Email to GenScript

LMNA lamin A/C [Homo sapiens (human)]

Gene Symbol LMNA
Entrez Gene ID 4000
Full Name lamin A/C
General protein information
Preferred Names
70 kDa lamin
lamin A/C-like 1
renal carcinoma antigen NY-REN-32
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]. lac of sum
Disorder MIM:


Disorder Html: Emery-Dreifuss muscular dystrophy, AD, 181350 (3); Cardiomyopathy, dilated, 1A, 115200 (3); Lipodystrophy, familial partial, 151660 (3);

The following LMNA gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LMNA gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu27661 NM_001282626 Homo sapiens lamin A/C (LMNA), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $439
OHu27626 NM_001282624 Homo sapiens lamin A/C (LMNA), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu22769 NM_001257374 Homo sapiens lamin A/C (LMNA), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu20696 NM_170708 Homo sapiens lamin A/C (LMNA), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 Quote Price
OHu16808 NM_005572 Homo sapiens lamin A/C (LMNA), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379
OHu16808 NM_001282625 Homo sapiens lamin A/C (LMNA), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $439
OHu21250 NM_170707 Homo sapiens lamin A/C (LMNA), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379
OHu58735 XM_011509533 PREDICTED: Homo sapiens lamin A/C (LMNA), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu58736 XM_011509534 PREDICTED: Homo sapiens lamin A/C (LMNA), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu27661
Accession Version NM_001282626.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1845bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 16-JUL-2015
Organism Homo sapiens (human)
Product lamin isoform A-delta50
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA551594.1, AY357727.1, BU685425.1, BU732343.1 and AI872233.1. Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (7) uses an alternate 3' exon structure and thus differs in the 3' coding region and 3' UTR, compared to variant 1. This results in a shorter isoform (A-delta50, also known as progerin) with a distinct C-terminus when compared to isoform prelamin A. Although this isoform has been linked to Hutchinson-Gilford progeria syndrome, it is also found in unaffected individuals and thought to be linked to cellular terminal differentiation and physiological aging (see PubMed IDs: 12702809, 16645051, and 18060063). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AY357727.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)13..15(+)
Misc Feature(2)250..639(+)
Misc Feature(3)250..348(+)
Misc Feature(4)250..252(+)
Misc Feature(5)256..258(+)
Misc Feature(6)283..285(+)
Misc Feature(7)301..303(+)
Misc Feature(8)304..306(+)
Misc Feature(9)313..315(+)
Misc Feature(10)337..1407(+)
Misc Feature(11)343..693(+)
Misc Feature(12)343..345(+)
Misc Feature(13)343..345(+)
Misc Feature(14)349..1398(+)
Misc Feature(15)349..459(+)
Misc Feature(16)460..489(+)
Misc Feature(17)490..903(+)
Misc Feature(18)571..573(+)
Misc Feature(19)616..618(+)
Misc Feature(20)652..654(+)
Misc Feature(21)712..714(+)
Misc Feature(22)757..>1038(+)
Misc Feature(23)760..762(+)
Misc Feature(24)760..762(+)
Misc Feature(25)850..852(+)
Misc Feature(26)883..885(+)
Misc Feature(27)904..975(+)
Misc Feature(28)976..1398(+)
Misc Feature(29)1027..1029(+)
Misc Feature(30)1045..1047(+)
Misc Feature(31)1057..1059(+)
Misc Feature(32)1078..1080(+)
Misc Feature(33)1150..1152(+)
Misc Feature(34)1153..>1338(+)
Misc Feature(35)1168..1170(+)
Misc Feature(36)1180..1182(+)
Misc Feature(37)1222..1224(+)
Misc Feature(38)1237..1239(+)
Misc Feature(39)1417..1419(+)
Misc Feature(40)1423..1425(+)
Misc Feature(41)1432..1434(+)
Misc Feature(42)1456..1458(+)
Misc Feature(43)1459..1461(+)
Misc Feature(44)1468..1470(+)
Misc Feature(45)1489..1491(+)
Misc Feature(46)1498..1515(+)
Misc Feature(47)1540..1542(+)
Misc Feature(48)1546..1893(+)
Misc Feature(49)1597..1599(+)
Misc Feature(50)1618..1620(+)
Misc Feature(51)1621..1623(+)
Misc Feature(52)1636..1638(+)
Misc Feature(53)1735..1737(+)
Misc Feature(54)1762..1764(+)
Misc Feature(55)1777..1779(+)
Misc Feature(56)1885..1887(+)
Exon (1)1..605
Gene Synonym:
Exon (2)606..762
Gene Synonym:
Exon (3)763..888
Gene Synonym:
Exon (4)889..1059
Gene Synonym:
Exon (5)1060..1185
Gene Synonym:
Exon (6)1186..1406
Gene Synonym:
Exon (7)1407..1629
Gene Synonym:
Exon (8)1630..1737
Gene Synonym:
Exon (9)1738..1857
Gene Synonym:
Exon (10)1858..1947
Gene Synonym:
Exon (11)1948..2067
Gene Synonym:
Exon (12)2068..3077
Gene Synonym:
Position Chain Variation Link
27 27 c, t dbSNP:188625872
85 85 a, c dbSNP:529934671
122 122 c, t dbSNP:80356803
162 162 g, t dbSNP:115800510
208 208 c, t dbSNP:761922735
210 210 c, g dbSNP:534069590
230 230 g, t dbSNP:765558668
232 232 a, g dbSNP:750665274
239 239 a, g dbSNP:758887740
247 247 -, gccatggagaccccg dbSNP:267607546
254 254 a, g dbSNP:11549669
260 260 c, g dbSNP:267607620
261 261 a, g dbSNP:369823958
263 263 c, t dbSNP:766624427
265 265 c, t dbSNP:61046466
269 269 a, g dbSNP:751916168
277 277 -, a dbSNP:58727209
278 278 c, t dbSNP:57077886
280 280 -, c dbSNP:60029152
280 280 c, g dbSNP:755465323
287 287 c, g dbSNP:781684338
288 288 a, g dbSNP:747663457
289 289 a, g dbSNP:755617982
291 291 a, g dbSNP:777460187
292 292 -, agg dbSNP:751431601
293 293 a, c dbSNP:748918487
296 296 a, c dbSNP:770799870
300 300 c, t dbSNP:11549668
322 322 c, g, t dbSNP:58327533
323 323 c, g, t dbSNP:61578124
324 324 c, t dbSNP:80356804
327 327 c, t dbSNP:373721390
331 331 c, t dbSNP:59914820
343 343 -, aag dbSNP:60872029
345 345 a, g dbSNP:775429079
347 347 a, g dbSNP:267607614
348 348 c, g, t dbSNP:57966821
352 352 c, g dbSNP:56694480
353 353 c, t dbSNP:267607644
355 355 c, t dbSNP:267607601
364 364 a, t dbSNP:267607627
365 365 a, g dbSNP:57983345
376 376 a, g dbSNP:60446065
381 381 c, g dbSNP:762049172
383 383 a, g dbSNP:58436778
385 385 a, g dbSNP:267607615
388 388 c, g dbSNP:267607608
391 391 c, g dbSNP:769977710
396 396 a, g dbSNP:376196924
397 397 a, c, t dbSNP:59931416
398 398 a, c, g dbSNP:60695352
399 399 c, t dbSNP:397517894
402 402 a, g, t dbSNP:751886390
403 403 c, g dbSNP:397517895
404 404 c, t dbSNP:267607611
407 407 a, t dbSNP:60290646
418 418 c, g dbSNP:28928903
425 425 g, t dbSNP:58922911
427 427 c, g, t dbSNP:28928900
433 433 c, g dbSNP:56793579
437 437 a, g, t dbSNP:57793737
438 438 a, c dbSNP:767976986
440 440 a, c dbSNP:753191587
441 441 c, t dbSNP:137969290
447 447 c, g, t dbSNP:397517899
452 452 -, aggtgg dbSNP:267607586
453 453 a, g dbSNP:753304214
459 459 a, c dbSNP:756880374
463 463 c, g dbSNP:17847247
464 464 a, g, t dbSNP:727504340
475 475 a, g dbSNP:745651340
483 483 c, g dbSNP:727505038
488 488 c, t dbSNP:771893681
489 489 c, t dbSNP:780194620
493 493 a, g dbSNP:59270054
498 498 c, t dbSNP:746916710
503 503 g, t dbSNP:28933090
506 506 a, g dbSNP:768678385
510 510 c, t dbSNP:397517900
514 514 c, t dbSNP:267607559
515 515 a, g, t dbSNP:59040894
523 523 c, t dbSNP:267607560
536 536 c, g dbSNP:773451393
538 538 a, g dbSNP:59065411
551 551 c, g dbSNP:267607568
553 553 c, t dbSNP:763033565
571 571 a, g dbSNP:771065515
578 578 a, g dbSNP:556237236
580 580 c, g, t dbSNP:61726475
583 583 -, gag dbSNP:61726474
588 588 c, t dbSNP:759878335
589 589 a, g dbSNP:767902515
592 592 ga, tt dbSNP:727503134
597 597 -, g dbSNP:267607646
599 599 a, g dbSNP:397517901
604 604 c, t dbSNP:17856971
605 605 c, g dbSNP:397517902
606 606 c, t dbSNP:41313880
609 609 a, t dbSNP:763717410
610 610 a, g dbSNP:543011658
611 611 c, t dbSNP:757961893
618 618 a, g dbSNP:367938270
622 622 a, g dbSNP:267607605
632 632 c, t dbSNP:746475627
635 635 a, c dbSNP:768203943
643 643 c, g, t dbSNP:61726478
647 647 c, g, t dbSNP:60864230
655 655 c, g dbSNP:267607619
658 658 c, t dbSNP:747998566
661 661 a, g dbSNP:267607649
668 668 c, g, t dbSNP:60652225
676 676 c, t dbSNP:61661343
677 677 c, t dbSNP:58912633
682 682 a, g dbSNP:60310264
685 685 a, g dbSNP:397517903
687 687 c, t dbSNP:80356805
688 688 a, g, t dbSNP:139875047
697 697 a, c dbSNP:58917027
700 700 a, g dbSNP:766291714
713 713 a, c dbSNP:775448051
715 715 c, t dbSNP:760743233
716 716 a, g dbSNP:764475194
719 719 c, t dbSNP:754097769
720 720 a, g dbSNP:150645079
724 724 a, g dbSNP:267607622
727 727 c, g dbSNP:765665953
728 728 a, g dbSNP:750755990
729 729 c, t dbSNP:758848135
730 730 a, g dbSNP:28933093
734 734 c, t dbSNP:267607594
735 735 a, g dbSNP:727503135
739 739 c, g dbSNP:751033102
745 745 c, t dbSNP:370200334
746 746 a, c, g dbSNP:267607570
753 753 c, g dbSNP:747771347
755 755 -, t dbSNP:267607595
762 762 a, g dbSNP:267607542
770 770 a, c dbSNP:762153472
773 773 c, t dbSNP:369714176
775 775 c, t dbSNP:149113760
796 796 c, t dbSNP:574749413
797 797 c, t dbSNP:267607583
805 805 a, g dbSNP:61726479
813 813 a, g dbSNP:750762996
814 814 c, t dbSNP:267607626
815 815 cc, gg dbSNP:267607643
815 815 a, g dbSNP:766856162
817 817 c, t dbSNP:59026483
818 818 a, g dbSNP:267607571
819 819 -, cgg dbSNP:267607628
821 821 g, t dbSNP:752087253
822 822 a, g dbSNP:754525930
824 824 a, g, t dbSNP:57045855
828 828 c, t dbSNP:749728556
834 834 a, c, g dbSNP:28933091
837 837 -, gctgcagac dbSNP:267607541
846 846 c, t dbSNP:755777307
847 847 a, g dbSNP:777419380
856 856 a, g dbSNP:61195471
857 857 a, g, t dbSNP:28933092
861 861 a, g dbSNP:12117552
867 867 c, g dbSNP:267607629
871 871 -, aag dbSNP:267607540
871 871 a, c dbSNP:770744765
873 873 -, gaa dbSNP:267607551
874 874 -, a dbSNP:62636507
878 878 g, t dbSNP:267607572
892 892 c, g, t dbSNP:397517905
893 893 c, t dbSNP:61295588
894 894 a, c, g, t dbSNP:80356808
896 896 a, g dbSNP:757041809
904 904 a, c dbSNP:778798942
905 905 a, c, g dbSNP:267607584
907 907 c, t dbSNP:370134870
908 908 a, g dbSNP:780066296
911 911 a, g dbSNP:372567202
913 913 c, t dbSNP:28928901
914 914 a, c dbSNP:58034145
922 922 c, t dbSNP:60682848
923 923 a, g dbSNP:199474724
930 930 a, g dbSNP:769896881
935 935 c, t dbSNP:727505357
937 937 a, g dbSNP:61214927
938 938 a, g dbSNP:773349450
940 940 a, c dbSNP:11549666
941 941 a, g dbSNP:760388350
943 943 c, g dbSNP:267607609
944 944 a, g dbSNP:57207746
949 949 c, t dbSNP:267607573
952 952 c, g, t dbSNP:201227908
953 953 a, g dbSNP:759829161
959 959 c, t dbSNP:730880132
960 960 c, t dbSNP:768081358
967 967 c, t dbSNP:775964460
972 972 a, g dbSNP:58235810
974 974 c, t dbSNP:397517906
975 975 a, g dbSNP:763625309
978 978 c, t dbSNP:753243743
979 979 a, g dbSNP:201866557
981 981 a, g dbSNP:756952925
985 985 c, t dbSNP:267607587
988 988 a, g dbSNP:727504373
992 992 c, t dbSNP:58850446
994 994 c, g, t dbSNP:121912496
995 995 a, g dbSNP:59332535
996 996 a, g dbSNP:587781025
998 998 c, t dbSNP:397517907
1000 1000 -, c dbSNP:34777960
1008 1008 c, g dbSNP:764738988
1012 1012 -, c dbSNP:397517908
1024 1024 c, g, t dbSNP:60578328
1026 1026 a, t dbSNP:58048078
1030 1030 -, aag dbSNP:58978449
1030 1030 aag, nnnnnnnnnnnnnnnnnn dbSNP:672601257
1033 1033 g, t dbSNP:397517909
1036 1036 c, g dbSNP:750246389
1037 1037 c, t dbSNP:267607625
1038 1038 a, g dbSNP:148557956
1048 1048 c, t dbSNP:267607593
1049 1049 a, g dbSNP:57048196
1051 1051 c, t dbSNP:267607630
1059 1059 a, g dbSNP:267607631
1061 1061 c, t dbSNP:267607641
1064 1064 acaa, ccagac dbSNP:267607616
1066 1066 a, g dbSNP:754020721
1086 1086 a, g dbSNP:727505198
1097 1097 a, g dbSNP:765241364
1102 1102 g, t dbSNP:746056534
1104 1104 -, g dbSNP:59564495
1104 1104 g, t dbSNP:373384985
1109 1109 c, t dbSNP:397517910
1110 1110 c, t dbSNP:538089
1112 1112 c, g dbSNP:397517911
1113 1113 -, ccac dbSNP:60168366
1116 1116 c, t dbSNP:780415585
1117 1117 a, g dbSNP:397517912
1119 1119 a, g dbSNP:747275587
1130 1130 a, c dbSNP:61616775
1132 1132 c, t dbSNP:267607633
1133 1133 c, t dbSNP:769210828
1134 1134 a, g dbSNP:776999079
1135 1135 c, t dbSNP:375987939
1141 1141 c, t dbSNP:59885338
1142 1142 a, g dbSNP:762653476
1143 1143 a, c dbSNP:769404097
1144 1144 a, g dbSNP:150924946
1145 1145 c, t dbSNP:267607684
1146 1146 c, g, t dbSNP:762718963
1147 1147 a, g dbSNP:267607591
1148 1148 a, c dbSNP:79907212
1151 1151 c, g dbSNP:546272425
1154 1154 c, t dbSNP:267607596
1156 1156 c, t dbSNP:61527854
1157 1157 -, ct dbSNP:59684335
1166 1166 g, t dbSNP:730882262
1169 1169 c, g dbSNP:759249597
1170 1170 c, t dbSNP:767552619
1176 1176 a, c dbSNP:752558753
1189 1189 a, g dbSNP:769498020
1197 1197 a, g dbSNP:778421025
1198 1198 a, g dbSNP:56816490
1201 1201 a, g dbSNP:267607574
1203 1203 a, g dbSNP:397517914
1206 1206 a, g dbSNP:770547079
1207 1207 -, c dbSNP:397517915
1207 1207 c, t dbSNP:3209921
1208 1208 -, t dbSNP:56771886
1210 1210 c, t dbSNP:267607554
1225 1225 a, t dbSNP:56851164
1226 1226 c, t dbSNP:745540806
1228 1228 c, t dbSNP:771703754
1234 1234 a, c dbSNP:775159300
1235 1235 a, g dbSNP:397517913
1239 1239 a, g dbSNP:140800215
1241 1241 a, c, g dbSNP:59301204
1247 1247 c, t dbSNP:763069566
1250 1250 a, g dbSNP:370656306
1252 1252 a, c, t dbSNP:386134243
1253 1253 a, g dbSNP:138592977
1256 1256 a, g dbSNP:58105277
1260 1260 c, g dbSNP:753179748
1265 1265 a, c dbSNP:756538414
1266 1266 a, g dbSNP:17847242
1271 1271 a, c dbSNP:11549667
1276 1276 a, c, t dbSNP:749784223
1277 1277 a, g dbSNP:61177390
1288 1288 a, g dbSNP:267607548
1293 1293 g, t dbSNP:587777892
1294 1294 c, t dbSNP:267607555
1295 1295 g, t dbSNP:58789393
1296 1296 a, g dbSNP:147015659
1297 1297 c, g dbSNP:267607610
1300 1300 a, c dbSNP:771623461
1301 1301 a, g dbSNP:779749639
1306 1306 a, c dbSNP:267607623
1312 1312 c, g, t dbSNP:267607617
1313 1313 -, agc dbSNP:267607635
1318 1318 c, g dbSNP:267607567
1320 1320 c, t dbSNP:376875762
1321 1321 a, g, t dbSNP:60458016
1330 1330 a, g dbSNP:267607634
1334 1334 -, t dbSNP:58389804
1335 1335 -, t dbSNP:587782956
1341 1341 c, t dbSNP:776589077
1347 1347 a, g dbSNP:57901307
1355 1355 c, t dbSNP:397517886
1360 1360 -, atggagatccacgcc dbSNP:397517887
1361 1361 a, t dbSNP:59653062
1363 1363 -, g dbSNP:267607575
1364 1364 -, tgga dbSNP:397517888
1371 1371 c, t dbSNP:143715750
1378 1378 c, t dbSNP:397517889
1379 1379 -, gccctggacatggagatccacgcctaccg dbSNP:267607624
1379 1379 a, g, t dbSNP:61672878
1388 1388 c, t dbSNP:121912495
1391 1391 a, c dbSNP:267607558
1395 1395 c, t dbSNP:57508089
1398 1398 a, g dbSNP:267607603
1406 1406 a, g, t dbSNP:267607545
1408 1408 c, g dbSNP:267607562
1411 1411 c, t dbSNP:58133342
1412 1412 a, g dbSNP:267607576
1416 1416 a, g dbSNP:750919582
1430 1430 c, t dbSNP:757887400
1433 1433 c, t dbSNP:267607561
1434 1434 a, g dbSNP:397517890
1436 1436 a, g, t dbSNP:61693978
1438 1438 c, t dbSNP:374726751
1439 1439 a, g dbSNP:747952058
1444 1444 c, t dbSNP:58672172
1445 1445 a, g dbSNP:267607563
1446 1446 c, t dbSNP:749284229
1449 1449 c, t dbSNP:770727928
1450 1450 c, t dbSNP:61094188
1451 1451 a, g dbSNP:141490569
1453 1453 a, g dbSNP:769064643
1458 1458 c, t dbSNP:776975256
1463 1463 a, g dbSNP:758278487
1472 1472 a, c dbSNP:397517891
1476 1476 a, g dbSNP:762130433
1480 1480 g, t dbSNP:727504852
1481 1481 a, g dbSNP:267607647
1485 1485 c, g dbSNP:763537103
1486 1486 a, g, t dbSNP:766811975
1488 1488 a, c dbSNP:754472024
1491 1491 c, t dbSNP:184946451
1492 1492 a, g dbSNP:267607606
1496 1496 c, t dbSNP:752367284
1504 1504 c, t dbSNP:755686359
1505 1505 a, g dbSNP:777648901
1506 1506 c, t dbSNP:748980648
1511 1511 c, t dbSNP:267607564
1528 1528 c, t dbSNP:373584456
1529 1529 a, g dbSNP:747139279
1533 1533 c, g dbSNP:368831495
1543 1543 c, t dbSNP:267607618
1548 1548 c, t dbSNP:61217436
1549 1549 -, gcacgcac dbSNP:727504833
1549 1549 a, g dbSNP:748433620
1552 1552 c, t dbSNP:150840924
1556 1556 -, gcac dbSNP:267607577
1556 1556 c, t dbSNP:773638171
1560 1560 c, t dbSNP:763224059
1561 1561 a, g dbSNP:766932100
1563 1563 a, g dbSNP:774817302
1564 1564 c, t dbSNP:62636506
1566 1566 a, c, t dbSNP:374804871
1567 1567 a, g dbSNP:121912493
1572 1572 a, c dbSNP:140194535
1573 1573 a, g dbSNP:368542816
1579 1579 a, g dbSNP:545531053
1586 1586 a, t dbSNP:58541611
1587 1587 a, c, g, t dbSNP:505058
1590 1590 a, g dbSNP:750352203
1595 1595 a, g dbSNP:267607637
1606 1606 c, t dbSNP:58932704
1607 1607 a, c, g dbSNP:267607598
1610 1610 c, t dbSNP:267607638
1611 1611 a, g dbSNP:151160622
1612 1612 c, t dbSNP:397517892
1613 1613 c, g dbSNP:267607597
1615 1615 a, g dbSNP:267607599
1616 1616 a, t dbSNP:60992550
1617 1617 -, caa dbSNP:267607550
1617 1617 a, c dbSNP:61235244
1619 1619 -, a dbSNP:267607549
1625 1625 a, g dbSNP:372011095
1630 1630 g, t dbSNP:267607642
1637 1637 c, t dbSNP:778099589
1639 1639 a, g dbSNP:200262654
1641 1641 a, g dbSNP:771095582
1643 1643 a, g dbSNP:61282106
1646 1646 -, a dbSNP:58100028
1647 1647 c, t dbSNP:779266133
1648 1648 c, t dbSNP:267607639
1655 1655 c, t dbSNP:57394692
1660 1660 c, g, t dbSNP:28928902
1661 1661 a, g dbSNP:267607578
1673 1673 -, aga dbSNP:267607579
1690 1690 c, t dbSNP:57747780
1691 1691 a, g dbSNP:397517893
1692 1692 c, g dbSNP:56935051
1693 1693 c, t dbSNP:57920071
1694 1694 a, g, t dbSNP:11575937
1707 1707 c, g, t dbSNP:59981161
1711 1711 a, c dbSNP:267607607
1723 1723 a, g dbSNP:373480082
1726 1726 c, t dbSNP:56699480
1729 1729 g, t dbSNP:760277884
1731 1731 a, g dbSNP:768017760
1736 1736 c, t dbSNP:200466188
1737 1737 a, g dbSNP:375516745
1741 1741 a, t dbSNP:267607585
1742 1742 -, g dbSNP:60556110
1743 1743 g, t dbSNP:57730570
1745 1745 -, c dbSNP:267607580
1756 1756 a, g dbSNP:545393299
1758 1758 a, g dbSNP:747595031
1759 1759 a, g dbSNP:769637371
1761 1761 -, ag dbSNP:267607553
1765 1765 c, g dbSNP:267607565
1773 1773 c, t dbSNP:772978446
1774 1774 c, t dbSNP:762847359
1775 1775 -, c dbSNP:58013325
1775 1775 c, t dbSNP:766120841
1779 1779 c, t dbSNP:138098342
1780 1780 a, g dbSNP:759408439
1784 1784 c, t dbSNP:57877560
1800 1800 a, g dbSNP:41314035
1801 1801 a, g dbSNP:757733890
1805 1805 c, t dbSNP:753988867
1807 1807 g, t dbSNP:267607557
1808 1808 c, g dbSNP:58362413
1815 1815 c, t dbSNP:149339264
1816 1816 a, g dbSNP:201583907
1828 1828 -, ctgc dbSNP:58571998
1828 1828 c, t dbSNP:57318642
1829 1829 a, c, g dbSNP:57520892
1832 1832 a, c, g, t dbSNP:57629361
1833 1833 a, g dbSNP:80356812
1834 1834 a, g dbSNP:121912494
1835 1835 c, t dbSNP:60580541
1837 1837 c, g dbSNP:780302064
1838 1838 c, t dbSNP:60934003
1839 1839 c, t dbSNP:747338820
1850 1850 c, g dbSNP:144740174
1851 1851 c, t dbSNP:781763410
1853 1853 a, g dbSNP:747717293
1854 1854 a, g dbSNP:769398087
1862 1862 c, t dbSNP:766555060
1868 1868 c, t dbSNP:267607547
1869 1869 a, g dbSNP:483352811
1870 1870 a, c, g, t dbSNP:56984562
1871 1871 a, c, g dbSNP:61444459
1875 1875 c, g dbSNP:56673169
1882 1882 c, t dbSNP:267607613
1883 1883 a, g dbSNP:142191737
1888 1888 a, g dbSNP:201947393
1894 1894 a, g dbSNP:781774834
1896 1896 c, g dbSNP:753288092
1905 1905 c, t dbSNP:370219874
1906 1906 a, g dbSNP:373671419
1908 1908 c, t dbSNP:748768783
1909 1909 c, g dbSNP:71630616
1911 1911 a, g dbSNP:201936898
1913 1913 a, g dbSNP:141578711
1929 1929 c, t dbSNP:17847249
1944 1944 c, t dbSNP:778618908
1947 1947 c, t dbSNP:4641
1967 1967 c, t dbSNP:60890628
1968 1968 a, g dbSNP:759853354
1977 1977 c, t dbSNP:767783294
1980 1980 c, t dbSNP:776066211
1982 1982 a, t dbSNP:61224243
1983 1983 a, g dbSNP:541072397
1994 1994 a, g dbSNP:57830985
1995 1995 c, t dbSNP:764561834
1997 1997 c, g, t dbSNP:59601651
1999 1999 c, t dbSNP:578193315
2000 2000 a, g dbSNP:56657623
2004 2004 c, t dbSNP:545752475
2005 2005 a, g dbSNP:758048062
2010 2010 a, g dbSNP:80356813
2011 2011 c, t dbSNP:267607621
2013 2013 c, t dbSNP:759016336
2014 2014 a, g dbSNP:372201662
2019 2019 c, g, t dbSNP:397517896
2021 2021 g, t dbSNP:267607556
2022 2022 c, t dbSNP:397517897
2023 2023 a, g dbSNP:786205448
2034 2034 c, t dbSNP:748139390
2035 2035 a, g dbSNP:769561386
2039 2039 -, a dbSNP:34195769
2042 2042 c, g dbSNP:774494686
2052 2052 c, t dbSNP:267607604
2053 2053 a, g dbSNP:60662302
2061 2061 a, t dbSNP:775835223
2077 2077 a, g dbSNP:374926367
2086 2086 a, g dbSNP:781516147
2089 2089 a, t dbSNP:748348868
2094 2094 a, g dbSNP:756280442
2096 2096 c, t dbSNP:778115258
2100 2100 a, g dbSNP:397517885
2113 2113 a, g dbSNP:771483910
2113 2113 -, g dbSNP:767436047
2116 2116 a, g dbSNP:774695700
2118 2118 a, c, g dbSNP:745421199
2121 2121 a, g dbSNP:267607682
2122 2122 a, g dbSNP:760413367
2123 2123 a, t dbSNP:763777256
2136 2136 c, t dbSNP:776637934
2137 2137 a, g dbSNP:543260437
2139 2139 c, t dbSNP:752050337
2173 2173 c, g dbSNP:7339
2190 2190 a, g dbSNP:528470522
2224 2224 g, t dbSNP:181732923
2234 2234 g, t dbSNP:80356815
2241 2241 a, t dbSNP:2070754
2286 2286 a, c dbSNP:708605
2291 2291 -, a dbSNP:535843454
2292 2292 -, a dbSNP:200317083
2305 2305 -, a dbSNP:397862291
2366 2366 a, g dbSNP:565034780
2384 2384 a, g dbSNP:143860978
2435 2435 g, t dbSNP:11549665
2456 2456 a, g dbSNP:551168123
2459 2459 c, t dbSNP:74116489
2478 2478 c, t dbSNP:575668767
2487 2487 c, t dbSNP:111601180
2526 2526 c, t dbSNP:757889970
2543 2543 c, t dbSNP:148620960
2577 2577 -, ga dbSNP:748490381
2578 2578 -, ga dbSNP:768899010
2606 2606 c, t dbSNP:534580892
2613 2613 c, g dbSNP:377680638
2696 2696 a, g dbSNP:377597995
2722 2722 a, g dbSNP:750298346
2730 2730 c, t dbSNP:571358642
2733 2733 a, g dbSNP:185169879
2760 2760 a, t dbSNP:557591514
2765 2765 a, g dbSNP:746597763
2788 2788 a, g dbSNP:767516603
2833 2833 a, g dbSNP:3204564
2835 2835 a, c dbSNP:371251854
2840 2840 g, t dbSNP:752755714
2841 2841 a, g dbSNP:189656652
2872 2872 c, t dbSNP:777957193
2881 2881 c, g dbSNP:542967720
2891 2891 a, g dbSNP:555221717
2893 2893 c, g dbSNP:529375252
2895 2895 a, g dbSNP:781055697
2938 2938 c, t dbSNP:144299350
2944 2944 c, g dbSNP:754849110
2993 2993 a, g dbSNP:375604123
3009 3009 c, t dbSNP:15292

Target ORF information:

RefSeq Version NM_001282626
Organism Homo sapiens (human)
Definition Homo sapiens lamin A/C (LMNA), transcript variant 7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27626
Accession Version NM_001282624.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1476bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 16-JUL-2015
Organism Homo sapiens (human)
Product lamin isoform E
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY027676.1, AK097801.1 and BC000511.2. On Sep 17, 2013 this sequence version replaced gi:383792155. Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (5) differs in both UTRs and has multiple differences in the coding region compared to variant 1. This variant encodes isoform E, which is shorter and has distinct N- and C-termini compared to isoform prelamin A. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK097801.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2148874 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)130..132(+)
Misc Feature(2)439..>720(+)
Misc Feature(3)481..1023(+)
Misc Feature(4)835..>1020(+)
Misc Feature(5)1228..1575(+)
Exon (1)1..107
Gene Synonym:
Exon (2)108..287
Gene Synonym:
Exon (3)288..444
Gene Synonym:
Exon (4)445..570
Gene Synonym:
Exon (5)571..741
Gene Synonym:
Exon (6)742..867
Gene Synonym:
Exon (7)868..1088
Gene Synonym:
Exon (8)1089..1311
Gene Synonym:
Exon (9)1312..1419
Gene Synonym:
Exon (10)1420..1539
Gene Synonym:
Exon (11)1540..1752
Gene Synonym:
Position Chain Variation Link
38 38 a, g dbSNP:781213600
42 42 a, g dbSNP:560423911
46 46 a, g, t dbSNP:573448332
47 47 a, g dbSNP:771030948
75 75 a, g dbSNP:540937543
113 113 c, t dbSNP:182588937
143 143 a, c, t dbSNP:762488606
150 150 c, t dbSNP:751247989
153 153 c, t dbSNP:754870189
155 155 a, c, t dbSNP:538673864
156 156 a, c, g dbSNP:756101473
167 167 -, cactgggat dbSNP:752427131
169 169 a, t dbSNP:556985558
177 177 a, g dbSNP:758467676
180 180 a, g dbSNP:780309198
193 193 c, t dbSNP:747205385
216 216 a, g dbSNP:575264563
224 224 c, t dbSNP:781641454
230 230 c, g dbSNP:748406161
248 248 c, t dbSNP:770340403
249 249 a, g dbSNP:773592552
250 250 c, g dbSNP:536374804
254 254 a, g dbSNP:770543241
260 260 a, g dbSNP:774186710
262 262 a, g dbSNP:759295051
263 263 a, c dbSNP:767029896
265 265 c, g dbSNP:752549023
269 269 c, t dbSNP:760318158
270 270 a, g dbSNP:764158740
272 272 a, g dbSNP:148559653
276 276 a, g dbSNP:758518801
279 279 c, g dbSNP:41302091
288 288 c, t dbSNP:41313880
291 291 a, t dbSNP:763717410
292 292 a, g dbSNP:543011658
293 293 c, t dbSNP:757961893
300 300 a, g dbSNP:367938270
304 304 a, g dbSNP:267607605
314 314 c, t dbSNP:746475627
317 317 a, c dbSNP:768203943
325 325 c, g, t dbSNP:61726478
329 329 c, g, t dbSNP:60864230
337 337 c, g dbSNP:267607619
340 340 c, t dbSNP:747998566
343 343 a, g dbSNP:267607649
350 350 c, g, t dbSNP:60652225
358 358 c, t dbSNP:61661343
359 359 c, t dbSNP:58912633
364 364 a, g dbSNP:60310264
367 367 a, g dbSNP:397517903
369 369 c, t dbSNP:80356805
370 370 a, g, t dbSNP:139875047
379 379 a, c dbSNP:58917027
382 382 a, g dbSNP:766291714
395 395 a, c dbSNP:775448051
397 397 c, t dbSNP:760743233
398 398 a, g dbSNP:764475194
401 401 c, t dbSNP:754097769
402 402 a, g dbSNP:150645079
406 406 a, g dbSNP:267607622
409 409 c, g dbSNP:765665953
410 410 a, g dbSNP:750755990
411 411 c, t dbSNP:758848135
412 412 a, g dbSNP:28933093
416 416 c, t dbSNP:267607594
417 417 a, g dbSNP:727503135
421 421 c, g dbSNP:751033102
427 427 c, t dbSNP:370200334
428 428 a, c, g dbSNP:267607570
435 435 c, g dbSNP:747771347
437 437 -, t dbSNP:267607595
444 444 a, g dbSNP:267607542
452 452 a, c dbSNP:762153472
455 455 c, t dbSNP:369714176
457 457 c, t dbSNP:149113760
478 478 c, t dbSNP:574749413
479 479 c, t dbSNP:267607583
487 487 a, g dbSNP:61726479
495 495 a, g dbSNP:750762996
496 496 c, t dbSNP:267607626
497 497 cc, gg dbSNP:267607643
497 497 a, g dbSNP:766856162
499 499 c, t dbSNP:59026483
500 500 a, g dbSNP:267607571
501 501 -, cgg dbSNP:267607628
503 503 g, t dbSNP:752087253
504 504 a, g dbSNP:754525930
506 506 a, g, t dbSNP:57045855
510 510 c, t dbSNP:749728556
516 516 a, c, g dbSNP:28933091
519 519 -, gctgcagac dbSNP:267607541
528 528 c, t dbSNP:755777307
529 529 a, g dbSNP:777419380
538 538 a, g dbSNP:61195471
539 539 a, g, t dbSNP:28933092
543 543 a, g dbSNP:12117552
549 549 c, g dbSNP:267607629
553 553 -, aag dbSNP:267607540
553 553 a, c dbSNP:770744765
555 555 -, gaa dbSNP:267607551
556 556 -, a dbSNP:62636507
560 560 g, t dbSNP:267607572
574 574 c, g, t dbSNP:397517905
575 575 c, t dbSNP:61295588
576 576 a, c, g, t dbSNP:80356808
578 578 a, g dbSNP:757041809
586 586 a, c dbSNP:778798942
587 587 a, c, g dbSNP:267607584
589 589 c, t dbSNP:370134870
590 590 a, g dbSNP:780066296
593 593 a, g dbSNP:372567202
595 595 c, t dbSNP:28928901
596 596 a, c dbSNP:58034145
604 604 c, t dbSNP:60682848
605 605 a, g dbSNP:199474724
612 612 a, g dbSNP:769896881
617 617 c, t dbSNP:727505357
619 619 a, g dbSNP:61214927
620 620 a, g dbSNP:773349450
622 622 a, c dbSNP:11549666
623 623 a, g dbSNP:760388350
625 625 c, g dbSNP:267607609
626 626 a, g dbSNP:57207746
631 631 c, t dbSNP:267607573
634 634 c, g, t dbSNP:201227908
635 635 a, g dbSNP:759829161
641 641 c, t dbSNP:730880132
642 642 c, t dbSNP:768081358
649 649 c, t dbSNP:775964460
654 654 a, g dbSNP:58235810
656 656 c, t dbSNP:397517906
657 657 a, g dbSNP:763625309
660 660 c, t dbSNP:753243743
661 661 a, g dbSNP:201866557
663 663 a, g dbSNP:756952925
667 667 c, t dbSNP:267607587
670 670 a, g dbSNP:727504373
674 674 c, t dbSNP:58850446
676 676 c, g, t dbSNP:121912496
677 677 a, g dbSNP:59332535
678 678 a, g dbSNP:587781025
680 680 c, t dbSNP:397517907
682 682 -, c dbSNP:34777960
690 690 c, g dbSNP:764738988
694 694 -, c dbSNP:397517908
706 706 c, g, t dbSNP:60578328
708 708 a, t dbSNP:58048078
712 712 -, aag dbSNP:58978449
712 712 aag, nnnnnnnnnnnnnnnnnn dbSNP:672601257
715 715 g, t dbSNP:397517909
718 718 c, g dbSNP:750246389
719 719 c, t dbSNP:267607625
720 720 a, g dbSNP:148557956
730 730 c, t dbSNP:267607593
731 731 a, g dbSNP:57048196
733 733 c, t dbSNP:267607630
741 741 a, g dbSNP:267607631
743 743 c, t dbSNP:267607641
746 746 acaa, ccagac dbSNP:267607616
748 748 a, g dbSNP:754020721
768 768 a, g dbSNP:727505198
779 779 a, g dbSNP:765241364
784 784 g, t dbSNP:746056534
786 786 -, g dbSNP:59564495
786 786 g, t dbSNP:373384985
791 791 c, t dbSNP:397517910
792 792 c, t dbSNP:538089
794 794 c, g dbSNP:397517911
795 795 -, ccac dbSNP:60168366
798 798 c, t dbSNP:780415585
799 799 a, g dbSNP:397517912
801 801 a, g dbSNP:747275587
812 812 a, c dbSNP:61616775
814 814 c, t dbSNP:267607633
815 815 c, t dbSNP:769210828
816 816 a, g dbSNP:776999079
817 817 c, t dbSNP:375987939
823 823 c, t dbSNP:59885338
824 824 a, g dbSNP:762653476
825 825 a, c dbSNP:769404097
826 826 a, g dbSNP:150924946
827 827 c, t dbSNP:267607684
828 828 c, g, t dbSNP:762718963
829 829 a, g dbSNP:267607591
830 830 a, c dbSNP:79907212
833 833 c, g dbSNP:546272425
836 836 c, t dbSNP:267607596
838 838 c, t dbSNP:61527854
839 839 -, ct dbSNP:59684335
848 848 g, t dbSNP:730882262
851 851 c, g dbSNP:759249597
852 852 c, t dbSNP:767552619
858 858 a, c dbSNP:752558753
871 871 a, g dbSNP:769498020
879 879 a, g dbSNP:778421025
880 880 a, g dbSNP:56816490
883 883 a, g dbSNP:267607574
885 885 a, g dbSNP:397517914
888 888 a, g dbSNP:770547079
889 889 -, c dbSNP:397517915
889 889 c, t dbSNP:3209921
890 890 -, t dbSNP:56771886
892 892 c, t dbSNP:267607554
907 907 a, t dbSNP:56851164
908 908 c, t dbSNP:745540806
910 910 c, t dbSNP:771703754
916 916 a, c dbSNP:775159300
917 917 a, g dbSNP:397517913
921 921 a, g dbSNP:140800215
923 923 a, c, g dbSNP:59301204
929 929 c, t dbSNP:763069566
932 932 a, g dbSNP:370656306
934 934 a, c, t dbSNP:386134243
935 935 a, g dbSNP:138592977
938 938 a, g dbSNP:58105277
942 942 c, g dbSNP:753179748
947 947 a, c dbSNP:756538414
948 948 a, g dbSNP:17847242
953 953 a, c dbSNP:11549667
958 958 a, c, t dbSNP:749784223
959 959 a, g dbSNP:61177390
970 970 a, g dbSNP:267607548
976 976 c, t dbSNP:267607555
977 977 g, t dbSNP:58789393
978 978 a, g dbSNP:147015659
979 979 c, g dbSNP:267607610
982 982 a, c dbSNP:771623461
983 983 a, g dbSNP:779749639
988 988 a, c dbSNP:267607623
994 994 c, g, t dbSNP:267607617
995 995 -, agc dbSNP:267607635
1000 1000 c, g dbSNP:267607567
1002 1002 c, t dbSNP:376875762
1003 1003 a, g, t dbSNP:60458016
1012 1012 a, g dbSNP:267607634
1016 1016 -, t dbSNP:58389804
1017 1017 -, t dbSNP:587782956
1023 1023 c, t dbSNP:776589077
1029 1029 a, g dbSNP:57901307
1037 1037 c, t dbSNP:397517886
1042 1042 -, atggagatccacgcc dbSNP:397517887
1043 1043 a, t dbSNP:59653062
1045 1045 -, g dbSNP:267607575
1046 1046 -, tgga dbSNP:397517888
1053 1053 c, t dbSNP:143715750
1060 1060 c, t dbSNP:397517889
1061 1061 -, gccctggacatggagatccacgcctaccg dbSNP:267607624
1061 1061 a, g, t dbSNP:61672878
1070 1070 c, t dbSNP:121912495
1073 1073 a, c dbSNP:267607558
1077 1077 c, t dbSNP:57508089
1080 1080 a, g dbSNP:267607603
1088 1088 a, g, t dbSNP:267607545
1090 1090 c, g dbSNP:267607562
1093 1093 c, t dbSNP:58133342
1094 1094 a, g dbSNP:267607576
1098 1098 a, g dbSNP:750919582
1112 1112 c, t dbSNP:757887400
1115 1115 c, t dbSNP:267607561
1116 1116 a, g dbSNP:397517890
1118 1118 a, g, t dbSNP:61693978
1120 1120 c, t dbSNP:374726751
1121 1121 a, g dbSNP:747952058
1126 1126 c, t dbSNP:58672172
1127 1127 a, g dbSNP:267607563
1128 1128 c, t dbSNP:749284229
1131 1131 c, t dbSNP:770727928
1132 1132 c, t dbSNP:61094188
1133 1133 a, g dbSNP:141490569
1135 1135 a, g dbSNP:769064643
1140 1140 c, t dbSNP:776975256
1145 1145 a, g dbSNP:758278487
1154 1154 a, c dbSNP:397517891
1158 1158 a, g dbSNP:762130433
1162 1162 g, t dbSNP:727504852
1163 1163 a, g dbSNP:267607647
1167 1167 c, g dbSNP:763537103
1168 1168 a, g, t dbSNP:766811975
1170 1170 a, c dbSNP:754472024
1173 1173 c, t dbSNP:184946451
1174 1174 a, g dbSNP:267607606
1178 1178 c, t dbSNP:752367284
1186 1186 c, t dbSNP:755686359
1187 1187 a, g dbSNP:777648901
1188 1188 c, t dbSNP:748980648
1193 1193 c, t dbSNP:267607564
1210 1210 c, t dbSNP:373584456
1211 1211 a, g dbSNP:747139279
1215 1215 c, g dbSNP:368831495
1225 1225 c, t dbSNP:267607618
1230 1230 c, t dbSNP:61217436
1231 1231 -, gcacgcac dbSNP:727504833
1231 1231 a, g dbSNP:748433620
1234 1234 c, t dbSNP:150840924
1238 1238 -, gcac dbSNP:267607577
1238 1238 c, t dbSNP:773638171
1242 1242 c, t dbSNP:763224059
1243 1243 a, g dbSNP:766932100
1245 1245 a, g dbSNP:774817302
1246 1246 c, t dbSNP:62636506
1248 1248 a, c, t dbSNP:374804871
1249 1249 a, g dbSNP:121912493
1254 1254 a, c dbSNP:140194535
1255 1255 a, g dbSNP:368542816
1261 1261 a, g dbSNP:545531053
1268 1268 a, t dbSNP:58541611
1269 1269 a, c, g, t dbSNP:505058
1272 1272 a, g dbSNP:750352203
1277 1277 a, g dbSNP:267607637
1288 1288 c, t dbSNP:58932704
1289 1289 a, c, g dbSNP:267607598
1292 1292 c, t dbSNP:267607638
1293 1293 a, g dbSNP:151160622
1294 1294 c, t dbSNP:397517892
1295 1295 c, g dbSNP:267607597
1297 1297 a, g dbSNP:267607599
1298 1298 a, t dbSNP:60992550
1299 1299 -, caa dbSNP:267607550
1299 1299 a, c dbSNP:61235244
1301 1301 -, a dbSNP:267607549
1307 1307 a, g dbSNP:372011095
1312 1312 g, t dbSNP:267607642
1319 1319 c, t dbSNP:778099589
1321 1321 a, g dbSNP:200262654
1323 1323 a, g dbSNP:771095582
1325 1325 a, g dbSNP:61282106
1328 1328 -, a dbSNP:58100028
1329 1329 c, t dbSNP:779266133
1330 1330 c, t dbSNP:267607639
1337 1337 c, t dbSNP:57394692
1342 1342 c, g, t dbSNP:28928902
1343 1343 a, g dbSNP:267607578
1355 1355 -, aga dbSNP:267607579
1372 1372 c, t dbSNP:57747780
1373 1373 a, g dbSNP:397517893
1374 1374 c, g dbSNP:56935051
1375 1375 c, t dbSNP:57920071
1376 1376 a, g, t dbSNP:11575937
1389 1389 c, g, t dbSNP:59981161
1393 1393 a, c dbSNP:267607607
1405 1405 a, g dbSNP:373480082
1408 1408 c, t dbSNP:56699480
1411 1411 g, t dbSNP:760277884
1413 1413 a, g dbSNP:768017760
1418 1418 c, t dbSNP:200466188
1419 1419 a, g dbSNP:375516745
1423 1423 a, t dbSNP:267607585
1424 1424 -, g dbSNP:60556110
1425 1425 g, t dbSNP:57730570
1427 1427 -, c dbSNP:267607580
1438 1438 a, g dbSNP:545393299
1440 1440 a, g dbSNP:747595031
1441 1441 a, g dbSNP:769637371
1443 1443 -, ag dbSNP:267607553
1447 1447 c, g dbSNP:267607565
1455 1455 c, t dbSNP:772978446
1456 1456 c, t dbSNP:762847359
1457 1457 -, c dbSNP:58013325
1457 1457 c, t dbSNP:766120841
1461 1461 c, t dbSNP:138098342
1462 1462 a, g dbSNP:759408439
1466 1466 c, t dbSNP:57877560
1482 1482 a, g dbSNP:41314035
1483 1483 a, g dbSNP:757733890
1487 1487 c, t dbSNP:753988867
1489 1489 g, t dbSNP:267607557
1490 1490 c, g dbSNP:58362413
1497 1497 c, t dbSNP:149339264
1498 1498 a, g dbSNP:201583907
1510 1510 -, ctgc dbSNP:58571998
1510 1510 c, t dbSNP:57318642
1511 1511 a, c, g dbSNP:57520892
1514 1514 a, c, g, t dbSNP:57629361
1515 1515 a, g dbSNP:80356812
1516 1516 a, g dbSNP:121912494
1517 1517 c, t dbSNP:60580541
1519 1519 c, g dbSNP:780302064
1520 1520 c, t dbSNP:60934003
1521 1521 c, t dbSNP:747338820
1532 1532 c, g dbSNP:144740174
1533 1533 c, t dbSNP:781763410
1535 1535 a, g dbSNP:747717293
1536 1536 a, g dbSNP:769398087
1544 1544 c, t dbSNP:766555060
1550 1550 c, t dbSNP:267607547
1551 1551 a, g dbSNP:483352811
1552 1552 a, c, g, t dbSNP:56984562
1553 1553 a, c, g dbSNP:61444459
1557 1557 c, g dbSNP:56673169
1564 1564 c, t dbSNP:267607613
1565 1565 a, g dbSNP:142191737
1570 1570 a, g dbSNP:201947393
1576 1576 a, g dbSNP:781774834
1578 1578 c, g dbSNP:753288092
1587 1587 c, t dbSNP:370219874
1588 1588 a, g dbSNP:373671419
1590 1590 c, t dbSNP:748768783
1591 1591 c, g dbSNP:71630616
1593 1593 a, g dbSNP:201936898
1595 1595 a, g dbSNP:141578711
1611 1611 c, t dbSNP:17847249
1626 1626 c, t dbSNP:778618908
1629 1629 c, t dbSNP:4641
1640 1640 -, c dbSNP:370091195
1642 1642 a, c, t dbSNP:80338938
1643 1643 a, c, g dbSNP:200917748
1645 1645 c, t dbSNP:773169005
1654 1654 c, g, t dbSNP:727504435
1655 1655 a, g dbSNP:766567207
1679 1679 c, t dbSNP:751783165
1683 1683 c, t dbSNP:759792792
1686 1686 a, g dbSNP:557334569
1689 1689 a, g dbSNP:368763171
1697 1697 c, t dbSNP:756695810
1708 1708 -, c dbSNP:534523071
1711 1711 -, c dbSNP:371440703
1711 1711 c, t dbSNP:367740182
1712 1712 a, g dbSNP:555844506

Target ORF information:

RefSeq Version NM_001282624
Organism Homo sapiens (human)
Definition Homo sapiens lamin A/C (LMNA), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu22769
Accession Version NM_001257374.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1725bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 16-JUL-2015
Organism Homo sapiens (human)
Product lamin isoform D
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from HY027676.1, AK295390.1, BC018863.2, AL135927.14 and AI872233.1. On Sep 17, 2013 this sequence version replaced gi:383792149. Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (4) represents use of an alternate promoter and uses an alternate 3' exon structure compared to variant 1. The resulting protein (isoform D) has distinct N- and C-termini and is shorter than isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK295390.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2146982 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)259..>540(+)
Misc Feature(2)301..843(+)
Misc Feature(3)655..>840(+)
Misc Feature(4)1048..1395(+)
Exon (1)1..107
Gene Synonym:
Exon (2)108..264
Gene Synonym:
Exon (3)265..390
Gene Synonym:
Exon (4)391..561
Gene Synonym:
Exon (5)562..687
Gene Synonym:
Exon (6)688..908
Gene Synonym:
Exon (7)909..1131
Gene Synonym:
Exon (8)1132..1239
Gene Synonym:
Exon (9)1240..1359
Gene Synonym:
Exon (10)1360..1449
Gene Synonym:
Exon (11)1450..1719
Gene Synonym:
Exon (12)1720..1742
Gene Synonym:
Exon (13)1743..2062
Gene Synonym:
Position Chain Variation Link
38 38 a, g dbSNP:781213600
42 42 a, g dbSNP:560423911
46 46 a, g, t dbSNP:573448332
47 47 a, g dbSNP:771030948
75 75 a, g dbSNP:540937543
108 108 c, t dbSNP:41313880
111 111 a, t dbSNP:763717410
112 112 a, g dbSNP:543011658
113 113 c, t dbSNP:757961893
120 120 a, g dbSNP:367938270
124 124 a, g dbSNP:267607605
134 134 c, t dbSNP:746475627
137 137 a, c dbSNP:768203943
145 145 c, g, t dbSNP:61726478
149 149 c, g, t dbSNP:60864230
157 157 c, g dbSNP:267607619
160 160 c, t dbSNP:747998566
163 163 a, g dbSNP:267607649
170 170 c, g, t dbSNP:60652225
178 178 c, t dbSNP:61661343
179 179 c, t dbSNP:58912633
184 184 a, g dbSNP:60310264
187 187 a, g dbSNP:397517903
189 189 c, t dbSNP:80356805
190 190 a, g, t dbSNP:139875047
199 199 a, c dbSNP:58917027
202 202 a, g dbSNP:766291714
215 215 a, c dbSNP:775448051
217 217 c, t dbSNP:760743233
218 218 a, g dbSNP:764475194
221 221 c, t dbSNP:754097769
222 222 a, g dbSNP:150645079
226 226 a, g dbSNP:267607622
229 229 c, g dbSNP:765665953
230 230 a, g dbSNP:750755990
231 231 c, t dbSNP:758848135
232 232 a, g dbSNP:28933093
236 236 c, t dbSNP:267607594
237 237 a, g dbSNP:727503135
241 241 c, g dbSNP:751033102
247 247 c, t dbSNP:370200334
248 248 a, c, g dbSNP:267607570
255 255 c, g dbSNP:747771347
257 257 -, t dbSNP:267607595
264 264 a, g dbSNP:267607542
272 272 a, c dbSNP:762153472
275 275 c, t dbSNP:369714176
277 277 c, t dbSNP:149113760
298 298 c, t dbSNP:574749413
299 299 c, t dbSNP:267607583
307 307 a, g dbSNP:61726479
315 315 a, g dbSNP:750762996
316 316 c, t dbSNP:267607626
317 317 cc, gg dbSNP:267607643
317 317 a, g dbSNP:766856162
319 319 c, t dbSNP:59026483
320 320 a, g dbSNP:267607571
321 321 -, cgg dbSNP:267607628
323 323 g, t dbSNP:752087253
324 324 a, g dbSNP:754525930
326 326 a, g, t dbSNP:57045855
330 330 c, t dbSNP:749728556
336 336 a, c, g dbSNP:28933091
339 339 -, gctgcagac dbSNP:267607541
348 348 c, t dbSNP:755777307
349 349 a, g dbSNP:777419380
358 358 a, g dbSNP:61195471
359 359 a, g, t dbSNP:28933092
363 363 a, g dbSNP:12117552
369 369 c, g dbSNP:267607629
373 373 -, aag dbSNP:267607540
373 373 a, c dbSNP:770744765
375 375 -, gaa dbSNP:267607551
376 376 -, a dbSNP:62636507
380 380 g, t dbSNP:267607572
394 394 c, g, t dbSNP:397517905
395 395 c, t dbSNP:61295588
396 396 a, c, g, t dbSNP:80356808
398 398 a, g dbSNP:757041809
406 406 a, c dbSNP:778798942
407 407 a, c, g dbSNP:267607584
409 409 c, t dbSNP:370134870
410 410 a, g dbSNP:780066296
413 413 a, g dbSNP:372567202
415 415 c, t dbSNP:28928901
416 416 a, c dbSNP:58034145
424 424 c, t dbSNP:60682848
425 425 a, g dbSNP:199474724
432 432 a, g dbSNP:769896881
437 437 c, t dbSNP:727505357
439 439 a, g dbSNP:61214927
440 440 a, g dbSNP:773349450
442 442 a, c dbSNP:11549666
443 443 a, g dbSNP:760388350
445 445 c, g dbSNP:267607609
446 446 a, g dbSNP:57207746
451 451 c, t dbSNP:267607573
454 454 c, g, t dbSNP:201227908
455 455 a, g dbSNP:759829161
461 461 c, t dbSNP:730880132
462 462 c, t dbSNP:768081358
469 469 c, t dbSNP:775964460
474 474 a, g dbSNP:58235810
476 476 c, t dbSNP:397517906
477 477 a, g dbSNP:763625309
480 480 c, t dbSNP:753243743
481 481 a, g dbSNP:201866557
483 483 a, g dbSNP:756952925
487 487 c, t dbSNP:267607587
490 490 a, g dbSNP:727504373
494 494 c, t dbSNP:58850446
496 496 c, g, t dbSNP:121912496
497 497 a, g dbSNP:59332535
498 498 a, g dbSNP:587781025
500 500 c, t dbSNP:397517907
502 502 -, c dbSNP:34777960
510 510 c, g dbSNP:764738988
514 514 -, c dbSNP:397517908
526 526 c, g, t dbSNP:60578328
528 528 a, t dbSNP:58048078
532 532 -, aag dbSNP:58978449
532 532 aag, nnnnnnnnnnnnnnnnnn dbSNP:672601257
535 535 g, t dbSNP:397517909
538 538 c, g dbSNP:750246389
539 539 c, t dbSNP:267607625
540 540 a, g dbSNP:148557956
550 550 c, t dbSNP:267607593
551 551 a, g dbSNP:57048196
553 553 c, t dbSNP:267607630
561 561 a, g dbSNP:267607631
563 563 c, t dbSNP:267607641
566 566 acaa, ccagac dbSNP:267607616
568 568 a, g dbSNP:754020721
588 588 a, g dbSNP:727505198
599 599 a, g dbSNP:765241364
604 604 g, t dbSNP:746056534
606 606 -, g dbSNP:59564495
606 606 g, t dbSNP:373384985
611 611 c, t dbSNP:397517910
612 612 c, t dbSNP:538089
614 614 c, g dbSNP:397517911
615 615 -, ccac dbSNP:60168366
618 618 c, t dbSNP:780415585
619 619 a, g dbSNP:397517912
621 621 a, g dbSNP:747275587
632 632 a, c dbSNP:61616775
634 634 c, t dbSNP:267607633
635 635 c, t dbSNP:769210828
636 636 a, g dbSNP:776999079
637 637 c, t dbSNP:375987939
643 643 c, t dbSNP:59885338
644 644 a, g dbSNP:762653476
645 645 a, c dbSNP:769404097
646 646 a, g dbSNP:150924946
647 647 c, t dbSNP:267607684
648 648 c, g, t dbSNP:762718963
649 649 a, g dbSNP:267607591
650 650 a, c dbSNP:79907212
653 653 c, g dbSNP:546272425
656 656 c, t dbSNP:267607596
658 658 c, t dbSNP:61527854
659 659 -, ct dbSNP:59684335
668 668 g, t dbSNP:730882262
671 671 c, g dbSNP:759249597
672 672 c, t dbSNP:767552619
678 678 a, c dbSNP:752558753
691 691 a, g dbSNP:769498020
699 699 a, g dbSNP:778421025
700 700 a, g dbSNP:56816490
703 703 a, g dbSNP:267607574
705 705 a, g dbSNP:397517914
708 708 a, g dbSNP:770547079
709 709 -, c dbSNP:397517915
709 709 c, t dbSNP:3209921
710 710 -, t dbSNP:56771886
712 712 c, t dbSNP:267607554
727 727 a, t dbSNP:56851164
728 728 c, t dbSNP:745540806
730 730 c, t dbSNP:771703754
736 736 a, c dbSNP:775159300
737 737 a, g dbSNP:397517913
741 741 a, g dbSNP:140800215
743 743 a, c, g dbSNP:59301204
749 749 c, t dbSNP:763069566
752 752 a, g dbSNP:370656306
754 754 a, c, t dbSNP:386134243
755 755 a, g dbSNP:138592977
758 758 a, g dbSNP:58105277
762 762 c, g dbSNP:753179748
767 767 a, c dbSNP:756538414
768 768 a, g dbSNP:17847242
773 773 a, c dbSNP:11549667
778 778 a, c, t dbSNP:749784223
779 779 a, g dbSNP:61177390
790 790 a, g dbSNP:267607548
795 795 g, t dbSNP:587777892
796 796 c, t dbSNP:267607555
797 797 g, t dbSNP:58789393
798 798 a, g dbSNP:147015659
799 799 c, g dbSNP:267607610
802 802 a, c dbSNP:771623461
803 803 a, g dbSNP:779749639
808 808 a, c dbSNP:267607623
814 814 c, g, t dbSNP:267607617
815 815 -, agc dbSNP:267607635
820 820 c, g dbSNP:267607567
822 822 c, t dbSNP:376875762
823 823 a, g, t dbSNP:60458016
832 832 a, g dbSNP:267607634
836 836 -, t dbSNP:58389804
837 837 -, t dbSNP:587782956
843 843 c, t dbSNP:776589077
849 849 a, g dbSNP:57901307
857 857 c, t dbSNP:397517886
862 862 -, atggagatccacgcc dbSNP:397517887
863 863 a, t dbSNP:59653062
865 865 -, g dbSNP:267607575
866 866 -, tgga dbSNP:397517888
873 873 c, t dbSNP:143715750
880 880 c, t dbSNP:397517889
881 881 -, gccctggacatggagatccacgcctaccg dbSNP:267607624
881 881 a, g, t dbSNP:61672878
890 890 c, t dbSNP:121912495
893 893 a, c dbSNP:267607558
897 897 c, t dbSNP:57508089
900 900 a, g dbSNP:267607603
908 908 a, g, t dbSNP:267607545
910 910 c, g dbSNP:267607562
913 913 c, t dbSNP:58133342
914 914 a, g dbSNP:267607576
918 918 a, g dbSNP:750919582
932 932 c, t dbSNP:757887400
935 935 c, t dbSNP:267607561
936 936 a, g dbSNP:397517890
938 938 a, g, t dbSNP:61693978
940 940 c, t dbSNP:374726751
941 941 a, g dbSNP:747952058
946 946 c, t dbSNP:58672172
947 947 a, g dbSNP:267607563
948 948 c, t dbSNP:749284229
951 951 c, t dbSNP:770727928
952 952 c, t dbSNP:61094188
953 953 a, g dbSNP:141490569
955 955 a, g dbSNP:769064643
960 960 c, t dbSNP:776975256
965 965 a, g dbSNP:758278487
974 974 a, c dbSNP:397517891
978 978 a, g dbSNP:762130433
982 982 g, t dbSNP:727504852
983 983 a, g dbSNP:267607647
987 987 c, g dbSNP:763537103
988 988 a, g, t dbSNP:766811975
990 990 a, c dbSNP:754472024
993 993 c, t dbSNP:184946451
994 994 a, g dbSNP:267607606
998 998 c, t dbSNP:752367284
1006 1006 c, t dbSNP:755686359
1007 1007 a, g dbSNP:777648901
1008 1008 c, t dbSNP:748980648
1013 1013 c, t dbSNP:267607564
1030 1030 c, t dbSNP:373584456
1031 1031 a, g dbSNP:747139279
1035 1035 c, g dbSNP:368831495
1045 1045 c, t dbSNP:267607618
1050 1050 c, t dbSNP:61217436
1051 1051 -, gcacgcac dbSNP:727504833
1051 1051 a, g dbSNP:748433620
1054 1054 c, t dbSNP:150840924
1058 1058 -, gcac dbSNP:267607577
1058 1058 c, t dbSNP:773638171
1062 1062 c, t dbSNP:763224059
1063 1063 a, g dbSNP:766932100
1065 1065 a, g dbSNP:774817302
1066 1066 c, t dbSNP:62636506
1068 1068 a, c, t dbSNP:374804871
1069 1069 a, g dbSNP:121912493
1074 1074 a, c dbSNP:140194535
1075 1075 a, g dbSNP:368542816
1081 1081 a, g dbSNP:545531053
1088 1088 a, t dbSNP:58541611
1089 1089 a, c, g, t dbSNP:505058
1092 1092 a, g dbSNP:750352203
1097 1097 a, g dbSNP:267607637
1108 1108 c, t dbSNP:58932704
1109 1109 a, c, g dbSNP:267607598
1112 1112 c, t dbSNP:267607638
1113 1113 a, g dbSNP:151160622
1114 1114 c, t dbSNP:397517892
1115 1115 c, g dbSNP:267607597
1117 1117 a, g dbSNP:267607599
1118 1118 a, t dbSNP:60992550
1119 1119 -, caa dbSNP:267607550
1119 1119 a, c dbSNP:61235244
1121 1121 -, a dbSNP:267607549
1127 1127 a, g dbSNP:372011095
1132 1132 g, t dbSNP:267607642
1139 1139 c, t dbSNP:778099589
1141 1141 a, g dbSNP:200262654
1143 1143 a, g dbSNP:771095582
1145 1145 a, g dbSNP:61282106
1148 1148 -, a dbSNP:58100028
1149 1149 c, t dbSNP:779266133
1150 1150 c, t dbSNP:267607639
1157 1157 c, t dbSNP:57394692
1162 1162 c, g, t dbSNP:28928902
1163 1163 a, g dbSNP:267607578
1175 1175 -, aga dbSNP:267607579
1192 1192 c, t dbSNP:57747780
1193 1193 a, g dbSNP:397517893
1194 1194 c, g dbSNP:56935051
1195 1195 c, t dbSNP:57920071
1196 1196 a, g, t dbSNP:11575937
1209 1209 c, g, t dbSNP:59981161
1213 1213 a, c dbSNP:267607607
1225 1225 a, g dbSNP:373480082
1228 1228 c, t dbSNP:56699480
1231 1231 g, t dbSNP:760277884
1233 1233 a, g dbSNP:768017760
1238 1238 c, t dbSNP:200466188
1239 1239 a, g dbSNP:375516745
1243 1243 a, t dbSNP:267607585
1244 1244 -, g dbSNP:60556110
1245 1245 g, t dbSNP:57730570
1247 1247 -, c dbSNP:267607580
1258 1258 a, g dbSNP:545393299
1260 1260 a, g dbSNP:747595031
1261 1261 a, g dbSNP:769637371
1263 1263 -, ag dbSNP:267607553
1267 1267 c, g dbSNP:267607565
1275 1275 c, t dbSNP:772978446
1276 1276 c, t dbSNP:762847359
1277 1277 -, c dbSNP:58013325
1277 1277 c, t dbSNP:766120841
1281 1281 c, t dbSNP:138098342
1282 1282 a, g dbSNP:759408439
1286 1286 c, t dbSNP:57877560
1302 1302 a, g dbSNP:41314035
1303 1303 a, g dbSNP:757733890
1307 1307 c, t dbSNP:753988867
1309 1309 g, t dbSNP:267607557
1310 1310 c, g dbSNP:58362413
1317 1317 c, t dbSNP:149339264
1318 1318 a, g dbSNP:201583907
1330 1330 -, ctgc dbSNP:58571998
1330 1330 c, t dbSNP:57318642
1331 1331 a, c, g dbSNP:57520892
1334 1334 a, c, g, t dbSNP:57629361
1335 1335 a, g dbSNP:80356812
1336 1336 a, g dbSNP:121912494
1337 1337 c, t dbSNP:60580541
1339 1339 c, g dbSNP:780302064
1340 1340 c, t dbSNP:60934003
1341 1341 c, t dbSNP:747338820
1352 1352 c, g dbSNP:144740174
1353 1353 c, t dbSNP:781763410
1355 1355 a, g dbSNP:747717293
1356 1356 a, g dbSNP:769398087
1364 1364 c, t dbSNP:766555060
1370 1370 c, t dbSNP:267607547
1371 1371 a, g dbSNP:483352811
1372 1372 a, c, g, t dbSNP:56984562
1373 1373 a, c, g dbSNP:61444459
1377 1377 c, g dbSNP:56673169
1384 1384 c, t dbSNP:267607613
1385 1385 a, g dbSNP:142191737
1390 1390 a, g dbSNP:201947393
1396 1396 a, g dbSNP:781774834
1398 1398 c, g dbSNP:753288092
1407 1407 c, t dbSNP:370219874
1408 1408 a, g dbSNP:373671419
1410 1410 c, t dbSNP:748768783
1411 1411 c, g dbSNP:71630616
1413 1413 a, g dbSNP:201936898
1415 1415 a, g dbSNP:141578711
1431 1431 c, t dbSNP:17847249
1446 1446 c, t dbSNP:778618908
1449 1449 c, t dbSNP:4641
1469 1469 c, t dbSNP:60890628
1470 1470 a, g dbSNP:759853354
1479 1479 c, t dbSNP:767783294
1482 1482 c, t dbSNP:776066211
1484 1484 a, t dbSNP:61224243
1485 1485 a, g dbSNP:541072397
1496 1496 a, g dbSNP:57830985
1497 1497 c, t dbSNP:764561834
1499 1499 c, g, t dbSNP:59601651
1501 1501 c, t dbSNP:578193315
1502 1502 a, g dbSNP:56657623
1506 1506 c, t dbSNP:545752475
1507 1507 a, g dbSNP:758048062
1512 1512 a, g dbSNP:80356813
1513 1513 c, t dbSNP:267607621
1515 1515 c, t dbSNP:759016336
1516 1516 a, g dbSNP:372201662
1521 1521 c, g, t dbSNP:397517896
1523 1523 g, t dbSNP:267607556
1524 1524 c, t dbSNP:397517897
1525 1525 a, g dbSNP:786205448
1536 1536 c, t dbSNP:748139390
1537 1537 a, g dbSNP:769561386
1541 1541 -, a dbSNP:34195769
1544 1544 c, g dbSNP:774494686
1554 1554 c, t dbSNP:267607604
1555 1555 a, g dbSNP:60662302
1563 1563 a, t dbSNP:775835223
1572 1572 a, g dbSNP:59886214
1573 1573 a, g dbSNP:61064130
1575 1575 c, t dbSNP:58596362
1576 1576 a, g dbSNP:397517898
1585 1585 c, t dbSNP:761166160
1588 1588 c, t dbSNP:147627124
1602 1602 c, t dbSNP:143189394
1608 1608 c, t dbSNP:368581237
1613 1613 c, t dbSNP:765594825
1614 1614 a, g dbSNP:749999967
1618 1618 a, g dbSNP:757888891
1619 1619 c, g dbSNP:59267781
1621 1621 c, t dbSNP:140455668
1622 1622 a, g, t dbSNP:13768
1624 1624 a, c, t dbSNP:398124550
1625 1625 c, g dbSNP:398124551
1628 1628 a, g dbSNP:138208127
1629 1629 c, t dbSNP:756144792
1630 1630 c, t dbSNP:777841827
1631 1631 a, c, g dbSNP:745997478
1632 1632 c, t dbSNP:780246331
1633 1633 a, c dbSNP:747253572
1637 1637 -, g dbSNP:770335541
1637 1637 g, t dbSNP:768700201
1638 1638 a, g dbSNP:777055343
1640 1640 g, t dbSNP:762077332
1641 1641 a, g dbSNP:770389147
1643 1643 a, g dbSNP:267607648
1655 1655 a, g dbSNP:267607612
1659 1659 c, t dbSNP:80356814
1660 1660 g, t dbSNP:765905188
1662 1662 a, c, t dbSNP:117939448
1663 1663 a, g dbSNP:144851946
1670 1670 a, g dbSNP:752598065
1675 1675 a, g dbSNP:551309521
1679 1679 c, t dbSNP:777900936
1681 1681 a, c, t dbSNP:142000963
1682 1682 a, g dbSNP:368386019
1695 1695 a, g dbSNP:780291249
1698 1698 c, t dbSNP:3209857
1700 1700 a, g dbSNP:775728847
1711 1711 c, t dbSNP:267607544
1712 1712 a, g dbSNP:768986279
1715 1715 -, g dbSNP:267607566
1716 1716 a, c, t dbSNP:781255269
1729 1729 a, g dbSNP:374926367
1738 1738 a, g dbSNP:781516147
1741 1741 a, t dbSNP:748348868
1745 1745 a, t dbSNP:557591514
1750 1750 a, g dbSNP:746597763
1773 1773 a, g dbSNP:767516603
1818 1818 a, g dbSNP:3204564
1820 1820 a, c dbSNP:371251854
1825 1825 g, t dbSNP:752755714
1826 1826 a, g dbSNP:189656652
1857 1857 c, t dbSNP:777957193
1866 1866 c, g dbSNP:542967720
1876 1876 a, g dbSNP:555221717
1878 1878 c, g dbSNP:529375252
1880 1880 a, g dbSNP:781055697
1923 1923 c, t dbSNP:144299350
1929 1929 c, g dbSNP:754849110
1978 1978 a, g dbSNP:375604123
1994 1994 c, t dbSNP:15292

Target ORF information:

RefSeq Version NM_001257374
Organism Homo sapiens (human)
Definition Homo sapiens lamin A/C (LMNA), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20696
Accession Version NM_170708.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1905bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 16-JUL-2015
Organism Homo sapiens (human)
Product lamin isoform A-delta10
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BG822820.1, BC000511.2, AF381029.1, BC014507.1, AL135927.14 and AI872233.1. On Apr 10, 2012 this sequence version replaced gi:153281094. Summary: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (3) lacks an internal segment of sequence compared to variant 1. The encoded isoform (A delta10), is shorter but has the same C-terminus when compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968968 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## inferred exon combination :: based on alignments, homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)13..15(+)
Misc Feature(2)277..279(+)
Misc Feature(3)304..306(+)
Misc Feature(4)304..306(+)
Misc Feature(5)304..306(+)
Misc Feature(6)313..315(+)
Misc Feature(7)313..315(+)
Misc Feature(8)319..321(+)
Misc Feature(9)337..1407(+)
Misc Feature(10)343..693(+)
Misc Feature(11)529..531(+)
Misc Feature(12)757..>1038(+)
Misc Feature(13)937..939(+)
Misc Feature(14)937..939(+)
Misc Feature(15)1078..1080(+)
Misc Feature(16)1093..1095(+)
Misc Feature(17)1153..>1338(+)
Misc Feature(18)1417..1419(+)
Misc Feature(19)1417..1419(+)
Misc Feature(20)1423..1425(+)
Misc Feature(21)1423..1425(+)
Misc Feature(22)1423..1425(+)
Misc Feature(23)1429..1431(+)
Misc Feature(24)1432..1434(+)
Misc Feature(25)1456..1458(+)
Misc Feature(26)1459..1461(+)
Misc Feature(27)1465..1467(+)
Misc Feature(28)1468..1470(+)
Misc Feature(29)1474..1476(+)
Misc Feature(30)1489..1491(+)
Misc Feature(31)1495..1497(+)
Misc Feature(32)1516..1518(+)
Misc Feature(33)1519..1521(+)
Misc Feature(34)1525..1527(+)
Misc Feature(35)1546..1857(+)
Misc Feature(36)1822..1824(+)
Misc Feature(37)1993..1995(+)
Misc Feature(38)1996..1998(+)
Misc Feature(39)2005..2007(+)
Misc Feature(40)2011..2013(+)
Misc Feature(41)2014..2016(+)
Misc Feature(42)2041..2043(+)
Misc Feature(43)2053..2055(+)
Misc Feature(44)2065..2067(+)
Misc Feature(45)2086..2088(+)
Misc Feature(46)2095..2097(+)
Misc Feature(47)2113..2115(+)
Misc Feature(48)2113..2115(+)
Exon (1)1..605
Gene Synonym:
Exon (2)606..762
Gene Synonym:
Exon (3)763..888
Gene Synonym:
Exon (4)889..1059
Gene Synonym:
Exon (5)1060..1185
Gene Synonym:
Exon (6)1186..1406
Gene Synonym:
Exon (7)1407..1629
Gene Synonym:
Exon (8)1630..1737
Gene Synonym:
Exon (9)1738..1857
Gene Synonym:
Exon (10)1858..2127
Gene Synonym:
Exon (11)2128..3137
Gene Synonym:
Position Chain Variation Link
27 27 c, t dbSNP:188625872
85 85 a, c dbSNP:529934671
122 122 c, t dbSNP:80356803
162 162 g, t dbSNP:115800510
208 208 c, t dbSNP:761922735
210 210 c, g dbSNP:534069590
230 230 g, t dbSNP:765558668
232 232 a, g dbSNP:750665274
239 239 a, g dbSNP:758887740
247 247 -, gccatggagaccccg dbSNP:267607546
254 254 a, g dbSNP:11549669
260 260 c, g dbSNP:267607620
261 261 a, g dbSNP:369823958
263 263 c, t dbSNP:766624427
265 265 c, t dbSNP:61046466
269 269 a, g dbSNP:751916168
277 277 -, a dbSNP:58727209
278 278 c, t dbSNP:57077886
280 280 -, c dbSNP:60029152
280 280 c, g dbSNP:755465323
287 287 c, g dbSNP:781684338
288 288 a, g dbSNP:747663457
289 289 a, g dbSNP:755617982
291 291 a, g dbSNP:777460187
292 292 -, agg dbSNP:751431601
293 293 a, c dbSNP:748918487
296 296 a, c dbSNP:770799870
300 300 c, t dbSNP:11549668
322 322 c, g, t dbSNP:58327533
323 323 c, g, t dbSNP:61578124
324 324 c, t dbSNP:80356804
327 327 c, t dbSNP:373721390
331 331 c, t dbSNP:59914820
343 343 -, aag dbSNP:60872029
345 345 a, g dbSNP:775429079
347 347 a, g dbSNP:267607614
348 348 c, g, t dbSNP:57966821
352 352 c, g dbSNP:56694480
353 353 c, t dbSNP:267607644
355 355 c, t dbSNP:267607601
364 364 a, t dbSNP:267607627
365 365 a, g dbSNP:57983345
376 376 a, g dbSNP:60446065
381 381 c, g dbSNP:762049172
383 383 a, g dbSNP:58436778
385 385 a, g dbSNP:267607615
388 388 c, g dbSNP:267607608
391 391 c, g dbSNP:769977710
396 396 a, g dbSNP:376196924
397 397 a, c, t dbSNP:59931416
398 398 a, c, g dbSNP:60695352
399 399 c, t dbSNP:397517894
402 402 a, g, t dbSNP:751886390
403 403 c, g dbSNP:397517895
404 404 c, t dbSNP:267607611
407 407 a, t dbSNP:60290646
418 418 c, g dbSNP:28928903
425 425 g, t dbSNP:58922911
427 427 c, g, t dbSNP:28928900
433 433 c, g dbSNP:56793579
437 437 a, g, t dbSNP:57793737
438 438 a, c dbSNP:767976986
440 440 a, c dbSNP:753191587
441 441 c, t dbSNP:137969290
447 447 c, g, t dbSNP:397517899
452 452 -, aggtgg dbSNP:267607586
453 453 a, g dbSNP:753304214
459 459 a, c dbSNP:756880374
463 463 c, g dbSNP:17847247
464 464 a, g, t dbSNP:727504340
475 475 a, g dbSNP:745651340
483 483 c, g dbSNP:727505038
488 488 c, t dbSNP:771893681
489 489 c, t dbSNP:780194620
493 493 a, g dbSNP:59270054
498 498 c, t dbSNP:746916710
503 503 g, t dbSNP:28933090
506 506 a, g dbSNP:768678385
510 510 c, t dbSNP:397517900
514 514 c, t dbSNP:267607559
515 515 a, g, t dbSNP:59040894
523 523 c, t dbSNP:267607560
536 536 c, g dbSNP:773451393
538 538 a, g dbSNP:59065411
551 551 c, g dbSNP:267607568
553 553 c, t dbSNP:763033565
571 571 a, g dbSNP:771065515
578 578 a, g dbSNP:556237236
580 580 c, g, t dbSNP:61726475
583 583 -, gag dbSNP:61726474
588 588 c, t dbSNP:759878335
589 589 a, g dbSNP:767902515
592 592 ga, tt dbSNP:727503134
597 597 -, g dbSNP:267607646
599 599 a, g dbSNP:397517901
604 604 c, t dbSNP:17856971
605 605 c, g dbSNP:397517902
606 606 c, t dbSNP:41313880
609 609 a, t dbSNP:763717410
610 610 a, g dbSNP:543011658
611 611 c, t dbSNP:757961893
618 618 a, g dbSNP:367938270
622 622 a, g dbSNP:267607605
632 632 c, t dbSNP:746475627
635 635 a, c dbSNP:768203943
643 643 c, g, t dbSNP:61726478
647 647 c, g, t dbSNP:60864230
655 655 c, g dbSNP:267607619
658 658 c, t dbSNP:747998566
661 661 a, g dbSNP:267607649
668 668 c, g, t dbSNP:60652225
676 676 c, t dbSNP:61661343
677 677 c, t dbSNP:58912633
682 682 a, g dbSNP:60310264
685 685 a, g dbSNP:397517903
687 687 c, t dbSNP:80356805
688 688 a, g, t dbSNP:139875047
697 697 a, c dbSNP:58917027
700 700 a, g dbSNP:766291714
713 713 a, c dbSNP:775448051
715 715 c, t dbSNP:760743233
716 716 a, g dbSNP:764475194
719 719 c, t dbSNP:754097769
720 720 a, g dbSNP:150645079
724 724 a, g dbSNP:267607622
727 727 c, g dbSNP:765665953
728 728 a, g dbSNP:750755990
729 729 c, t dbSNP:758848135
730 730 a, g dbSNP:28933093
734 734 c, t dbSNP:267607594
735 735 a, g dbSNP:727503135
739 739 c, g dbSNP:751033102
745 745 c, t dbSNP:370200334
746 746 a, c, g dbSNP:267607570
753 753 c, g dbSNP:747771347
755 755 -, t dbSNP:267607595
762 762 a, g dbSNP:267607542
770 770 a, c dbSNP:762153472
773 773 c, t dbSNP:369714176
775 775 c, t dbSNP:149113760
796 796 c, t dbSNP:574749413
797 797 c, t dbSNP:267607583
805 805 a, g dbSNP:61726479
813 813 a, g dbSNP:750762996
814 814 c, t dbSNP:267607626
815 815 cc, gg dbSNP:267607643
815 815 a, g dbSNP:766856162
817 817 c, t dbSNP:59026483
818 818 a, g dbSNP:267607571
819 819 -, cgg dbSNP:267607628
821 821 g, t dbSNP:752087253
822 822 a, g dbSNP:754525930
824 824 a, g, t dbSNP:57045855
828 828 c, t dbSNP:749728556
834 834 a, c, g dbSNP:28933091
837 837 -, gctgcagac dbSNP:267607541
846 846 c, t dbSNP:755777307
847 847 a, g dbSNP:777419380
856 856 a, g dbSNP:61195471
857 857 a, g, t dbSNP:28933092
861 861 a, g dbSNP:12117552
867 867 c, g dbSNP:267607629
871 871 -, aag dbSNP:267607540
871 871 a, c dbSNP:770744765
873 873 -, gaa dbSNP:267607551
874 874 -, a dbSNP:62636507
878 878 g, t dbSNP:267607572
892 892 c, g, t dbSNP:397517905
893 893 c, t dbSNP:61295588
894 894 a, c, g, t dbSNP:80356808
896 896 a, g dbSNP:757041809
904 904 a, c dbSNP:778798942
905 905 a, c, g dbSNP:267607584
907 907 c, t dbSNP:370134870
908 908 a, g dbSNP:780066296
911 911 a, g dbSNP:372567202
913 913 c, t dbSNP:28928901
914 914 a, c dbSNP:58034145
922 922 c, t dbSNP:60682848
923 923 a, g dbSNP:199474724
930 930 a, g dbSNP:769896881
935 935 c, t dbSNP:727505357
937 937 a, g dbSNP:61214927
938 938 a, g dbSNP:773349450
940 940 a, c dbSNP:11549666
941 941 a, g dbSNP:760388350
943 943 c, g dbSNP:267607609
944 944 a, g dbSNP:57207746
949 949 c, t dbSNP:267607573
952 952 c, g, t dbSNP:201227908
953 953 a, g dbSNP:759829161
959 959 c, t dbSNP:730880132
960 960 c, t dbSNP:768081358
967 967 c, t dbSNP:775964460
972 972 a, g dbSNP:58235810
974 974 c, t dbSNP:397517906
975 975 a, g dbSNP:763625309
978 978 c, t dbSNP:753243743
979 979 a, g dbSNP:201866557
981 981 a, g dbSNP:756952925
985 985 c, t dbSNP:267607587
988 988 a, g dbSNP:727504373
992 992 c, t dbSNP:58850446
994 994 c, g, t dbSNP:121912496
995 995 a, g dbSNP:59332535
996 996 a, g dbSNP:587781025
998 998 c, t dbSNP:397517907
1000 1000 -, c dbSNP:34777960
1008 1008 c, g dbSNP:764738988
1012 1012 -, c dbSNP:397517908
1024 1024 c, g, t dbSNP:60578328
1026 1026 a, t dbSNP:58048078
1030 1030 -, aag dbSNP:58978449
1030 1030 aag, nnnnnnnnnnnnnnnnnn dbSNP:672601257
1033 1033 g, t dbSNP:397517909
1036 1036 c, g dbSNP:750246389
1037 1037 c, t dbSNP:267607625
1038 1038 a, g dbSNP:148557956
1048 1048 c, t dbSNP:267607593
1049 1049 a, g dbSNP:57048196
1051 1051 c, t dbSNP:267607630
1059 1059 a, g dbSNP:267607631
1061 1061 c, t dbSNP:267607641
1064 1064 acaa, ccagac dbSNP:267607616
1066 1066 a, g dbSNP:754020721
1086 1086 a, g dbSNP:727505198
1097 1097 a, g dbSNP:765241364
1102 1102 g, t dbSNP:746056534
1104 1104 -, g dbSNP:59564495
1104 1104 g, t dbSNP:373384985
1109 1109 c, t dbSNP:397517910
1110 1110 c, t dbSNP:538089
1112 1112 c, g dbSNP:397517911
1113 1113 -, ccac dbSNP:60168366
1116 1116 c, t dbSNP:780415585
1117 1117 a, g dbSNP:397517912
1119 1119 a, g dbSNP:747275587
1130 1130 a, c dbSNP:61616775
1132 1132 c, t dbSNP:267607633
1133 1133 c, t dbSNP:769210828
1134 1134 a, g dbSNP:776999079
1135 1135 c, t dbSNP:375987939
1141 1141 c, t dbSNP:59885338
1142 1142 a, g dbSNP:762653476
1143 1143 a, c dbSNP:769404097
1144 1144 a, g dbSNP:150924946
1145 1145 c, t dbSNP:267607684
1146 1146 c, g, t dbSNP:762718963
1147 1147 a, g dbSNP:267607591
1148 1148 a, c dbSNP:79907212
1151 1151 c, g dbSNP:546272425
1154 1154 c, t dbSNP:267607596
1156 1156 c, t dbSNP:61527854
1157 1157 -, ct dbSNP:59684335
1166 1166 g, t dbSNP:730882262
1169 1169 c, g dbSNP:759249597
1170 1170 c, t dbSNP:767552619
1176 1176 a, c dbSNP:752558753
1189 1189 a, g dbSNP:769498020
1197 1197 a, g dbSNP:778421025
1198 1198 a, g dbSNP:56816490
1201 1201 a, g dbSNP:267607574
1203 1203 a, g dbSNP:397517914
1206 1206 a, g dbSNP:770547079
1207 1207 -, c dbSNP:397517915
1207 1207 c, t dbSNP:3209921
1208 1208 -, t dbSNP:56771886
1210 1210 c, t dbSNP:267607554
1225 1225 a, t dbSNP:56851164
1226 1226 c, t dbSNP:745540806
1228 1228 c, t dbSNP:771703754
1234 1234 a, c dbSNP:775159300
1235 1235 a, g dbSNP:397517913
1239 1239 a, g dbSNP:140800215
1241 1241 a, c, g dbSNP:59301204
1247 1247 c, t dbSNP:763069566
1250 1250 a, g dbSNP:370656306
1252 1252 a, c, t dbSNP:386134243
1253 1253 a, g dbSNP:138592977
1256 1256 a, g dbSNP:58105277
1260 1260 c, g dbSNP:753179748
1265 1265 a, c dbSNP:756538414
1266 1266 a, g dbSNP:17847242
1271 1271 a, c dbSNP:11549667
1276 1276 a, c, t dbSNP:749784223
1277 1277 a, g dbSNP:61177390
1288 1288 a, g dbSNP:267607548
1293 1293 g, t dbSNP:587777892
1294 1294 c, t dbSNP:267607555
1295 1295 g, t dbSNP:58789393
1296 1296 a, g dbSNP:147015659
1297 1297 c, g dbSNP:267607610
1300 1300 a, c dbSNP:771623461
1301 1301 a, g dbSNP:779749639
1306 1306 a, c dbSNP:267607623
1312 1312 c, g, t dbSNP:267607617
1313 1313 -, agc dbSNP:267607635
1318 1318 c, g dbSNP:267607567
1320 1320 c, t dbSNP:376875762
1321 1321 a, g, t dbSNP:60458016
1330 1330 a, g dbSNP:267607634
1334 1334 -, t dbSNP:58389804
1335 1335 -, t dbSNP:587782956
1341 1341 c, t dbSNP:776589077
1347 1347 a, g dbSNP:57901307
1355 1355 c, t dbSNP:397517886
1360 1360 -, atggagatccacgcc dbSNP:397517887
1361 1361 a, t dbSNP:59653062
1363 1363 -, g dbSNP:267607575
1364 1364 -, tgga dbSNP:397517888
1371 1371 c, t dbSNP:143715750
1378 1378 c, t dbSNP:397517889
1379 1379 -, gccctggacatggagatccacgcctaccg dbSNP:267607624
1379 1379 a, g, t dbSNP:61672878
1388 1388 c, t dbSNP:121912495
1391 1391 a, c dbSNP:267607558
1395 1395 c, t dbSNP:57508089
1398 1398 a, g dbSNP:267607603
1406 1406 a, g, t dbSNP:267607545
1408 1408 c, g dbSNP:267607562
1411 1411 c, t dbSNP:58133342
1412 1412 a, g dbSNP:267607576
1416 1416 a, g dbSNP:750919582
1430 1430 c, t dbSNP:757887400
1433 1433 c, t dbSNP:267607561
1434 1434 a, g dbSNP:397517890
1436 1436 a, g, t dbSNP:61693978
1438 1438 c, t dbSNP:374726751
1439 1439 a, g dbSNP:747952058
1444 1444 c, t dbSNP:58672172
1445 1445 a, g dbSNP:267607563
1446 1446 c, t dbSNP:749284229
1449 1449 c, t dbSNP:770727928
1450 1450 c, t dbSNP:61094188
1451 1451 a, g dbSNP:141490569
1453 1453 a, g dbSNP:769064643
1458 1458 c, t dbSNP:776975256
1463 1463 a, g dbSNP:758278487
1472 1472 a, c dbSNP:397517891
1476 1476 a, g dbSNP:762130433
1480 1480 g, t dbSNP:727504852
1481 1481 a, g dbSNP:267607647
1485 1485 c, g dbSNP:763537103
1486 1486 a, g, t dbSNP:766811975
1488 1488 a, c dbSNP:754472024
1491 1491 c, t dbSNP:184946451
1492 1492 a, g dbSNP:267607606
1496 1496 c, t dbSNP:752367284
1504 1504 c, t dbSNP:755686359
1505 1505 a, g dbSNP:777648901
1506 1506 c, t dbSNP:748980648
1511 1511 c, t dbSNP:267607564
1528 1528 c, t dbSNP:373584456
1529 1529 a, g dbSNP:747139279
1533 1533 c, g dbSNP:368831495
1543 1543 c, t dbSNP:267607618
1548 1548 c, t dbSNP:61217436
1549 1549 -, gcacgcac dbSNP:727504833
1549 1549 a, g dbSNP:748433620
1552 1552 c, t dbSNP:150840924
1556 1556 -, gcac dbSNP:267607577
1556 1556 c, t dbSNP:773638171
1560 1560 c, t dbSNP:763224059
1561 1561 a, g dbSNP:766932100
1563 1563 a, g dbSNP:774817302
1564 1564 c, t dbSNP:62636506
1566 1566 a, c, t dbSNP:374804871
1567 1567 a, g dbSNP:121912493
1572 1572 a, c dbSNP:140194535
1573 1573 a, g dbSNP:368542816
1579 1579 a, g dbSNP:545531053
1586 1586 a, t dbSNP:58541611
1587 1587 a, c, g, t dbSNP:505058
1590 1590 a, g dbSNP:750352203
1595 1595 a, g dbSNP:267607637
1606 1606 c, t dbSNP:58932704
1607 1607 a, c, g dbSNP:267607598
1610 1610 c, t dbSNP:267607638
1611 1611 a, g dbSNP:151160622
1612 1612 c, t dbSNP:397517892
1613 1613 c, g dbSNP:267607597
1615 1615 a, g dbSNP:267607599
1616 1616 a, t dbSNP:60992550
1617 1617 -, caa dbSNP:267607550
1617 1617 a, c dbSNP:61235244
1619 1619 -, a dbSNP:267607549
1625 1625 a, g dbSNP:372011095
1630 1630 g, t dbSNP:267607642
1637 1637 c, t dbSNP:778099589
1639 1639 a, g dbSNP:200262654
1641 1641 a, g dbSNP:771095582
1643 1643 a, g dbSNP:61282106
1646 1646 -, a dbSNP:58100028
1647 1647 c, t dbSNP:779266133
1648 1648 c, t dbSNP:267607639
1655 1655 c, t dbSNP:57394692
1660 1660 c, g, t dbSNP:28928902
1661 1661 a, g dbSNP:267607578
1673 1673 -, aga dbSNP:267607579
1690 1690 c, t dbSNP:57747780
1691 1691 a, g dbSNP:397517893
1692 1692 c, g dbSNP:56935051
1693 1693 c, t dbSNP:57920071
1694 1694 a, g, t dbSNP:11575937
1707 1707 c, g, t dbSNP:59981161
1711 1711 a, c dbSNP:267607607
1723 1723 a, g dbSNP:373480082
1726 1726 c, t dbSNP:56699480
1729 1729 g, t dbSNP:760277884
1731 1731 a, g dbSNP:768017760
1736 1736 c, t dbSNP:200466188
1737 1737 a, g dbSNP:375516745
1741 1741 a, t dbSNP:267607585
1742 1742 -, g dbSNP:60556110
1743 1743 g, t dbSNP:57730570
1745 1745 -, c dbSNP:267607580
1756 1756 a, g dbSNP:545393299
1758 1758 a, g dbSNP:747595031
1759 1759 a, g dbSNP:769637371
1761 1761 -, ag dbSNP:267607553
1765 1765 c, g dbSNP:267607565
1773 1773 c, t dbSNP:772978446
1774 1774 c, t dbSNP:762847359
1775 1775 -, c dbSNP:58013325
1775 1775 c, t dbSNP:766120841
1779 1779 c, t dbSNP:138098342
1780 1780 a, g dbSNP:759408439
1784 1784 c, t dbSNP:57877560
1800 1800 a, g dbSNP:41314035
1801 1801 a, g dbSNP:757733890