t dbSNP:768028663
2948 2948 a, c, g dbSNP:751715563
2950 2950 c, t dbSNP:764198024
2954 2954 c, t dbSNP:199946321
2955 2955 a, g dbSNP:775605446
2961 2961 a, t dbSNP:538194768
2962 2962 a, c, g dbSNP:200322380
2966 2966 a, g dbSNP:773217655
2968 2968 a, g dbSNP:372188386
2972 2972 a, g dbSNP:747650205
2981 2981 a, c, t dbSNP:368271817
2982 2982 a, g, t dbSNP:183045589
2987 2987 a, c, g, t dbSNP:201003237
2988 2988 a, g dbSNP:139896242
2995 2995 a, g dbSNP:3179860
3004 3004 a, g dbSNP:764193178
3007 3007 a, c dbSNP:531027639
3008 3008 c, t dbSNP:752906798
3009 3009 a, g dbSNP:147033674
3016 3016 c, t dbSNP:267598350
3019 3019 a, g dbSNP:115431256
3028 3028 c, t dbSNP:776286182
3042 3042 a, c, g dbSNP:747338921
3045 3045 c, t dbSNP:61753424
3050 3050 c, g dbSNP:573410951
3061 3061 c, t dbSNP:555013361
3062 3062 a, g dbSNP:779175415
3067 3067 c, t dbSNP:200462390
3068 3068 a, g dbSNP:145014090
3069 3069 c, t dbSNP:780440472
3070 3070 c, g dbSNP:757014178
3075 3075 c, g dbSNP:201460793
3076 3076 c, t dbSNP:557721715
3077 3077 c, t dbSNP:764065772
3083 3083 a, c dbSNP:539390533
3086 3086 c, g dbSNP:752659930
3096 3096 c, t dbSNP:572365081
3099 3099 a, c dbSNP:2076222
3101 3101 a, g dbSNP:759059147
3103 3103 g, t dbSNP:766354902
3112 3112 a, g dbSNP:776198236
3117 3117 c, t dbSNP:139829784
3123 3123 a, c dbSNP:761087646
3124 3124 a, g, t dbSNP:772602315
3128 3128 c, t dbSNP:121912485
3134 3134 a, g dbSNP:748627434
3135 3135 c, t dbSNP:775023132
3145 3145 c, g dbSNP:377525360
3149 3149 c, g dbSNP:146443318
3150 3150 c, g dbSNP:749386777
3153 3153 a, g dbSNP:567776263
3154 3154 c, t dbSNP:112109122
3155 3155 a, g, t dbSNP:777389254
3163 3163 a, g dbSNP:144342691
3164 3164 -, g dbSNP:772421306
3177 3177 a, c dbSNP:752572011
3183 3183 -, a dbSNP:765803663
3186 3186 -, acattgcgcgtgcccgccggttgcagg dbSNP:745574977
3186 3186 a, t dbSNP:199691851
3191 3191 a, g dbSNP:754674255
3192 3192 c, t dbSNP:149625153
3193 3193 a, c, g dbSNP:143164025
3194 3194 c, t dbSNP:377695976
3195 3195 a, g, t dbSNP:142984572
3199 3199 c, t dbSNP:772950886
3200 3200 c, t dbSNP:146501772
3201 3201 a, g dbSNP:141894965
3203 3203 c, t dbSNP:78303595
3204 3204 a, g dbSNP:533449267
3219 3219 c, t dbSNP:201582241
3234 3234 a, g dbSNP:201448367
3236 3236 c, t dbSNP:747916314
3237 3237 a, g dbSNP:143547447
3244 3244 -, t dbSNP:778546271
3249 3249 c, t dbSNP:768471993
3252 3252 a, g dbSNP:749132724
3255 3255 c, g dbSNP:138748613
3256 3256 c, t dbSNP:755515075
3259 3259 a, g dbSNP:750019735
3260 3260 g, t dbSNP:780982351
3262 3262 g, t dbSNP:757023222
3267 3267 a, g dbSNP:140769823
3284 3284 a, c, t dbSNP:2229467
3285 3285 a, g dbSNP:142912342
3292 3292 a, g dbSNP:765832266
3296 3296 a, g dbSNP:759531138
3297 3297 -, t dbSNP:770548526
3320 3320 a, c dbSNP:776813358
3324 3324 g, t dbSNP:771120009
3326 3326 a, c dbSNP:760837625
3330 3330 c, g, t dbSNP:768371778
3332 3332 a, c dbSNP:201207044
3333 3333 c, g, t dbSNP:769833376
3337 3337 c, t dbSNP:745334916
3338 3338 c, t dbSNP:376701936
3339 3339 a, g, t dbSNP:751193145
3342 3342 c, t dbSNP:777584225
3344 3344 -, c dbSNP:748776162
3346 3346 -, t dbSNP:777292177
3347 3347 c, t dbSNP:758678733
3348 3348 a, g dbSNP:753174535
3352 3352 c, t dbSNP:765632243
3364 3364 c, g dbSNP:199715844
3373 3373 c, g dbSNP:200270332
3374 3374 a, g dbSNP:765020069
3383 3383 c, g, t dbSNP:376701500
3389 3389 c, t dbSNP:199980014
3390 3390 a, g dbSNP:147527725
3411 3411 c, g, t dbSNP:371981464
3444 3444 c, t dbSNP:747795614
3446 3446 c, g, t dbSNP:114040223
3447 3447 a, g dbSNP:749709873
3451 3451 a, g dbSNP:780532198
3457 3457 a, g dbSNP:756650682
3461 3461 c, t dbSNP:750476293
3471 3471 c, g dbSNP:781280262
3473 3473 c, t dbSNP:527365033
3474 3474 a, g dbSNP:751750658
3479 3479 -, cag dbSNP:754373356
3481 3481 c, g dbSNP:764283942
3485 3485 a, g dbSNP:759403308
3486 3486 a, c, t dbSNP:766399202
3490 3490 a, g dbSNP:760642281
3513 3513 c, t dbSNP:368115484
3514 3514 a, g dbSNP:115239928
3515 3515 a, g dbSNP:761241565
3526 3526 c, g, t dbSNP:768257008
3527 3527 a, c, g dbSNP:780442109
3529 3529 g, t dbSNP:770161500
3533 3533 c, g dbSNP:746310687
3534 3534 a, c dbSNP:781566508
3540 3540 a, g dbSNP:757348998
3542 3542 g, t dbSNP:751659101
3553 3553 a, t dbSNP:764938585
3554 3554 c, t dbSNP:573606004
3561 3561 a, g dbSNP:759916560
3564 3564 a, g, t dbSNP:771351792
3574 3574 a, g dbSNP:372120856
3576 3576 a, g dbSNP:773861793
3579 3579 a, c dbSNP:539990375
3580 3580 c, t dbSNP:748296127
3593 3593 c, t dbSNP:779271518
3594 3594 a, g, t dbSNP:186130143
3603 3603 a, c dbSNP:780798755
3604 3604 -, gag dbSNP:781203724
3604 3604 c, g dbSNP:757102692
3612 3612 g, t dbSNP:751382636
3614 3614 c, t dbSNP:764079601
3615 3615 -, t dbSNP:754806971
3615 3615 c, t dbSNP:116580440
3620 3620 a, g dbSNP:752247056
3622 3622 a, g dbSNP:764850534
3627 3627 g, t dbSNP:759062564
3629 3629 a, g dbSNP:368778455
3631 3631 a, c dbSNP:776379217
3632 3632 c, t dbSNP:766585562
3633 3633 a, g dbSNP:149573831
3645 3645 g, t dbSNP:150859715
3650 3650 a, g dbSNP:200585982
3655 3655 c, g dbSNP:758317371
3661 3661 a, g dbSNP:772773344
3667 3667 a, g dbSNP:761951206
3669 3669 c, t dbSNP:752797320
3673 3673 a, g dbSNP:114560498
3677 3677 a, g dbSNP:768800208
3685 3685 a, c, g dbSNP:780324954
3690 3690 a, t dbSNP:78483218
3695 3695 a, t dbSNP:746876797
3698 3698 a, t dbSNP:777658403
3713 3713 g, t dbSNP:775574815
3716 3716 -, g dbSNP:786201004
3725 3725 c, t dbSNP:373007866
3726 3726 a, g dbSNP:115712132
3729 3729 a, g dbSNP:777498798
3733 3733 c, t dbSNP:771886651
3735 3735 a, g dbSNP:748014965
3736 3736 a, g dbSNP:778923534
3743 3743 a, t dbSNP:754434241
3748 3748 a, g dbSNP:753454602
3749 3749 c, t dbSNP:371221254
3754 3754 a, g dbSNP:1049607
3756 3756 c, t dbSNP:750121518
3757 3757 a, g dbSNP:200469035
3758 3758 g, t dbSNP:148831499
3762 3762 c, t dbSNP:752051425
3763 3763 g, t dbSNP:764732120
3765 3765 a, c dbSNP:544617603
3766 3766 a, g dbSNP:374453446
3770 3770 c, t dbSNP:2228342
3773 3773 a, g dbSNP:759715557
3779 3779 c, t dbSNP:565264503
3780 3780 a, g dbSNP:771796673
3782 3782 a, g dbSNP:747996518
3788 3788 a, c dbSNP:774150667
3794 3794 c, t dbSNP:370023805
3795 3795 a, g dbSNP:748722966
3801 3801 a, g dbSNP:147931502
3803 3803 a, g dbSNP:755713391
3809 3809 a, g dbSNP:745444340
3812 3812 c, g, t dbSNP:540971405
3813 3813 a, g dbSNP:376506766
3814 3814 c, t dbSNP:764488417
3815 3815 a, g dbSNP:373304451
3816 3816 a, t dbSNP:573577248
3820 3820 c, g dbSNP:765295906
3823 3823 c, t dbSNP:759625668
3828 3828 c, t dbSNP:751403505
3836 3836 a, c dbSNP:776822301
3843 3843 a, g dbSNP:766656252
3847 3847 c, g dbSNP:761563303
3850 3850 c, t dbSNP:774249671
3859 3859 c, t dbSNP:370824531
3860 3860 a, g dbSNP:369211699
3863 3863 a, g dbSNP:775290696
3868 3868 a, c dbSNP:575310994
3871 3871 c, t dbSNP:201971267
3878 3878 c, t dbSNP:538322482
3879 3879 a, g dbSNP:757022831
3911 3911 a, g dbSNP:368450102
3943 3943 c, t dbSNP:2566
3951 3951 a, g dbSNP:534647010
3965 3965 c, t dbSNP:185362831
3978 3978 c, t dbSNP:549169984
4013 4013 c, t dbSNP:530592313
4045 4045 a, g dbSNP:145792505
4055 4055 a, g dbSNP:754108338
4079 4079 g, t dbSNP:193069291
4103 4103 a, g dbSNP:371579247
4116 4116 c, t dbSNP:188120955
4119 4119 c, t dbSNP:750772872
4120 4120 a, g dbSNP:566086702
4132 4132 c, t dbSNP:368031652
4133 4133 c, t dbSNP:12033066
4146 4146 c, t dbSNP:11555727
4171 4171 c, t dbSNP:540588997
4210 4210 c, t dbSNP:111402627
4212 4212 a, g dbSNP:528806447
4233 4233 c, t dbSNP:558747584

Target ORF information:

RefSeq Version XM_005273124
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens laminin, beta 3 (LAMB3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17378
Accession Version NM_001127641.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3519bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product laminin subunit beta-3 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL031316.2, BC075838.1, BP350980.1 and AY035783.1. Summary: The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3, also known as B3B) has an alternate 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L25541.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)50..52(+)
Misc Feature(2)176..862(+)
Misc Feature(3)863..1030(+)
Misc Feature(4)866..988(+)
Misc Feature(5)1061..1225(+)
Misc Feature(6)1064..1183(+)
Misc Feature(7)1250..1405(+)
Misc Feature(8)1253..1348(+)
Misc Feature(9)1406..1555(+)
Misc Feature(10)1409..1504(+)
Misc Feature(11)1556..1714(+)
Misc Feature(12)1559..1651(+)
Misc Feature(13)1715..1864(+)
Misc Feature(14)1718..1810(+)
Misc Feature(15)1853..2473(+)
Misc Feature(16)2474..2566(+)
Misc Feature(17)2567..3628(+)
Misc Feature(18)2648..3331(+)
Misc Feature(19)2702..3346(+)
Misc Feature(20)2735..3346(+)
Misc Feature(21)2993..3109(+)
Exon (1)1..81
Gene Synonym:
Exon (2)82..146
Gene Synonym:
Exon (3)147..301
Gene Synonym:
Exon (4)302..416
Gene Synonym:
Exon (5)417..490
Gene Synonym:
Exon (6)491..682
Gene Synonym:
Exon (7)683..746
Gene Synonym:
Exon (8)747..940
Gene Synonym:
Exon (9)941..1061
Gene Synonym:
Exon (10)1062..1250
Gene Synonym:
Exon (11)1251..1406
Gene Synonym:
Exon (12)1407..1603
Gene Synonym:
Exon (13)1604..1715
Gene Synonym:
Exon (14)1716..2094
Gene Synonym:
Exon (15)2095..2255
Gene Synonym:
Exon (16)2256..2476
Gene Synonym:
Exon (17)2477..2674
Gene Synonym:
Exon (18)2675..2819
Gene Synonym:
Exon (19)2820..3027
Gene Synonym:
Exon (20)3028..3169
Gene Synonym:
Exon (21)3170..3346
Gene Synonym:
Exon (22)3347..3500
Gene Synonym:
Exon (23)3501..4038
Gene Synonym:
Position Chain Variation Link
33 33 c, g dbSNP:776276165
44 44 a, g dbSNP:546781621
49 49 c, g dbSNP:535089819
83 83 a, t dbSNP:757463127
86 86 a, g dbSNP:547771685
104 104 c, t dbSNP:764990667
105 105 a, c dbSNP:369316294
111 111 c, g dbSNP:369518861
112 112 a, g dbSNP:753697952
121 121 a, g dbSNP:766177957
126 126 a, c dbSNP:760672832
128 128 c, t dbSNP:116218572
133 133 c, t dbSNP:140470350
134 134 c, t dbSNP:113185295
148 148 c, t dbSNP:114304155
149 149 -, c dbSNP:777672897
156 156 g, t dbSNP:746335563
170 170 c, t dbSNP:777231178
173 173 a, c, g dbSNP:200672750
179 179 a, t dbSNP:751818569
183 183 a, c, t dbSNP:147620922
185 185 c, t dbSNP:115191959
186 186 a, g, t dbSNP:139480015
188 188 g, t dbSNP:750218343
192 192 c, t dbSNP:781227957
197 197 -, t dbSNP:751141486
197 197 c, t dbSNP:757278127
200 200 c, t dbSNP:751050188
203 203 c, t dbSNP:763767212
207 207 c, t dbSNP:116643086
214 214 c, t dbSNP:752440951
222 222 c, t dbSNP:765484485
233 233 c, t dbSNP:759900167
234 234 a, g dbSNP:146125956
242 242 c, t dbSNP:80356680
243 243 a, g dbSNP:761173046
256 256 c, t dbSNP:2228339
286 286 c, t dbSNP:772245138
288 288 c, t dbSNP:748289290
292 292 a, g dbSNP:779157351
298 298 c, t dbSNP:114295238
299 299 a, g dbSNP:765935706
301 301 a, g dbSNP:745623000
302 302 a, t dbSNP:753545651
309 309 a, t dbSNP:201830202
312 312 a, c, g dbSNP:375522351
330 330 c, t dbSNP:756431966
331 331 -, c dbSNP:765981678
331 331 c, t dbSNP:566813980
334 334 a, g dbSNP:765883028
335 335 c, t dbSNP:762234799
337 337 a, g dbSNP:774488682
385 385 a, c, t dbSNP:143833060
386 386 a, g dbSNP:775892223
387 387 a, g dbSNP:770169154
389 389 a, c dbSNP:371036275
393 393 c, t dbSNP:746748625
395 395 c, t dbSNP:772891857
396 396 a, g dbSNP:771977502
400 400 a, g dbSNP:748099677
409 409 a, c dbSNP:2076356
424 424 a, c dbSNP:376274555
425 425 c, g, t dbSNP:200105150
432 432 c, g dbSNP:768605252
440 440 c, g dbSNP:748738681
450 450 a, g dbSNP:55824996
451 451 c, t dbSNP:769435295
453 453 a, g dbSNP:745569387
455 455 a, c, g dbSNP:371231587
457 457 a, t dbSNP:199599061
458 458 g, t dbSNP:372620941
460 460 c, t dbSNP:758983287
463 463 a, g dbSNP:752754551
477 477 c, t dbSNP:765479137
490 490 a, g dbSNP:759819148
492 492 c, g dbSNP:574291969
493 493 c, g dbSNP:776214216
497 497 a, c dbSNP:202025705
502 502 c, t dbSNP:1130667
505 505 c, t dbSNP:374988953
506 506 a, g, t dbSNP:769334793
520 520 a, g dbSNP:183509078
521 521 c, t dbSNP:372985506
522 522 a, g dbSNP:148603717
527 527 a, t dbSNP:780249357
535 535 c, t dbSNP:201554705
536 536 a, g, t dbSNP:749618741
543 543 c, t dbSNP:758154155
547 547 a, c, g dbSNP:369555024
548 548 c, t dbSNP:759518184
549 549 a, c, g dbSNP:375668443
550 550 a, g dbSNP:760221702
562 562 c, t dbSNP:200607251
563 563 c, t dbSNP:372787389
564 564 -, acct dbSNP:746705740
571 571 c, t dbSNP:369986809
572 572 a, g dbSNP:748466087
577 577 c, t dbSNP:565416040
580 580 a, c dbSNP:375815552
581 581 -, t dbSNP:776537364
589 589 c, t dbSNP:749866341
590 590 c, t dbSNP:779979101
593 593 c, t dbSNP:116472735
594 594 a, g, t dbSNP:528873916
597 597 g, t dbSNP:192538322
600 600 a, g dbSNP:752418863
608 608 c, t dbSNP:764027121
609 609 a, g dbSNP:754855375
610 610 c, g dbSNP:753862334
613 613 c, t dbSNP:765773474
614 614 c, t dbSNP:121912483
619 619 c, g dbSNP:772869809
632 632 c, t dbSNP:767212880
633 633 a, g, t dbSNP:550005240
638 638 c, t dbSNP:769114930
639 639 a, g, t dbSNP:776028142
659 659 a, g dbSNP:2235542
665 665 c, t dbSNP:116124880
666 666 a, g dbSNP:150895872
667 667 a, c dbSNP:771134182
674 674 c, g dbSNP:747286969
675 675 a, g, t dbSNP:200501999
677 677 a, g dbSNP:375282891
678 678 a, g dbSNP:779991209
679 679 g, t dbSNP:756125849
694 694 c, t dbSNP:765643345
696 696 g, t dbSNP:760011884
700 700 g, t dbSNP:75876132
701 701 g, t dbSNP:748912418
708 708 a, t dbSNP:766901705
714 714 c, g dbSNP:121912486
715 715 g, t dbSNP:373068469
729 729 a, g dbSNP:773179112
730 730 a, g dbSNP:772335033
732 732 c, g dbSNP:748377271
734 734 c, t dbSNP:775405524
737 737 a, c dbSNP:121912487
740 740 -, a dbSNP:768303931
746 746 a, g dbSNP:121912482
747 747 a, g dbSNP:761090321
748 748 a, g dbSNP:773329364
753 753 c, g dbSNP:767543203
759 759 c, t dbSNP:372806619
760 760 c, t dbSNP:774677423
768 768 c, t dbSNP:769024097
769 769 g, t dbSNP:369436088
771 771 a, c, g dbSNP:770902074
784 784 c, t dbSNP:746973120
787 787 a, g dbSNP:200235429
789 789 c, t dbSNP:138986366
790 790 g, t dbSNP:747721994
796 796 c, t dbSNP:778486899
807 807 c, g dbSNP:61734502
810 810 g, t dbSNP:143725782
815 815 -, c dbSNP:774418654
819 819 a, c dbSNP:766795526
823 823 c, t dbSNP:554528737
825 825 c, g dbSNP:750934724
826 826 c, t dbSNP:768102929
827 827 a, g dbSNP:761752478
833 833 -, tatgctgt dbSNP:771217575
839 839 a, g dbSNP:751706367
845 845 c, t dbSNP:80356681
848 848 c, t dbSNP:763338054
851 851 c, t dbSNP:776549945
852 852 a, g dbSNP:114886812
862 862 a, c, g dbSNP:772980989
865 865 c, t dbSNP:772067391
873 873 g, t dbSNP:747598160
877 877 c, t dbSNP:778399071
882 882 a, c dbSNP:768293920
883 883 c, t dbSNP:748990020
889 889 c, t dbSNP:780435765
890 890 c, t dbSNP:145575474
891 891 a, g dbSNP:568932560
895 895 c, t dbSNP:146529524
896 896 a, g dbSNP:113063967
899 899 c, g, t dbSNP:537985381
930 930 a, c dbSNP:115812503
931 931 c, g, t dbSNP:146690433
932 932 a, g, t dbSNP:371543476
933 933 a, c dbSNP:771836143
934 934 c, t dbSNP:761804631
935 935 c, g dbSNP:201231089
938 938 c, g dbSNP:773837164
942 942 c, t dbSNP:758985269
946 946 c, g dbSNP:182105392
947 947 a, g dbSNP:369999185
950 950 c, g dbSNP:554334415
976 976 a, c, t dbSNP:200006309
977 977 a, g dbSNP:144788254
980 980 c, t dbSNP:149420629
985 985 c, t dbSNP:115579649
989 989 a, g dbSNP:763950597
992 992 c, t dbSNP:762942741
993 993 a, g, t dbSNP:12091253
995 995 a, t dbSNP:759084687
997 997 g, t dbSNP:776310420
998 998 a, g dbSNP:770733108
1001 1001 c, t dbSNP:747323019
1009 1009 c, t dbSNP:371462192
1011 1011 a, g dbSNP:772703970
1016 1016 c, t dbSNP:368834085
1017 1017 a, g dbSNP:376688965
1020 1020 c, t dbSNP:577878087
1022 1022 -, t dbSNP:786205094
1028 1028 c, t dbSNP:768740994
1029 1029 c, t dbSNP:114394307
1030 1030 a, g dbSNP:371979667
1032 1032 c, t dbSNP:756331697
1033 1033 a, g dbSNP:751348872
1038 1038 a, g, t dbSNP:758243149
1040 1040 a, c dbSNP:752716711
1045 1045 a, c, t dbSNP:141059189
1046 1046 a, g dbSNP:140216548
1047 1047 c, t dbSNP:199755124
1054 1054 a, g dbSNP:760472886
1057 1057 c, t dbSNP:773700438
1059 1059 -, t dbSNP:770449058
1059 1059 a, c dbSNP:772614360
1066 1066 c, t dbSNP:779681550
1068 1068 -, ac dbSNP:746735166
1070 1070 -, t dbSNP:779588133
1071 1071 -, tga dbSNP:758005073
1072 1072 c, t dbSNP:755645935
1073 1073 -, t dbSNP:749956696
1074 1074 a, g dbSNP:749966322
1075 1075 -, t dbSNP:764704766
1077 1077 -, aggtgtgtgtgacaagg dbSNP:757224556
1081 1081 c, g dbSNP:371132145
1086 1086 a, g dbSNP:185105348
1089 1089 c, t dbSNP:756925528
1095 1095 -, a dbSNP:753711190
1096 1096 -, c dbSNP:763559509
1096 1096 c, t dbSNP:145473444
1102 1102 a, c, t dbSNP:764412477
1104 1104 c, t dbSNP:567822076
1106 1106 a, g, t dbSNP:555662201
1125 1125 a, g dbSNP:759558086
1126 1126 a, g dbSNP:114404740
1133 1133 c, t dbSNP:52814161
1134 1134 a, g dbSNP:747255131
1135 1135 g, t dbSNP:774174881
1152 1152 a, c dbSNP:768377367
1156 1156 c, t dbSNP:749126992
1157 1157 c, g, t dbSNP:375680175
1158 1158 a, g dbSNP:745366407
1168 1168 c, t dbSNP:76690225
1169 1169 a, g dbSNP:114875539
1174 1174 c, g dbSNP:373815949
1181 1181 c, t dbSNP:532875477
1187 1187 c, t dbSNP:548096567
1188 1188 g, t dbSNP:149360787
1190 1190 c, t dbSNP:758709728
1198 1198 a, g dbSNP:116607807
1203 1203 a, g dbSNP:765669683
1208 1208 c, t dbSNP:370699820
1209 1209 a, g dbSNP:776762253
1214 1214 c, t dbSNP:142542174
1217 1217 a, c, t dbSNP:140336145
1218 1218 a, g dbSNP:772446912
1221 1221 c, t dbSNP:549692468
1222 1222 a, g dbSNP:376561409
1237 1237 a, g dbSNP:769838988
1239 1239 a, g dbSNP:544881628
1242 1242 a, c dbSNP:565286176
1255 1255 c, t dbSNP:762182152
1258 1258 a, g dbSNP:372967322
1261 1261 a, t dbSNP:769748910
1266 1266 c, t dbSNP:759403991
1267 1267 a, g dbSNP:2076351
1268 1268 a, g dbSNP:267598351
1269 1269 a, g dbSNP:115433823
1272 1272 g, t dbSNP:746441639
1286 1286 g, t dbSNP:370805844
1289 1289 c, t dbSNP:541302403
1295 1295 a, g dbSNP:189196778
1304 1304 a, g dbSNP:771702350
1306 1306 c, t dbSNP:115883756
1307 1307 a, g dbSNP:779219301
1312 1312 a, g dbSNP:116602483
1316 1316 c, g dbSNP:550298199
1319 1319 -, tg dbSNP:775285992
1330 1330 c, t dbSNP:780367752
1333 1333 a, g dbSNP:756709484
1340 1340 c, g dbSNP:145170416
1343 1343 a, c dbSNP:750455797
1354 1354 a, g dbSNP:202113091
1362 1362 c, t dbSNP:755841333
1363 1363 a, g dbSNP:572149945
1369 1369 c, t dbSNP:764431791
1376 1376 c, g dbSNP:376412573
1381 1381 -, ctac dbSNP:766741809
1382 1382 a, t dbSNP:776493641
1384 1384 c, t dbSNP:766227083
1385 1385 a, g dbSNP:139404117
1392 1392 c, t dbSNP:150917125
1393 1393 a, g, t dbSNP:148726330
1402 1402 c, t dbSNP:142876683
1406 1406 c, g, t dbSNP:767490741
1419 1419 a, g dbSNP:746254246
1420 1420 c, t dbSNP:781740513
1421 1421 a, g dbSNP:757840096
1422 1422 a, t dbSNP:747084268
1430 1430 a, t dbSNP:2229468
1433 1433 c, t dbSNP:758529827
1437 1437 g, t dbSNP:753007019
1446 1446 c, t dbSNP:202096620
1447 1447 a, g dbSNP:371309063
1448 1448 c, t dbSNP:199952752
1453 1453 c, g, t dbSNP:374430633
1454 1454 a, g dbSNP:749069550
1458 1458 a, t dbSNP:370106489
1461 1461 a, g dbSNP:763698625
1465 1465 a, g dbSNP:762400142
1466 1466 c, t dbSNP:200895463
1475 1475 g, t dbSNP:769342279
1483 1483 -, ca dbSNP:769967565
1487 1487 a, g dbSNP:370089561
1491 1491 c, t dbSNP:201559735
1505 1505 -, g dbSNP:748758397
1517 1517 c, t dbSNP:777199704
1531 1531 a, g dbSNP:112316651
1541 1541 a, g dbSNP:147986178
1547 1547 a, g dbSNP:375152403
1549 1549 c, t dbSNP:376505059
1551 1551 a, g dbSNP:748199854
1557 1557 -, cgtgt dbSNP:786205095
1557 1557 c, t dbSNP:61734494
1558 1558 a, g dbSNP:779846779
1564 1564 c, t dbSNP:750215205
1567 1567 c, t dbSNP:781012508
1568 1568 a, g dbSNP:372654158
1572 1572 c, t dbSNP:751474007
1580 1580 g, t dbSNP:763960179
1595 1595 c, t dbSNP:762462819
1598 1598 a, c dbSNP:752148248
1600 1600 a, c dbSNP:764935884
1602 1602 a, g dbSNP:114315478
1611 1611 a, g, t dbSNP:770003713
1619 1619 c, t dbSNP:746810833
1620 1620 c, t dbSNP:777484868
1625 1625 c, t dbSNP:758331576
1626 1626 a, g dbSNP:202095584
1634 1634 a, t dbSNP:145548817
1635 1635 g, t dbSNP:754492217
1640 1640 a, g dbSNP:753412479
1644 1644 a, t dbSNP:570482366
1654 1654 c, t dbSNP:375260663
1659 1659 a, c dbSNP:750788587
1664 1664 a, g dbSNP:148988085
1667 1667 c, t dbSNP:78788119
1673 1673 a, t dbSNP:774790556
1676 1676 c, t dbSNP:764597128
1679 1679 g, t dbSNP:149855893
1682 1682 c, t dbSNP:775608853
1683 1683 a, g dbSNP:144249951
1684 1684 c, g dbSNP:746121545
1689 1689 a, g dbSNP:773032458
1692 1692 c, g dbSNP:771727419
1696 1696 c, t dbSNP:567151867
1697 1697 a, g dbSNP:2076349
1704 1704 c, t dbSNP:754971420
1705 1705 -, ag dbSNP:769151482
1712 1712 c, t dbSNP:757145297
1713 1713 a, g dbSNP:748803172
1719 1719 c, g dbSNP:749288167
1721 1721 a, g dbSNP:141723352
1723 1723 c, t dbSNP:769135594
1724 1724 c, t dbSNP:745396663
1727 1727 a, g dbSNP:780641517
1729 1729 c, t dbSNP:756997937
1733 1733 c, t dbSNP:200300715
1734 1734 a, g dbSNP:530692211
1737 1737 a, g dbSNP:758869121
1740 1740 c, g dbSNP:753165127
1745 1745 a, g dbSNP:765797641
1746 1746 -, g dbSNP:747341006
1749 1749 c, t dbSNP:563186752
1750 1750 a, g dbSNP:753960912
1756 1756 c, t dbSNP:555155357
1757 1757 a, g dbSNP:761037344
1759 1759 a, c dbSNP:774266864
1763 1763 a, g dbSNP:768613245
1769 1769 a, g dbSNP:762860854
1772 1772 c, t dbSNP:767004520
1773 1773 a, g dbSNP:201154610
1776 1776 a, g dbSNP:375264939
1784 1784 c, t dbSNP:745365535
1785 1785 a, g, t dbSNP:371013768
1786 1786 c, t dbSNP:777689673
1788 1788 c, t dbSNP:746700898
1795 1795 g, t dbSNP:114274965
1798 1798 c, t dbSNP:376183751
1799 1799 a, g dbSNP:748528323
1805 1805 c, t dbSNP:779224166
1806 1806 a, c, g dbSNP:753850608
1814 1814 c, g dbSNP:766530868
1819 1819 c, t dbSNP:756375245
1821 1821 a, g dbSNP:540286145
1823 1823 c, t dbSNP:201551805
1824 1824 a, c, g dbSNP:368764676
1827 1827 g, t dbSNP:200027100
1834 1834 c, t dbSNP:2179402
1836 1836 a, g dbSNP:373642074
1839 1839 a, g dbSNP:370280436
1845 1845 c, g, t dbSNP:202063530
1846 1846 a, g dbSNP:771720883
1852 1852 c, t dbSNP:138710333
1853 1853 a, g dbSNP:779392542
1871 1871 c, t dbSNP:755418511
1874 1874 c, t dbSNP:749842554
1876 1876 a, g dbSNP:780457747
1879 1879 a, c dbSNP:185451408
1881 1881 a, g dbSNP:750534260
1882 1882 c, t dbSNP:2229465
1885 1885 c, t dbSNP:757611041
1887 1887 c, t dbSNP:143370006
1888 1888 a, g dbSNP:143594988
1895 1895 c, t dbSNP:146647886
1896 1896 a, g dbSNP:546638996
1900 1900 c, g dbSNP:766320452
1904 1904 a, g, t dbSNP:374016408
1905 1905 c, t dbSNP:370897270
1910 1910 c, t dbSNP:139547896
1911 1911 a, g dbSNP:139555809
1912 1912 -, t dbSNP:35794952
1912 1912 c, t dbSNP:377645754
1913 1913 c, t dbSNP:749625880
1925 1925 c, t dbSNP:374239232
1926 1926 a, g, t dbSNP:114651102
1936 1936 c, t dbSNP:781466716
1937 1937 a, g dbSNP:150564174
1939 1939 c, t dbSNP:751762651
1947 1947 c, g dbSNP:371154345
1948 1948 a, g dbSNP:121912484
1955 1955 c, t dbSNP:147438032
1960 1960 a, g dbSNP:753583338
1970 1970 c, t dbSNP:200108885
1971 1971 a, g dbSNP:760667887
1978 1978 a, g dbSNP:749913780
1979 1979 c, g dbSNP:767055039
1980 1980 c, t dbSNP:142689095
1982 1982 c, t dbSNP:774009013
1985 1985 a, c, t dbSNP:763369856
1986 1986 a, g dbSNP:145841733
1991 1991 c, t dbSNP:563197235
1994 1994 a, g dbSNP:746413547
1996 1996 g, t dbSNP:377744457
2002 2002 g, t dbSNP:770992053
2006 2006 a, g dbSNP:747071130
2007 2007 a, g dbSNP:777987443
2009 2009 a, t dbSNP:544814940
2014 2014 a, g dbSNP:753621603
2021 2021 c, t dbSNP:80356682
2022 2022 a, g dbSNP:756014878
2028 2028 c, t dbSNP:750321453
2035 2035 c, t dbSNP:767466042
2039 2039 c, t dbSNP:761318412
2041 2041 c, t dbSNP:751096261
2042 2042 a, g dbSNP:767931599
2063 2063 -, g dbSNP:780346237
2070 2070 c, t dbSNP:533116129
2086 2086 c, t dbSNP:140478941
2096 2096 c, t dbSNP:146794392
2097 2097 a, g dbSNP:375951428
2104 2104 c, t dbSNP:763548088
2107 2107 c, g dbSNP:570007388
2113 2113 a, g dbSNP:752347905
2124 2124 a, t dbSNP:3180385
2131 2131 a, g dbSNP:147801427
2136 2136 a, c dbSNP:764993973
2142 2142 c, t dbSNP:372853075
2143 2143 a, g, t dbSNP:766896825
2144 2144 a, t dbSNP:761135286
2153 2153 c, g dbSNP:773311125
2154 2154 c, t dbSNP:201223111
2155 2155 a, c, g dbSNP:774502087
2169 2169 a, g dbSNP:768930489
2181 2181 a, g dbSNP:551762609
2184 2184 c, t dbSNP:149161589
2187 2187 a, g dbSNP:2229466
2189 2189 a, g dbSNP:144538210
2190 2190 a, g dbSNP:777788000
2194 2194 c, t dbSNP:140248040
2200 2200 c, t dbSNP:752258026
2201 2201 a, g dbSNP:113725466
2202 2202 c, t dbSNP:764979701
2203 2203 a, g dbSNP:754737309
2212 2212 a, g dbSNP:115704192
2216 2216 a, g dbSNP:375139399
2226 2226 c, t dbSNP:761136720
2228 2228 c, g dbSNP:750850607
2234 2234 -, a dbSNP:756743929
2235 2235 a, t dbSNP:371974580
2236 2236 a, g, t dbSNP:761816760
2240 2240 a, c dbSNP:774469551
2242 2242 c, t dbSNP:2072937
2243 2243 g, t dbSNP:184108671
2244 2244 c, t dbSNP:763198922
2251 2251 g, t dbSNP:192846348
2252 2252 g, t dbSNP:770582807
2257 2257 a, g dbSNP:755864689
2264 2264 c, t dbSNP:377692281
2265 2265 a, g dbSNP:114174766
2271 2271 c, t dbSNP:199517693
2275 2275 c, t dbSNP:757647232
2276 2276 a, g dbSNP:752009807
2277 2277 c, t dbSNP:764597310
2281 2281 c, t dbSNP:758343266
2282 2282 a, t dbSNP:752888285
2284 2284 c, g, t dbSNP:552611500
2294 2294 g, t dbSNP:374547902
2312 2312 c, g dbSNP:371634132
2313 2313 a, t dbSNP:761724022
2315 2315 c, t dbSNP:547378825
2316 2316 c, t dbSNP:768646871
2317 2317 c, t dbSNP:748747266
2318 2318 a, g dbSNP:376093933
2320 2320 c, t dbSNP:140720448
2323 2323 c, t dbSNP:745490136
2325 2325 c, t dbSNP:780840750
2326 2326 a, g dbSNP:757559545
2327 2327 a, c, t dbSNP:778247685
2328 2328 a, g dbSNP:759000432
2330 2330 a, c dbSNP:746964803
2336 2336 c, g, t dbSNP:765400469
2338 2338 c, t dbSNP:755044487
2354 2354 c, t dbSNP:754065029
2355 2355 a, g dbSNP:373170122
2359 2359 a, c dbSNP:199758152
2360 2360 a, g dbSNP:369131781
2362 2362 a, g dbSNP:774356902
2368 2368 a, g dbSNP:151058440
2371 2371 c, g dbSNP:762984555
2374 2374 a, g dbSNP:151334148
2375 2375 -, gggttggg dbSNP:753327892
2376 2376 g, t dbSNP:202068754
2378 2378 c, g, t dbSNP:62637710
2381 2381 a, c, t dbSNP:747358627
2382 2382 -, a dbSNP:763940102
2383 2383 g, t dbSNP:778248763
2385 2385 -, a dbSNP:756035853
2385 2385 a, c, t dbSNP:748650288
2386 2386 a, g dbSNP:779309922
2389 2389 a, g dbSNP:755028905
2392 2392 a, g dbSNP:753974556
2393 2393 a, g dbSNP:780424034
2395 2395 a, g dbSNP:756465011
2397 2397 a, g dbSNP:751380979
2398 2398 -, agg dbSNP:767400914
2399 2399 a, g dbSNP:763906242
2400 2400 -, agg dbSNP:752460751
2401 2401 a, c dbSNP:762673892
2404 2404 a, c, t dbSNP:11555726
2405 2405 a, g dbSNP:759042889
2406 2406 a, g dbSNP:776174778
2409 2409 a, g dbSNP:770547607
2416 2416 a, g dbSNP:113745536
2420 2420 a, g dbSNP:772773088
2441 2441 a, t dbSNP:772433385
2445 2445 c, t dbSNP:748475714
2446 2446 a, g dbSNP:139058862
2455 2455 c, t dbSNP:769358854
2462 2462 c, t dbSNP:749368326
2467 2467 a, c dbSNP:150736643
2490 2490 c, t dbSNP:781471338
2493 2493 a, g dbSNP:757478374
2500 2500 a, g dbSNP:747951188
2505 2505 a, g dbSNP:370177518
2506 2506 c, t dbSNP:754799781
2515 2515 a, g dbSNP:114544692
2521 2521 c, t dbSNP:115279528
2522 2522 a, c dbSNP:755556227
2528 2528 a, g dbSNP:749971678
2529 2529 a, t dbSNP:764622148
2530 2530 a, g dbSNP:535416687
2532 2532 c, t dbSNP:761423349
2534 2534 a, t dbSNP:774750062
2537 2537 a, c dbSNP:764501504
2538 2538 c, t dbSNP:763420482
2541 2541 a, t dbSNP:776068228
2550 2550 a, g, t dbSNP:144275374
2555 2555 c, g dbSNP:745946333
2565 2565 c, t dbSNP:568428420
2568 2568 a, c, g dbSNP:747157392
2573 2573 a, g dbSNP:754706586
2575 2575 a, c, g dbSNP:61734500
2576 2576 a, g dbSNP:374815499
2577 2577 g, t dbSNP:371726915
2582 2582 c, t dbSNP:779963397
2588 2588 a, g dbSNP:756068828
2590 2590 a, g dbSNP:749931743
2591 2591 g, t dbSNP:766978893
2592 2592 a, c dbSNP:756826356
2593 2593 c, t dbSNP:550033087
2594 2594 a, g, t dbSNP:763401881
2595 2595 a, g dbSNP:532009786
2613 2613 c, t dbSNP:765817202
2614 2614 a, g dbSNP:759999121
2615 2615 a, g dbSNP:777225131
2618 2618 a, c dbSNP:770868939
2633 2633 c, g dbSNP:35310684
2636 2636 c, t dbSNP:747126025
2637 2637 a, g dbSNP:142191279
2638 2638 c, g dbSNP:772348603
2647 2647 g, t dbSNP:749072083
2656 2656 c, t dbSNP:564556671
2658 2658 a, g dbSNP:769743596
2660 2660 c, t dbSNP:59260335
2661 2661 a, g dbSNP:781198655
2667 2667 a, g dbSNP:756651445
2672 2672 a, g, t dbSNP:12748250
2682 2682 c, g, t dbSNP:151006337
2686 2686 c, g, t dbSNP:148395967
2687 2687 a, g dbSNP:774367298
2695 2695 c, t dbSNP:568142745
2696 2696 g, t dbSNP:759236601
2699 2699 a, t dbSNP:776535209
2700 2700 c, t dbSNP:145464247
2703 2703 a, g dbSNP:746900366
2705 2705 a, g dbSNP:773304144
2706 2706 g, t dbSNP:539752226
2709 2709 a, t dbSNP:771649114
2716 2716 c, t dbSNP:747666767
2723 2723 a, c, t dbSNP:11555728
2724 2724 a, c, g dbSNP:145977001
2733 2733 a, c dbSNP:756505234
2739 2739 g, t dbSNP:750884568
2743 2743 c, t dbSNP:768028663
2744 2744 a, c, g dbSNP:751715563
2746 2746 c, t dbSNP:764198024
2750 2750 c, t dbSNP:199946321
2751 2751 a, g dbSNP:775605446
2757 2757 a, t dbSNP:538194768
2758 2758 a, c, g dbSNP:200322380
2762 2762 a, g dbSNP:773217655
2764 2764 a, g dbSNP:372188386
2768 2768 a, g dbSNP:747650205
2777 2777 a, c, t dbSNP:368271817
2778 2778 a, g, t dbSNP:183045589
2783 2783 a, c, g, t dbSNP:201003237
2784 2784 a, g dbSNP:139896242
2791 2791 a, g dbSNP:3179860
2800 2800 a, g dbSNP:764193178
2803 2803 a, c dbSNP:531027639
2804 2804 c, t dbSNP:752906798
2805 2805 a, g dbSNP:147033674
2812 2812 c, t dbSNP:267598350
2815 2815 a, g dbSNP:115431256
2824 2824 c, t dbSNP:776286182
2838 2838 a, c, g dbSNP:747338921
2841 2841 c, t dbSNP:61753424
2846 2846 c, g dbSNP:573410951
2857 2857 c, t dbSNP:555013361
2858 2858 a, g dbSNP:779175415
2863 2863 c, t dbSNP:200462390
2864 2864 a, g dbSNP:145014090
2865 2865 c, t dbSNP:780440472
2866 2866 c, g dbSNP:757014178
2871 2871 c, g dbSNP:201460793
2872 2872 c, t dbSNP:557721715
2873 2873 c, t dbSNP:764065772
2879 2879 a, c dbSNP:539390533
2882 2882 c, g dbSNP:752659930
2892 2892 c, t dbSNP:572365081
2895 2895 a, c dbSNP:2076222
2897 2897 a, g dbSNP:759059147
2899 2899 g, t dbSNP:766354902
2908 2908 a, g dbSNP:776198236
2913 2913 c, t dbSNP:139829784
2919 2919 a, c dbSNP:761087646
2920 2920 a, g, t dbSNP:772602315
2924 2924 c, t dbSNP:121912485
2930 2930 a, g dbSNP:748627434
2931 2931 c, t dbSNP:775023132
2941 2941 c, g dbSNP:377525360
2945 2945 c, g dbSNP:146443318
2946 2946 c, g dbSNP:749386777
2949 2949 a, g dbSNP:567776263
2950 2950 c, t dbSNP:112109122
2951 2951 a, g, t dbSNP:777389254
2959 2959 a, g dbSNP:144342691
2960 2960 -, g dbSNP:772421306
2973 2973 a, c dbSNP:752572011
2979 2979 -, a dbSNP:765803663
2982 2982 -, acattgcgcgtgcccgccggttgcagg dbSNP:745574977
2982 2982 a, t dbSNP:199691851
2987 2987 a, g dbSNP:754674255
2988 2988 c, t dbSNP:149625153
2989 2989 a, c, g dbSNP:143164025
2990 2990 c, t dbSNP:377695976
2991 2991 a, g, t dbSNP:142984572
2995 2995 c, t dbSNP:772950886
2996 2996 c, t dbSNP:146501772
2997 2997 a, g dbSNP:141894965
2999 2999 c, t dbSNP:78303595
3000 3000 a, g dbSNP:533449267
3015 3015 c, t dbSNP:201582241
3030 3030 a, g dbSNP:201448367
3032 3032 c, t dbSNP:747916314
3033 3033 a, g dbSNP:143547447
3040 3040 -, t dbSNP:778546271
3045 3045 c, t dbSNP:768471993
3048 3048 a, g dbSNP:749132724
3051 3051 c, g dbSNP:138748613
3052 3052 c, t dbSNP:755515075
3055 3055 a, g dbSNP:750019735
3056 3056 g, t dbSNP:780982351
3058 3058 g, t dbSNP:757023222
3063 3063 a, g dbSNP:140769823
3080 3080 a, c, t dbSNP:2229467
3081 3081 a, g dbSNP:142912342
3088 3088 a, g dbSNP:765832266
3092 3092 a, g dbSNP:759531138
3093 3093 -, t dbSNP:770548526
3116 3116 a, c dbSNP:776813358
3120 3120 g, t dbSNP:771120009
3122 3122 a, c dbSNP:760837625
3126 3126 c, g, t dbSNP:768371778
3128 3128 a, c dbSNP:201207044
3129 3129 c, g, t dbSNP:769833376
3133 3133 c, t dbSNP:745334916
3134 3134 c, t dbSNP:376701936
3135 3135 a, g, t dbSNP:751193145
3138 3138 c, t dbSNP:777584225
3140 3140 -, c dbSNP:748776162
3142 3142 -, t dbSNP:777292177
3143 3143 c, t dbSNP:758678733
3144 3144 a, g dbSNP:753174535
3148 3148 c, t dbSNP:765632243
3160 3160 c, g dbSNP:199715844
3169 3169 c, g dbSNP:200270332
3170 3170 a, g dbSNP:765020069
3179 3179 c, g, t dbSNP:376701500
3185 3185 c, t dbSNP:199980014
3186 3186 a, g dbSNP:147527725
3207 3207 c, g, t dbSNP:371981464
3240 3240 c, t dbSNP:747795614
3242 3242 c, g, t dbSNP:114040223
3243 3243 a, g dbSNP:749709873
3247 3247 a, g dbSNP:780532198
3253 3253 a, g dbSNP:756650682
3257 3257 c, t dbSNP:750476293
3267 3267 c, g dbSNP:781280262
3269 3269 c, t dbSNP:527365033
3270 3270 a, g dbSNP:751750658
3275 3275 -, cag dbSNP:754373356
3277 3277 c, g dbSNP:764283942
3281 3281 a, g dbSNP:759403308
3282 3282 a, c, t dbSNP:766399202
3286 3286 a, g dbSNP:760642281
3309 3309 c, t dbSNP:368115484
3310 3310 a, g dbSNP:115239928
3311 3311 a, g dbSNP:761241565
3322 3322 c, g, t dbSNP:768257008
3323 3323 a, c, g dbSNP:780442109
3325 3325 g, t dbSNP:770161500
3329 3329 c, g dbSNP:746310687
3330 3330 a, c dbSNP:781566508
3336 3336 a, g dbSNP:757348998
3338 3338 g, t dbSNP:751659101
3349 3349 a, t dbSNP:764938585
3350 3350 c, t dbSNP:573606004
3357 3357 a, g dbSNP:759916560
3360 3360 a, g, t dbSNP:771351792
3370 3370 a, g dbSNP:372120856
3372 3372 a, g dbSNP:773861793
3375 3375 a, c dbSNP:539990375
3376 3376 c, t dbSNP:748296127
3389 3389 c, t dbSNP:779271518
3390 3390 a, g, t dbSNP:186130143
3399 3399 a, c dbSNP:780798755
3400 3400 -, gag dbSNP:781203724
3400 3400 c, g dbSNP:757102692
3408 3408 g, t dbSNP:751382636
3410 3410 c, t dbSNP:764079601
3411 3411 -, t dbSNP:754806971
3411 3411 c, t dbSNP:116580440
3416 3416 a, g dbSNP:752247056
3418 3418 a, g dbSNP:764850534
3423 3423 g, t dbSNP:759062564
3425 3425 a, g dbSNP:368778455
3427 3427 a, c dbSNP:776379217
3428 3428 c, t dbSNP:766585562
3429 3429 a, g dbSNP:149573831
3441 3441 g, t dbSNP:150859715
3446 3446 a, g dbSNP:200585982
3451 3451 c, g dbSNP:758317371
3457 3457 a, g dbSNP:772773344
3463 3463 a, g dbSNP:761951206
3465 3465 c, t dbSNP:752797320
3469 3469 a, g dbSNP:114560498
3473 3473 a, g dbSNP:768800208
3481 3481 a, c, g dbSNP:780324954
3486 3486 a, t dbSNP:78483218
3491 3491 a, t dbSNP:746876797
3494 3494 a, t dbSNP:777658403
3509 3509 g, t dbSNP:775574815
3512 3512 -, g dbSNP:786201004
3521 3521 c, t dbSNP:373007866
3522 3522 a, g dbSNP:115712132
3525 3525 a, g dbSNP:777498798
3529 3529 c, t dbSNP:771886651
3531 3531 a, g dbSNP:748014965
3532 3532 a, g dbSNP:778923534
3539 3539 a, t dbSNP:754434241
3544 3544 a, g dbSNP:753454602
3545 3545 c, t dbSNP:371221254
3550 3550 a, g dbSNP:1049607
3552 3552 c, t dbSNP:750121518
3553 3553 a, g dbSNP:200469035
3554 3554 g, t dbSNP:148831499
3558 3558 c, t dbSNP:752051425
3559 3559 g, t dbSNP:764732120
3561 3561 a, c dbSNP:544617603
3562 3562 a, g dbSNP:374453446
3566 3566 c, t dbSNP:2228342
3569 3569 a, g dbSNP:759715557
3575 3575 c, t dbSNP:565264503
3576 3576 a, g dbSNP:771796673
3578 3578 a, g dbSNP:747996518
3584 3584 a, c dbSNP:774150667
3590 3590 c, t dbSNP:370023805
3591 3591 a, g dbSNP:748722966
3597 3597 a, g dbSNP:147931502
3599 3599 a, g dbSNP:755713391
3605 3605 a, g dbSNP:745444340
3608 3608 c, g, t dbSNP:540971405
3609 3609 a, g dbSNP:376506766
3610 3610 c, t dbSNP:764488417
3611 3611 a, g dbSNP:373304451
3612 3612 a, t dbSNP:573577248
3616 3616 c, g dbSNP:765295906
3619 3619 c, t dbSNP:759625668
3624 3624 c, t dbSNP:751403505
3632 3632 a, c dbSNP:776822301
3639 3639 a, g dbSNP:766656252
3643 3643 c, g dbSNP:761563303
3646 3646 c, t dbSNP:774249671
3655 3655 c, t dbSNP:370824531
3656 3656 a, g dbSNP:369211699
3659 3659 a, g dbSNP:775290696
3664 3664 a, c dbSNP:575310994
3667 3667 c, t dbSNP:201971267
3674 3674 c, t dbSNP:538322482
3675 3675 a, g dbSNP:757022831
3707 3707 a, g dbSNP:368450102
3739 3739 c, t dbSNP:2566
3747 3747 a, g dbSNP:534647010
3761 3761 c, t dbSNP:185362831
3774 3774 c, t dbSNP:549169984
3809 3809 c, t dbSNP:530592313
3841 3841 a, g dbSNP:145792505
3851 3851 a, g dbSNP:754108338
3875 3875 g, t dbSNP:193069291
3899 3899 a, g dbSNP:371579247
3912 3912 c, t dbSNP:188120955
3915 3915 c, t dbSNP:750772872
3916 3916 a, g dbSNP:566086702
3928 3928 c, t dbSNP:368031652
3929 3929 c, t dbSNP:12033066
3942 3942 c, t dbSNP:11555727
3967 3967 c, t dbSNP:540588997
4006 4006 c, t dbSNP:111402627
4008 4008 a, g dbSNP:528806447
4029 4029 c, t dbSNP:558747584

Target ORF information:

RefSeq Version NM_001127641
Organism Homo sapiens (human)
Definition Homo sapiens laminin, beta 3 (LAMB3), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17378
Accession Version NM_000228.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3519bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product laminin subunit beta-3 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL555685.3, BC058922.1, AY035783.1 and BC075838.1. This sequence is a reference standard in the RefSeqGene project. On Apr 23, 2005 this sequence version replaced gi:4557712. Summary: The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1, also known as B3A) encodes the same protein as variants 2 and 3. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC058922.1, D37766.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)7..9(+)
Misc Feature(2)202..888(+)
Misc Feature(3)889..1056(+)
Misc Feature(4)892..1014(+)
Misc Feature(5)1087..1251(+)
Misc Feature(6)1090..1209(+)
Misc Feature(7)1276..1431(+)
Misc Feature(8)1279..1374(+)
Misc Feature(9)1432..1581(+)
Misc Feature(10)1435..1530(+)
Misc Feature(11)1582..1740(+)
Misc Feature(12)1585..1677(+)
Misc Feature(13)1741..1890(+)
Misc Feature(14)1744..1836(+)
Misc Feature(15)1879..2499(+)
Misc Feature(16)2500..2592(+)
Misc Feature(17)2593..3654(+)
Misc Feature(18)2674..3357(+)
Misc Feature(19)2728..3372(+)
Misc Feature(20)2761..3372(+)
Misc Feature(21)3019..3135(+)
Exon (1)1..107
Gene Synonym:
Exon (2)108..172
Gene Synonym:
Exon (3)173..327
Gene Synonym:
Exon (4)328..442
Gene Synonym:
Exon (5)443..516
Gene Synonym:
Exon (6)517..708
Gene Synonym:
Exon (7)709..772
Gene Synonym:
Exon (8)773..966
Gene Synonym:
Exon (9)967..1087
Gene Synonym:
Exon (10)1088..1276
Gene Synonym:
Exon (11)1277..1432
Gene Synonym:
Exon (12)1433..1629
Gene Synonym:
Exon (13)1630..1741
Gene Synonym:
Exon (14)1742..2120
Gene Synonym:
Exon (15)2121..2281
Gene Synonym:
Exon (16)2282..2502
Gene Synonym:
Exon (17)2503..2700
Gene Synonym:
Exon (18)2701..2845
Gene Synonym:
Exon (19)2846..3053
Gene Synonym:
Exon (20)3054..3195
Gene Synonym:
Exon (21)3196..3372
Gene Synonym:
Exon (22)3373..3526
Gene Synonym:
Exon (23)3527..4064
Gene Synonym:
Position Chain Variation Link
10 10 g, t dbSNP:189447616
20 20 -, t dbSNP:142666490
35 35 a, g dbSNP:573561610
46 46 a, c dbSNP:555316141
52 52 c, t dbSNP:546193219
73 73 a, c dbSNP:543183724
80 80 a, g dbSNP:575967730
90 90 a, g dbSNP:75007722
109 109 a, t dbSNP:757463127
112 112 a, g dbSNP:547771685
130 130 c, t dbSNP:764990667
131 131 a, c dbSNP:369316294
137 137 c, g dbSNP:369518861
138 138 a, g dbSNP:753697952
147 147 a, g dbSNP:766177957
152 152 a, c dbSNP:760672832
154 154 c, t dbSNP:116218572
159 159 c, t dbSNP:140470350
160 160 c, t dbSNP:113185295
174 174 c, t dbSNP:114304155
175 175 -, c dbSNP:777672897
182 182 g, t dbSNP:746335563
196 196 c, t dbSNP:777231178
199 199 a, c, g dbSNP:200672750
205 205 a, t dbSNP:751818569
209 209 a, c, t dbSNP:147620922
211 211 c, t dbSNP:115191959
212 212 a, g, t dbSNP:139480015
214 214 g, t dbSNP:750218343
218 218 c, t dbSNP:781227957
223 223 -, t dbSNP:751141486
223 223 c, t dbSNP:757278127
226 226 c, t dbSNP:751050188
229 229 c, t dbSNP:763767212
233 233 c, t dbSNP:116643086
240 240 c, t dbSNP:752440951
248 248 c, t dbSNP:765484485
259 259 c, t dbSNP:759900167
260 260 a, g dbSNP:146125956
268 268 c, t dbSNP:80356680
269 269 a, g dbSNP:761173046
282 282 c, t dbSNP:2228339
312 312 c, t dbSNP:772245138
314 314 c, t dbSNP:748289290
318 318 a, g dbSNP:779157351
324 324 c, t dbSNP:114295238
325 325 a, g dbSNP:765935706
327 327 a, g dbSNP:745623000
328 328 a, t dbSNP:753545651
335 335 a, t dbSNP:201830202
338 338 a, c, g dbSNP:375522351
356 356 c, t dbSNP:756431966
357 357 -, c dbSNP:765981678
357 357 c, t dbSNP:566813980
360 360 a, g dbSNP:765883028
361 361 c, t dbSNP:762234799
363 363 a, g dbSNP:774488682
411 411 a, c, t dbSNP:143833060
412 412 a, g dbSNP:775892223
413 413 a, g dbSNP:770169154
415 415 a, c dbSNP:371036275
419 419 c, t dbSNP:746748625
421 421 c, t dbSNP:772891857
422 422 a, g dbSNP:771977502
426 426 a, g dbSNP:748099677
435 435 a, c dbSNP:2076356
450 450 a, c dbSNP:376274555
451 451 c, g, t dbSNP:200105150
458 458 c, g dbSNP:768605252
466 466 c, g dbSNP:748738681
476 476 a, g dbSNP:55824996
477 477 c, t dbSNP:769435295
479 479 a, g dbSNP:745569387
481 481 a, c, g dbSNP:371231587
483 483 a, t dbSNP:199599061
484 484 g, t dbSNP:372620941
486 486 c, t dbSNP:758983287
489 489 a, g dbSNP:752754551
503 503 c, t dbSNP:765479137
516 516 a, g dbSNP:759819148
518 518 c, g dbSNP:574291969
519 519 c, g dbSNP:776214216
523 523 a, c dbSNP:202025705
528 528 c, t dbSNP:1130667
531 531 c, t dbSNP:374988953
532 532 a, g, t dbSNP:769334793
546 546 a, g dbSNP:183509078
547 547 c, t dbSNP:372985506
548 548 a, g dbSNP:148603717
553 553 a, t dbSNP:780249357
561 561 c, t dbSNP:201554705
562 562 a, g, t dbSNP:749618741
569 569 c, t dbSNP:758154155
573 573 a, c, g dbSNP:369555024
574 574 c, t dbSNP:759518184
575 575 a, c, g dbSNP:375668443
576 576 a, g dbSNP:760221702
588 588 c, t dbSNP:200607251
589 589 c, t dbSNP:372787389
590 590 -, acct dbSNP:746705740
597 597 c, t dbSNP:369986809
598 598 a, g dbSNP:748466087
603 603 c, t dbSNP:565416040
606 606 a, c dbSNP:375815552
607 607 -, t dbSNP:776537364
615 615 c, t dbSNP:749866341
616 616 c, t dbSNP:779979101
619 619 c, t dbSNP:116472735
620 620 a, g, t dbSNP:528873916
623 623 g, t dbSNP:192538322
626 626 a, g dbSNP:752418863