Email to GenScript

LAMP2 lysosomal-associated membrane protein 2 [Homo sapiens (human)]

Gene Symbol LAMP2
Entrez Gene ID 3920
Full Name lysosomal-associated membrane protein 2
Synonyms CD107b, LAMP-2, LAMPB, LGP110
General protein information
Preferred Names
lysosome-associated membrane glycoprotein 2
lysosome-associated membrane glycoprotein 2
CD107 antigen-like family member B
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Glycogen storage disease IIb, 300257 (3)

The following LAMP2 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LAMP2 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu23655 NM_002294 Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant A, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu23847 NM_013995 Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant B, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu23862 NM_001122606 Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant C, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu23655
Accession Version NM_002294.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1233bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu23655D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product lysosome-associated membrane glycoprotein 2 isoform A precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA405328.1, X77196.1, AC002476.1 and BC040653.2. This sequence is a reference standard in the RefSeqGene project. On Mar 12, 2008 this sequence version replaced gi:4504956. Summary: The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (A) is the longest and predominant form of this gene. Variant A encodes isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X77196.1, AK291090.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)37..39(+)
Misc Feature(2)265..756(+)
Misc Feature(3)274..276(+)
Misc Feature(4)292..294(+)
Misc Feature(5)325..327(+)
Misc Feature(6)352..354(+)
Misc Feature(7)505..1410(+)
Misc Feature(8)757..864(+)
Misc Feature(9)763..765(+)
Misc Feature(10)766..768(+)
Misc Feature(11)778..780(+)
Misc Feature(12)787..789(+)
Misc Feature(13)790..792(+)
Misc Feature(14)799..801(+)
Misc Feature(15)805..807(+)
Misc Feature(16)808..810(+)
Misc Feature(17)811..813(+)
Misc Feature(18)865..1305(+)
Misc Feature(19)904..906(+)
Misc Feature(20)1099..1101(+)
Misc Feature(21)1303..1305(+)
Misc Feature(22)1306..1377(+)
Exon (1)1..244
Gene Synonym:
Exon (2)245..363
Gene Synonym:
Exon (3)364..577
Gene Synonym:
Exon (4)578..736
Gene Synonym:
Exon (5)737..921
Gene Synonym:
Exon (6)922..1044
Gene Synonym:
Exon (7)1045..1108
Gene Synonym:
Exon (8)1109..1273
Gene Synonym:
Exon (9)1274..6588
Gene Synonym:
Position Chain Variation Link
13 13 -, c dbSNP:760941179
29 29 a, g dbSNP:775484817
43 43 g, t dbSNP:144321444
46 46 a, g dbSNP:181118176
52 52 c, t dbSNP:759576473
81 81 a, g dbSNP:188688129
84 84 a, g dbSNP:771371201
96 96 a, c dbSNP:370136094
142 142 -, cgccgccgt dbSNP:730880477
142 142 c, t dbSNP:778851681
148 148 c, t dbSNP:368403767
154 154 c, t dbSNP:587781015
158 158 -, gtcgccgcc dbSNP:193922648
161 161 a, g dbSNP:780284129
163 163 c, t dbSNP:756511454
171 171 c, t dbSNP:201209341
173 173 c, g dbSNP:768073560
174 174 c, t dbSNP:762305947
177 177 a, c, g dbSNP:200297370
180 180 c, g dbSNP:773623849
188 188 a, g dbSNP:730880489
189 189 c, t dbSNP:775032667
209 209 c, t dbSNP:769378984
210 210 a, g dbSNP:11540224
212 212 c, g, t dbSNP:3180515
214 214 a, c, t dbSNP:367914423
217 217 g, t dbSNP:12853266
219 219 g, t dbSNP:776553740
222 222 c, t dbSNP:727503122
229 229 a, g, t dbSNP:777718603
236 236 g, t dbSNP:397516745
237 237 a, g dbSNP:768651205
240 240 c, g dbSNP:749357064
247 247 -, gag dbSNP:766343235
253 253 c, t dbSNP:730880478
254 254 a, g dbSNP:750118236
261 261 c, t dbSNP:757589432
265 265 c, t dbSNP:747363310
274 274 a, g dbSNP:367625418
280 280 a, g dbSNP:778191463
301 301 -, t dbSNP:727504600
309 309 -, at dbSNP:730880344
336 336 a, t dbSNP:12097
337 337 c, t dbSNP:752321157
338 338 a, g dbSNP:397516735
363 363 a, c, g, t dbSNP:397516736
371 371 g, t dbSNP:769883128
371 371 -, t dbSNP:397516738
383 383 a, g dbSNP:113529754
384 384 c, g dbSNP:376215728
385 385 c, t dbSNP:776875696
386 386 a, g dbSNP:771157957
391 391 a, g dbSNP:747390282
394 394 a, g dbSNP:778193991
397 397 -, a dbSNP:397516739
398 398 c, t dbSNP:758621669
412 412 a, g dbSNP:748676358
433 433 a, g dbSNP:371149731
444 444 a, t dbSNP:779524035
456 456 c, t dbSNP:754577706
457 457 a, g dbSNP:727504953
464 464 a, g, t dbSNP:755790073
473 473 a, g dbSNP:397516740
479 479 c, t dbSNP:397516741
480 480 a, g dbSNP:765548221
500 500 c, g dbSNP:730880497
502 502 a, g dbSNP:751526532
511 511 a, g dbSNP:762218821
513 513 c, t dbSNP:397516742
515 515 a, g dbSNP:759658269
519 519 c, t dbSNP:147369153
520 520 a, g dbSNP:377652722
533 533 a, g dbSNP:760953845
536 536 a, g dbSNP:773248859
542 542 a, g dbSNP:772520416
544 544 a, g dbSNP:730880480
551 551 c, t dbSNP:397516744
553 553 -, aca dbSNP:760602347
553 553 a, g dbSNP:748494547
565 565 a, g dbSNP:149276836
585 585 c, t dbSNP:764073250
595 595 a, g dbSNP:373007615
611 611 g, t dbSNP:752509876
620 620 a, t dbSNP:137852527
623 623 a, g dbSNP:766491800
633 633 c, t dbSNP:200348335
641 641 a, g dbSNP:773525538
642 642 c, t dbSNP:772164739
643 643 -, a dbSNP:193922649
652 652 a, g dbSNP:138374063
663 663 c, g dbSNP:774853191
684 684 c, t dbSNP:150520869
695 695 c, t dbSNP:371174243
697 697 a, g dbSNP:141574558
700 700 c, t dbSNP:104894857
713 713 a, c, g dbSNP:775432228
716 716 -, a dbSNP:730880491
739 739 -, a dbSNP:768401197
746 746 a, g dbSNP:750457485
752 752 a, t dbSNP:767918596
759 759 -, aacttcaa dbSNP:398123685
766 766 a, g, t dbSNP:138991195
768 768 -, caaca dbSNP:730880492
771 771 a, g dbSNP:201030806
785 785 a, c dbSNP:730880475
807 807 a, t dbSNP:763189947
810 810 a, g dbSNP:112341751
820 820 a, c dbSNP:776101722
831 831 -, a dbSNP:730880493
841 841 a, g dbSNP:145169006
852 852 a, g dbSNP:397516746
855 855 g, t dbSNP:745437545
856 856 a, g dbSNP:775997773
877 877 c, g dbSNP:772577020
889 889 a, g dbSNP:746678211
895 895 c, g dbSNP:730880481
909 909 c, g dbSNP:777354230
917 917 a, g dbSNP:730880482
930 930 a, c dbSNP:765836082
931 931 a, g dbSNP:759964363
935 935 g, t dbSNP:141541387
939 939 c, t dbSNP:770447676
946 946 c, t dbSNP:185823878
947 947 a, c dbSNP:1043878
948 948 c, t dbSNP:772901542
949 949 a, g dbSNP:369032377
951 951 c, t dbSNP:138435481
953 953 c, t dbSNP:111703410
958 958 c, t dbSNP:778577575
964 964 a, g dbSNP:754748093
971 971 c, g dbSNP:749209441
975 975 a, c dbSNP:730880483
977 977 a, g dbSNP:200934351
1003 1003 a, g dbSNP:143699208
1004 1004 a, g dbSNP:397516747
1010 1010 a, g dbSNP:730880484
1022 1022 a, g dbSNP:397516748
1025 1025 g, t dbSNP:397516749
1030 1030 c, t dbSNP:374690629
1031 1031 -, tt dbSNP:727504648
1035 1035 c, t dbSNP:397516750
1057 1057 a, c, t dbSNP:727503118
1065 1065 c, t dbSNP:771546093
1067 1067 c, t dbSNP:730880486
1076 1076 c, t dbSNP:201328350
1077 1077 a, g dbSNP:774009218
1087 1087 a, g dbSNP:768369360
1100 1100 a, g dbSNP:749064700
1107 1107 c, t dbSNP:73219144
1108 1108 a, g dbSNP:104894858
1140 1140 c, t dbSNP:371959861
1141 1141 c, t dbSNP:104894859
1145 1145 a, t dbSNP:190221827
1154 1154 -, t dbSNP:730880498
1159 1159 a, g dbSNP:750874008
1179 1179 -, a dbSNP:727504557
1180 1180 c, g dbSNP:766962315
1183 1183 c, g dbSNP:145703593
1200 1200 -, t dbSNP:727504597
1201 1201 c, g dbSNP:773919751
1205 1205 c, t dbSNP:768336099
1220 1220 c, g dbSNP:730880487
1234 1234 a, g dbSNP:762895517
1247 1247 a, g dbSNP:775416221
1248 1248 c, t dbSNP:769643748
1257 1257 a, g dbSNP:1139708
1258 1258 a, g dbSNP:781134467
1264 1264 c, t dbSNP:367740222
1269 1269 c, t dbSNP:748227349
1271 1271 c, t dbSNP:183781327
1296 1296 c, t dbSNP:749338632
1297 1297 -, gac dbSNP:730880494
1297 1297 a, g, t dbSNP:727503117
1298 1298 a, g dbSNP:769995100
1305 1305 c, t dbSNP:746288560
1317 1317 a, g dbSNP:730880126
1319 1319 c, t dbSNP:747301460
1322 1322 c, t dbSNP:139633545
1342 1342 g, t dbSNP:372906565
1355 1355 c, t dbSNP:778382193
1356 1356 a, g dbSNP:758020252
1371 1371 c, t dbSNP:752231323
1373 1373 c, t dbSNP:727504625
1374 1374 -, attttatt dbSNP:752840154
1387 1387 a, c dbSNP:778764771
1391 1391 a, t dbSNP:727504957
1428 1428 c, t dbSNP:376806600
1437 1437 c, t dbSNP:753374435
1446 1446 a, c, g dbSNP:745798436
1488 1488 a, c dbSNP:768475790
1525 1525 c, t dbSNP:778938403
1533 1533 -, aatc dbSNP:757173953
1537 1537 c, t dbSNP:749090092
1565 1565 c, t dbSNP:542576305
1618 1618 c, t dbSNP:41300191
1650 1650 c, t dbSNP:143070918
1670 1670 a, g dbSNP:371031457
1673 1673 g, t dbSNP:753133641
1709 1709 a, c dbSNP:1801135
1710 1710 a, c dbSNP:8160
1727 1727 c, t dbSNP:755520529
1728 1728 -, taacat dbSNP:766396944
1763 1763 c, t dbSNP:758434357
1843 1843 c, t dbSNP:749885888
1890 1890 c, t dbSNP:750939378
1898 1898 ca, tg dbSNP:386827301
1898 1898 c, t dbSNP:185972753
1899 1899 a, g dbSNP:5957383
1963 1963 a, g dbSNP:756938982
1996 1996 c, t dbSNP:181333906
1999 1999 a, g dbSNP:41312757
2097 2097 c, t dbSNP:184344224
2124 2124 -, gttt dbSNP:761300966
2266 2266 a, g dbSNP:763861761
2291 2291 c, t dbSNP:775142637
2317 2317 c, t dbSNP:771496857
2337 2337 a, g dbSNP:762796984
2415 2415 c, g dbSNP:368723660
2454 2454 c, t dbSNP:759105844
2484 2484 g, t dbSNP:2285548
2487 2487 c, g dbSNP:770959886
2509 2509 c, t dbSNP:5957382
2538 2538 a, g dbSNP:181690821
2627 2627 -, ct dbSNP:769587066
2656 2656 a, g dbSNP:147825361
2727 2727 c, t dbSNP:5957381
2738 2738 c, t dbSNP:140499497
2742 2742 -, atgag dbSNP:772626501
2769 2769 c, g dbSNP:188897063
2804 2804 a, g dbSNP:747215176
2826 2826 a, g dbSNP:773379092
2843 2843 a, c dbSNP:772282965
2899 2899 a, g dbSNP:779447908
2905 2905 c, t dbSNP:185680374
2940 2940 c, t dbSNP:754306794
3002 3002 a, g dbSNP:73612906
3030 3030 c, t dbSNP:141881232
3045 3045 a, g dbSNP:755434692
3055 3055 a, t dbSNP:752352307
3113 3113 -, t dbSNP:373005118
3114 3114 -, t dbSNP:765860680
3188 3188 -, a dbSNP:759156736
3271 3271 c, g dbSNP:551726898
3363 3363 a, g dbSNP:770516462
3392 3392 c, t dbSNP:763011446
3397 3397 a, g dbSNP:148513908
3404 3404 -, tcaagatttaaacacagttctgtctgaatccagaactcaaaa dbSNP:372028662
3406 3406 -, aagatttaaacacagttctgtctgaatccagaactcaaaatc dbSNP:746044334
3406 3406 a, t dbSNP:5956215
3408 3408 c, g dbSNP:747959447
3418 3418 c, g dbSNP:200014321
3436 3436 c, g dbSNP:193230112
3490 3490 a, c dbSNP:749840453
3501 3501 c, t dbSNP:780826840
3512 3512 a, g dbSNP:756779550
3530 3530 c, t dbSNP:779000030
3560 3560 -, gt, gtat, gtatat dbSNP:778330920
3561 3561 -, catatata dbSNP:753072593
3561 3561 a, g dbSNP:756504749
3562 3562 c, t dbSNP:187660648
3572 3572 -, at dbSNP:769125462
3573 3573 -, at dbSNP:753399289
3574 3574 -, atat, atatat, atatatat dbSNP:765988404
3575 3575 a, g dbSNP:767123866
3582 3582 c, t dbSNP:751146184
3584 3584 c, t dbSNP:184297875
3588 3588 c, t dbSNP:191802231
3596 3596 c, t dbSNP:765214315
3608 3608 c, t dbSNP:13441024
3614 3614 -, ta dbSNP:776510193
3638 3638 -, tatatatacaca dbSNP:200167553
3644 3644 c, t dbSNP:768404397
3674 3674 a, g dbSNP:12395643
3699 3699 a, c dbSNP:556281238
3757 3757 a, g dbSNP:752409883
3763 3763 a, c dbSNP:111473686
3767 3767 a, g dbSNP:771058435
3783 3783 c, g dbSNP:539545568
3808 3808 a, g dbSNP:10127185
3811 3811 c, g dbSNP:756620818
3873 3873 a, g dbSNP:10127182
3888 3888 c, t dbSNP:781643131
3889 3889 c, t dbSNP:776684734
3927 3927 a, t dbSNP:755322977
3931 3931 a, g dbSNP:56158197
3934 3934 g, t dbSNP:766113990
3935 3935 c, t dbSNP:758046468
3937 3937 c, t dbSNP:150119198
3950 3950 a, g dbSNP:187346492
3984 3984 c, t dbSNP:772262558
3988 3988 c, g dbSNP:77126790
3998 3998 -, t dbSNP:202199842
4004 4004 -, actaa dbSNP:776369585
4019 4019 c, g dbSNP:763889562
4038 4038 c, t dbSNP:182654000
4039 4039 -, aca dbSNP:200780311
4065 4065 c, t dbSNP:201640841
4084 4084 c, t dbSNP:750418202
4087 4087 a, t dbSNP:767422843
4090 4090 c, t dbSNP:763082089
4091 4091 a, g dbSNP:775547188
4131 4131 -, ct dbSNP:765285068
4135 4135 c, t dbSNP:769795421
4147 4147 c, t dbSNP:759814013
4158 4158 a, c dbSNP:776665496
4159 4159 a, g dbSNP:3827478
4184 4184 a, g dbSNP:747304113
4186 4186 a, c dbSNP:397516587
4192 4192 -, tgt dbSNP:760540948
4193 4193 g, t dbSNP:372396556
4207 4207 c, t dbSNP:368937075
4208 4208 a, g dbSNP:749374058
4220 4220 a, g dbSNP:778580428
4228 4228 c, t dbSNP:754397650
4229 4229 a, c dbSNP:375994314
4270 4270 g, t dbSNP:143420310
4273 4273 c, t dbSNP:755988734
4276 4276 -, gttt dbSNP:773163247
4280 4280 g, t dbSNP:769717509
4283 4283 -, t dbSNP:761717112
4283 4283 -, t dbSNP:767240416
4286 4286 a, g dbSNP:373841690
4288 4288 c, t dbSNP:761747329
4296 4296 -, a dbSNP:773987053
4297 4297 a, c, t dbSNP:376318727
4298 4298 a, g dbSNP:759490403
4304 4304 a, g dbSNP:780055219
4315 4315 a, g dbSNP:749628026
4322 4322 c, t dbSNP:190781020
4332 4332 a, c dbSNP:780640930
4350 4350 a, t dbSNP:756720313
4436 4436 -, t dbSNP:397803568
4444 4444 -, t dbSNP:113549733
4445 4445 c, t dbSNP:755451497
4449 4449 c, t dbSNP:747372256
4456 4456 a, g dbSNP:188577917
4487 4487 g, t dbSNP:758148695
4653 4653 a, g dbSNP:750004511
4661 4661 a, g dbSNP:5957380
4662 4662 c, t dbSNP:41300908
4694 4694 g, t dbSNP:183969784
4764 4764 -, gtta dbSNP:764018077
4798 4798 a, c dbSNP:192151171
4865 4865 c, t dbSNP:752469856
4872 4872 g, t dbSNP:185990694
4881 4881 -, gtt dbSNP:199705754
4901 4901 c, t dbSNP:773236667
4907 4907 a, g dbSNP:180681121
4960 4960 -, t dbSNP:761785059
4996 4996 a, g dbSNP:144504054
5041 5041 c, g dbSNP:189695743
5061 5061 g, t dbSNP:752459076
5100 5100 c, t dbSNP:185627568
5307 5307 c, g dbSNP:181132832
5353 5353 a, g dbSNP:754740000
5511 5511 c, g dbSNP:772259249
5657 5657 -, c dbSNP:745547671
5688 5688 a, c dbSNP:13460
5710 5710 a, g dbSNP:778421977
5865 5865 a, t dbSNP:756862897
5975 5975 a, g dbSNP:142200759
5992 5992 a, g dbSNP:42885
5996 5996 a, g dbSNP:190092370
6000 6000 a, g dbSNP:540341520
6032 6032 a, t dbSNP:766259260
6036 6036 a, g dbSNP:760657814
6040 6040 a, g dbSNP:752588468
6084 6084 c, t dbSNP:14152
6084 6084 c, t dbSNP:1045953
6170 6170 a, g dbSNP:767652057
6176 6176 a, t dbSNP:761928368
6211 6211 g, t dbSNP:759191240
6236 6236 c, t dbSNP:774576256
6303 6303 c, t dbSNP:768765720
6306 6306 a, g, t dbSNP:776018861
6352 6352 a, g dbSNP:750715219
6374 6374 a, g dbSNP:765371462
6376 6376 -, g dbSNP:754879365
6419 6419 a, t dbSNP:185156571
6420 6420 g, t dbSNP:11548982
6426 6426 a, g dbSNP:746415532
6451 6451 a, g dbSNP:2748
6451 6451 a, g dbSNP:529459795
6461 6461 a, t dbSNP:113285013
6492 6492 a, g dbSNP:747621180
6547 6547 c, t dbSNP:761270364
6585 6585 a, g dbSNP:778592348

Target ORF information:

RefSeq Version NM_002294
Organism Homo sapiens (human)
Definition Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant A, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23847
Accession Version NM_013995.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1233bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product lysosome-associated membrane glycoprotein 2 isoform B precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA405328.1, S79873.1, AC002476.1 and BP386088.1. This sequence is a reference standard in the RefSeqGene project. On Mar 12, 2008 this sequence version replaced gi:7669502. Summary: The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (B) results from alternative splicing of exon 9 and results in a shorter transcript, but not protein, as compared to variant A. Transcript variant B is over-expressed in muscle and encodes isoform B. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: S79873.1, U36336.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)37..39(+)
Misc Feature(2)274..276(+)
Misc Feature(3)292..294(+)
Misc Feature(4)325..327(+)
Misc Feature(5)352..354(+)
Misc Feature(6)505..1410(+)
Misc Feature(7)763..765(+)
Misc Feature(8)766..768(+)
Misc Feature(9)778..780(+)
Misc Feature(10)787..789(+)
Misc Feature(11)790..792(+)
Misc Feature(12)799..801(+)
Misc Feature(13)805..807(+)
Misc Feature(14)808..810(+)
Misc Feature(15)811..813(+)
Misc Feature(16)904..906(+)
Misc Feature(17)1099..1101(+)
Exon (1)1..244
Gene Synonym:
Exon (2)245..363
Gene Synonym:
Exon (3)364..577
Gene Synonym:
Exon (4)578..736
Gene Synonym:
Exon (5)737..921
Gene Synonym:
Exon (6)922..1044
Gene Synonym:
Exon (7)1045..1108
Gene Synonym:
Exon (8)1109..1273
Gene Synonym:
Exon (9)1274..4073
Gene Synonym:
Position Chain Variation Link
13 13 -, c dbSNP:760941179
29 29 a, g dbSNP:775484817
43 43 g, t dbSNP:144321444
46 46 a, g dbSNP:181118176
52 52 c, t dbSNP:759576473
81 81 a, g dbSNP:188688129
84 84 a, g dbSNP:771371201
96 96 a, c dbSNP:370136094
142 142 -, cgccgccgt dbSNP:730880477
142 142 c, t dbSNP:778851681
148 148 c, t dbSNP:368403767
154 154 c, t dbSNP:587781015
158 158 -, gtcgccgcc dbSNP:193922648
161 161 a, g dbSNP:780284129
163 163 c, t dbSNP:756511454
171 171 c, t dbSNP:201209341
173 173 c, g dbSNP:768073560
174 174 c, t dbSNP:762305947
177 177 a, c, g dbSNP:200297370
180 180 c, g dbSNP:773623849
188 188 a, g dbSNP:730880489
189 189 c, t dbSNP:775032667
209 209 c, t dbSNP:769378984
210 210 a, g dbSNP:11540224
212 212 c, g, t dbSNP:3180515
214 214 a, c, t dbSNP:367914423
217 217 g, t dbSNP:12853266
219 219 g, t dbSNP:776553740
222 222 c, t dbSNP:727503122
229 229 a, g, t dbSNP:777718603
236 236 g, t dbSNP:397516745
237 237 a, g dbSNP:768651205
240 240 c, g dbSNP:749357064
247 247 -, gag dbSNP:766343235
253 253 c, t dbSNP:730880478
254 254 a, g dbSNP:750118236
261 261 c, t dbSNP:757589432
265 265 c, t dbSNP:747363310
274 274 a, g dbSNP:367625418
280 280 a, g dbSNP:778191463
301 301 -, t dbSNP:727504600
309 309 -, at dbSNP:730880344
336 336 a, t dbSNP:12097
337 337 c, t dbSNP:752321157
338 338 a, g dbSNP:397516735
363 363 a, c, g, t dbSNP:397516736
371 371 g, t dbSNP:769883128
371 371 -, t dbSNP:397516738
383 383 a, g dbSNP:113529754
384 384 c, g dbSNP:376215728
385 385 c, t dbSNP:776875696
386 386 a, g dbSNP:771157957
391 391 a, g dbSNP:747390282
394 394 a, g dbSNP:778193991
397 397 -, a dbSNP:397516739
398 398 c, t dbSNP:758621669
412 412 a, g dbSNP:748676358
433 433 a, g dbSNP:371149731
444 444 a, t dbSNP:779524035
456 456 c, t dbSNP:754577706
457 457 a, g dbSNP:727504953
464 464 a, g, t dbSNP:755790073
473 473 a, g dbSNP:397516740
479 479 c, t dbSNP:397516741
480 480 a, g dbSNP:765548221
500 500 c, g dbSNP:730880497
502 502 a, g dbSNP:751526532
511 511 a, g dbSNP:762218821
513 513 c, t dbSNP:397516742
515 515 a, g dbSNP:759658269
519 519 c, t dbSNP:147369153
520 520 a, g dbSNP:377652722
533 533 a, g dbSNP:760953845
536 536 a, g dbSNP:773248859
542 542 a, g dbSNP:772520416
544 544 a, g dbSNP:730880480
551 551 c, t dbSNP:397516744
553 553 -, aca dbSNP:760602347
553 553 a, g dbSNP:748494547
565 565 a, g dbSNP:149276836
585 585 c, t dbSNP:764073250
595 595 a, g dbSNP:373007615
611 611 g, t dbSNP:752509876
620 620 a, t dbSNP:137852527
623 623 a, g dbSNP:766491800
633 633 c, t dbSNP:200348335
641 641 a, g dbSNP:773525538
642 642 c, t dbSNP:772164739
643 643 -, a dbSNP:193922649
652 652 a, g dbSNP:138374063
663 663 c, g dbSNP:774853191
684 684 c, t dbSNP:150520869
695 695 c, t dbSNP:371174243
697 697 a, g dbSNP:141574558
700 700 c, t dbSNP:104894857
713 713 a, c, g dbSNP:775432228
716 716 -, a dbSNP:730880491
739 739 -, a dbSNP:768401197
746 746 a, g dbSNP:750457485
752 752 a, t dbSNP:767918596
759 759 -, aacttcaa dbSNP:398123685
766 766 a, g, t dbSNP:138991195
768 768 -, caaca dbSNP:730880492
771 771 a, g dbSNP:201030806
785 785 a, c dbSNP:730880475
807 807 a, t dbSNP:763189947
810 810 a, g dbSNP:112341751
820 820 a, c dbSNP:776101722
831 831 -, a dbSNP:730880493
841 841 a, g dbSNP:145169006
852 852 a, g dbSNP:397516746
855 855 g, t dbSNP:745437545
856 856 a, g dbSNP:775997773
877 877 c, g dbSNP:772577020
889 889 a, g dbSNP:746678211
895 895 c, g dbSNP:730880481
909 909 c, g dbSNP:777354230
917 917 a, g dbSNP:730880482
930 930 a, c dbSNP:765836082
931 931 a, g dbSNP:759964363
935 935 g, t dbSNP:141541387
939 939 c, t dbSNP:770447676
946 946 c, t dbSNP:185823878
947 947 a, c dbSNP:1043878
948 948 c, t dbSNP:772901542
949 949 a, g dbSNP:369032377
951 951 c, t dbSNP:138435481
953 953 c, t dbSNP:111703410
958 958 c, t dbSNP:778577575
964 964 a, g dbSNP:754748093
971 971 c, g dbSNP:749209441
975 975 a, c dbSNP:730880483
977 977 a, g dbSNP:200934351
1003 1003 a, g dbSNP:143699208
1004 1004 a, g dbSNP:397516747
1010 1010 a, g dbSNP:730880484
1022 1022 a, g dbSNP:397516748
1025 1025 g, t dbSNP:397516749
1030 1030 c, t dbSNP:374690629
1031 1031 -, tt dbSNP:727504648
1035 1035 c, t dbSNP:397516750
1057 1057 a, c, t dbSNP:727503118
1065 1065 c, t dbSNP:771546093
1067 1067 c, t dbSNP:730880486
1076 1076 c, t dbSNP:201328350
1077 1077 a, g dbSNP:774009218
1087 1087 a, g dbSNP:768369360
1100 1100 a, g dbSNP:749064700
1107 1107 c, t dbSNP:73219144
1108 1108 a, g dbSNP:104894858
1140 1140 c, t dbSNP:371959861
1141 1141 c, t dbSNP:104894859
1145 1145 a, t dbSNP:190221827
1154 1154 -, t dbSNP:730880498
1159 1159 a, g dbSNP:750874008
1179 1179 -, a dbSNP:727504557
1180 1180 c, g dbSNP:766962315
1183 1183 c, g dbSNP:145703593
1200 1200 -, t dbSNP:727504597
1201 1201 c, g dbSNP:773919751
1205 1205 c, t dbSNP:768336099
1220 1220 c, g dbSNP:730880487
1234 1234 a, g dbSNP:762895517
1247 1247 a, g dbSNP:775416221
1248 1248 c, t dbSNP:769643748
1257 1257 a, g dbSNP:1139708
1258 1258 a, g dbSNP:781134467
1264 1264 c, t dbSNP:367740222
1269 1269 c, t dbSNP:748227349
1271 1271 c, t dbSNP:183781327
1286 1286 c, t dbSNP:765143363
1287 1287 a, g dbSNP:149783672
1306 1306 a, c, g dbSNP:770877964
1312 1312 c, t dbSNP:748244453
1315 1315 a, g dbSNP:140936359
1321 1321 a, g dbSNP:768666714
1325 1325 g, t dbSNP:749536246
1330 1330 a, g dbSNP:758513753
1332 1332 c, t dbSNP:756513550
1341 1341 c, g dbSNP:746226006
1350 1350 c, t dbSNP:147630563
1351 1351 a, g dbSNP:144140265
1368 1368 c, t dbSNP:375487167
1369 1369 a, g dbSNP:730880488
1381 1381 a, g dbSNP:777128122
1405 1405 a, t dbSNP:370910743
1416 1416 c, t dbSNP:752427591
1418 1418 a, t dbSNP:764949357
1426 1426 c, t dbSNP:377303143
1458 1458 -, acaagt dbSNP:764345579
1498 1498 a, t dbSNP:761239620
1656 1656 a, g dbSNP:765266884
1665 1665 a, c dbSNP:191040541
1716 1716 c, t dbSNP:754357697
1742 1742 a, t dbSNP:764572777
1828 1828 c, t dbSNP:187001041
1834 1834 g, t dbSNP:775687350
1835 1835 -, tg, ttgtgt, tttt, ttttgt dbSNP:576233822
1836 1836 -, g dbSNP:60325643
1836 1836 g, t dbSNP:45622238
1837 1837 g, t dbSNP:113842465
1838 1838 -, g dbSNP:774013302
1838 1838 g, t dbSNP:112371042
1840 1840 -, g dbSNP:748746109
1840 1840 g, t dbSNP:770567862
1869 1869 -, tgtgtg dbSNP:767342235
1869 1869 -, tg dbSNP:747404411
1871 1871 -, tg dbSNP:555004130
1873 1873 -, tg dbSNP:67522937
1875 1875 -, a dbSNP:754766500
1886 1886 c, t dbSNP:12850824
1887 1887 a, g dbSNP:12862637
1928 1928 c, t dbSNP:746085859
1935 1935 a, c dbSNP:190220547
1997 1997 a, g dbSNP:186556741
2004 2004 c, t dbSNP:753912996
2012 2012 -, c dbSNP:778292937
2032 2032 g, t dbSNP:756593055
2061 2061 a, t dbSNP:773716127
2078 2078 -, aat dbSNP:759257111
2102 2102 -, t dbSNP:767804392
2102 2102 a, t dbSNP:12852798
2103 2103 a, t dbSNP:759875640
2212 2212 a, g dbSNP:751184166
2267 2267 a, g dbSNP:766114041
2293 2293 c, t dbSNP:149520898
2304 2304 a, t dbSNP:772814251
2371 2371 a, t dbSNP:769422834
2409 2409 c, t dbSNP:769898129
2420 2420 c, t dbSNP:766142801
2423 2423 c, t dbSNP:745587553
2430 2430 c, t dbSNP:41310450
2459 2459 a, g dbSNP:757095441
2518 2518 a, c dbSNP:776569718
2538 2538 c, t dbSNP:768352796
2584 2584 c, t dbSNP:746808426
2591 2591 a, g dbSNP:779174556
2605 2605 a, g dbSNP:751335427
2618 2618 c, t dbSNP:771111651
2620 2620 c, g dbSNP:749419833
2648 2648 c, t dbSNP:188382921
2649 2649 a, g dbSNP:756145778
2673 2673 a, g dbSNP:183673904
2683 2683 a, g dbSNP:781681262
2694 2694 -, caaaacaaaa dbSNP:375999498
2708 2708 -, acaaaacaaa dbSNP:755353103
2711 2711 -, aaac dbSNP:375197709
2713 2713 -, acaaa dbSNP:766044190
2726 2726 -, caaa dbSNP:199756350
2804 2804 c, g dbSNP:752769768
2868 2868 a, g dbSNP:5957387
2881 2881 a, g dbSNP:42889
2933 2933 -, t dbSNP:769244306
2961 2961 a, g dbSNP:754158744
3080 3080 a, g dbSNP:192936472
3089 3089 c, t dbSNP:375062333
3118 3118 a, t dbSNP:5957386
3119 3119 c, t dbSNP:371130964
3148 3148 g, t dbSNP:112195778
3149 3149 g, t dbSNP:113361775
3153 3153 -, tt dbSNP:201938539
3154 3154 -, g, tt, ttt dbSNP:761330989
3154 3154 -, t dbSNP:10565432
3155 3155 -, g dbSNP:768636360
3155 3155 g, t dbSNP:776493190
3156 3156 -, tg dbSNP:760428576
3159 3159 g, t dbSNP:12853078
3185 3185 c, g dbSNP:112151652
3239 3239 a, g dbSNP:549257274
3250 3250 -, at dbSNP:113932840
3260 3260 -, ta dbSNP:143416156
3262 3262 -, at dbSNP:765735586
3263 3263 -, at dbSNP:769006362
3264 3264 -, at dbSNP:755523524
3330 3330 g, t dbSNP:16995851
3349 3349 c, t dbSNP:14410
3364 3364 c, t dbSNP:5957385
3404 3404 a, t dbSNP:550323580
3411 3411 a, c dbSNP:768008937
3442 3442 g, t dbSNP:748245402
3519 3519 g, t dbSNP:184879874
3559 3559 a, g dbSNP:762283779
3589 3589 -, at dbSNP:755474880
3613 3613 a, t dbSNP:774976705
3708 3708 a, g dbSNP:192985244
3720 3720 a, g dbSNP:769334823
3773 3773 a, g dbSNP:780585526
3787 3787 a, g dbSNP:758771784
3814 3814 a, g dbSNP:747875916
3835 3835 c, g dbSNP:187317957
3848 3848 a, t dbSNP:11540225
3908 3908 a, c dbSNP:183386365
3910 3910 g, t dbSNP:764972817
3987 3987 a, t dbSNP:1802861
3991 3991 a, g dbSNP:745499517
4011 4011 g, t dbSNP:542527520
4040 4040 a, g dbSNP:776218901
4067 4067 a, c dbSNP:753358547
4069 4069 a, g dbSNP:142526834

Target ORF information:

RefSeq Version NM_013995
Organism Homo sapiens (human)
Definition Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant B, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23862
Accession Version NM_001122606.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1236bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product lysosome-associated membrane glycoprotein 2 isoform C precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC002476.1, AY561849.1 and BC040653.2. This sequence is a reference standard in the RefSeqGene project. Summary: The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (C) results from alternative splicing of exon 9 and results in a shorter transcript, but longer protein, as compared to variant A. Variant C encodes isoform C. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY561849.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)37..39(+)
Misc Feature(2)505..1413(+)
Exon (1)1..244
Gene Synonym:
Exon (2)245..363
Gene Synonym:
Exon (3)364..577
Gene Synonym:
Exon (4)578..736
Gene Synonym:
Exon (5)737..921
Gene Synonym:
Exon (6)922..1044
Gene Synonym:
Exon (7)1045..1108
Gene Synonym:
Exon (8)1109..1273
Gene Synonym:
Exon (9)1274..3752
Gene Synonym:
Position Chain Variation Link
13 13 -, c dbSNP:760941179
29 29 a, g dbSNP:775484817
43 43 g, t dbSNP:144321444
46 46 a, g dbSNP:181118176
52 52 c, t dbSNP:759576473
81 81 a, g dbSNP:188688129
84 84 a, g dbSNP:771371201
96 96 a, c dbSNP:370136094
142 142 -, cgccgccgt dbSNP:730880477
142 142 c, t dbSNP:778851681
148 148 c, t dbSNP:368403767
154 154 c, t dbSNP:587781015
158 158 -, gtcgccgcc dbSNP:193922648
161 161 a, g dbSNP:780284129
163 163 c, t dbSNP:756511454
171 171 c, t dbSNP:201209341
173 173 c, g dbSNP:768073560
174 174 c, t dbSNP:762305947
177 177 a, c, g dbSNP:200297370
180 180 c, g dbSNP:773623849
188 188 a, g dbSNP:730880489
189 189 c, t dbSNP:775032667
209 209 c, t dbSNP:769378984
210 210 a, g dbSNP:11540224
212 212 c, g, t dbSNP:3180515
214 214 a, c, t dbSNP:367914423
217 217 g, t dbSNP:12853266
219 219 g, t dbSNP:776553740
222 222 c, t dbSNP:727503122
229 229 a, g, t dbSNP:777718603
236 236 g, t dbSNP:397516745
237 237 a, g dbSNP:768651205
240 240 c, g dbSNP:749357064
247 247 -, gag dbSNP:766343235
253 253 c, t dbSNP:730880478
254 254 a, g dbSNP:750118236
261 261 c, t dbSNP:757589432
265 265 c, t dbSNP:747363310
274 274 a, g dbSNP:367625418
280 280 a, g dbSNP:778191463
301 301 -, t dbSNP:727504600
309 309 -, at dbSNP:730880344
336 336 a, t dbSNP:12097
337 337 c, t dbSNP:752321157
338 338 a, g dbSNP:397516735
363 363 a, c, g, t dbSNP:397516736
371 371 g, t dbSNP:769883128
371 371 -, t dbSNP:397516738
383 383 a, g dbSNP:113529754
384 384 c, g dbSNP:376215728
385 385 c, t dbSNP:776875696
386 386 a, g dbSNP:771157957
391 391 a, g dbSNP:747390282
394 394 a, g dbSNP:778193991
397 397 -, a dbSNP:397516739
398 398 c, t dbSNP:758621669
412 412 a, g dbSNP:748676358
433 433 a, g dbSNP:371149731
444 444 a, t dbSNP:779524035
456 456 c, t dbSNP:754577706
457 457 a, g dbSNP:727504953
464 464 a, g, t dbSNP:755790073
473 473 a, g dbSNP:397516740
479 479 c, t dbSNP:397516741
480 480 a, g dbSNP:765548221
500 500 c, g dbSNP:730880497
502 502 a, g dbSNP:751526532
511 511 a, g dbSNP:762218821
513 513 c, t dbSNP:397516742
515 515 a, g dbSNP:759658269
519 519 c, t dbSNP:147369153
520 520 a, g dbSNP:377652722
533 533 a, g dbSNP:760953845
536 536 a, g dbSNP:773248859
542 542 a, g dbSNP:772520416
544 544 a, g dbSNP:730880480
551 551 c, t dbSNP:397516744
553 553 -, aca dbSNP:760602347
553 553 a, g dbSNP:748494547
565 565 a, g dbSNP:149276836
585 585 c, t dbSNP:764073250
595 595 a, g dbSNP:373007615
611 611 g, t dbSNP:752509876
620 620 a, t dbSNP:137852527
623 623 a, g dbSNP:766491800
633 633 c, t dbSNP:200348335
641 641 a, g dbSNP:773525538
642 642 c, t dbSNP:772164739
643 643 -, a dbSNP:193922649
652 652 a, g dbSNP:138374063
663 663 c, g dbSNP:774853191
684 684 c, t dbSNP:150520869
695 695 c, t dbSNP:371174243
697 697 a, g dbSNP:141574558
700 700 c, t dbSNP:104894857
713 713 a, c, g dbSNP:775432228
716 716 -, a dbSNP:730880491
739 739 -, a dbSNP:768401197
746 746 a, g dbSNP:750457485
752 752 a, t dbSNP:767918596
759 759 -, aacttcaa dbSNP:398123685
766 766 a, g, t dbSNP:138991195
768 768 -, caaca dbSNP:730880492
771 771 a, g dbSNP:201030806
785 785 a, c dbSNP:730880475
807 807 a, t dbSNP:763189947
810 810 a, g dbSNP:112341751
820 820 a, c dbSNP:776101722
831 831 -, a dbSNP:730880493
841 841 a, g dbSNP:145169006
852 852 a, g dbSNP:397516746
855 855 g, t dbSNP:745437545
856 856 a, g dbSNP:775997773
877 877 c, g dbSNP:772577020
889 889 a, g dbSNP:746678211
895 895 c, g dbSNP:730880481
909 909 c, g dbSNP:777354230
917 917 a, g dbSNP:730880482
930 930 a, c dbSNP:765836082
931 931 a, g dbSNP:759964363
935 935 g, t dbSNP:141541387
939 939 c, t dbSNP:770447676
946 946 c, t dbSNP:185823878
947 947 a, c dbSNP:1043878
948 948 c, t dbSNP:772901542
949 949 a, g dbSNP:369032377
951 951 c, t dbSNP:138435481
953 953 c, t dbSNP:111703410
958 958 c, t dbSNP:778577575
964 964 a, g dbSNP:754748093
971 971 c, g dbSNP:749209441
975 975 a, c dbSNP:730880483
977 977 a, g dbSNP:200934351
1003 1003 a, g dbSNP:143699208
1004 1004 a, g dbSNP:397516747
1010 1010 a, g dbSNP:730880484
1022 1022 a, g dbSNP:397516748
1025 1025 g, t dbSNP:397516749
1030 1030 c, t dbSNP:374690629
1031 1031 -, tt dbSNP:727504648
1035 1035 c, t dbSNP:397516750
1057 1057 a, c, t dbSNP:727503118
1065 1065 c, t dbSNP:771546093
1067 1067 c, t dbSNP:730880486
1076 1076 c, t dbSNP:201328350
1077 1077 a, g dbSNP:774009218
1087 1087 a, g dbSNP:768369360
1100 1100 a, g dbSNP:749064700
1107 1107 c, t dbSNP:73219144
1108 1108 a, g dbSNP:104894858
1140 1140 c, t dbSNP:371959861
1141 1141 c, t dbSNP:104894859
1145 1145 a, t dbSNP:190221827
1154 1154 -, t dbSNP:730880498
1159 1159 a, g dbSNP:750874008
1179 1179 -, a dbSNP:727504557
1180 1180 c, g dbSNP:766962315
1183 1183 c, g dbSNP:145703593
1200 1200 -, t dbSNP:727504597
1201 1201 c, g dbSNP:773919751
1205 1205 c, t dbSNP:768336099
1220 1220 c, g dbSNP:730880487
1234 1234 a, g dbSNP:762895517
1247 1247 a, g dbSNP:775416221
1248 1248 c, t dbSNP:769643748
1257 1257 a, g dbSNP:1139708
1258 1258 a, g dbSNP:781134467
1264 1264 c, t dbSNP:367740222
1269 1269 c, t dbSNP:748227349
1271 1271 c, t dbSNP:183781327
1295 1295 -, ct dbSNP:765285068
1299 1299 c, t dbSNP:769795421
1311 1311 c, t dbSNP:759814013
1322 1322 a, c dbSNP:776665496
1323 1323 a, g dbSNP:3827478
1348 1348 a, g dbSNP:747304113
1350 1350 a, c dbSNP:397516587
1356 1356 -, tgt dbSNP:760540948
1357 1357 g, t dbSNP:372396556
1371 1371 c, t dbSNP:368937075
1372 1372 a, g dbSNP:749374058
1384 1384 a, g dbSNP:778580428
1392 1392 c, t dbSNP:754397650
1393 1393 a, c dbSNP:375994314
1434 1434 g, t dbSNP:143420310
1437 1437 c, t dbSNP:755988734
1440 1440 -, gttt dbSNP:773163247
1444 1444 g, t dbSNP:769717509
1447 1447 -, t dbSNP:761717112
1447 1447 -, t dbSNP:767240416
1450 1450 a, g dbSNP:373841690
1452 1452 c, t dbSNP:761747329
1460 1460 -, a dbSNP:773987053
1461 1461 a, c, t dbSNP:376318727
1462 1462 a, g dbSNP:759490403
1468 1468 a, g dbSNP:780055219
1479 1479 a, g dbSNP:749628026
1486 1486 c, t dbSNP:190781020
1496 1496 a, c dbSNP:780640930
1514 1514 a, t dbSNP:756720313
1600 1600 -, t dbSNP:397803568
1608 1608 -, t dbSNP:113549733
1609 1609 c, t dbSNP:755451497
1613 1613 c, t dbSNP:747372256
1620 1620 a, g dbSNP:188577917
1651 1651 g, t dbSNP:758148695
1817 1817 a, g dbSNP:750004511
1825 1825 a, g dbSNP:5957380
1826 1826 c, t dbSNP:41300908
1858 1858 g, t dbSNP:183969784
1928 1928 -, gtta dbSNP:764018077
1962 1962 a, c dbSNP:192151171
2029 2029 c, t dbSNP:752469856
2036 2036 g, t dbSNP:185990694
2045 2045 -, gtt dbSNP:199705754
2065 2065 c, t dbSNP:773236667
2071 2071 a, g dbSNP:180681121
2124 2124 -, t dbSNP:761785059
2160 2160 a, g dbSNP:144504054
2205 2205 c, g dbSNP:189695743
2225 2225 g, t dbSNP:752459076
2264 2264 c, t dbSNP:185627568
2471 2471 c, g dbSNP:181132832
2517 2517 a, g dbSNP:754740000
2675 2675 c, g dbSNP:772259249
2821 2821 -, c dbSNP:745547671
2852 2852 a, c dbSNP:13460
2874 2874 a, g dbSNP:778421977
3029 3029 a, t dbSNP:756862897
3139 3139 a, g dbSNP:142200759
3156 3156 a, g dbSNP:42885
3160 3160 a, g dbSNP:190092370
3164 3164 a, g dbSNP:540341520
3196 3196 a, t dbSNP:766259260
3200 3200 a, g dbSNP:760657814
3204 3204 a, g dbSNP:752588468
3248 3248 c, t dbSNP:14152
3248 3248 c, t dbSNP:1045953
3334 3334 a, g dbSNP:767652057
3340 3340 a, t dbSNP:761928368
3375 3375 g, t dbSNP:759191240
3400 3400 c, t dbSNP:774576256
3467 3467 c, t dbSNP:768765720
3470 3470 a, g, t dbSNP:776018861
3516 3516 a, g dbSNP:750715219
3538 3538 a, g dbSNP:765371462
3540 3540 -, g dbSNP:754879365
3583 3583 a, t dbSNP:185156571
3584 3584 g, t dbSNP:11548982
3590 3590 a, g dbSNP:746415532
3615 3615 a, g dbSNP:2748
3615 3615 a, g dbSNP:529459795
3625 3625 a, t dbSNP:113285013
3656 3656 a, g dbSNP:747621180
3711 3711 c, t dbSNP:761270364
3749 3749 a, g dbSNP:778592348

Target ORF information:

RefSeq Version NM_001122606
Organism Homo sapiens (human)
Definition Homo sapiens lysosomal-associated membrane protein 2 (LAMP2), transcript variant C, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.