
LRP5 cDNA ORF clone, Homo sapiens (human)

Gene Symbol LRP5
Entrez Gene ID 4041
Full Name low density lipoprotein receptor-related protein 5
Synonyms BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP7, OPPG, OPS, OPTA1, VBCH2
General protein information
Preferred Names
low-density lipoprotein receptor-related protein 5
low-density lipoprotein receptor-related protein 5
low density lipoprotein receptor-related protein 7
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]. lac of sum
Disorder MIM:


Disorder Html: Osteoporosis-pseudoglioma syndrome, 259770 (3); [Bone mineral density

mRNA and Protein(s)

mRNA Protein Name
XM_011545029 XP_011543331 low-density lipoprotein receptor-related protein 5 isoform X1
XM_005273994 XP_005274051 low-density lipoprotein receptor-related protein 5 isoform X2
XM_011545030 XP_011543332 low-density lipoprotein receptor-related protein 5 isoform X3
XM_011545031 XP_011543333 low-density lipoprotein receptor-related protein 5 isoform X4
NM_002335 NP_002326 low-density lipoprotein receptor-related protein 5 isoform 1 precursor
NM_001291902 NP_001278831 low-density lipoprotein receptor-related protein 5 isoform 2

hsa04310 Wnt signaling pathway
R-HSA-5663202 Diseases of signal transduction
R-HSA-1643685 Disease
R-HSA-4791275 Signaling by WNT in cancer
R-HSA-5340588 RNF mutants show enhanced WNT signaling and proliferation
R-HSA-5339717 Misspliced LRP5 mutants have enhanced beta-catenin-dependent signaling
R-HSA-162582 Signal Transduction
R-HSA-201681 TCF dependent signaling in response to WNT
R-HSA-4641262 Disassembly of the destruction complex and recruitment of AXIN to the membrane
R-HSA-195721 Signaling by Wnt
R-HSA-3772470 Negative regulation of TCF-dependent signaling by WNT ligand antagonists
R-HSA-4641263 Regulation of FZD by ubiquitination
Pathway Interaction Database
ncadherinpathway N-cadherin signaling events
wnt_signaling_pathway Wnt signaling network
WP1544 MicroRNAs in cardiomyocyte hypertrophy
WP363 Wnt Signaling Pathway NetPath
WP399 Wnt Signaling Pathway and Pluripotency

Homo sapiens (human) LRP5 NP_002326.2
Pan troglodytes (chimpanzee) LRP5 XP_508605.3
Canis lupus familiaris (dog) LRP5 XP_003432463.2
Bos taurus (cattle) LRP5 XP_002699451.2
Mus musculus (house mouse) Lrp5 NP_032539.2
Rattus norvegicus (Norway rat) Lrp5 NP_001099791.2
Gallus gallus (chicken) LRP5 NP_001012915.1
Danio rerio (zebrafish) lrp5 NP_001170929.1
Xenopus (Silurana) tropicalis (western clawed frog) lrp5 XP_002941689.1


ID Name Evidence
GO:0005783 endoplasmic reticulum IEA
GO:0005886 plasma membrane IDA
GO:0016021 integral to membrane IEA
GO:0043235 receptor complex IDA


ID Name Evidence
GO:0004872 receptor activity IEA
GO:0005515 protein binding IPI
GO:0019534 toxin transporter activity IMP


ID Name Evidence
GO:0002053 positive regulation of mesenchymal cell proliferation IMP
GO:0006007 glucose catabolic process IMP
GO:0006897 endocytosis IEA
GO:0007166 cell surface receptor linked signaling pathway IDA
GO:0007275 multicellular organismal development IEA
GO:0008217 regulation of blood pressure IMP
GO:0008284 positive regulation of cell proliferation IDA
GO:0042632 cholesterol homeostasis IMP
GO:0044332 Wnt receptor signaling pathway involved in dorsal/ventral axis specification IDA
GO:0045600 positive regulation of fat cell differentiation IMP
GO:0045668 negative regulation of osteoblast differentiation IMP
GO:0045840 positive regulation of mitosis IDA
GO:0045893 positive regulation of transcription, DNA-dependent IDA
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IDA
GO:0048539 bone marrow development IMP
GO:0060042 retina morphogenesis in camera-type eye IMP
GO:0060070 canonical Wnt receptor signaling pathway IDA
GO:0060070 canonical Wnt receptor signaling pathway IMP
GO:0060349 bone morphogenesis IMP
GO:0060612 adipose tissue development IMP
GO:0060828 regulation of canonical Wnt receptor signaling pathway IMP
GO:0061304 retinal blood vessel morphogenesis IMP
GO:0071901 negative regulation of protein serine/threonine kinase activity IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following LRP5 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LRP5 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu58778 XM_011545029 PREDICTED: Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu45334 XM_005273994 PREDICTED: Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu58779 XM_011545030 PREDICTED: Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu58780 XM_011545031 PREDICTED: Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu27945 NM_002335 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu23272 NM_001291902 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu58778
Accession Version XM_011545029.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4989bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product low-density lipoprotein receptor-related protein 5 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167190.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)151..>549(+)
Misc Feature(2)157..228(+)
Misc Feature(3)235..354(+)
Misc Feature(4)346..468(+)
Misc Feature(5)361..486(+)
Misc Feature(6)496..549(+)
Misc Feature(7)529..651(+)
Misc Feature(8)601..729(+)
Misc Feature(9)784..900(+)
Misc Feature(10)937..1050(+)
Misc Feature(11)1138..1260(+)
Misc Feature(12)1264..1392(+)
Misc Feature(13)1453..1575(+)
Misc Feature(14)1525..1653(+)
Misc Feature(15)1654..1755(+)
Misc Feature(16)1855..1962(+)
Misc Feature(17)2095..2676(+)
Misc Feature(18)2098..2178(+)
Misc Feature(19)2170..2298(+)
Misc Feature(20)2200..2310(+)
Misc Feature(21)2329..2448(+)
Misc Feature(22)2464..2553(+)
Misc Feature(23)2581..2655(+)
Misc Feature(24)2758..2865(+)
Misc Feature(25)2950..3069(+)
Misc Feature(26)3220..3351(+)
Misc Feature(27)3352..3480(+)
Misc Feature(28)3691..3801(+)
Misc Feature(29)3817..3927(+)
Misc Feature(30)3832..3900(+)
Misc Feature(31)3874..3918(+)
Misc Feature(32)3904..3918(+)
Misc Feature(33)3934..4038(+)
Misc Feature(34)3949..4011(+)
Misc Feature(35)3985..4029(+)
Misc Feature(36)4015..4029(+)
Misc Feature(37)4048..4152(+)
Misc Feature(38)4063..4125(+)
Misc Feature(39)4099..4143(+)
Misc Feature(40)4129..4143(+)
Position Chain Variation Link
27 27 a, g dbSNP:145690695
79 79 a, g dbSNP:4988324
109 109 a, g dbSNP:753976229
137 137 c, t dbSNP:755388709
138 138 a, g dbSNP:202039395
140 140 c, t dbSNP:753259758
141 141 a, g, t dbSNP:375594120
142 142 c, t dbSNP:118154213
156 156 c, t dbSNP:368373906
158 158 a, g dbSNP:770308939
160 160 c, t dbSNP:780921829
163 163 c, t dbSNP:745454417
164 164 a, g dbSNP:573768844
168 168 c, t dbSNP:573589930
169 169 a, g dbSNP:775334774
171 171 a, t dbSNP:144719110
172 172 c, t dbSNP:371690402
173 173 a, g dbSNP:774243312
179 179 g, t dbSNP:760837106
183 183 c, t dbSNP:375980894
186 186 c, t dbSNP:776920568
187 187 a, g dbSNP:759606638
190 190 a, g dbSNP:558895370
193 193 a, g dbSNP:753169711
198 198 g, t dbSNP:758810766
204 204 c, g dbSNP:764736624
206 206 c, t dbSNP:148462220
207 207 c, t dbSNP:756806068
213 213 c, t dbSNP:543962342
222 222 c, t dbSNP:533073394
223 223 a, g dbSNP:757930323
237 237 a, g dbSNP:779662838
240 240 c, t dbSNP:763664158
241 241 a, g dbSNP:544861971
243 243 a, c, g dbSNP:540291726
246 246 a, g dbSNP:747974546
252 252 c, t dbSNP:771043544
254 254 a, g dbSNP:142607308
261 261 c, t dbSNP:759675214
262 262 a, g dbSNP:765603774
270 270 c, t dbSNP:564857130
271 271 a, g dbSNP:763434689
274 274 a, t dbSNP:764497512
285 285 c, t dbSNP:752111903
291 291 c, t dbSNP:375802434
292 292 a, c, g dbSNP:201119420
294 294 a, c, g dbSNP:755593193
303 303 c, t dbSNP:748887818
305 305 a, g dbSNP:78219242
308 308 a, g dbSNP:41494349
310 310 a, g dbSNP:747967502
325 325 a, c dbSNP:771960523
326 326 c, t dbSNP:777743208
327 327 a, g dbSNP:745983270
332 332 c, t dbSNP:143433231
333 333 c, t dbSNP:146667935
336 336 c, t dbSNP:763203475
337 337 a, g dbSNP:768918663
345 345 c, t dbSNP:372860842
346 346 a, g dbSNP:140216273
357 357 c, t dbSNP:767954187
363 363 c, g dbSNP:750905217
366 366 c, g dbSNP:11574419
372 372 c, t dbSNP:760197742
375 375 c, t dbSNP:765814871
381 381 c, t dbSNP:753488677
387 387 c, t dbSNP:144053326
388 388 g, t dbSNP:778613031
390 390 c, t dbSNP:747826647
400 400 a, g dbSNP:752483392
402 402 a, g dbSNP:758180204
405 405 a, g dbSNP:777601488
406 406 c, g dbSNP:144939255
408 408 a, g dbSNP:746886033
416 416 c, t dbSNP:770000425
417 417 a, g, t dbSNP:780348578
426 426 a, g dbSNP:138651503
427 427 a, t dbSNP:774605136
428 428 a, c dbSNP:762118228
433 433 c, t dbSNP:368250404
434 434 a, g dbSNP:773718615
438 438 c, t dbSNP:761101328
443 443 c, t dbSNP:539346540
448 448 a, g dbSNP:753400613
449 449 a, c, g dbSNP:759063931
450 450 a, c dbSNP:752352965
453 453 c, t dbSNP:758149177
455 455 a, g dbSNP:371729974
459 459 c, t dbSNP:751397561
461 461 c, t dbSNP:557685583
465 465 c, g dbSNP:781254570
466 466 c, t dbSNP:201093134
467 467 a, g, t dbSNP:368198391
468 468 c, g dbSNP:201193537
475 475 c, t dbSNP:80358305
477 477 c, t dbSNP:569392655
483 483 c, g dbSNP:748347747
488 488 a, c, g dbSNP:772324668
491 491 g, t dbSNP:376089595
492 492 c, t dbSNP:771475699
494 494 a, c dbSNP:777090670
500 500 c, t dbSNP:758997145
501 501 a, g dbSNP:78844574
508 508 a, g dbSNP:367846606
511 511 a, g, t dbSNP:762734738
514 514 c, t dbSNP:751450413
521 521 c, t dbSNP:757090225
522 522 c, g, t dbSNP:377114189
526 526 c, t dbSNP:755030131
528 528 c, t dbSNP:191882942
529 529 a, g dbSNP:748168729
533 533 a, g, t dbSNP:778000208
534 534 c, t dbSNP:757631150
535 535 a, c, g dbSNP:761767474
539 539 a, g dbSNP:746204905
542 542 g, t dbSNP:770383372
550 550 -, tg dbSNP:781481891
553 553 c, g dbSNP:121908669
554 554 g, t dbSNP:121908668
560 560 c, t dbSNP:80358306
561 561 a, g dbSNP:148128016
565 565 c, g dbSNP:373823574
566 566 a, g dbSNP:774164233
574 574 c, t dbSNP:200728516
575 575 a, g, t dbSNP:183377804
578 578 c, g dbSNP:760362830
579 579 a, c dbSNP:531476978
582 582 a, g dbSNP:753676598
593 593 a, g dbSNP:142649952
594 594 c, t dbSNP:764102072
595 595 a, c dbSNP:751784556
598 598 c, t dbSNP:200484935
599 599 a, g dbSNP:146895334
600 600 c, g dbSNP:369652619
601 601 a, g dbSNP:750841970
604 604 a, g dbSNP:372984788
605 605 a, t dbSNP:780636010
611 611 c, t dbSNP:199787141
613 613 a, g dbSNP:749757604
617 617 c, g, t dbSNP:549579496
618 618 a, g dbSNP:139063572
640 640 c, t dbSNP:370574039
642 642 a, g dbSNP:771896111
648 648 c, t dbSNP:772705728
649 649 a, g dbSNP:760548029
671 671 a, g dbSNP:770580929
675 675 c, g dbSNP:776643520
681 681 c, t dbSNP:150859573
682 682 a, g dbSNP:121908671
683 683 c, t dbSNP:121908672
703 703 c, t dbSNP:765147716
704 704 a, g dbSNP:751688462
712 712 a, c dbSNP:201681766
714 714 a, g dbSNP:761851629
717 717 c, t dbSNP:138207107
722 722 c, t dbSNP:200384949
723 723 a, g dbSNP:756516754
727 727 c, t dbSNP:766589610
728 728 a, g dbSNP:754254742
747 747 a, c dbSNP:553569731
751 751 c, t dbSNP:780791760
755 755 c, t dbSNP:375404890
756 756 a, g dbSNP:149522146
765 765 c, t dbSNP:775422664
766 766 a, g dbSNP:121908670
773 773 c, t dbSNP:397514665
780 780 c, t dbSNP:768638466
781 781 a, g dbSNP:773226526
782 782 a, g dbSNP:539068423
788 788 -, ct dbSNP:748552376
788 788 c, t dbSNP:766546504
789 789 a, t dbSNP:144040425
795 795 c, t dbSNP:759998730
796 796 g, t dbSNP:765637520
798 798 a, g dbSNP:753259530
800 800 c, t dbSNP:121908673
801 801 a, c dbSNP:763435713
812 812 c, t dbSNP:557291376
814 814 c, t dbSNP:751071752
828 828 c, t dbSNP:756752524
831 831 c, t dbSNP:575935133
838 838 c, t dbSNP:368484557
842 842 c, t dbSNP:755910471
845 845 -, gggggaagag dbSNP:80358307
845 845 c, g dbSNP:779893871
866 866 a, t dbSNP:749099090
871 871 a, g dbSNP:768528750
878 878 a, t dbSNP:778874445
879 879 c, t dbSNP:747085802
907 907 c, g dbSNP:771082674
914 914 a, g dbSNP:777003697
918 918 a, g dbSNP:759764117
922 922 -, cca dbSNP:778332568
922 922 a, t dbSNP:770136120
930 930 c, g dbSNP:754740683
932 932 c, t dbSNP:765013945
934 934 c, t dbSNP:752428183
954 954 c, t dbSNP:758466329
955 955 a, g dbSNP:377176311
960 960 c, t dbSNP:528414646
966 966 c, t dbSNP:756215440
976 976 c, g dbSNP:780154174
987 987 c, t dbSNP:749461497
988 988 a, g dbSNP:768757897
995 995 c, t dbSNP:774840027
1000 1000 a, t dbSNP:748493448
1005 1005 c, t dbSNP:772611192
1006 1006 g, t dbSNP:773665226
1016 1016 c, t dbSNP:760196023
1017 1017 a, g, t dbSNP:765854475
1039 1039 a, g dbSNP:759297600
1040 1040 a, c, g dbSNP:764782174
1041 1041 c, t dbSNP:758236607
1044 1044 -, gac dbSNP:776221148
1045 1045 a, g dbSNP:764149976
1046 1046 c, t dbSNP:751485385
1047 1047 a, g dbSNP:756268764
1049 1049 a, g dbSNP:139896674
1053 1053 c, g dbSNP:780249365
1062 1062 c, t dbSNP:762759902
1063 1063 a, g dbSNP:184945579
1068 1068 a, g dbSNP:368750109
1069 1069 g, t dbSNP:761479086
1073 1073 c, t dbSNP:767517943
1074 1074 c, g dbSNP:143499301
1081 1081 c, g dbSNP:759679533
1085 1085 a, g dbSNP:765237837
1087 1087 c, t dbSNP:200740071
1091 1091 c, t dbSNP:758679423
1092 1092 a, g dbSNP:777951142
1099 1099 c, t dbSNP:371514699
1103 1103 a, g dbSNP:757523656
1104 1104 g, t dbSNP:781728966
1118 1118 c, t dbSNP:746292760
1119 1119 a, g dbSNP:200179967
1120 1120 c, t dbSNP:779767448
1121 1121 c, t dbSNP:748782653
1122 1122 a, g dbSNP:146264359
1128 1128 c, t dbSNP:1043461
1131 1131 c, g, t dbSNP:747651554
1132 1132 a, g dbSNP:771711120
1138 1138 a, g dbSNP:367543496
1145 1145 a, g dbSNP:372337584
1147 1147 a, g dbSNP:766293910
1150 1150 a, g dbSNP:775598320
1152 1152 c, t dbSNP:376709985
1153 1153 a, g dbSNP:764331609
1159 1159 c, t dbSNP:751683687
1160 1160 a, g dbSNP:757644956
1164 1164 c, t dbSNP:764504521
1165 1165 a, g, t dbSNP:750784979
1172 1172 c, t dbSNP:780673652
1174 1174 a, g dbSNP:369747444
1176 1176 c, t dbSNP:139130382
1182 1182 c, t dbSNP:142506263
1185 1185 c, t dbSNP:747693977
1187 1187 c, t dbSNP:397514664
1192 1192 c, g dbSNP:771754782
1218 1218 c, t dbSNP:202236798
1224 1224 a, g dbSNP:746800397
1226 1226 a, g dbSNP:201539068
1234 1234 c, t dbSNP:776512547
1235 1235 a, g dbSNP:763043311
1241 1241 c, t dbSNP:201320326
1242 1242 a, g dbSNP:774484799
1247 1247 c, t dbSNP:761997651
1251 1251 c, t dbSNP:142055640
1252 1252 a, g dbSNP:750791263
1253 1253 a, g dbSNP:756503895
1254 1254 a, g, t dbSNP:377403217
1262 1262 c, t dbSNP:369125661
1263 1263 a, g dbSNP:150970251
1268 1268 a, c, t dbSNP:199686378
1269 1269 a, g dbSNP:140779623
1281 1281 c, t dbSNP:746304511
1282 1282 a, g dbSNP:770664323
1290 1290 c, t dbSNP:149682423
1291 1291 a, g dbSNP:745871660
1296 1296 c, t dbSNP:769705901
1297 1297 a, g dbSNP:200789047
1306 1306 g, t dbSNP:774342727
1307 1307 c, t dbSNP:761919591
1308 1308 c, g dbSNP:772212144
1311 1311 c, t dbSNP:377461570
1312 1312 a, g dbSNP:761131376
1320 1320 a, g dbSNP:766778722
1324 1324 c, t dbSNP:121908661
1325 1325 a, g dbSNP:770223547
1326 1326 a, c dbSNP:760182519
1335 1335 c, t dbSNP:765756341
1341 1341 c, t dbSNP:145362529
1342 1342 a, g dbSNP:757888034
1346 1346 c, t dbSNP:777314081
1347 1347 a, g dbSNP:751156557
1352 1352 c, t dbSNP:370901051
1353 1353 a, g dbSNP:374322550
1358 1358 a, g dbSNP:201547952
1360 1360 a, g dbSNP:201779301
1362 1362 a, c, t dbSNP:745638620
1363 1363 a, g dbSNP:376152274
1370 1370 c, t dbSNP:200416179
1371 1371 a, g dbSNP:142511038
1372 1372 c, t dbSNP:80358308
1373 1373 a, g dbSNP:761049544
1379 1379 a, g dbSNP:771268909
1380 1380 c, t dbSNP:777187538
1388 1388 c, g dbSNP:759951621
1390 1390 c, t dbSNP:765695793
1398 1398 -, c dbSNP:767723514
1399 1399 c, t dbSNP:12364012
1402 1402 a, g dbSNP:373910016
1407 1407 a, g dbSNP:146912729
1416 1416 a, g dbSNP:763594374
1419 1419 c, t dbSNP:367873767
1427 1427 a, g dbSNP:756952499
1428 1428 a, g dbSNP:767124237
1429 1429 -, c dbSNP:34216038
1434 1434 c, t dbSNP:569443429
1435 1435 a, g dbSNP:755886863
1437 1437 a, c, g dbSNP:200075657
1443 1443 a, c, t dbSNP:113518978
1446 1446 c, t dbSNP:747067664
1447 1447 a, g dbSNP:771321752
1450 1450 a, t dbSNP:776956543
1470 1470 a, g dbSNP:769905219
1495 1495 g, t dbSNP:121908666
1499 1499 g, t dbSNP:775971156
1503 1503 c, t dbSNP:267603151
1513 1513 a, g dbSNP:749584413
1523 1523 a, g dbSNP:121908664
1526 1526 a, g dbSNP:200409162
1534 1534 g, t dbSNP:766493225
1536 1536 c, g, t dbSNP:774790391
1538 1538 a, g dbSNP:150771999
1544 1544 c, t dbSNP:145897519
1548 1548 a, c dbSNP:772589056
1549 1549 a, g dbSNP:766988509
1554 1554 a, g dbSNP:545508982
1557 1557 c, g dbSNP:557805230
1560 1560 a, c, t dbSNP:148073961
1561 1561 a, g dbSNP:765290711
1567 1567 -, c dbSNP:756479857
1570 1570 c, g dbSNP:752625747
1578 1578 c, g dbSNP:757418771
1602 1602 a, c dbSNP:781489196
1605 1605 c, t dbSNP:750457614
1606 1606 a, g dbSNP:80358309
1608 1608 a, c dbSNP:756398181
1623 1623 c, t dbSNP:780098863
1624 1624 a, g dbSNP:749683290
1635 1635 c, t dbSNP:748487092
1646 1646 c, t dbSNP:80358310
1647 1647 a, g dbSNP:141896162
1649 1649 a, c dbSNP:746554984
1650 1650 a, g dbSNP:150209973
1654 1654 c, t dbSNP:770292689
1655 1655 a, g dbSNP:138692892
1657 1657 a, g dbSNP:759331617
1666 1666 a, g dbSNP:769557748
1669 1669 a, g dbSNP:566952681
1671 1671 c, t dbSNP:761424454
1675 1675 a, c dbSNP:762794790
1677 1677 c, t dbSNP:764112300
1678 1678 c, t dbSNP:774097621
1680 1680 a, g dbSNP:774083040
1684 1684 a, g dbSNP:201576246
1689 1689 c, t dbSNP:545382
1690 1690 a, g dbSNP:80358311
1697 1697 c, t dbSNP:397514663
1698 1698 a, g dbSNP:146285115
1704 1704 a, g, t dbSNP:184457951
1707 1707 a, g dbSNP:778361337
1708 1708 c, g dbSNP:747408714
1719 1719 c, t dbSNP:757777983
1722 1722 g, t dbSNP:377144001
1725 1725 c, t dbSNP:139408531
1735 1735 a, c, t dbSNP:745350421
1738 1738 c, t dbSNP:775233316
1739 1739 a, g dbSNP:587783024
1746 1746 c, t dbSNP:200627198
1747 1747 a, c, g dbSNP:768268948
1749 1749 a, g dbSNP:199707305
1750 1750 c, t dbSNP:121908665
1751 1751 a, g dbSNP:80358312
1755 1755 a, g dbSNP:767464846
1763 1763 a, t dbSNP:776728388
1766 1766 a, g dbSNP:574974332
1774 1774 c, t dbSNP:765468063
1775 1775 c, g dbSNP:752862568
1779 1779 c, t dbSNP:758798637
1780 1780 a, g dbSNP:149524398
1800 1800 c, t dbSNP:751940504
1803 1803 c, t dbSNP:757754971
1827 1827 c, t dbSNP:781756147
1829 1829 g, t dbSNP:745391397
1834 1834 -, t dbSNP:757860805
1839 1839 c, t dbSNP:554437931
1840 1840 a, g dbSNP:143878170
1842 1842 c, t dbSNP:200800275
1843 1843 a, g dbSNP:576436176
1853 1853 c, t dbSNP:774574205
1854 1854 a, g dbSNP:200163787
1858 1858 a, g dbSNP:768061512
1859 1859 c, t dbSNP:750804004
1860 1860 a, c, g dbSNP:148603249
1862 1862 a, g dbSNP:753317134
1865 1865 a, g dbSNP:754464622
1869 1869 c, t dbSNP:778446537
1870 1870 a, c, g, t dbSNP:80358313
1875 1875 a, g dbSNP:142126662
1891 1891 g, t dbSNP:367619965
1892 1892 g, t dbSNP:80358314
1893 1893 c, t dbSNP:746784651
1904 1904 a, g dbSNP:567426021
1905 1905 c, t dbSNP:781145030
1906 1906 c, g dbSNP:147792724
1909 1909 a, t dbSNP:768712336
1910 1910 c, g dbSNP:774289856
1913 1913 a, g, t dbSNP:748460105
1920 1920 c, g dbSNP:371269062
1923 1923 c, g dbSNP:773747650
1929 1929 a, c, t dbSNP:140958524
1930 1930 a, g dbSNP:777141177
1954 1954 a, g dbSNP:758976409
1956 1956 g, t dbSNP:368392203
1965 1965 c, t dbSNP:17848264
1966 1966 a, g dbSNP:371615673
1974 1974 a, g dbSNP:2277268
1980 1980 c, g dbSNP:751387901
1990 1990 a, g dbSNP:756999448
1994 1994 a, g dbSNP:780994858
1998 1998 a, g dbSNP:745882899
2001 2001 a, c, t dbSNP:755991257
2002 2002 a, g, t dbSNP:747131775
2005 2005 a, g dbSNP:773516415
2010 2010 c, t dbSNP:144847027
2016 2016 a, c dbSNP:771264031
2022 2022 c, t dbSNP:140604679
2032 2032 -, aac dbSNP:780882911
2034 2034 c, t dbSNP:760151423
2037 2037 c, t dbSNP:150471658
2038 2038 a, g dbSNP:180941579
2040 2040 c, t dbSNP:762411916
2041 2041 a, c, g dbSNP:4988321
2045 2045 c, t dbSNP:149130784
2051 2051 c, t dbSNP:201207267
2052 2052 a, g dbSNP:143304197
2057 2057 c, t dbSNP:575865236
2058 2058 a, g dbSNP:375853556
2061 2061 c, t dbSNP:779811816
2062 2062 a, g dbSNP:543279405
2064 2064 c, t dbSNP:748257457
2066 2066 a, g dbSNP:758492536
2070 2070 c, g dbSNP:778147505
2088 2088 c, t dbSNP:61740517
2094 2094 g, t dbSNP:771048928
2098 2098 a, g dbSNP:781660447
2099 2099 a, g dbSNP:746188108
2121 2121 c, t dbSNP:770364888
2122 2122 a, g dbSNP:141796804
2128 2128 c, g dbSNP:541165691
2144 2144 a, g dbSNP:145008551
2145 2145 c, t dbSNP:761184187
2146 2146 a, g dbSNP:771775019
2149 2149 g, t dbSNP:772679034
2157 2157 c, t dbSNP:145456776
2165 2165 c, t dbSNP:532035027
2166 2166 a, g dbSNP:140977837
2175 2175 c, t dbSNP:33958013
2176 2176 a, g dbSNP:765239493
2179 2179 c, g dbSNP:751720886
2181 2181 a, g dbSNP:34369535
2184 2184 a, g dbSNP:201973717
2193 2193 -, t dbSNP:121908662
2198 2198 a, g dbSNP:750547007
2199 2199 c, t dbSNP:749139386
2213 2213 c, t dbSNP:376671764
2214 2214 c, t dbSNP:780444299
2215 2215 a, g dbSNP:769035778
2217 2217 c, t dbSNP:200570645
2223 2223 g, t dbSNP:779339888
2224 2224 a, t dbSNP:149241739
2232 2232 c, g dbSNP:771414728
2235 2235 c, t dbSNP:147388442
2239 2239 c, t dbSNP:746701187
2244 2244 a, g dbSNP:121908667
2247 2247 c, g dbSNP:770688294
2248 2248 a, g dbSNP:776613004
2250 2250 c, t dbSNP:35298380
2262 2262 c, t dbSNP:2306862
2268 2268 c, t dbSNP:147932332
2275 2275 g, t dbSNP:761958436
2276 2276 c, t dbSNP:148550774
2277 2277 a, g dbSNP:750492852
2278 2278 c, t dbSNP:201916993
2279 2279 a, g dbSNP:766548006
2284 2284 a, g dbSNP:576718732
2285 2285 a, t dbSNP:544505368
2286 2286 c, t dbSNP:142986090
2296 2296 c, g dbSNP:121908674
2297 2297 a, g dbSNP:776542904
2302 2302 a, g dbSNP:755274667
2308 2308 a, g, t dbSNP:138777930
2325 2325 c, g dbSNP:151110465
2331 2331 a, g dbSNP:372734142
2337 2337 a, c, g, t dbSNP:140955013
2344 2344 c, g dbSNP:80358315
2350 2350 c, g dbSNP:745674892
2358 2358 a, g dbSNP:769649663
2359 2359 a, g dbSNP:775353605
2366 2366 c, t dbSNP:144983823
2368 2368 c, t dbSNP:759805400
2373 2373 g, t dbSNP:557686671
2376 2376 c, g, t dbSNP:753035383
2377 2377 a, g dbSNP:764526918
2383 2383 a, g dbSNP:569787963
2384 2384 a, g dbSNP:752049489
2385 2385 c, t dbSNP:757838059
2386 2386 a, g dbSNP:537161896
2393 2393 c, t dbSNP:749919151
2394 2394 a, g dbSNP:755749782
2400 2400 a, c, g, t dbSNP:140616444
2401 2401 a, g, t dbSNP:778567335
2405 2405 a, g dbSNP:771972596
2414 2414 c, t dbSNP:776734260
2418 2418 c, t dbSNP:759574283
2426 2426 a, g dbSNP:368485424
2431 2431 a, g dbSNP:775727748
2432 2432 a, t dbSNP:763236037
2434 2434 a, g dbSNP:80358316
2435 2435 c, t dbSNP:371155552
2436 2436 a, g dbSNP:762447750
2439 2439 g, t dbSNP:768094405
2441 2441 c, t dbSNP:749972187
2446 2446 a, g dbSNP:755589464
2455 2455 c, t dbSNP:765952535
2456 2456 a, g dbSNP:565245995
2463 2463 a, c, t dbSNP:138051657
2464 2464 a, g dbSNP:754571473
2470 2470 a, g dbSNP:778726416
2472 2472 c, t dbSNP:747908467
2473 2473 a, g dbSNP:758364834
2482 2482 a, g dbSNP:573746993
2485 2485 a, g dbSNP:200483542
2487 2487 c, t dbSNP:149080536
2491 2491 c, t dbSNP:775431782
2505 2505 c, t dbSNP:778180589
2509 2509 c, t dbSNP:768741253
2516 2516 c, g dbSNP:774885857
2521 2521 a, c dbSNP:762216902
2526 2526 c, t dbSNP:577932894
2527 2527 c, g dbSNP:773784389
2529 2529 c, g dbSNP:770370415
2530 2530 a, t dbSNP:761081986
2532 2532 a, g dbSNP:765971625
2537 2537 a, g dbSNP:545636414
2542 2542 c, t dbSNP:747324802
2554 2554 c, t dbSNP:762593049
2555 2555 a, g dbSNP:559129140
2559 2559 c, t dbSNP:375223225
2560 2560 a, g dbSNP:757262154
2568 2568 c, t dbSNP:780939776
2571 2571 a, c, t dbSNP:143204891
2577 2577 c, g dbSNP:779128276
2580 2580 a, g, t dbSNP:748439020
2586 2586 a, g, t dbSNP:148271293
2589 2589 c, t dbSNP:771492871
2590 2590 a, g dbSNP:776947784
2592 2592 c, t dbSNP:759051327
2598 2598 a, g dbSNP:769361598
2599 2599 c, t dbSNP:121908663
2604 2604 c, t dbSNP:774970595
2608 2608 a, g dbSNP:575222684
2612 2612 a, g dbSNP:762646007
2616 2616 c, t dbSNP:140411171
2628 2628 c, t dbSNP:751390139
2632 2632 a, t dbSNP:761455808
2637 2637 g, t dbSNP:200079431
2642 2642 a, g, t dbSNP:750390421
2650 2650 -, g dbSNP:762823842
2650 2650 c, t dbSNP:769188092
2651 2651 a, g dbSNP:774814837
2652 2652 g, t dbSNP:554108619
2653 2653 g, t dbSNP:758724530
2655 2655 c, t dbSNP:375529792
2656 2656 a, g dbSNP:747416148
2658 2658 c, g dbSNP:771134762
2670 2670 a, c dbSNP:781616623
2671 2671 c, t dbSNP:200501120
2672 2672 a, g dbSNP:770267716
2673 2673 a, g dbSNP:369900147
2677 2677 c, t dbSNP:750804153
2679 2679 c, t dbSNP:141174027
2681 2681 c, t dbSNP:768364811
2688 2688 c, g dbSNP:147352603
2695 2695 c, t dbSNP:756487767
2706 2706 c, t dbSNP:373351312
2707 2707 -, gt dbSNP:770862328
2718 2718 a, c dbSNP:761518661
2719 2719 c, t dbSNP:767270901
2731 2731 c, t dbSNP:773036756
2737 2737 c, t dbSNP:760734426
2749 2749 c, t dbSNP:766376965
2753 2753 a, g dbSNP:752844724
2755 2755 a, g dbSNP:758494958
2761 2761 a, g dbSNP:137861541
2762 2762 c, t dbSNP:751796016
2763 2763 a, g dbSNP:757489082
2766 2766 c, g dbSNP:143539498
2772 2772 a, c, t dbSNP:376944217
2790 2790 a, g dbSNP:780478829
2803 2803 c, t dbSNP:368736765
2805 2805 c, t dbSNP:147158768
2806 2806 a, g dbSNP:773895575
2808 2808 c, t dbSNP:139372523
2809 2809 a, g dbSNP:771724060
2813 2813 a, g dbSNP:773170628
2814 2814 c, t dbSNP:749482837
2815 2815 c, t dbSNP:369471051
2816 2816 a, g, t dbSNP:373466030
2820 2820 c, t dbSNP:759513973
2821 2821 a, g dbSNP:764138752
2826 2826 c, t dbSNP:369623848
2827 2827 a, g dbSNP:372374697
2835 2835 c, t dbSNP:767740919
2838 2838 c, t dbSNP:750812663
2839 2839 a, c, t dbSNP:756401189
2840 2840 c, t dbSNP:749848133
2842 2842 c, g dbSNP:755484892
2843 2843 c, t dbSNP:778326106
2845 2845 g, t dbSNP:747654722
2846 2846 a, c dbSNP:771643715
2851 2851 -, c dbSNP:150625922
2856 2856 c, t dbSNP:376937882
2857 2857 c, t dbSNP:746806229
2858 2858 a, g dbSNP:770919090
2862 2862 a, c dbSNP:369139308
2869 2869 c, t dbSNP:776554205
2870 2870 c, t dbSNP:773251794
2871 2871 a, g dbSNP:201018263
2879 2879 c, t dbSNP:201639368
2884 2884 c, t dbSNP:766546188
2886 2886 c, g dbSNP:370798399
2914 2914 a, c, t dbSNP:754174678
2915 2915 a, g dbSNP:765665314
2918 2918 c, t dbSNP:753313934
2924 2924 a, c, t dbSNP:189095829
2925 2925 a, g dbSNP:150031686
2928 2928 c, t dbSNP:144415767
2929 2929 a, g dbSNP:780945547
2937 2937 c, g dbSNP:745667609
2938 2938 a, c dbSNP:374891715
2942 2942 c, t dbSNP:780789533
2952 2952 c, t dbSNP:779697005
2956 2956 a, c dbSNP:749294674
2963 2963 a, c, g dbSNP:768546268
2976 2976 c, t dbSNP:747039844
2988 2988 c, t dbSNP:147716006
2989 2989 a, g dbSNP:776844865
2993 2993 a, g dbSNP:759674127
3001 3001 a, c, g dbSNP:61370283
3006 3006 c, t dbSNP:200117377
3015 3015 c, t dbSNP:764659105
3017 3017 a, g dbSNP:751139831
3021 3021 c, g dbSNP:756773762
3024 3024 a, g dbSNP:371528796
3032 3032 a, g dbSNP:750144525
3039 3039 c, t dbSNP:755696364
3047 3047 a, g dbSNP:779935967
3057 3057 c, t dbSNP:749039189
3058 3058 a, g, t dbSNP:147758521
3060 3060 c, t dbSNP:146792434
3061 3061 a, g dbSNP:771064776
3070 3070 c, t dbSNP:201793593
3084 3084 c, t dbSNP:762445774
3089 3089 c, t dbSNP:775499713
3095 3095 a, g dbSNP:373483389
3099 3099 c, t dbSNP:772416019
3111 3111 c, t dbSNP:772798522
3114 3114 g, t dbSNP:760044208
3117 3117 c, g dbSNP:766057993
3118 3118 c, t dbSNP:753554800
3119 3119 c, t dbSNP:201745746
3121 3121 c, t dbSNP:140482319
3133 3133 a, g, t dbSNP:377410080
3135 3135 c, t dbSNP:777524051
3136 3136 a, g dbSNP:750533610
3144 3144 c, t dbSNP:756084148
3148 3148 c, t dbSNP:780281215
3149 3149 a, g, t dbSNP:61889560
3153 3153 a, g dbSNP:779448157
3163 3163 a, t dbSNP:748409889
3165 3165 a, g dbSNP:368960282
3168 3168 c, t dbSNP:773523178
3175 3175 a, g dbSNP:761238994
3181 3181 a, g dbSNP:770404987
3188 3188 a, g dbSNP:776097279
3189 3189 c, t dbSNP:200247220
3190 3190 a, g dbSNP:577519439
3191 3191 a, t dbSNP:752513082
3198 3198 a, g dbSNP:199675099
3204 3204 c, t dbSNP:762600156
3206 3206 c, g dbSNP:764100421
3208 3208 a, g dbSNP:751521743
3210 3210 a, t dbSNP:757209267
3215 3215 -, g dbSNP:752933404
3215 3215 c, t dbSNP:763899883
3226 3226 c, t dbSNP:374077278
3227 3227 g, t dbSNP:773922004
3229 3229 c, t dbSNP:753926639
3230 3230 a, g dbSNP:755269989
3233 3233 a, g dbSNP:779216380
3237 3237 c, t dbSNP:748548185
3238 3238 c, t dbSNP:201285828
3240 3240 c, t dbSNP:370274326
3241 3241 a, g dbSNP:747518922
3255 3255 c, t dbSNP:771397740
3256 3256 a, g dbSNP:776150382
3258 3258 c, t dbSNP:200786182
3259 3259 a, g dbSNP:769451612
3261 3261 c, t dbSNP:774940861
3262 3262 a, g dbSNP:376914943
3266 3266 a, g dbSNP:763856228
3267 3267 c, t dbSNP:774177044
3268 3268 a, g dbSNP:368217689
3269 3269 c, t dbSNP:761682970
3270 3270 a, g, t dbSNP:767509386
3273 3273 c, g dbSNP:755040631
3274 3274 c, g dbSNP:765402802
3275 3275 a, g dbSNP:371323193
3279 3279 a, g dbSNP:760734436
3282 3282 c, t dbSNP:770861594
3287 3287 a, g dbSNP:113804402
3296 3296 a, g dbSNP:763033294
3298 3298 a, g dbSNP:145774832
3299 3299 c, t dbSNP:751848282
3306 3306 c, t dbSNP:762012801
3307 3307 c, t dbSNP:767922063
3308 3308 a, g dbSNP:373906355
3315 3315 c, t dbSNP:756632070
3319 3319 a, c dbSNP:780548194
3321 3321 c, g, t dbSNP:140852936
3325 3325 c, t dbSNP:201957991
3327 3327 c, t dbSNP:80038357
3328 3328 a, g dbSNP:189758820
3333 3333 c, t dbSNP:199822785
3339 3339 c, t dbSNP:17149104
3340 3340 a, g dbSNP:770787447
3345 3345 c, g, t dbSNP:776565930
3349 3349 c, t dbSNP:768840999
3350 3350 a, g dbSNP:566582167
3351 3351 c, t dbSNP:141446007
3352 3352 a, g dbSNP:767690779
3367 3367 a, g dbSNP:773575510
3369 3369 c, t dbSNP:565949158
3370 3370 a, g dbSNP:766646482
3374 3374 c, t dbSNP:754423729
3375 3375 c, t dbSNP:755416405
3378 3378 c, g dbSNP:558756869
3379 3379 c, t dbSNP:377258285
3380 3380 a, g dbSNP:758155077
3397 3397 g, t dbSNP:777500365
3399 3399 a, g dbSNP:556442
3403 3403 a, g dbSNP:80358317
3410 3410 c, t dbSNP:137928647
3421 3421 c, t dbSNP:556325422
3425 3425 a, g dbSNP:745855933
3432 3432 c, t dbSNP:769592327
3434 3434 c, t dbSNP:199960554
3435 3435 a, g dbSNP:542188388
3445 3445 c, t dbSNP:143396225
3446 3446 a, g, t dbSNP:560826688
3447 3447 c, t dbSNP:527947606
3449 3449 c, t dbSNP:776839535
3462 3462 a, c dbSNP:760112335
3463 3463 c, g dbSNP:765799138
3472 3472 a, g dbSNP:754889690
3478 3478 c, t dbSNP:367862196
3479 3479 a, g dbSNP:370086361
3485 3485 c, t dbSNP:771190332
3486 3486 a, c dbSNP:781214159
3488 3488 a, c, t dbSNP:200389686
3495 3495 c, t dbSNP:147175387
3501 3501 c, t dbSNP:763601638
3502 3502 a, g dbSNP:769234328
3510 3510 a, c, g dbSNP:724159825
3511 3511 c, t dbSNP:761157531
3517 3517 a, g dbSNP:767045610
3526 3526 a, g dbSNP:750114132
3529 3529 c, t dbSNP:562616743
3531 3531 g, t dbSNP:766214195
3533 3533 a, g dbSNP:753583068
3544 3544 c, t dbSNP:80358318
3552 3552 c, t dbSNP:529725269
3553 3553 a, g dbSNP:778649315
3557 3557 a, g dbSNP:751672886
3563 3563 a, c dbSNP:757337537
3564 3564 g, t dbSNP:368719679
3570 3570 a, g dbSNP:148217741
3573 3573 c, t dbSNP:763431606
3574 3574 a, g dbSNP:756379371
3577 3577 a, c, t dbSNP:780585577
3578 3578 a, g dbSNP:372697844
3580 3580 a, g dbSNP:186535471
3582 3582 a, g dbSNP:548336977
3589 3589 a, t dbSNP:748687344
3590 3590 a, c dbSNP:771525241
3594 3594 a, c, t dbSNP:764663599
3595 3595 a, g dbSNP:375557997
3598 3598 g, t dbSNP:776416009
3604 3604 c, g, t dbSNP:141178995
3605 3605 a, g dbSNP:559854587
3606 3606 a, g dbSNP:117289001
3610 3610 c, t dbSNP:767540992
3611 3611 a, g, t dbSNP:372205313
3623 3623 a, g dbSNP:201017887
3628 3628 a, g dbSNP:199887400
3640 3640 a, g dbSNP:749679949
3642 3642 c, t dbSNP:202207765
3648 3648 c, t dbSNP:779308864
3652 3652 c, g dbSNP:11607268
3657 3657 a, g dbSNP:748655416
3659 3659 a, g dbSNP:772584231
3679 3679 c, t dbSNP:772741983
3680 3680 c, t dbSNP:745554938
3683 3683 c, t dbSNP:769437751
3686 3686 a, c dbSNP:775175955
3696 3696 c, t dbSNP:780817068
3697 3697 c, t dbSNP:139847357
3698 3698 a, g dbSNP:143924910
3730 3730 g, t dbSNP:571212778
3737 3737 c, g dbSNP:761814285
3739 3739 a, g dbSNP:146388120
3744 3744 c, g dbSNP:753922833
3749 3749 c, t dbSNP:759711110
3751 3751 c, t dbSNP:771696099
3752 3752 a, g dbSNP:765434644
3762 3762 c, t dbSNP:753018792
3764 3764 c, t dbSNP:758855924
3765 3765 a, g dbSNP:139554243
3766 3766 a, g dbSNP:752100070
3768 3768 c, t dbSNP:201107260
3773 3773 a, t dbSNP:757737452
3774 3774 c, t dbSNP:556919142
3780 3780 c, t dbSNP:745339698
3786 3786 a, g dbSNP:769333963
3788 3788 a, g dbSNP:779694789
3792 3792 a, g dbSNP:748876053
3800 3800 g, t dbSNP:768615287
3807 3807 a, g dbSNP:549694807
3809 3809 c, g, t dbSNP:772149876
3810 3810 a, g dbSNP:746916192
3812 3812 c, t dbSNP:769957975
3816 3816 c, g dbSNP:567898028
3821 3821 c, t dbSNP:763184695
3824 3824 c, g, t dbSNP:764259701
3825 3825 a, g dbSNP:762105365
3835 3835 c, g dbSNP:201530801
3846 3846 -, a dbSNP:80358319
3855 3855 c, t dbSNP:751002704
3856 3856 a, g dbSNP:763407700
3859 3859 c, t dbSNP:756560110
3867 3867 c, t dbSNP:765940834
3868 3868 a, g dbSNP:370744430
3871 3871 g, t dbSNP:754686025
3878 3878 a, g, t dbSNP:145293239
3879 3879 c, t dbSNP:372930578
3880 3880 c, t dbSNP:758334950
3885 3885 c, t dbSNP:200373872
3886 3886 a, g dbSNP:747015625
3889 3889 c, t dbSNP:770724104
3894 3894 c, t dbSNP:144115017
3895 3895 a, g dbSNP:749297859
3900 3900 c, t dbSNP:768877066
3903 3903 c, t dbSNP:774612455
3905 3905 a, g dbSNP:762014835
3909 3909 c, g dbSNP:767961897
3912 3912 c, t dbSNP:749656764
3916 3916 a, g dbSNP:761279762
3918 3918 c, g dbSNP:766732438
3919 3919 a, g dbSNP:753416214
3921 3921 a, g dbSNP:759175453
3928 3928 c, g dbSNP:375935572
3930 3930 c, t dbSNP:752439831
3939 3939 c, t dbSNP:377145254
3940 3940 a, g dbSNP:565799629
3942 3942 c, t dbSNP:539506227
3943 3943 a, g dbSNP:149166384
3948 3948 g, t dbSNP:780929844
3952 3952 c, t dbSNP:745787785
3953 3953 c, t dbSNP:569632869
3957 3957 c, t dbSNP:778930556
3958 3958 a, g dbSNP:748395267
3959 3959 a, c, t dbSNP:772148405
3960 3960 a, g, t dbSNP:11574425
3961 3961 c, t dbSNP:370347973
3962 3962 a, g dbSNP:760090713
3964 3964 a, g dbSNP:764890075
3967 3967 c, t dbSNP:752204698
3979 3979 c, t dbSNP:762695831
3982 3982 c, t dbSNP:373750800
3983 3983 a, g dbSNP:751382262
3985 3985 c, t dbSNP:151200211
3988 3988 c, t dbSNP:768904962
3989 3989 a, g dbSNP:780957124
3993 3993 c, t dbSNP:141306017
3994 3994 a, g dbSNP:541726127
3996 3996 c, t dbSNP:201352823
3999 3999 c, t dbSNP:778998196
4000 4000 a, g dbSNP:748162115
4005 4005 a, c dbSNP:772355850
4010 4010 c, g dbSNP:777918830
4013 4013 a, g dbSNP:747250870
4019 4019 a, g dbSNP:368985815
4020 4020 a, c dbSNP:777115982
4026 4026 a, c, t dbSNP:555253491
4027 4027 a, g dbSNP:775143370
4029 4029 a, c, g dbSNP:762312251
4031 4031 c, t dbSNP:3736228
4032 4032 a, g dbSNP:147637431
4041 4041 c, t dbSNP:767345487
4042 4042 a, g dbSNP:750182264
4053 4053 a, g dbSNP:764105501
4058 4058 a, g dbSNP:142001526
4066 4066 c, t dbSNP:568426341
4067 4067 a, c, g, t dbSNP:150088620
4071 4071 c, t dbSNP:138359428
4074 4074 a, g dbSNP:749805373
4075 4075 a, c dbSNP:572540297
4077 4077 c, t dbSNP:773741784
4078 4078 a, g dbSNP:747638441
4085 4085 a, g dbSNP:149275252
4091 4091 g, t dbSNP:531205284
4093 4093 a, g dbSNP:769778086
4103 4103 a, g dbSNP:772918826
4104 4104 a, g dbSNP:558375186
4107 4107 c, t dbSNP:770762272
4110 4110 c, t dbSNP:367555198
4117 4117 c, g dbSNP:759424621
4119 4119 c, t dbSNP:143482432
4120 4120 a, g dbSNP:751601938
4123 4123 g, t dbSNP:80358320
4126 4126 a, g dbSNP:767699531
4128 4128 c, t dbSNP:544242555
4129 4129 a, g dbSNP:756378949
4131 4131 c, t dbSNP:3736229
4132 4132 a, g dbSNP:146404570
4137 4137 c, t dbSNP:199576767
4138 4138 a, g dbSNP:779534615
4139 4139 a, g dbSNP:748653025
4140 4140 c, t dbSNP:771614628
4141 4141 a, g dbSNP:28939709
4147 4147 -, at dbSNP:769348608
4148 4148 c, t dbSNP:746686714
4149 4149 a, g dbSNP:770579331
4157 4157 c, t dbSNP:769670788
4158 4158 c, g dbSNP:775399508
4161 4161 -, c dbSNP:80358321
4166 4166 c, t dbSNP:749257270
4167 4167 a, g dbSNP:768672207
4171 4171 c, t dbSNP:773426857
4176 4176 c, t dbSNP:375358365
4179 4179 c, t dbSNP:139755343
4184 4184 c, t dbSNP:369637767
4185 4185 a, g dbSNP:759659671
4190 4190 a, c dbSNP:765656433
4198 4198 a, g dbSNP:547456980
4203 4203 a, c, t dbSNP:565597015
4204 4204 a, g dbSNP:143015732
4207 4207 c, t dbSNP:756857023
4209 4209 c, t dbSNP:780535389
4210 4210 a, g dbSNP:745582449
4224 4224 c, t dbSNP:755669785
4234 4234 g, t dbSNP:780023025
4235 4235 c, t dbSNP:749021748
4236 4236 c, t dbSNP:150618161
4237 4237 a, g dbSNP:113315676
4242 4242 c, g dbSNP:748007622
4243 4243 a, g dbSNP:200552541
4248 4248 c, t dbSNP:771096362
4251 4251 c, g dbSNP:147671915
4267 4267 c, t dbSNP:759834541
4268 4268 a, g, t dbSNP:765378705
4269 4269 c, t dbSNP:536928726
4270 4270 a, g dbSNP:200121061
4272 4272 c, g dbSNP:752100031
4278 4278 c, t dbSNP:750573655
4282 4282 a, c dbSNP:757683069
4283 4283 a, g dbSNP:573492210
4289 4289 c, t dbSNP:376164225
4290 4290 a, g dbSNP:17848257
4293 4293 a, g dbSNP:553437373
4298 4298 a, g dbSNP:145750689
4299 4299 c, t dbSNP:201374967
4300 4300 a, g dbSNP:778832210
4310 4310 c, t dbSNP:748143518
4311 4311 a, g dbSNP:139701701
4313 4313 a, c dbSNP:578011670
4314 4314 c, t dbSNP:145226802
4320 4320 c, t dbSNP:142328132
4326 4326 a, c, t dbSNP:563657853
4327 4327 a, g dbSNP:201210158
4328 4328 c, g dbSNP:763129542
4330 4330 a, t dbSNP:543337222
4334 4334 c, t dbSNP:561503730
4335 4335 a, g dbSNP:142283161
4338 4338 c, t dbSNP:372446875
4339 4339 a, g, t dbSNP:199871539
4359 4359 c, t dbSNP:760317428
4361 4361 c, t dbSNP:528693139
4362 4362 a, g dbSNP:753598091
4365 4365 c, t dbSNP:754632907
4366 4366 a, g dbSNP:778882996
4374 4374 a, g dbSNP:752368811
4379 4379 g, t dbSNP:143166423
4380 4380 c, t dbSNP:777631951
4382 4382 c, g dbSNP:746960230
4387 4387 a, c dbSNP:546852998
4395 4395 c, t dbSNP:151148660
4396 4396 a, g dbSNP:780134568
4397 4397 a, c dbSNP:377023192
4401 4401 c, t dbSNP:755205426
4404 4404 a, c dbSNP:779060093
4408 4408 c, t dbSNP:748395047
4422 4422 c, t dbSNP:11574420
4423 4423 a, g dbSNP:563067310
4433 4433 c, t dbSNP:113007633
4435 4435 c, g dbSNP:771501940
4441 4441 c, t dbSNP:368049854
4442 4442 a, g dbSNP:150332207
4444 4444 a, g dbSNP:764802790
4446 4446 c, t dbSNP:775042995
4447 4447 a, g dbSNP:188909481
4449 4449 a, g dbSNP:763815058
4455 4455 c, g dbSNP:751311955
4461 4461 c, t dbSNP:757191543
4465 4465 c, g, t dbSNP:767384132
4466 4466 a, g dbSNP:755077399
4471 4471 a, c dbSNP:779029955
4473 4473 c, t dbSNP:11574426
4474 4474 a, g dbSNP:758606794
4487 4487 c, t dbSNP:778004788
4488 4488 a, c, g dbSNP:142191419
4496 4496 c, g dbSNP:546569008
4500 4500 a, g, t dbSNP:75571306
4502 4502 c, g dbSNP:775012025
4503 4503 c, g dbSNP:762541197
4508 4508 c, t dbSNP:376584791
4509 4509 a, g dbSNP:774145162
4510 4510 a, c dbSNP:761653252
4517 4517 c, t dbSNP:767294114
4518 4518 a, g dbSNP:550766311
4522 4522 c, t dbSNP:760613534
4523 4523 a, c dbSNP:765265038
4526 4526 c, t dbSNP:752755797
4527 4527 a, g dbSNP:569410686
4529 4529 c, t dbSNP:778202459
4532 4532 a, g dbSNP:760534684
4536 4536 c, t dbSNP:766283180
4538 4538 a, g dbSNP:756434028
4549 4549 a, g dbSNP:780297107
4550 4550 c, t dbSNP:753711010
4578 4578 c, t dbSNP:749506407
4624 4624 c, t dbSNP:763163717
4625 4625 a, g dbSNP:764241848
4652 4652 a, g dbSNP:747832451
4653 4653 c, t dbSNP:771647377
4656 4656 a, g dbSNP:773004799
4659 4659 a, g dbSNP:760580570
4667 4667 c, t dbSNP:201475647
4668 4668 a, g dbSNP:776673862
4673 4673 c, t dbSNP:371173423
4674 4674 a, g dbSNP:764288902
4681 4681 -, c dbSNP:34310730
4684 4684 c, g, t dbSNP:774530181
4704 4704 a, c dbSNP:767785450
4706 4706 a, g dbSNP:201030241
4720 4720 a, c dbSNP:558768735
4721 4721 c, t dbSNP:200624778
4722 4722 a, g dbSNP:368178411
4723 4723 g, t dbSNP:757841896
4725 4725 c, t dbSNP:755440252
4730 4730 c, t dbSNP:1127291
4734 4734 a, g dbSNP:747600102
4735 4735 a, c, t dbSNP:757890963
4736 4736 c, t dbSNP:80291963
4737 4737 a, g dbSNP:770810556
4738 4738 a, t dbSNP:776243782
4743 4743 c, g dbSNP:724159826
4756 4756 c, g, t dbSNP:149645175
4757 4757 a, g dbSNP:372941344
4758 4758 a, t dbSNP:759961020
4765 4765 a, g dbSNP:144376510
4766 4766 c, t dbSNP:753256748
4767 4767 a, g dbSNP:763403461
4769 4769 c, g dbSNP:377147274
4772 4772 c, t dbSNP:148725079
4775 4775 c, t dbSNP:141407040
4776 4776 a, g dbSNP:369181184
4778 4778 c, g, t dbSNP:150862227
4779 4779 a, g dbSNP:139974816
4791 4791 c, t dbSNP:145406397
4792 4792 a, g dbSNP:768436809
4794 4794 c, t dbSNP:777923928
4799 4799 g, t dbSNP:147618989
4801 4801 c, g dbSNP:771039237
4806 4806 c, t dbSNP:776879888
4807 4807 a, g dbSNP:724159827
4815 4815 c, g, t dbSNP:112415702
4816 4816 a, c, g dbSNP:770169409
4822 4822 c, t dbSNP:140474222
4823 4823 a, g dbSNP:764447598
4829 4829 a, g dbSNP:752089268
4841 4841 a, g dbSNP:761292600
4843 4843 a, t dbSNP:767021396
4845 4845 c, t dbSNP:149752460
4859 4859 c, t dbSNP:755776774
4860 4860 a, g dbSNP:145608758
4865 4865 c, t dbSNP:753630884
4868 4868 -, c dbSNP:762251780
4869 4869 a, c dbSNP:754790936
4870 4870 c, t dbSNP:778783757
4876 4876 c, g dbSNP:748088266
4884 4884 a, c dbSNP:201603736
4885 4885 c, g dbSNP:770969117
4890 4890 a, g dbSNP:781203252
4895 4895 a, c dbSNP:533589947
4898 4898 g, t dbSNP:769940068
4902 4902 c, g dbSNP:775843550
4909 4909 c, t dbSNP:749670287
4910 4910 c, t dbSNP:377323023
4911 4911 a, g dbSNP:545586907
4912 4912 a, g dbSNP:762358421
4913 4913 c, t dbSNP:767157733
4914 4914 a, g dbSNP:772806499
4925 4925 g, t dbSNP:760407382
4928 4928 c, t dbSNP:766194797
4930 4930 c, t dbSNP:753526343
4933 4933 c, t dbSNP:754769760
4935 4935 a, g dbSNP:765060834
4938 4938 c, t dbSNP:752602099
4939 4939 a, g dbSNP:371285818
4944 4944 c, g, t dbSNP:113442867
4945 4945 a, c, g dbSNP:756170312
4946 4946 a, t dbSNP:749491802
4947 4947 c, g dbSNP:142508112
4969 4969 c, t dbSNP:774727824
4970 4970 c, t dbSNP:748634726
4971 4971 a, g dbSNP:772640505
4977 4977 a, c, t dbSNP:773843568
4992 4992 a, g dbSNP:765958012
4993 4993 a, g dbSNP:776196884
5006 5006 c, g dbSNP:759182457
5008 5008 c, t dbSNP:374104266
5009 5009 a, g dbSNP:367962345
5012 5012 c, t dbSNP:758348649
5013 5013 a, g dbSNP:371493435
5020 5020 a, t dbSNP:751489947
5027 5027 c, t dbSNP:756223471
5030 5030 c, g dbSNP:780083222
5031 5031 -, tg dbSNP:765743789
5032 5032 a, g dbSNP:749492623
5039 5039 c, t dbSNP:755186285
5042 5042 a, c, g dbSNP:766714137
5066 5066 -, a dbSNP:534015557
5088 5088 a, g dbSNP:546035270
5108 5108 a, c, g dbSNP:116937625

Target ORF information:

RefSeq Version XM_011545029
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu45334
Accession Version XM_005273994.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4962bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product low-density lipoprotein receptor-related protein 5 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167190.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530396779. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)210..>608(+)
Misc Feature(2)216..287(+)
Misc Feature(3)294..413(+)
Misc Feature(4)405..527(+)
Misc Feature(5)420..545(+)
Misc Feature(6)555..608(+)
Misc Feature(7)588..710(+)
Misc Feature(8)660..788(+)
Misc Feature(9)843..959(+)
Misc Feature(10)996..1109(+)
Misc Feature(11)1197..1319(+)
Misc Feature(12)1323..1451(+)
Misc Feature(13)1512..1634(+)
Misc Feature(14)1584..1712(+)
Misc Feature(15)1713..1814(+)
Misc Feature(16)1914..2021(+)
Misc Feature(17)2154..2735(+)
Misc Feature(18)2157..2237(+)
Misc Feature(19)2229..2357(+)
Misc Feature(20)2259..2369(+)
Misc Feature(21)2388..2507(+)
Misc Feature(22)2523..2612(+)
Misc Feature(23)2640..2714(+)
Misc Feature(24)2817..2924(+)
Misc Feature(25)3009..3128(+)
Misc Feature(26)3279..3410(+)
Misc Feature(27)3411..3539(+)
Misc Feature(28)3750..3860(+)
Misc Feature(29)3876..3986(+)
Misc Feature(30)3891..3959(+)
Misc Feature(31)3933..3977(+)
Misc Feature(32)3963..3977(+)
Misc Feature(33)3993..4097(+)
Misc Feature(34)4008..4070(+)
Misc Feature(35)4044..4088(+)
Misc Feature(36)4074..4088(+)
Misc Feature(37)4107..4211(+)
Misc Feature(38)4122..4184(+)
Misc Feature(39)4158..4202(+)
Misc Feature(40)4188..4202(+)
Position Chain Variation Link
4 4 c, g dbSNP:551018389
81 81 -, c dbSNP:763941232
117 117 a, c dbSNP:771718186
130 130 a, g dbSNP:121908660
133 133 -, gct, gctgct, gctgctgct dbSNP:564221347
134 134 -, gct dbSNP:761595196
135 135 (ctg)6, 10, 11, 7, 8, 9 dbSNP:72555376
153 153 c, t dbSNP:777352225
159 159 -, ctg dbSNP:794726904
171 171 g, t dbSNP:746511983
196 196 c, t dbSNP:755388709
197 197 a, g dbSNP:202039395
199 199 c, t dbSNP:753259758
200 200 a, g, t dbSNP:375594120
201 201 c, t dbSNP:118154213
215 215 c, t dbSNP:368373906
217 217 a, g dbSNP:770308939
219 219 c, t dbSNP:780921829
222 222 c, t dbSNP:745454417
223 223 a, g dbSNP:573768844
227 227 c, t dbSNP:573589930
228 228 a, g dbSNP:775334774
230 230 a, t dbSNP:144719110
231 231 c, t dbSNP:371690402
232 232 a, g dbSNP:774243312
238 238 g, t dbSNP:760837106
242 242 c, t dbSNP:375980894
245 245 c, t dbSNP:776920568
246 246 a, g dbSNP:759606638
249 249 a, g dbSNP:558895370
252 252 a, g dbSNP:753169711
257 257 g, t dbSNP:758810766
263 263 c, g dbSNP:764736624
265 265 c, t dbSNP:148462220
266 266 c, t dbSNP:756806068
272 272 c, t dbSNP:543962342
281 281 c, t dbSNP:533073394
282 282 a, g dbSNP:757930323
296 296 a, g dbSNP:779662838
299 299 c, t dbSNP:763664158
300 300 a, g dbSNP:544861971
302 302 a, c, g dbSNP:540291726
305 305 a, g dbSNP:747974546
311 311 c, t dbSNP:771043544
313 313 a, g dbSNP:142607308
320 320 c, t dbSNP:759675214
321 321 a, g dbSNP:765603774
329 329 c, t dbSNP:564857130
330 330 a, g dbSNP:763434689
333 333 a, t dbSNP:764497512
344 344 c, t dbSNP:752111903
350 350 c, t dbSNP:375802434
351 351 a, c, g dbSNP:201119420
353 353 a, c, g dbSNP:755593193
362 362 c, t dbSNP:748887818
364 364 a, g dbSNP:78219242
367 367 a, g dbSNP:41494349
369 369 a, g dbSNP:747967502
384 384 a, c dbSNP:771960523
385 385 c, t dbSNP:777743208
386 386 a, g dbSNP:745983270
391 391 c, t dbSNP:143433231
392 392 c, t dbSNP:146667935
395 395 c, t dbSNP:763203475
396 396 a, g dbSNP:768918663
404 404 c, t dbSNP:372860842
405 405 a, g dbSNP:140216273
416 416 c, t dbSNP:767954187
422 422 c, g dbSNP:750905217
425 425 c, g dbSNP:11574419
431 431 c, t dbSNP:760197742
434 434 c, t dbSNP:765814871
440 440 c, t dbSNP:753488677
446 446 c, t dbSNP:144053326
447 447 g, t dbSNP:778613031
449 449 c, t dbSNP:747826647
459 459 a, g dbSNP:752483392
461 461 a, g dbSNP:758180204
464 464 a, g dbSNP:777601488
465 465 c, g dbSNP:144939255
467 467 a, g dbSNP:746886033
475 475 c, t dbSNP:770000425
476 476 a, g, t dbSNP:780348578
485 485 a, g dbSNP:138651503
486 486 a, t dbSNP:774605136
487 487 a, c dbSNP:762118228
492 492 c, t dbSNP:368250404
493 493 a, g dbSNP:773718615
497 497 c, t dbSNP:761101328
502 502 c, t dbSNP:539346540
507 507 a, g dbSNP:753400613
508 508 a, c, g dbSNP:759063931
509 509 a, c dbSNP:752352965
512 512 c, t dbSNP:758149177
514 514 a, g dbSNP:371729974
518 518 c, t dbSNP:751397561
520 520 c, t dbSNP:557685583
524 524 c, g dbSNP:781254570
525 525 c, t dbSNP:201093134
526 526 a, g, t dbSNP:368198391
527 527 c, g dbSNP:201193537
534 534 c, t dbSNP:80358305
536 536 c, t dbSNP:569392655
542 542 c, g dbSNP:748347747
547 547 a, c, g dbSNP:772324668
550 550 g, t dbSNP:376089595
551 551 c, t dbSNP:771475699
553 553 a, c dbSNP:777090670
559 559 c, t dbSNP:758997145
560 560 a, g dbSNP:78844574
567 567 a, g dbSNP:367846606
570 570 a, g, t dbSNP:762734738
573 573 c, t dbSNP:751450413
580 580 c, t dbSNP:757090225
581 581 c, g, t dbSNP:377114189
585 585 c, t dbSNP:755030131
587 587 c, t dbSNP:191882942
588 588 a, g dbSNP:748168729
592 592 a, g, t dbSNP:778000208
593 593 c, t dbSNP:757631150
594 594 a, c, g dbSNP:761767474
598 598 a, g dbSNP:746204905
601 601 g, t dbSNP:770383372
609 609 -, tg dbSNP:781481891
612 612 c, g dbSNP:121908669
613 613 g, t dbSNP:121908668
619 619 c, t dbSNP:80358306
620 620 a, g dbSNP:148128016
624 624 c, g dbSNP:373823574
625 625 a, g dbSNP:774164233
633 633 c, t dbSNP:200728516
634 634 a, g, t dbSNP:183377804
637 637 c, g dbSNP:760362830
638 638 a, c dbSNP:531476978
641 641 a, g dbSNP:753676598
652 652 a, g dbSNP:142649952
653 653 c, t dbSNP:764102072
654 654 a, c dbSNP:751784556
657 657 c, t dbSNP:200484935
658 658 a, g dbSNP:146895334
659 659 c, g dbSNP:369652619
660 660 a, g dbSNP:750841970
663 663 a, g dbSNP:372984788
664 664 a, t dbSNP:780636010
670 670 c, t dbSNP:199787141
672 672 a, g dbSNP:749757604
676 676 c, g, t dbSNP:549579496
677 677 a, g dbSNP:139063572
699 699 c, t dbSNP:370574039
701 701 a, g dbSNP:771896111
707 707 c, t dbSNP:772705728
708 708 a, g dbSNP:760548029
730 730 a, g dbSNP:770580929
734 734 c, g dbSNP:776643520
740 740 c, t dbSNP:150859573
741 741 a, g dbSNP:121908671
742 742 c, t dbSNP:121908672
762 762 c, t dbSNP:765147716
763 763 a, g dbSNP:751688462
771 771 a, c dbSNP:201681766
773 773 a, g dbSNP:761851629
776 776 c, t dbSNP:138207107
781 781 c, t dbSNP:200384949
782 782 a, g dbSNP:756516754
786 786 c, t dbSNP:766589610
787 787 a, g dbSNP:754254742
806 806 a, c dbSNP:553569731
810 810 c, t dbSNP:780791760
814 814 c, t dbSNP:375404890
815 815 a, g dbSNP:149522146
824 824 c, t dbSNP:775422664
825 825 a, g dbSNP:121908670
832 832 c, t dbSNP:397514665
839 839 c, t dbSNP:768638466
840 840 a, g dbSNP:773226526
841 841 a, g dbSNP:539068423
847 847 -, ct dbSNP:748552376
847 847 c, t dbSNP:766546504
848 848 a, t dbSNP:144040425
854 854 c, t dbSNP:759998730
855 855 g, t dbSNP:765637520
857 857 a, g dbSNP:753259530
859 859 c, t dbSNP:121908673
860 860 a, c dbSNP:763435713
871 871 c, t dbSNP:557291376
873 873 c, t dbSNP:751071752
887 887 c, t dbSNP:756752524
890 890 c, t dbSNP:575935133
897 897 c, t dbSNP:368484557
901 901 c, t dbSNP:755910471
904 904 -, gggggaagag dbSNP:80358307
904 904 c, g dbSNP:779893871
925 925 a, t dbSNP:749099090
930 930 a, g dbSNP:768528750
937 937 a, t dbSNP:778874445
938 938 c, t dbSNP:747085802
966 966 c, g dbSNP:771082674
973 973 a, g dbSNP:777003697
977 977 a, g dbSNP:759764117
980 980 -, gggcgacagaccgagac dbSNP:756504802
981 981 -, cca dbSNP:778332568
981 981 a, t dbSNP:770136120
989 989 c, g dbSNP:754740683
991 991 c, t dbSNP:765013945
993 993 c, t dbSNP:752428183
1013 1013 c, t dbSNP:758466329
1014 1014 a, g dbSNP:377176311
1019 1019 c, t dbSNP:528414646
1025 1025 c, t dbSNP:756215440
1035 1035 c, g dbSNP:780154174
1046 1046 c, t dbSNP:749461497
1047 1047 a, g dbSNP:768757897
1054 1054 c, t dbSNP:774840027
1059 1059 a, t dbSNP:748493448
1064 1064 c, t dbSNP:772611192
1065 1065 g, t dbSNP:773665226
1075 1075 c, t dbSNP:760196023
1076 1076 a, g, t dbSNP:765854475
1088 1088 -, gcaggacaacg dbSNP:768435638
1098 1098 a, g dbSNP:759297600
1099 1099 a, c, g dbSNP:764782174
1100 1100 c, t dbSNP:758236607
1103 1103 -, gac dbSNP:776221148
1104 1104 a, g dbSNP:764149976
1105 1105 c, t dbSNP:751485385
1106 1106 a, g dbSNP:756268764
1108 1108 a, g dbSNP:139896674
1112 1112 c, g dbSNP:780249365
1121 1121 c, t dbSNP:762759902
1122 1122 a, g dbSNP:184945579
1127 1127 a, g dbSNP:368750109
1128 1128 g, t dbSNP:761479086
1132 1132 c, t dbSNP:767517943
1133 1133 c, g dbSNP:143499301
1140 1140 c, g dbSNP:759679533
1144 1144 a, g dbSNP:765237837
1146 1146 c, t dbSNP:200740071
1150 1150 c, t dbSNP:758679423
1151 1151 a, g dbSNP:777951142
1158 1158 c, t dbSNP:371514699
1162 1162 a, g dbSNP:757523656
1163 1163 g, t dbSNP:781728966
1177 1177 c, t dbSNP:746292760
1178 1178 a, g dbSNP:200179967
1179 1179 c, t dbSNP:779767448
1180 1180 c, t dbSNP:748782653
1181 1181 a, g dbSNP:146264359
1187 1187 c, t dbSNP:1043461
1190 1190 c, g, t dbSNP:747651554
1191 1191 a, g dbSNP:771711120
1197 1197 a, g dbSNP:367543496
1204 1204 a, g dbSNP:372337584
1206 1206 a, g dbSNP:766293910
1209 1209 a, g dbSNP:775598320
1211 1211 c, t dbSNP:376709985
1212 1212 a, g dbSNP:764331609
1218 1218 c, t dbSNP:751683687
1219 1219 a, g dbSNP:757644956
1223 1223 c, t dbSNP:764504521
1224 1224 a, g, t dbSNP:750784979
1231 1231 c, t dbSNP:780673652
1233 1233 a, g dbSNP:369747444
1235 1235 c, t dbSNP:139130382
1241 1241 c, t dbSNP:142506263
1244 1244 c, t dbSNP:747693977
1246 1246 c, t dbSNP:397514664
1251 1251 c, g dbSNP:771754782
1277 1277 c, t dbSNP:202236798
1283 1283 a, g dbSNP:746800397
1285 1285 a, g dbSNP:201539068
1293 1293 c, t dbSNP:776512547
1294 1294 a, g dbSNP:763043311
1300 1300 c, t dbSNP:201320326
1301 1301 a, g dbSNP:774484799
1306 1306 c, t dbSNP:761997651
1310 1310 c, t dbSNP:142055640
1311 1311 a, g dbSNP:750791263
1312 1312 a, g dbSNP:756503895
1313 1313 a, g, t dbSNP:377403217
1321 1321 c, t dbSNP:369125661
1322 1322 a, g dbSNP:150970251
1327 1327 a, c, t dbSNP:199686378
1328 1328 a, g dbSNP:140779623
1340 1340 c, t dbSNP:746304511
1341 1341 a, g dbSNP:770664323
1349 1349 c, t dbSNP:149682423
1350 1350 a, g dbSNP:745871660
1355 1355 c, t dbSNP:769705901
1356 1356 a, g dbSNP:200789047
1365 1365 g, t dbSNP:774342727
1366 1366 c, t dbSNP:761919591
1367 1367 c, g dbSNP:772212144
1370 1370 c, t dbSNP:377461570
1371 1371 a, g dbSNP:761131376
1379 1379 a, g dbSNP:766778722
1383 1383 c, t dbSNP:121908661
1384 1384 a, g dbSNP:770223547
1385 1385 a, c dbSNP:760182519
1394 1394 c, t dbSNP:765756341
1400 1400 c, t dbSNP:145362529
1401 1401 a, g dbSNP:757888034
1405 1405 c, t dbSNP:777314081
1406 1406 a, g dbSNP:751156557
1411 1411 c, t dbSNP:370901051
1412 1412 a, g dbSNP:374322550
1417 1417 a, g dbSNP:201547952
1419 1419 a, g dbSNP:201779301
1421 1421 a, c, t dbSNP:745638620
1422 1422 a, g dbSNP:376152274
1429 1429 c, t dbSNP:200416179
1430 1430 a, g dbSNP:142511038
1431 1431 c, t dbSNP:80358308
1432 1432 a, g dbSNP:761049544
1438 1438 a, g dbSNP:771268909
1439 1439 c, t dbSNP:777187538
1447 1447 c, g dbSNP:759951621
1449 1449 c, t dbSNP:765695793
1457 1457 -, c dbSNP:767723514
1458 1458 c, t dbSNP:12364012
1461 1461 a, g dbSNP:373910016
1466 1466 a, g dbSNP:146912729
1475 1475 a, g dbSNP:763594374
1478 1478 c, t dbSNP:367873767
1486 1486 a, g dbSNP:756952499
1487 1487 a, g dbSNP:767124237
1488 1488 -, c dbSNP:34216038
1493 1493 c, t dbSNP:569443429
1494 1494 a, g dbSNP:755886863
1496 1496 a, c, g dbSNP:200075657
1502 1502 a, c, t dbSNP:113518978
1505 1505 c, t dbSNP:747067664
1506 1506 a, g dbSNP:771321752
1509 1509 a, t dbSNP:776956543
1529 1529 a, g dbSNP:769905219
1554 1554 g, t dbSNP:121908666
1558 1558 g, t dbSNP:775971156
1562 1562 c, t dbSNP:267603151
1572 1572 a, g dbSNP:749584413
1582 1582 a, g dbSNP:121908664
1585 1585 a, g dbSNP:200409162
1593 1593 g, t dbSNP:766493225
1595 1595 c, g, t dbSNP:774790391
1597 1597 a, g dbSNP:150771999
1603 1603 c, t dbSNP:145897519
1607 1607 a, c dbSNP:772589056
1608 1608 a, g dbSNP:766988509
1613 1613 a, g dbSNP:545508982
1616 1616 c, g dbSNP:557805230
1619 1619 a, c, t dbSNP:148073961
1620 1620 a, g dbSNP:765290711
1626 1626 -, c dbSNP:756479857
1629 1629 c, g dbSNP:752625747
1637 1637 c, g dbSNP:757418771
1661 1661 a, c dbSNP:781489196
1664 1664 c, t dbSNP:750457614
1665 1665 a, g dbSNP:80358309
1667 1667 a, c dbSNP:756398181
1682 1682 c, t dbSNP:780098863
1683 1683 a, g dbSNP:749683290
1694 1694 c, t dbSNP:748487092
1705 1705 c, t dbSNP:80358310
1706 1706 a, g dbSNP:141896162
1708 1708 a, c dbSNP:746554984
1709 1709 a, g dbSNP:150209973
1713 1713 c, t dbSNP:770292689
1714 1714 a, g dbSNP:138692892
1716 1716 a, g dbSNP:759331617
1725 1725 a, g dbSNP:769557748
1728 1728 a, g dbSNP:566952681
1730 1730 c, t dbSNP:761424454
1734 1734 a, c dbSNP:762794790
1736 1736 c, t dbSNP:764112300
1737 1737 c, t dbSNP:774097621
1739 1739 a, g dbSNP:774083040
1743 1743 a, g dbSNP:201576246
1748 1748 c, t dbSNP:545382
1749 1749 a, g dbSNP:80358311
1756 1756 c, t dbSNP:397514663
1757 1757 a, g dbSNP:146285115
1763 1763 a, g, t dbSNP:184457951
1766 1766 a, g dbSNP:778361337
1767 1767 c, g dbSNP:747408714
1778 1778 c, t dbSNP:757777983
1781 1781 g, t dbSNP:377144001
1784 1784 c, t dbSNP:139408531
1794 1794 a, c, t dbSNP:745350421
1797 1797 c, t dbSNP:775233316
1798 1798 a, g dbSNP:587783024
1805 1805 c, t dbSNP:200627198
1806 1806 a, c, g dbSNP:768268948
1808 1808 a, g dbSNP:199707305
1809 1809 c, t dbSNP:121908665
1810 1810 a, g dbSNP:80358312
1814 1814 a, g dbSNP:767464846
1822 1822 a, t dbSNP:776728388
1825 1825 a, g dbSNP:574974332
1833 1833 c, t dbSNP:765468063
1834 1834 c, g dbSNP:752862568
1838 1838 c, t dbSNP:758798637
1839 1839 a, g dbSNP:149524398
1859 1859 c, t dbSNP:751940504
1862 1862 c, t dbSNP:757754971
1886 1886 c, t dbSNP:781756147
1888 1888 g, t dbSNP:745391397
1893 1893 -, t dbSNP:757860805
1898 1898 c, t dbSNP:554437931
1899 1899 a, g dbSNP:143878170
1901 1901 c, t dbSNP:200800275
1902 1902 a, g dbSNP:576436176
1912 1912 c, t dbSNP:774574205
1913 1913 a, g dbSNP:200163787
1917 1917 a, g dbSNP:768061512
1918 1918 c, t dbSNP:750804004
1919 1919 a, c, g dbSNP:148603249
1921 1921 a, g dbSNP:753317134
1924 1924 a, g dbSNP:754464622
1928 1928 c, t dbSNP:778446537
1929 1929 a, c, g, t dbSNP:80358313
1934 1934 a, g dbSNP:142126662
1950 1950 g, t dbSNP:367619965
1951 1951 g, t dbSNP:80358314
1952 1952 c, t dbSNP:746784651
1963 1963 a, g dbSNP:567426021
1964 1964 c, t dbSNP:781145030
1965 1965 c, g dbSNP:147792724
1968 1968 a, t dbSNP:768712336
1969 1969 c, g dbSNP:774289856
1972 1972 a, g, t dbSNP:748460105
1979 1979 c, g dbSNP:371269062
1982 1982 c, g dbSNP:773747650
1988 1988 a, c, t dbSNP:140958524
1989 1989 a, g dbSNP:777141177
2013 2013 a, g dbSNP:758976409
2015 2015 g, t dbSNP:368392203
2024 2024 c, t dbSNP:17848264
2025 2025 a, g dbSNP:371615673
2033 2033 a, g dbSNP:2277268
2039 2039 c, g dbSNP:751387901
2049 2049 a, g dbSNP:756999448
2053 2053 a, g dbSNP:780994858
2057 2057 a, g dbSNP:745882899
2060 2060 a, c, t dbSNP:755991257
2061 2061 a, g, t dbSNP:747131775
2064 2064 a, g dbSNP:773516415
2069 2069 c, t dbSNP:144847027
2075 2075 a, c dbSNP:771264031
2081 2081 c, t dbSNP:140604679
2091 2091 -, aac dbSNP:780882911
2093 2093 c, t dbSNP:760151423
2096 2096 c, t dbSNP:150471658
2097 2097 a, g dbSNP:180941579
2099 2099 c, t dbSNP:762411916
2100 2100 a, c, g dbSNP:4988321
2104 2104 c, t dbSNP:149130784
2110 2110 c, t dbSNP:201207267
2111 2111 a, g dbSNP:143304197
2116 2116 c, t dbSNP:575865236
2117 2117 a, g dbSNP:375853556
2120 2120 c, t dbSNP:779811816
2121 2121 a, g dbSNP:543279405
2123 2123 c, t dbSNP:748257457
2125 2125 a, g dbSNP:758492536
2129 2129 c, g dbSNP:778147505
2147 2147 c, t dbSNP:61740517
2153 2153 g, t dbSNP:771048928
2157 2157 a, g dbSNP:781660447
2158 2158 a, g dbSNP:746188108
2180 2180 c, t dbSNP:770364888
2181 2181 a, g dbSNP:141796804
2187 2187 c, g dbSNP:541165691
2203 2203 a, g dbSNP:145008551
2204 2204 c, t dbSNP:761184187
2205 2205 a, g dbSNP:771775019
2208 2208 g, t dbSNP:772679034
2216 2216 c, t dbSNP:145456776
2224 2224 c, t dbSNP:532035027
2225 2225 a, g dbSNP:140977837
2234 2234 c, t dbSNP:33958013
2235 2235 a, g dbSNP:765239493
2238 2238 c, g dbSNP:751720886
2240 2240 a, g dbSNP:34369535
2243 2243 a, g dbSNP:201973717
2252 2252 -, t dbSNP:121908662
2257 2257 a, g dbSNP:750547007
2258 2258 c, t dbSNP:749139386
2272 2272 c, t dbSNP:376671764
2273 2273 c, t dbSNP:780444299
2274 2274 a, g dbSNP:769035778
2276 2276 c, t dbSNP:200570645
2282 2282 g, t dbSNP:779339888
2283 2283 a, t dbSNP:149241739
2291 2291 c, g dbSNP:771414728
2294 2294 c, t dbSNP:147388442
2298 2298 c, t dbSNP:746701187
2303 2303 a, g dbSNP:121908667
2306 2306 c, g dbSNP:770688294
2307 2307 a, g dbSNP:776613004
2309 2309 c, t dbSNP:35298380
2321 2321 c, t dbSNP:2306862
2327 2327 c, t dbSNP:147932332
2334 2334 g, t dbSNP:761958436
2335 2335 c, t dbSNP:148550774
2336 2336 a, g dbSNP:750492852
2337 2337 c, t dbSNP:201916993
2338 2338 a, g dbSNP:766548006
2343 2343 a, g dbSNP:576718732
2344 2344 a, t dbSNP:544505368
2345 2345 c, t dbSNP:142986090
2355 2355 c, g dbSNP:121908674
2356 2356 a, g dbSNP:776542904
2361 2361 a, g dbSNP:755274667
2367 2367 a, g, t dbSNP:138777930
2384 2384 c, g dbSNP:151110465
2390 2390 a, g dbSNP:372734142
2396 2396 a, c, g, t dbSNP:140955013
2403 2403 c, g dbSNP:80358315
2409 2409 c, g dbSNP:745674892
2417 2417 a, g dbSNP:769649663
2418 2418 a, g dbSNP:775353605
2425 2425 c, t dbSNP:144983823
2427 2427 c, t dbSNP:759805400
2432 2432 g, t dbSNP:557686671
2435 2435 c, g, t dbSNP:753035383
2436 2436 a, g dbSNP:764526918
2442 2442 a, g dbSNP:569787963
2443 2443 a, g dbSNP:752049489
2444 2444 c, t dbSNP:757838059
2445 2445 a, g dbSNP:537161896
2452 2452 c, t dbSNP:749919151
2453 2453 a, g dbSNP:755749782
2459 2459 a, c, g, t dbSNP:140616444
2460 2460 a, g, t dbSNP:778567335
2464 2464 a, g dbSNP:771972596
2473 2473 c, t dbSNP:776734260
2477 2477 c, t dbSNP:759574283
2485 2485 a, g dbSNP:368485424
2490 2490 a, g dbSNP:775727748
2491 2491 a, t dbSNP:763236037
2493 2493 a, g dbSNP:80358316
2494 2494 c, t dbSNP:371155552
2495 2495 a, g dbSNP:762447750
2498 2498 g, t dbSNP:768094405
2500 2500 c, t dbSNP:749972187
2505 2505 a, g dbSNP:755589464
2514 2514 c, t dbSNP:765952535
2515 2515 a, g dbSNP:565245995
2522 2522 a, c, t dbSNP:138051657
2523 2523 a, g dbSNP:754571473
2529 2529 a, g dbSNP:778726416
2531 2531 c, t dbSNP:747908467
2532 2532 a, g dbSNP:758364834
2541 2541 a, g dbSNP:573746993
2544 2544 a, g dbSNP:200483542
2546 2546 c, t dbSNP:149080536
2550 2550 c, t dbSNP:775431782
2564 2564 c, t dbSNP:778180589
2568 2568 c, t dbSNP:768741253
2575 2575 c, g dbSNP:774885857
2580 2580 a, c dbSNP:762216902
2585 2585 c, t dbSNP:577932894
2586 2586 c, g dbSNP:773784389
2588 2588 c, g dbSNP:770370415
2589 2589 a, t dbSNP:761081986
2591 2591 a, g dbSNP:765971625
2596 2596 a, g dbSNP:545636414
2601 2601 c, t dbSNP:747324802
2613 2613 c, t dbSNP:762593049
2614 2614 a, g dbSNP:559129140
2618 2618 c, t dbSNP:375223225
2619 2619 a, g dbSNP:757262154
2627 2627 c, t dbSNP:780939776
2630 2630 a, c, t dbSNP:143204891
2636 2636 c, g dbSNP:779128276
2639 2639 a, g, t dbSNP:748439020
2645 2645 a, g, t dbSNP:148271293
2648 2648 c, t dbSNP:771492871
2649 2649 a, g dbSNP:776947784
2651 2651 c, t dbSNP:759051327
2657 2657 a, g dbSNP:769361598
2658 2658 c, t dbSNP:121908663
2663 2663 c, t dbSNP:774970595
2667 2667 a, g dbSNP:575222684
2671 2671 a, g dbSNP:762646007
2675 2675 c, t dbSNP:140411171
2687 2687 c, t dbSNP:751390139
2691 2691 a, t dbSNP:761455808
2696 2696 g, t dbSNP:200079431
2701 2701 a, g, t dbSNP:750390421
2709 2709 -, g dbSNP:762823842
2709 2709 c, t dbSNP:769188092
2710 2710 a, g dbSNP:774814837
2711 2711 g, t dbSNP:554108619
2712 2712 g, t dbSNP:758724530
2714 2714 c, t dbSNP:375529792
2715 2715 a, g dbSNP:747416148
2717 2717 c, g dbSNP:771134762
2729 2729 a, c dbSNP:781616623
2730 2730 c, t dbSNP:200501120
2731 2731 a, g dbSNP:770267716
2732 2732 a, g dbSNP:369900147
2736 2736 c, t dbSNP:750804153
2738 2738 c, t dbSNP:141174027
2740 2740 c, t dbSNP:768364811
2747 2747 c, g dbSNP:147352603
2754 2754 c, t dbSNP:756487767
2765 2765 c, t dbSNP:373351312
2766 2766 -, gt dbSNP:770862328
2777 2777 a, c dbSNP:761518661
2778 2778 c, t dbSNP:767270901
2790 2790 c, t dbSNP:773036756
2796 2796 c, t dbSNP:760734426
2808 2808 c, t dbSNP:766376965
2812 2812 a, g dbSNP:752844724
2814 2814 a, g dbSNP:758494958
2820 2820 a, g dbSNP:137861541
2821 2821 c, t dbSNP:751796016
2822 2822 a, g dbSNP:757489082
2825 2825 c, g dbSNP:143539498
2831 2831 a, c, t dbSNP:376944217
2849 2849 a, g dbSNP:780478829
2862 2862 c, t dbSNP:368736765
2864 2864 c, t dbSNP:147158768
2865 2865 a, g dbSNP:773895575
2867 2867 c, t dbSNP:139372523
2868 2868 a, g dbSNP:771724060
2872 2872 a, g dbSNP:773170628
2873 2873 c, t dbSNP:749482837
2874 2874 c, t dbSNP:369471051
2875 2875 a, g, t dbSNP:373466030
2879 2879 c, t dbSNP:759513973
2880 2880 a, g dbSNP:764138752
2885 2885 c, t dbSNP:369623848
2886 2886 a, g dbSNP:372374697
2894 2894 c, t dbSNP:767740919
2897 2897 c, t dbSNP:750812663
2898 2898 a, c, t dbSNP:756401189
2899 2899 c, t dbSNP:749848133
2901 2901 c, g dbSNP:755484892
2902 2902 c, t dbSNP:778326106
2904 2904 g, t dbSNP:747654722
2905 2905 a, c dbSNP:771643715
2910 2910 -, c dbSNP:150625922
2915 2915 c, t dbSNP:376937882
2916 2916 c, t dbSNP:746806229
2917 2917 a, g dbSNP:770919090
2918 2918 -, aactgcagccgt dbSNP:774341563
2921 2921 a, c dbSNP:369139308
2928 2928 c, t dbSNP:776554205
2929 2929 c, t dbSNP:773251794
2930 2930 a, g dbSNP:201018263
2938 2938 c, t dbSNP:201639368
2943 2943 c, t dbSNP:766546188
2945 2945 c, g dbSNP:370798399
2973 2973 a, c, t dbSNP:754174678
2974 2974 a, g dbSNP:765665314
2977 2977 c, t dbSNP:753313934
2983 2983 a, c, t dbSNP:189095829
2984 2984 a, g dbSNP:150031686
2987 2987 c, t dbSNP:144415767
2988 2988 a, g dbSNP:780945547
2996 2996 c, g dbSNP:745667609
2997 2997 a, c dbSNP:374891715
3001 3001 c, t dbSNP:780789533
3011 3011 c, t dbSNP:779697005
3015 3015 a, c dbSNP:749294674
3022 3022 a, c, g dbSNP:768546268
3035 3035 c, t dbSNP:747039844
3047 3047 c, t dbSNP:147716006
3048 3048 a, g dbSNP:776844865
3052 3052 a, g dbSNP:759674127
3060 3060 a, c, g dbSNP:61370283
3065 3065 c, t dbSNP:200117377
3074 3074 c, t dbSNP:764659105
3076 3076 a, g dbSNP:751139831
3080 3080 c, g dbSNP:756773762
3083 3083 a, g dbSNP:371528796
3091 3091 a, g dbSNP:750144525
3098 3098 c, t dbSNP:755696364
3106 3106 a, g dbSNP:779935967
3116 3116 c, t dbSNP:749039189
3117 3117 a, g, t dbSNP:147758521
3118 3118 -, cgggacccaggcaggtgccctgtgggaagggtg dbSNP:759600834
3119 3119 c, t dbSNP:146792434
3120 3120 a, g dbSNP:771064776
3129 3129 c, t dbSNP:201793593
3143 3143 c, t dbSNP:762445774
3148 3148 c, t dbSNP:775499713
3154 3154 a, g dbSNP:373483389
3158 3158 c, t dbSNP:772416019
3170 3170 c, t dbSNP:772798522
3173 3173 g, t dbSNP:760044208
3176 3176 c, g dbSNP:766057993
3177 3177 c, t dbSNP:753554800
3178 3178 c, t dbSNP:201745746
3180 3180 c, t dbSNP:140482319
3192 3192 a, g, t dbSNP:377410080
3194 3194 c, t dbSNP:777524051
3195 3195 a, g dbSNP:750533610
3203 3203 c, t dbSNP:756084148
3207 3207 c, t dbSNP:780281215
3208 3208 a, g, t dbSNP:61889560
3212 3212 a, g dbSNP:779448157
3222 3222 a, t dbSNP:748409889
3224 3224 a, g dbSNP:368960282
3227 3227 c, t dbSNP:773523178
3234 3234 a, g dbSNP:761238994
3240 3240 a, g dbSNP:770404987
3247 3247 a, g dbSNP:776097279
3248 3248 c, t dbSNP:200247220
3249 3249 a, g dbSNP:577519439
3250 3250 a, t dbSNP:752513082
3257 3257 a, g dbSNP:199675099
3263 3263 c, t dbSNP:762600156
3265 3265 c, g dbSNP:764100421
3267 3267 a, g dbSNP:751521743
3269 3269 a, t dbSNP:757209267
3274 3274 -, g dbSNP:752933404