Email to GenScript

LRPAP1 low density lipoprotein receptor-related protein associated protein 1 [Homo sapiens (human)]

Gene Symbol LRPAP1
Entrez Gene ID 4043
Full Name low density lipoprotein receptor-related protein associated protein 1
Synonyms A2MRAP, A2RAP, HBP44, MRAP, MYP23, RAP, alpha-2-MRAP
General protein information
Preferred Names
alpha-2-macroglobulin receptor-associated protein
alpha-2-macroglobulin receptor-associated protein
lipoprotein receptor associated protein
alpha-2-macroglobulin receptor-associated protein 1
low density lipoprotein receptor-related protein-associated protein 1
low density lipoprotein-related protein-associated protein 1 (alpha-2-macroglobulin receptor-associated protein 1)
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]. lac of sum
Disorder MIM:


Disorder Html:

The following LRPAP1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the LRPAP1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu25194 NM_002337 Homo sapiens low density lipoprotein receptor-related protein associated protein 1 (LRPAP1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector in pcDNA3.1+/C-(K)DYK $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu25194
Accession Version NM_002337.3
Sequence Information ORF Nucleotide Sequence (Length: 1074bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product alpha-2-macroglobulin receptor-associated protein precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB035408.1, BC112067.1, BX647984.1, AK222504.1 and AL590235.23. This sequence is a reference standard in the RefSeqGene project. On Jun 22, 2011 this sequence version replaced gi:194440683. Summary: This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]. Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK222504.1, BX647984.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962337, SAMEA962346 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)50..52(+)
Misc Feature(2)245..457(+)
Misc Feature(3)257..286(+)
Misc Feature(4)308..373(+)
Misc Feature(5)374..376(+)
Misc Feature(6)404..445(+)
Misc Feature(7)515..1156(+)
Misc Feature(8)521..814(+)
Misc Feature(9)533..562(+)
Misc Feature(10)584..670(+)
Misc Feature(11)743..814(+)
Misc Feature(12)839..1156(+)
Misc Feature(13)860..883(+)
Misc Feature(14)902..1003(+)
Misc Feature(15)941..1087(+)
Misc Feature(16)1046..1135(+)
Exon (1)1..289
Gene Synonym:
Exon (2)290..434
Gene Synonym:
Exon (3)435..556
Gene Synonym:
Exon (4)557..677
Gene Synonym:
Exon (5)678..836
Gene Synonym:
Exon (6)837..919
Gene Synonym:
Exon (7)920..1096
Gene Synonym:
Exon (8)1097..10536
Gene Synonym:
Position Chain Variation Link
33 33 -, c dbSNP:35394575
46 46 a, c dbSNP:755083280
53 53 c, g dbSNP:749359128
58 58 c, t dbSNP:780193043
59 59 c, t dbSNP:756148204
61 61 -, cg dbSNP:3082915
61 61 c, t dbSNP:750315463
63 63 c, t dbSNP:767431428
64 64 c, g dbSNP:757057921
65 65 c, t dbSNP:141001956
68 68 c, g dbSNP:1800483
69 69 a, g dbSNP:762418729
74 74 c, g, t dbSNP:764688376
75 75 a, c dbSNP:373858485
76 76 g, t dbSNP:371652192
77 77 c, t dbSNP:368685421
78 78 a, c dbSNP:748544192
81 81 a, g dbSNP:774480108
90 90 c, t dbSNP:375417190
91 91 g, t dbSNP:749425165
93 93 c, t dbSNP:780281427
94 94 c, g dbSNP:374848233
95 95 c, t dbSNP:745856564
96 96 a, c, g dbSNP:563463515
97 97 a, g dbSNP:543378868
102 102 a, c, g, t dbSNP:752280001
103 103 c, g dbSNP:764741568
104 104 a, c, g dbSNP:17848316
105 105 a, c, g, t dbSNP:774805099
106 106 a, g, t dbSNP:201770716
108 108 a, c, g, t dbSNP:761639938
109 109 a, g dbSNP:745909895
111 111 g, t dbSNP:781325942
113 113 c, g, t dbSNP:370866898
115 115 a, g dbSNP:777628775
116 116 c, t dbSNP:758071696
118 118 c, t dbSNP:200330132
121 121 a, g, t dbSNP:754525703
122 122 c, t dbSNP:753327001
124 124 a, c, g dbSNP:762417810
126 126 c, t dbSNP:751949678
129 129 a, c dbSNP:764573629
131 131 c, g dbSNP:763402040
134 134 c, t dbSNP:775892261
138 138 g, t dbSNP:770116081
143 143 c, t dbSNP:759782230
144 144 c, t dbSNP:776803111
145 145 c, g dbSNP:770848726
152 152 c, t dbSNP:541409658
155 155 a, g dbSNP:777558745
156 156 c, g dbSNP:572340534
158 158 c, t dbSNP:747908477
165 165 c, t dbSNP:778589040
166 166 c, t dbSNP:139828333
168 168 -, ctgcgagcc dbSNP:751647491
171 171 c, g dbSNP:748902456
173 173 a, t dbSNP:201806719
178 178 -, c dbSNP:780710582
178 178 c, t dbSNP:755562082
179 179 c, g dbSNP:752173014
182 182 a, g dbSNP:764474172
188 188 c, t dbSNP:576017713
195 195 c, g dbSNP:148017639
230 230 a, g dbSNP:539416757
232 232 c, g dbSNP:377668697
234 234 c, t dbSNP:776659378
246 246 a, t dbSNP:766538982
261 261 c, t dbSNP:760667592
266 266 c, t dbSNP:773243225
275 275 c, g dbSNP:11940827
280 280 a, g dbSNP:570507981
282 282 a, c dbSNP:529342669
284 284 -, c dbSNP:786205216
287 287 c, t dbSNP:142940249
291 291 c, t dbSNP:757389389
292 292 a, g dbSNP:200867938
294 294 a, t dbSNP:764095933
298 298 c, t dbSNP:762831489
299 299 c, t dbSNP:752632932
304 304 a, c, g, t dbSNP:148553602
305 305 a, g dbSNP:573489074
306 306 a, c, t dbSNP:55856346
307 307 a, g dbSNP:373510897
310 310 a, g dbSNP:369933980
316 316 c, g, t dbSNP:377473977
317 317 a, g dbSNP:770127302
320 320 c, g dbSNP:746222429
323 323 c, t dbSNP:781481941
325 325 a, c, t dbSNP:536479711
329 329 g, t dbSNP:777738501
353 353 a, g dbSNP:146399188
356 356 c, t dbSNP:752616407
358 358 c, t dbSNP:765216292
359 359 a, g, t dbSNP:142211110
372 372 c, t dbSNP:766207464
373 373 a, g dbSNP:760432087
376 376 a, g dbSNP:772947787
382 382 c, t dbSNP:766981043
383 383 a, g, t dbSNP:11549511
388 388 a, g dbSNP:775922611
391 391 c, t dbSNP:770350585
392 392 a, g dbSNP:746310452
393 393 a, c dbSNP:777014677
397 397 c, g, t dbSNP:139103216
407 407 a, g dbSNP:747280979
411 411 c, t dbSNP:778025991
412 412 a, g dbSNP:142669297
414 414 c, g dbSNP:201485938
419 419 a, g dbSNP:780722395
422 422 c, t dbSNP:371563601
423 423 a, g dbSNP:11549516
426 426 a, g, t dbSNP:2228158
428 428 a, c, t dbSNP:559706967
430 430 c, t dbSNP:555099242
432 432 a, g dbSNP:34897511
450 450 a, g dbSNP:754773216
460 460 a, c, t dbSNP:150108954
461 461 a, g dbSNP:780228986
465 465 a, g dbSNP:577683161
470 470 g, t dbSNP:745755598
472 472 c, t dbSNP:781066883
473 473 a, g dbSNP:141746328
476 476 c, t dbSNP:751267591
477 477 a, g dbSNP:367608534
483 483 g, t dbSNP:542253319
485 485 a, t dbSNP:374080649
487 487 c, g dbSNP:757962242
492 492 a, t dbSNP:752216416
504 504 a, g dbSNP:190769048
512 512 c, g dbSNP:769578825
517 517 c, t dbSNP:761486612
518 518 a, g dbSNP:138080464
520 520 a, g dbSNP:147013302
525 525 a, g dbSNP:767970348
532 532 c, t dbSNP:11549513
549 549 g, t dbSNP:762050623
550 550 g, t dbSNP:202126851
551 551 c, t dbSNP:141393177
555 555 a, g dbSNP:763205407
558 558 c, t dbSNP:754580538
559 559 a, g dbSNP:748730807
564 564 c, t dbSNP:368431663
565 565 c, g, t dbSNP:752067923
574 574 a, g dbSNP:778333388
575 575 a, t dbSNP:758808328
576 576 g, t dbSNP:753036731
577 577 c, g dbSNP:765366946
580 580 c, t dbSNP:373275995
581 581 a, g dbSNP:143848774
583 583 c, t dbSNP:143257814
584 584 a, g dbSNP:760626933
585 585 a, g dbSNP:773110689
589 589 a, t dbSNP:771890752
593 593 g, t dbSNP:761589714
595 595 c, g dbSNP:774107204
606 606 a, g dbSNP:768203630
610 610 a, g dbSNP:748934340
613 613 a, c dbSNP:779457327
614 614 -, c dbSNP:759079938
614 614 c, g dbSNP:769408297
624 624 a, g dbSNP:747562279
626 626 a, g dbSNP:778421243
635 635 c, g dbSNP:758892723
637 637 a, c, t dbSNP:149133766
638 638 a, g dbSNP:755185603
639 639 a, t dbSNP:754043236
645 645 a, g dbSNP:145265768
646 646 a, c dbSNP:760713063
647 647 a, g dbSNP:750423681
649 649 a, c dbSNP:767426906
662 662 c, t dbSNP:761677497
663 663 -, tgagc dbSNP:773788109
666 666 a, g dbSNP:774017872
674 674 a, g dbSNP:768452623
676 676 a, c dbSNP:555708492
680 680 a, g dbSNP:35108689
684 684 a, g dbSNP:764995988
685 685 c, t dbSNP:759200709
686 686 a, g dbSNP:374011051
688 688 g, t dbSNP:770514690
689 689 a, g dbSNP:748649483
690 690 -, a dbSNP:786205127
691 691 c, t dbSNP:774890982
692 692 a, g dbSNP:768968055
695 695 a, c dbSNP:749647759
700 700 c, t dbSNP:199600966
705 705 c, t dbSNP:756331562
706 706 a, g dbSNP:746046454
712 712 a, g dbSNP:781301939
715 715 c, t dbSNP:560191136
716 716 a, c, g, t dbSNP:111244551
718 718 c, t dbSNP:758212452
723 723 a, c dbSNP:140204942
726 726 a, g, t dbSNP:374664239
728 728 a, g dbSNP:776398854
731 731 a, g dbSNP:766026463
733 733 c, t dbSNP:138236468
745 745 a, g dbSNP:146148546
746 746 c, t dbSNP:774775147
748 748 c, t dbSNP:769215112
749 749 a, c, t dbSNP:533591282
750 750 a, c, t dbSNP:142076491
751 751 a, g dbSNP:781392275
755 755 c, t dbSNP:770977619
768 768 c, t dbSNP:747126179
770 770 c, t dbSNP:777028219
771 771 a, g dbSNP:148604784
773 773 a, g dbSNP:752634240
776 776 a, g dbSNP:778899499
782 782 c, g dbSNP:754788192
786 786 g, t dbSNP:753610782
790 790 -, ggac dbSNP:763010898
791 791 a, g dbSNP:766116084
794 794 c, t dbSNP:773775312
795 795 a, g dbSNP:760183295
800 800 c, t dbSNP:376919981
801 801 a, g dbSNP:202048919
809 809 a, g dbSNP:763535258
814 814 c, t dbSNP:200151667
822 822 a, g dbSNP:770212678
823 823 c, t dbSNP:370957737
825 825 a, g dbSNP:776926951
829 829 -, t dbSNP:772987430
832 832 a, c, g dbSNP:747159323
835 835 c, t dbSNP:13325
839 839 g, t dbSNP:779919314
842 842 a, g dbSNP:368226243
851 851 a, g dbSNP:562679574
875 875 g, t dbSNP:780698459
876 876 c, t dbSNP:374220727
877 877 a, g dbSNP:751077223
883 883 c, g, t dbSNP:149473926
884 884 a, g dbSNP:755497927
888 888 a, g dbSNP:754280813
890 890 c, t dbSNP:763387331
895 895 a, g dbSNP:572287773
898 898 c, g dbSNP:773539951
904 904 a, g dbSNP:767865480
910 910 a, g dbSNP:762057162
912 912 c, t dbSNP:774599888
913 913 a, g dbSNP:768805093
917 917 c, t dbSNP:138120743
918 918 a, g dbSNP:192009446
920 920 c, g dbSNP:763172041
921 921 a, g dbSNP:534444180
926 926 c, g dbSNP:765312397
929 929 a, c dbSNP:759441276
937 937 c, t dbSNP:776519916
938 938 a, g dbSNP:770780844
948 948 -, tc dbSNP:398122836
949 949 c, t dbSNP:760447478
955 955 a, g dbSNP:772932880
958 958 c, g dbSNP:771627386
960 960 a, g dbSNP:747797286
962 962 c, g, t dbSNP:768186858
963 963 a, c dbSNP:746398851
964 964 c, t dbSNP:781762889
979 979 a, g dbSNP:757783119
987 987 c, t dbSNP:201384451
988 988 a, g, t dbSNP:200532799
991 991 c, t dbSNP:374981655
992 992 a, g dbSNP:765273361
996 996 a, g dbSNP:759659110
1004 1004 c, t dbSNP:753833282
1006 1006 c, t dbSNP:766316350
1007 1007 a, g dbSNP:760537405
1009 1009 a, g dbSNP:773021095
1011 1011 a, g dbSNP:767293311
1013 1013 a, c dbSNP:757625151
1015 1015 c, t dbSNP:11549512
1016 1016 a, g dbSNP:1800493
1024 1024 a, c, t dbSNP:35919694
1025 1025 a, g dbSNP:775076326
1028 1028 -, g dbSNP:780338459
1028 1028 a, c, g dbSNP:747474387
1031 1031 c, t dbSNP:778048222
1032 1032 a, g dbSNP:372003322
1033 1033 c, g, t dbSNP:150160443
1034 1034 c, g dbSNP:755095644
1036 1036 a, g dbSNP:201496652
1040 1040 c, t dbSNP:753917366
1041 1041 a, c, g dbSNP:756067957
1043 1043 a, g dbSNP:750333755
1046 1046 c, t dbSNP:200424526
1047 1047 a, g dbSNP:140947105
1048 1048 a, c, t dbSNP:763814281
1051 1051 a, g dbSNP:762657824
1054 1054 a, g dbSNP:374454307
1055 1055 c, t dbSNP:769410340
1056 1056 a, c dbSNP:747560141
1057 1057 c, t dbSNP:779642814
1058 1058 a, g dbSNP:148077268
1060 1060 a, c dbSNP:748560583
1061 1061 c, t dbSNP:779078377
1064 1064 c, g dbSNP:200159569
1073 1073 a, c, t dbSNP:780156971
1074 1074 a, g dbSNP:143714310
1083 1083 a, g dbSNP:750423596
1087 1087 a, c, g dbSNP:757078554
1088 1088 a, g dbSNP:751402764
1090 1090 c, g dbSNP:763749159
1095 1095 c, g, t dbSNP:140565543
1103 1103 -, aag dbSNP:779268666
1112 1112 c, t dbSNP:747039898
1117 1117 c, g dbSNP:559230004
1118 1118 c, t dbSNP:777843716
1123 1123 c, t dbSNP:758357054
1124 1124 a, g dbSNP:368995062
1142 1142 c, t dbSNP:753351085
1143 1143 a, g dbSNP:146814560
1145 1145 c, g dbSNP:143841560
1150 1150 c, t dbSNP:141943482
1151 1151 a, c, g dbSNP:141338615
1153 1153 a, g dbSNP:752165185
1154 1154 c, t dbSNP:764596971
1164 1164 a, g dbSNP:148120809
1165 1165 c, t dbSNP:6789
1171 1171 a, g dbSNP:1800495
1173 1173 c, t dbSNP:759842956
1179 1179 a, c dbSNP:776714366
1180 1180 c, t dbSNP:188271252
1181 1181 a, c, g dbSNP:773363042
1184 1184 a, c dbSNP:772170081
1192 1192 a, g dbSNP:76983628
1195 1195 c, t dbSNP:553148261
1197 1197 c, g dbSNP:754694064
1198 1198 c, t dbSNP:200127365
1199 1199 a, g dbSNP:779559622
1222 1222 a, g dbSNP:567289580
1233 1233 a, c, g dbSNP:774163008
1246 1246 c, t dbSNP:183983595
1247 1247 a, g dbSNP:55683554
1258 1258 a, t dbSNP:113953397
1317 1317 a, g dbSNP:376223749
1320 1320 a, g dbSNP:571881241
1321 1321 c, t dbSNP:1049574
1356 1356 g, t dbSNP:1802967
1407 1407 a, g dbSNP:528630876
1420 1420 c, t dbSNP:559905980
1435 1435 c, t dbSNP:113801833
1446 1446 g, t dbSNP:17848281
1457 1457 c, t dbSNP:1049608
1464 1464 g, t dbSNP:529018188
1481 1481 a, c dbSNP:575551397
1482 1482 c, t dbSNP:776584916
1485 1485 g, t dbSNP:371446293
1492 1492 a, t dbSNP:77768479
1497 1497 -, a dbSNP:557349319
1515 1515 c, t dbSNP:535992718
1516 1516 a, g dbSNP:139057451
1518 1518 a, g dbSNP:564273625
1544 1544 a, t dbSNP:9995685
1591 1591 c, t dbSNP:572107328
1595 1595 c, t dbSNP:774549711
1610 1610 a, g dbSNP:770989331
1618 1618 g, t dbSNP:377047499
1623 1623 g, t dbSNP:1794438
1631 1631 a, g dbSNP:2077130
1633 1633 c, t dbSNP:191853111
1634 1634 a, g dbSNP:556921435
1646 1646 c, g dbSNP:537087732
1659 1659 a, g dbSNP:777941414
1664 1664 g, t dbSNP:571617889
1694 1694 a, g dbSNP:756569034
1700 1700 c, t dbSNP:10024301
1701 1701 a, g dbSNP:574695480
1727 1727 c, t dbSNP:116622990
1761 1761 a, g dbSNP:549625234
1774 1774 g, t dbSNP:730748
1811 1811 a, g dbSNP:62272702
1812 1812 a, c dbSNP:188505547
1860 1860 c, t dbSNP:532747792
1869 1869 c, t dbSNP:564121822
1907 1907 c, g dbSNP:540935815
1917 1917 c, t dbSNP:185183975
1923 1923 c, t dbSNP:755587800
1924 1924 a, g dbSNP:112750320
1926 1926 a, g dbSNP:541657745
1946 1946 c, g dbSNP:573787518
1947 1947 g, t dbSNP:754367437
1956 1956 c, g dbSNP:537704710
1958 1958 c, t dbSNP:372804654
1959 1959 a, g dbSNP:111558413
1973 1973 a, g dbSNP:193226384
1975 1975 c, t dbSNP:577923452
1990 1990 c, t dbSNP:3021475
2019 2019 c, t dbSNP:1741554
2026 2026 a, g dbSNP:2093098
2048 2048 -, ctgagcctggaagaggctcgggtccggctccgagcgtggttcccttcc cgtgt dbSNP:71180192
2053 2053 c, t dbSNP:113572632
2057 2057 a, g dbSNP:566395847
2072 2072 c, t dbSNP:7442071
2079 2079 a, g dbSNP:7436998
2080 2080 a, g dbSNP:1730761
2106 2106 c, t dbSNP:1794432
2125 2125 c, t dbSNP:13126792
2132 2132 a, g dbSNP:112453164
2133 2133 a, g dbSNP:13112088
2149 2149 c, t dbSNP:731819
2159 2159 c, t dbSNP:7442035
2184 2184 c, t dbSNP:13126754
2185 2185 a, g dbSNP:111382803
2186 2186 a, g dbSNP:13112054
2202 2202 c, t dbSNP:28699606
2212 2212 c, t dbSNP:111983747
2217 2217 a, g dbSNP:112673739
2237 2237 c, t dbSNP:3897706
2238 2238 a, g dbSNP:112366599
2239 2239 a, g dbSNP:2014440
2265 2265 c, t dbSNP:113444648
2279 2279 a, g dbSNP:549863764
2290 2290 c, t dbSNP:36101076
2292 2292 g, t dbSNP:533064169
2309 2309 a, g dbSNP:563899927
2317 2317 a, g dbSNP:13146489
2338 2338 a, g dbSNP:547398103
2361 2361 c, t dbSNP:2014431
2365 2365 a, g dbSNP:2014430
2380 2380 a, g dbSNP:183521495
2386 2386 c, g dbSNP:189755673
2397 2397 c, t dbSNP:541621369
2405 2405 -, ttccc dbSNP:398072062
2405 2405 g, t dbSNP:531362402
2410 2410 -, ttccc dbSNP:78712138
2410 2410 c, t dbSNP:562357681
2413 2413 c, g dbSNP:543522935
2415 2415 c, t dbSNP:186967986
2419 2419 a, g dbSNP:140821121
2437 2437 a, c dbSNP:150975210
2441 2441 c, t dbSNP:572770700
2450 2450 c, t dbSNP:755672644
2470 2470 c, t dbSNP:28444167
2487 2487 g, t dbSNP:182634517
2492 2492 c, t dbSNP:556047145
2494 2494 a, g dbSNP:375835700
2498 2498 g, t dbSNP:536168207
2601 2601 c, t dbSNP:531625117
2604 2604 -, c dbSNP:35931653
2606 2606 c, t dbSNP:113960400
2630 2630 c, t dbSNP:767135601
2642 2642 g, t dbSNP:190269929
2655 2655 c, g dbSNP:1741555
2684 2684 c, t dbSNP:751322928
2716 2716 c, t dbSNP:547068055
2735 2735 c, t dbSNP:1741556
2756 2756 a, g dbSNP:144053967
2771 2771 a, g dbSNP:764007788
2775 2775 c, t dbSNP:575020323
2777 2777 a, g dbSNP:760673979
2822 2822 c, g dbSNP:76598271
2824 2824 a, g dbSNP:774228600
2835 2835 c, t dbSNP:771055762
2855 2855 c, t dbSNP:548046018
2866 2866 a, t dbSNP:531521804
2879 2879 c, t dbSNP:562320266
2880 2880 a, g dbSNP:546010309
2905 2905 c, g dbSNP:773513387
2924 2924 a, t dbSNP:374291359
2926 2926 c, g dbSNP:533256445
2930 2930 a, c dbSNP:564647485
2935 2935 c, t dbSNP:541167069
2948 2948 c, t dbSNP:770179060
2962 2962 c, t dbSNP:748498581
2990 2990 c, t dbSNP:572432322
2994 2994 c, t dbSNP:781726405
3010 3010 c, t dbSNP:146668093
3038 3038 c, t dbSNP:747550855
3039 3039 a, g dbSNP:542515908
3068 3068 c, g dbSNP:576838838
3073 3073 c, t dbSNP:556465652
3080 3080 a, g dbSNP:771011588
3083 3083 -, t dbSNP:773670194
3090 3090 a, g dbSNP:540066047
3098 3098 a, g dbSNP:570451425
3117 3117 c, t dbSNP:757961539
3130 3130 c, t dbSNP:553784447
3165 3165 a, t dbSNP:533665321
3170 3170 a, g dbSNP:1794424
3173 3173 c, g dbSNP:377320052
3175 3175 a, g dbSNP:778517683
3216 3216 c, t dbSNP:143154769
3248 3248 a, g dbSNP:186773036
3252 3252 c, t dbSNP:568850360
3266 3266 c, t dbSNP:552081108
3296 3296 c, t dbSNP:532285228
3297 3297 a, g dbSNP:1794423
3299 3299 a, t dbSNP:760549239
3314 3314 g, t dbSNP:772286348
3320 3320 c, t dbSNP:547837343
3331 3331 a, c dbSNP:6848039
3342 3342 c, t dbSNP:181800416
3362 3362 c, t dbSNP:559069601
3366 3366 c, t dbSNP:770124186
3367 3367 a, g dbSNP:762190035
3371 3371 c, g dbSNP:6818522
3381 3381 c, g dbSNP:192029686
3383 3383 a, g dbSNP:563244021
3390 3390 -, atct dbSNP:139078926
3432 3432 c, t dbSNP:73197125
3433 3433 a, g dbSNP:537384554
3439 3439 c, t dbSNP:546183568
3442 3442 a, c dbSNP:577332096
3461 3461 a, g dbSNP:769169045
3467 3467 c, t dbSNP:187115059
3468 3468 a, g dbSNP:148809456
3478 3478 a, g dbSNP:574226498
3491 3491 a, g dbSNP:75577696
3493 3493 a, g dbSNP:554132733
3498 3498 c, t dbSNP:570012189
3510 3510 a, g dbSNP:537492547
3524 3524 a, g dbSNP:10014674
3564 3564 a, t dbSNP:182039375
3574 3574 c, t dbSNP:538574949
3583 3583 g, t dbSNP:374226988
3587 3587 a, g dbSNP:144377775
3635 3635 a, g dbSNP:546508063
3644 3644 g, t dbSNP:554174008
3658 3658 c, t dbSNP:371132516
3670 3670 c, g dbSNP:527773914
3706 3706 g, t dbSNP:562205600
3712 3712 c, t dbSNP:188126355
3723 3723 a, g dbSNP:10014466
3730 3730 c, t dbSNP:778462650
3781 3781 c, t dbSNP:149622962
3782 3782 a, g dbSNP:756837841
3808 3808 g, t dbSNP:753502720
3819 3819 c, t dbSNP:556039367
3834 3834 a, g dbSNP:547198867
3859 3859 -, a dbSNP:749761730
3875 3875 c, t dbSNP:562749816
3876 3876 a, g dbSNP:35350183
3887 3887 a, g dbSNP:577493513
3902 3902 a, g dbSNP:752473252
3912 3912 a, g dbSNP:767465060
3917 3917 c, t dbSNP:57537103
3925 3925 a, g dbSNP:200446935
3928 3928 c, t dbSNP:574188827
4008 4008 a, g dbSNP:532189764
4011 4011 a, g dbSNP:373207822
4069 4069 a, c dbSNP:55654722
4083 4083 c, t dbSNP:181043252
4088 4088 c, t dbSNP:780653266
4106 4106 a, g dbSNP:537970322
4141 4141 -, a dbSNP:397715647
4141 4141 a, c dbSNP:201228201
4147 4147 -, a dbSNP:10710687
4147 4147 a, c dbSNP:78388152
4167 4167 a, g dbSNP:558292139
4185 4185 a, g dbSNP:531664094
4188 4188 g, t dbSNP:189674977
4192 4192 c, t dbSNP:566689986
4192 4192 -, t dbSNP:570703422
4235 4235 c, t dbSNP:553197755
4236 4236 a, g dbSNP:536498773
4238 4238 c, t dbSNP:143111263
4243 4243 c, t dbSNP:548662705
4245 4245 a, g dbSNP:531734075
4263 4263 g, t dbSNP:185142391
4264 4264 c, t dbSNP:755732950
4265 4265 a, g dbSNP:369404322
4275 4275 a, g dbSNP:532830915
4277 4277 g, t dbSNP:560666561
4290 4290 c, t dbSNP:112919605
4291 4291 g, t dbSNP:530190843
4300 4300 a, g dbSNP:375307678
4309 4309 a, g dbSNP:10021014
4330 4330 a, g dbSNP:561159681
4355 4355 a, g dbSNP:10013891
4364 4364 a, g dbSNP:10020994
4410 4410 a, g dbSNP:10011545
4419 4419 a, g dbSNP:1794439
4465 4465 a, g dbSNP:34898817
4474 4474 a, g dbSNP:112243122
4518 4518 c, t dbSNP:13129335
4520 4520 a, g dbSNP:71608286
4529 4529 a, g dbSNP:112896469
4575 4575 a, g dbSNP:62272701
4577 4577 a, g dbSNP:575273999
4578 4578 g, t dbSNP:558284858
4584 4584 a, g dbSNP:13149433
4630 4630 a, g dbSNP:138631611
4633 4633 g, t dbSNP:56124515
4685 4685 a, g dbSNP:1610579
4740 4740 a, g dbSNP:9761583
4795 4795 a, g dbSNP:1730764
4797 4797 a, g dbSNP:544721470
4841 4841 a, g dbSNP:373988038
4848 4848 c, t dbSNP:112287766
4850 4850 a, g dbSNP:6821400
4852 4852 a, g dbSNP:573089650
4867 4867 c, t dbSNP:553257162
4870 4870 a, g dbSNP:536561568
4895 4895 c, t dbSNP:567434921
4903 4903 c, t dbSNP:10002108
4906 4906 c, t dbSNP:1730765
4912 4912 c, g dbSNP:569293649
4922 4922 c, t dbSNP:188771294
4931 4931 c, t dbSNP:532354026
4934 4934 c, t dbSNP:116619832
4935 4935 a, g dbSNP:58673626
4939 4939 a, g dbSNP:184901788
4952 4952 c, t dbSNP:192641295
4980 4980 a, g dbSNP:544438944
5003 5003 g, t dbSNP:372711666
5013 5013 g, t dbSNP:145409422
5043 5043 c, t dbSNP:564879914
5046 5046 c, t dbSNP:369245719
5060 5060 c, t dbSNP:186626917
5071 5071 a, t dbSNP:182301878
5076 5076 a, c dbSNP:553021879
5083 5083 c, g dbSNP:542920915
5091 5091 c, t dbSNP:10001975
5092 5092 a, g dbSNP:140310151
5110 5110 a, g dbSNP:769044181
5111 5111 c, t dbSNP:536895388
5122 5122 c, t dbSNP:191304628
5123 5123 a, g dbSNP:558739514
5131 5131 c, t dbSNP:187928350
5154 5154 c, g dbSNP:539137072
5164 5164 c, t dbSNP:566499583
5174 5174 c, t dbSNP:546619240
5175 5175 a, g dbSNP:116213946
5176 5176 c, t dbSNP:146693994
5187 5187 -, tctg dbSNP:746282986
5190 5190 a, g dbSNP:143195082
5214 5214 c, t dbSNP:114048770
5218 5218 c, t dbSNP:183387675
5245 5245 c, t dbSNP:3183
5256 5256 a, g dbSNP:140688401
5262 5262 c, t dbSNP:3182
5273 5273 c, t dbSNP:191578245
5279 5279 a, g dbSNP:114126711
5295 5295 -, g dbSNP:763930341
5296 5296 c, g dbSNP:573979293
5299 5299 a, g dbSNP:563528095
5310 5310 c, g dbSNP:370867174
5346 5346 a, g dbSNP:3184
5353 5353 c, g dbSNP:770451398
5354 5354 a, t dbSNP:577726987
5379 5379 c, t dbSNP:549741872
5398 5398 g, t dbSNP:187147956
5400 5400 a, c dbSNP:181753831
5431 5431 c, t dbSNP:755770081
5445 5445 c, g dbSNP:79595315
5451 5451 a, g dbSNP:765119357
5463 5463 c, t dbSNP:567440791
5470 5470 c, t dbSNP:536295665
5471 5471 a, g dbSNP:567328941
5492 5492 c, t dbSNP:150921784
5497 5497 g, t dbSNP:533773920
5529 5529 c, t dbSNP:142985904
5534 5534 c, t dbSNP:549299624
5550 5550 c, t dbSNP:372895350
5556 5556 a, g dbSNP:1730766
5567 5567 c, t dbSNP:77567558
5571 5571 g, t dbSNP:765372196
5591 5591 a, g dbSNP:75458081
5594 5594 c, t dbSNP:547767379
5615 5615 c, t dbSNP:559536329
5622 5622 -, t dbSNP:140865416
5632 5632 g, t dbSNP:75953505
5707 5707 c, g dbSNP:532527040
5711 5711 a, g dbSNP:549103008
5752 5752 c, t dbSNP:377394871
5769 5769 a, g dbSNP:764366950
5800 5800 a, g dbSNP:563308575
5833 5833 a, g dbSNP:760874958
5845 5845 c, t dbSNP:543321378
5868 5868 a, g dbSNP:775860302
5898 5898 g, t dbSNP:11729369
5913 5913 c, g dbSNP:760040875
5939 5939 a, g dbSNP:564112358
5991 5991 -, c dbSNP:34439113
5995 5995 a, t dbSNP:771467574
6037 6037 a, g, t dbSNP:543479343
6069 6069 a, c dbSNP:774422843
6078 6078 c, g dbSNP:541262978
6081 6081 a, g dbSNP:573000988
6091 6091 c, t dbSNP:772766253
6096 6096 c, t dbSNP:571575908
6097 6097 a, g dbSNP:553006560
6101 6101 c, t dbSNP:570419089
6103 6103 c, t dbSNP:769480598
6117 6117 a, g dbSNP:190904722
6122 6122 a, g dbSNP:184973663
6166 6166 a, g dbSNP:542952418
6180 6180 a, g dbSNP:147521522
6193 6193 g, t dbSNP:571947721
6232 6232 c, t dbSNP:754748866
6261 6261 c, g dbSNP:180909447
6266 6266 c, t dbSNP:749601404
6296 6296 a, g dbSNP:535181268
6305 6305 c, g dbSNP:566286896
6343 6343 a, g dbSNP:11727559
6366 6366 -, t dbSNP:397992134
6376 6376 -, t dbSNP:34336383
6379 6379 a, g dbSNP:189588469
6416 6416 c, t dbSNP:529018083
6424 6424 c, t dbSNP:780121739
6428 6428 c, t dbSNP:758470257
6433 6433 a, g dbSNP:569526036
6442 6442 c, g dbSNP:144821798
6457 6457 c, t dbSNP:140847247
6459 6459 a, c dbSNP:77081441
6488 6488 a, g dbSNP:540932430
6498 6498 a, t dbSNP:527445697
6515 6515 -, tgggataatacagttaaaaactt dbSNP:79227311
6515 6515 -, tgggataatacagttaaaaact dbSNP:375297891
6518 6518 -, gataatacagttaaaaacttgg dbSNP:142051974
6518 6518 g, t dbSNP:372767283
6553 6553 a, g dbSNP:553512776
6554 6554 c, t dbSNP:753966124
6577 6577 a, g dbSNP:369870305
6600 6600 c, t dbSNP:71608285
6601 6601 a, g dbSNP:2858029
6632 6632 a, g dbSNP:574108724
6635 6635 c, t dbSNP:557063736
6640 6640 a, g dbSNP:543844853
6641 6641 a, t dbSNP:201250734
6642 6642 g, t dbSNP:200200445
6643 6643 -, taatg, tgatg dbSNP:57367734
6643 6643 a, g dbSNP:201746395
6644 6644 -, aatgt, gatgt dbSNP:577940690
6645 6645 a, g dbSNP:113781752
6647 6647 -, taatg dbSNP:386399086
6648 6648 -, taatg dbSNP:369724779
6649 6649 -, atgta dbSNP:33963422
6650 6650 -, atgta dbSNP:10625329
6653 6653 a, c dbSNP:201223435
6689 6689 g, t dbSNP:537892411
6707 6707 c, t dbSNP:28547570
6726 6726 a, c dbSNP:184652721
6739 6739 a, g dbSNP:767884255
6763 6763 a, c, t dbSNP:28410166
6799 6799 a, g dbSNP:566246289
6802 6802 g, t dbSNP:556022572
6807 6807 c, g dbSNP:763517662
6816 6816 c, g dbSNP:535525880
6887 6887 g, t dbSNP:772708931
6897 6897 -, tcttg dbSNP:377662486
6901 6901 -, gtctt dbSNP:760451105
6906 6906 c, t dbSNP:569773887
6912 6912 -, t dbSNP:200813321
6912 6912 c, t dbSNP:549510406
6924 6924 c, t dbSNP:769197097
6933 6933 c, t dbSNP:532896700
6936 6936 a, c, g dbSNP:149579808
6943 6943 g, t dbSNP:138162585
6946 6946 -, ag dbSNP:367683773
6954 6954 a, c dbSNP:534131281
6962 6962 c, g dbSNP:527603040
6995 6995 g, t dbSNP:150812194
6998 6998 c, t dbSNP:758219917
7009 7009 a, g dbSNP:752437565
7071 7071 g, t dbSNP:181591817
7079 7079 -, t dbSNP:199728200
7087 7087 c, t dbSNP:552186796
7111 7111 a, c dbSNP:776120535
7118 7118 c, t dbSNP:189946350
7119 7119 a, g dbSNP:563754932
7128 7128 c, g dbSNP:543561761
7133 7133 a, c dbSNP:184559590
7159 7159 a, g dbSNP:192346356
7172 7172 a, t dbSNP:746789796
7182 7182 a, g dbSNP:780064146
7189 7189 a, g dbSNP:2699403
7210 7210 a, g dbSNP:754984228
7212 7212 a, g dbSNP:745815802
7241 7241 c, t dbSNP:560688433
7246 7246 a, g dbSNP:6839714
7250 7250 c, t dbSNP:572809345
7269 7269 a, g dbSNP:55916136
7291 7291 c, g dbSNP:756180000
7337 7337 -, gaa dbSNP:767693872
7342 7342 c, g dbSNP:752861878
7379 7379 -, ttct dbSNP:552677703
7382 7382 c, t dbSNP:761742123
7383 7383 a, g dbSNP:536095121
7406 7406 c, t dbSNP:189543874
7427 7427 a, t dbSNP:371122487
7437 7437 c, t dbSNP:556185781
7439 7439 g, t dbSNP:138119054
7454 7454 c, t dbSNP:570399726
7455 7455 c, t dbSNP:183656076
7456 7456 c, t dbSNP:533821422
7457 7457 a, g dbSNP:568055368
7463 7463 a, g dbSNP:755250228
7501 7501 c, t dbSNP:548080984
7518 7518 c, t dbSNP:6820191
7526 7526 a, g dbSNP:192242230
7546 7546 c, g dbSNP:550219918
7572 7572 c, t dbSNP:188058551
7577 7577 c, t dbSNP:766731990
7622 7622 a, g dbSNP:533294179
7679 7679 a, g dbSNP:564457207
7687 7687 a, g dbSNP:59333061
7698 7698 a, g dbSNP:549868096
7709 7709 a, c dbSNP:182971157
7738 7738 a, g dbSNP:192936489
7745 7745 a, c dbSNP:74622705
7757 7757 -, a dbSNP:745568904
7757 7757 -, a dbSNP:200593210
7766 7766 a, g dbSNP:542169762
7821 7821 a, g dbSNP:576546314
7831 7831 c, t dbSNP:763389777
7834 7834 a, g dbSNP:556504626
7860 7860 c, g dbSNP:187215793
7864 7864 a, g dbSNP:78294484
7877 7877 c, t dbSNP:776049537
7905 7905 c, g dbSNP:764760579
7920 7920 a, g dbSNP:761210563
7945 7945 c, t dbSNP:776267175
7963 7963 a, g dbSNP:553344150
7980 7980 g, t dbSNP:770046627
8008 8008 a, g dbSNP:78869014
8021 8021 c, g dbSNP:567725068
8052 8052 a, c dbSNP:74717941
8083 8083 c, t dbSNP:548043941
8107 8107 -, t dbSNP:397690484
8116 8116 -, t dbSNP:59614185
8117 8117 -, t dbSNP:542788879
8122 8122 c, t dbSNP:537769272
8164 8164 a, c, g dbSNP:772016845
8217 8217 a, g dbSNP:569011352
8257 8257 c, t dbSNP:552120337
8293 8293 a, g dbSNP:143086286
8316 8316 c, g dbSNP:776943631
8329 8329 a, c dbSNP:564616040
8335 8335 c, g dbSNP:547915725
8339 8339 a, c dbSNP:77298395
8357 8357 a, g dbSNP:778685796
8372 8372 a, g dbSNP:562081057
8380 8380 c, t dbSNP:149051042
8414 8414 a, g dbSNP:531943159
8419 8419 c, t dbSNP:770949385
8421 8421 a, g dbSNP:748162910
8428 8428 c, t dbSNP:563084350
8429 8429 g, t dbSNP:546123888
8452 8452 c, t dbSNP:368551596
8454 8454 a, g dbSNP:560853129
8455 8455 g, t dbSNP:553409342
8474 8474 g, t dbSNP:149867039
8477 8477 a, g dbSNP:140653273
8479 8479 g, t dbSNP:147951440
8486 8486 a, g dbSNP:538126643
8500 8500 c, t dbSNP:569097355
8518 8518 ggtagc, tag dbSNP:386670703
8518 8518 c, t dbSNP:558712603
8536 8536 a, c, g dbSNP:144860657
8540 8540 a, g dbSNP:140939243
8569 8569 c, t dbSNP:537979994
8612 8612 c, g dbSNP:2858028
8616 8616 c, t dbSNP:375374932
8621 8621 a, g dbSNP:568446068
8642 8642 c, t dbSNP:147291715
8652 8652 c, t dbSNP:532024642
8655 8655 a, g dbSNP:182959094
8656 8656 a, g dbSNP:546483799
8673 8673 c, t dbSNP:16844488
8675 8675 c, t dbSNP:762452316
8680 8680 c, t dbSNP:73793965
8739 8739 a, t dbSNP:73080991
8747 8747 c, g dbSNP:370445747
8780 8780 c, t dbSNP:554540151
8785 8785 a, g dbSNP:372650261
8835 8835 c, t dbSNP:543918401
8883 8883 c, t dbSNP:112021500
8920 8920 c, t dbSNP:558533146
8922 8922 c, t dbSNP:377055951
8927 8927 c, t dbSNP:2858027
8944 8944 a, g dbSNP:533974118
8967 8967 a, g dbSNP:142872977
8987 8987 c, g dbSNP:534275406
8993 8993 a, t dbSNP:184159402
8998 8998 a, g dbSNP:548561709
9013 9013 a, g dbSNP:148523862
9037 9037 a, g dbSNP:569247522
9049 9049 a, g dbSNP:2858026
9077 9077 c, g dbSNP:771759982
9098 9098 a, g dbSNP:73080986
9131 9131 c, g dbSNP:767319202
9157 9157 c, t dbSNP:560295499
9173 9173 -, ctc, ttc dbSNP:10665176
9173 9173 c, t dbSNP:201748988
9174 9174 -, tct, ttc dbSNP:34765033
9175 9175 -, ctt, ttc dbSNP:141156680
9175 9175 -, t dbSNP:536899453
9176 9176 a, c dbSNP:77205235
9178 9178 -, att dbSNP:201057670
9179 9179 a, t dbSNP:79380656
9183 9183 -, ttt dbSNP:776118903
9192 9192 a, g dbSNP:546831045
9207 9207 c, t dbSNP:144701176
9271 9271 c, t dbSNP:566297037
9278 9278 c, t dbSNP:544306338
9281 9281 c, g dbSNP:575097422
9292 9292 c, t dbSNP:564917263
9319 9319 a, c dbSNP:545302235
9344 9344 g, t dbSNP:368893230
9369 9369 -, t dbSNP:71180190
9397 9397 -, ctca, ttca dbSNP:397797132
9398 9398 -, ac dbSNP:200242782
9400 9400 -, ctca dbSNP:367924853
9401 9401 -, ctca dbSNP:61489246
9413 9413 c, t dbSNP:753829757
9420 9420 c, g dbSNP:2858025
9426 9426 c, t dbSNP:553197741
9427 9427 a, g dbSNP:533525038
9488 9488 c, g dbSNP:573784533
9489 9489 a, g dbSNP:566076078
9521 9521 a, g dbSNP:774260021
9526 9526 g, t dbSNP:547672641
9533 9533 c, t dbSNP:538356349
9541 9541 a, t dbSNP:770767025
9555 9555 a, g dbSNP:200353970
9557 9557 g, t dbSNP:138150633
9567 9567 c, t dbSNP:552184147
9568 9568 a, g dbSNP:538937755
9569 9569 g, t dbSNP:779790942
9586 9586 a, g dbSNP:373392763
9603 9603 c, t dbSNP:557678328
9605 9605 a, g dbSNP:546890784
9646 9646 a, g dbSNP:6836064
9670 9670 g, t dbSNP:561548901
9671 9671 c, t dbSNP:550377522
9676 9676 c, g dbSNP:751643217
9678 9678 c, t dbSNP:56358267
9690 9690 c, g dbSNP:564711955
9691 9691 a, g dbSNP:747189188
9730 9730 c, g dbSNP:190768436
9754 9754 a, g dbSNP:186244367
9778 9778 a, c dbSNP:559641887
9786 9786 a, g dbSNP:763309560
9797 9797 c, t dbSNP:542954054
9856 9856 c, t dbSNP:573724220
9871 9871 c, t dbSNP:9999697
9884 9884 a, t dbSNP:765643974
9898 9898 c, t dbSNP:141814662
9950 9950 -, g dbSNP:35270999
9955 9955 a, c, g dbSNP:549029894
9962 9962 a, g dbSNP:181119674
9970 9970 c, t dbSNP:189845654
9984 9984 g, t dbSNP:558525271
9988 9988 c, t dbSNP:560434145
10008 10008 c, t dbSNP:566535180
10013 10013 g, t dbSNP:11723071
10024 10024 a, g dbSNP:536976458
10026 10026 a, t dbSNP:567736961
10028 10028 c, t dbSNP:551190692
10030 10030 c, t dbSNP:530515854
10050 10050 a, g dbSNP:571417868
10056 10056 c, t dbSNP:761148314
10078 10078 c, t dbSNP:755654321
10081 10081 c, t dbSNP:551505993
10083 10083 c, t dbSNP:528053132
10087 10087 c, g dbSNP:559411392
10090 10090 a, g dbSNP:374993976
10092 10092 c, g dbSNP:138690847
10098 10098 a, c dbSNP:35553977
10108 10108 a, g dbSNP:567934787
10110 10110 a, c dbSNP:56298218
10127 10127 c, t dbSNP:185976081
10203 10203 g, t dbSNP:140780854
10212 10212 c, t dbSNP:148007403
10224 10224 a, g dbSNP:117135297
10256 10256 a, g dbSNP:56027744
10278 10278 c, t dbSNP:766209555
10332 10332 a, t dbSNP:572875250
10337 10337 a, t dbSNP:552978324
10351 10351 c, t dbSNP:181642062
10362 10362 c, t dbSNP:762747340
10370 10370 a, t dbSNP:143461417
10384 10384 c, t dbSNP:141111838
10390 10390 c, t dbSNP:189189387
10393 10393 c, t dbSNP:372697288
10406 10406 c, t dbSNP:369860374
10410 10410 c, t dbSNP:528220365
10411 10411 a, g dbSNP:184908846
10412 10412 c, t dbSNP:3468
10418 10418 a, g dbSNP:367732281
10436 10436 c, t dbSNP:563551222
10437 10437 a, g dbSNP:543361949
10480 10480 g, t dbSNP:544206404
10486 10486 c, t dbSNP:193296400
10489 10489 c, t dbSNP:746117965
10505 10505 c, t dbSNP:779098928
10531 10531 a, c dbSNP:757671647
10534 10534 c, t dbSNP:563963321

Target ORF information:

RefSeq Version NM_002337
Organism Homo sapiens (human)
Definition Homo sapiens low density lipoprotein receptor-related protein associated protein 1 (LRPAP1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.