Email to GenScript

SMAD3 SMAD family member 3 [Homo sapiens (human)]

Gene Symbol SMAD3
Entrez Gene ID 4088
Full Name SMAD family member 3
Synonyms HSPC193, HsT17436, JV15-2, LDS1C, LDS3, MADH3
General protein information
Preferred Names
mothers against decapentaplegic homolog 3
mothers against decapentaplegic homolog 3
MAD homolog 3
mad homolog JV15-2
mad protein homolog
mothers against DPP homolog 3
SMA- and MAD-related protein 3
SMAD, mothers against DPP homolog 3
MAD, mothers against decapentaplegic homolog 3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]. lac of sum
Disorder MIM:


Disorder Html:

The following SMAD3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SMAD3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu58827 XM_011521559 PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu58828 XM_011521560 PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu19966 NM_005902 Homo sapiens SMAD family member 3 (SMAD3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu23553 NM_001145104 Homo sapiens SMAD family member 3 (SMAD3), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu23848 NM_001145103 Homo sapiens SMAD family member 3 (SMAD3), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu23803 NM_001145102 Homo sapiens SMAD family member 3 (SMAD3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu58827
Accession Version XM_011521559.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1146bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)550..924(+)
Misc Feature(2)625..831(+)
Misc Feature(3)718..906(+)
Misc Feature(4)1066..1638(+)
Misc Feature(5)1117..1632(+)
Position Chain Variation Link
56 56 a, g dbSNP:535883990
73 73 a, g dbSNP:548974798
91 91 a, c dbSNP:565790696
120 120 a, g dbSNP:534813658
121 121 c, g dbSNP:553517799
144 144 a, c dbSNP:576662894
149 149 c, g dbSNP:111267434
284 284 c, g dbSNP:539333807
414 414 c, t dbSNP:556470157
488 488 c, t dbSNP:760998942
489 489 g, t dbSNP:764492850
501 501 c, t dbSNP:144374592
502 502 a, c dbSNP:757567277
504 504 c, g dbSNP:765385701
506 506 c, t dbSNP:36221703
507 507 c, g dbSNP:758575599
508 508 g, t dbSNP:780103267
510 510 c, t dbSNP:368637535
511 511 c, t dbSNP:754796428
512 512 g, t dbSNP:781095541
514 514 a, g dbSNP:1061427
518 518 c, t dbSNP:769421223
519 519 c, t dbSNP:777303695
520 520 c, t dbSNP:748781102
528 528 c, t dbSNP:770457783
534 534 a, g dbSNP:775955959
535 535 a, t dbSNP:761230207
537 537 c, t dbSNP:149022137
543 543 a, g dbSNP:776987925
546 546 c, t dbSNP:191495317
554 554 c, t dbSNP:762101727
555 555 c, t dbSNP:765454938
561 561 c, g dbSNP:750644348
564 564 a, g dbSNP:201824839
577 577 a, g dbSNP:183418982
591 591 a, c dbSNP:751526306
594 594 a, g dbSNP:187952791
600 600 c, t dbSNP:780995229
602 602 g, t dbSNP:191612061
609 609 a, g dbSNP:755882401
614 614 a, g dbSNP:777440658
630 630 g, t dbSNP:748990258
640 640 c, t dbSNP:770416788
663 663 g, t dbSNP:778462473
697 697 a, c dbSNP:730880213
703 703 a, g dbSNP:745387614
705 705 c, t dbSNP:769153458
708 708 c, g dbSNP:368132899
723 723 c, t dbSNP:368462984
727 727 a, g dbSNP:762200897
757 757 a, g dbSNP:779576954
766 766 a, c dbSNP:750707381
767 767 a, g dbSNP:758823376
777 777 c, t dbSNP:780111111
799 799 c, t dbSNP:747307840
805 805 c, t dbSNP:768713596
822 822 c, t dbSNP:781320332
831 831 c, t dbSNP:762889441
837 837 a, g dbSNP:1065080
839 839 a, g dbSNP:769657093
841 841 -, g dbSNP:587776882
844 844 a, g dbSNP:138550573
861 861 c, t dbSNP:762612490
862 862 a, g dbSNP:770798158
863 863 c, t dbSNP:387906854
869 869 a, g dbSNP:369221296
870 870 c, t dbSNP:759319479
872 872 c, t dbSNP:767284328
882 882 c, t dbSNP:752196822
891 891 c, t dbSNP:760286714
892 892 a, g dbSNP:587782977
900 900 a, c dbSNP:765624013
907 907 -, t dbSNP:751304511
919 919 c, g dbSNP:750982529
922 922 a, g dbSNP:371876622
949 949 c, t dbSNP:768301198
968 968 c, t dbSNP:780727302
970 970 a, g dbSNP:555538965
984 984 a, g dbSNP:368710091
988 988 c, t dbSNP:553009515
993 993 c, t dbSNP:769225687
999 999 c, t dbSNP:774814963
1000 1000 a, g dbSNP:760091844
1009 1009 c, t dbSNP:150682850
1028 1028 c, t dbSNP:772510704
1029 1029 a, g dbSNP:776009102
1032 1032 a, g dbSNP:202094530
1035 1035 c, t dbSNP:768951907
1040 1040 c, g dbSNP:376353913
1044 1044 c, t dbSNP:776900159
1046 1046 a, g dbSNP:762010050
1049 1049 -, a dbSNP:587776881
1061 1061 a, g dbSNP:755924969
1071 1071 c, t dbSNP:763705336
1077 1077 c, t dbSNP:753539358
1081 1081 -, c dbSNP:779179350
1083 1083 a, g dbSNP:138940179
1092 1092 a, g dbSNP:778356642
1104 1104 c, t dbSNP:745390727
1110 1110 c, t dbSNP:149443777
1111 1111 a, g dbSNP:387906853
1119 1119 c, t dbSNP:144667334
1121 1121 a, t dbSNP:748488255
1125 1125 c, t dbSNP:569358776
1126 1126 a, g dbSNP:773543026
1128 1128 c, t dbSNP:749576770
1134 1134 a, g dbSNP:771037017
1137 1137 -, at dbSNP:587776880
1137 1137 a, t dbSNP:201614771
1140 1140 c, t dbSNP:376023379
1143 1143 c, t dbSNP:139907582
1146 1146 c, t dbSNP:771854466
1173 1173 c, t dbSNP:145414319
1178 1178 c, t dbSNP:387906851
1179 1179 c, t dbSNP:370620091
1184 1184 c, t dbSNP:387906855
1188 1188 c, t dbSNP:763936253
1193 1193 c, t dbSNP:753486471
1194 1194 a, g, t dbSNP:761391442
1197 1197 a, g dbSNP:764958567
1200 1200 c, t dbSNP:749855793
1207 1207 c, t dbSNP:757961683
1213 1213 c, t dbSNP:781515462
1223 1223 a, g dbSNP:753302359
1232 1232 a, g dbSNP:387906852
1251 1251 a, c, g dbSNP:756530470
1255 1255 c, t dbSNP:387906850
1256 1256 a, g dbSNP:730880214
1264 1264 a, g dbSNP:778345732
1266 1266 c, t dbSNP:117185005
1267 1267 a, g dbSNP:730880215
1274 1274 a, g dbSNP:747862625
1275 1275 c, t dbSNP:769683236
1280 1280 a, g dbSNP:772730200
1281 1281 a, g dbSNP:139616052
1286 1286 a, c dbSNP:142620875
1293 1293 c, t dbSNP:773943578
1308 1308 c, t dbSNP:759140708
1318 1318 c, t dbSNP:764656928
1321 1321 a, g dbSNP:754409301
1327 1327 a, g dbSNP:757548494
1329 1329 c, t dbSNP:771384141
1330 1330 c, g dbSNP:750756638
1364 1364 a, g dbSNP:758586312
1377 1377 c, g dbSNP:780274581
1380 1380 a, g dbSNP:150994304
1386 1386 c, t dbSNP:774470515
1395 1395 a, g dbSNP:781081744
1398 1398 a, c dbSNP:748178271
1401 1401 a, c dbSNP:34188464
1402 1402 c, g dbSNP:769475136
1407 1407 a, g dbSNP:556975942
1428 1428 a, c dbSNP:202098340
1440 1440 c, t dbSNP:751780616
1452 1452 c, g dbSNP:759691171
1455 1455 a, c dbSNP:767649515
1460 1460 c, t dbSNP:752776110
1461 1461 a, g dbSNP:756181827
1466 1466 a, g dbSNP:140880290
1477 1477 g, t dbSNP:387906856
1488 1488 c, t dbSNP:753875974
1498 1498 a, c dbSNP:757106110
1516 1516 a, g dbSNP:370394986
1521 1521 c, t dbSNP:144245324
1524 1524 c, t dbSNP:560348826
1525 1525 a, g dbSNP:730880216
1541 1541 c, t dbSNP:779602560
1542 1542 a, g dbSNP:746494089
1548 1548 c, t dbSNP:768097258
1565 1565 c, t dbSNP:772373466
1590 1590 g, t dbSNP:539999192
1593 1593 c, t dbSNP:760873147
1611 1611 c, g dbSNP:375243021
1618 1618 -, gaca dbSNP:748703880
1618 1618 g, t dbSNP:201263330
1619 1619 a, t dbSNP:776802892
1621 1621 -, tttc dbSNP:769280104
1626 1626 a, c dbSNP:375738035
1641 1641 c, t dbSNP:146659831
1655 1655 a, g, t dbSNP:762012589
1662 1662 c, g dbSNP:750432084
1680 1680 -, t dbSNP:772778568
1690 1690 g, t dbSNP:758196703
1694 1694 a, g dbSNP:766151342
1699 1699 c, g dbSNP:189249001
1701 1701 a, g dbSNP:754534264
1703 1703 a, g dbSNP:780848724
1704 1704 c, g, t dbSNP:201206131
1707 1707 c, g dbSNP:779372678
1716 1716 c, g dbSNP:746421127
1720 1720 a, g dbSNP:772481721
1721 1721 c, t dbSNP:775658712
1724 1724 -, t dbSNP:762375788
1725 1725 c, g dbSNP:368655036
1727 1727 a, t dbSNP:535477771
1739 1739 c, t dbSNP:182280596
1798 1798 a, g dbSNP:565727784
1800 1800 g, t dbSNP:563970330
1806 1806 a, t dbSNP:777850257
1829 1829 c, t dbSNP:534838557
1839 1839 c, t dbSNP:111695641
1889 1889 c, g dbSNP:576999514
1909 1909 a, g dbSNP:79827660
1916 1916 c, t dbSNP:56036573
1917 1917 a, g dbSNP:115213021
1924 1924 a, c dbSNP:754034578
1965 1965 a, g dbSNP:146287966
1975 1975 c, t dbSNP:72661159
1978 1978 c, t dbSNP:565932125
1982 1982 c, t dbSNP:561705330
1992 1992 a, g dbSNP:79368607
1998 1998 c, t dbSNP:746763813
2076 2076 c, t dbSNP:8025774
2088 2088 g, t dbSNP:562488816
2093 2093 g, t dbSNP:78329172
2096 2096 c, g dbSNP:781146835
2103 2103 c, t dbSNP:556034412
2147 2147 -, tct dbSNP:556033972
2172 2172 a, c, g dbSNP:533376218
2177 2177 c, t dbSNP:369493674
2183 2183 a, g dbSNP:765527642
2184 2184 -, ccccgccccaccactccagcagaccttgcccc dbSNP:55978804
2188 2188 a, g dbSNP:529503181
2206 2206 a, t dbSNP:748060441
2216 2216 c, t dbSNP:530801416
2226 2226 g, t dbSNP:769408016
2253 2253 -, g dbSNP:550707472
2258 2258 a, g dbSNP:549263304
2270 2270 c, g dbSNP:565764510
2283 2283 a, g dbSNP:564556206
2299 2299 g, t dbSNP:557988479
2328 2328 a, g dbSNP:571689385
2339 2339 a, t dbSNP:186841203
2372 2372 c, t dbSNP:556286103
2379 2379 c, t dbSNP:762690517
2452 2452 c, g dbSNP:78383292
2463 2463 a, g dbSNP:191679355
2472 2472 a, g dbSNP:138327222
2479 2479 a, g dbSNP:770764038
2489 2489 c, t dbSNP:555675656
2491 2491 c, t dbSNP:572102859
2500 2500 a, g dbSNP:540986513
2517 2517 a, g dbSNP:55970514
2548 2548 a, g dbSNP:532996307
2553 2553 c, t dbSNP:543663488
2554 2554 a, g dbSNP:759877290
2591 2591 a, t dbSNP:181289276
2598 2598 c, t dbSNP:751729329
2648 2648 a, g dbSNP:186538259
2668 2668 a, g dbSNP:190014997
2692 2692 a, c dbSNP:142827677
2754 2754 c, g dbSNP:528490702
2779 2779 a, g dbSNP:8031440
2784 2784 a, g dbSNP:571662141
2790 2790 a, g dbSNP:537594091
2823 2823 g, t dbSNP:550791512
2839 2839 a, g dbSNP:567052377
2855 2855 c, t dbSNP:72661160
2859 2859 g, t dbSNP:764124750
2870 2870 a, g dbSNP:142609762
2891 2891 a, g dbSNP:150600147
2904 2904 c, g dbSNP:112747060
2919 2919 a, g dbSNP:8031627
2923 2923 c, g dbSNP:757346607
2929 2929 a, g dbSNP:569581429
2934 2934 g, t dbSNP:577556064
2940 2940 c, t dbSNP:1061341
2960 2960 a, t dbSNP:537802993
2999 2999 c, t dbSNP:139620908
3023 3023 g, t dbSNP:182242274
3076 3076 -, gaaaaaa dbSNP:752492048
3077 3077 a, t dbSNP:750644411
3095 3095 c, t dbSNP:372217473
3097 3097 c, t dbSNP:2278670
3151 3151 c, g dbSNP:542786788
3187 3187 g, t dbSNP:559626107
3199 3199 a, g dbSNP:778591910
3216 3216 c, t dbSNP:28363812
3257 3257 g, t dbSNP:577631492
3261 3261 c, g, t dbSNP:748088336
3280 3280 c, t dbSNP:777408805
3300 3300 c, g dbSNP:528721359
3328 3328 a, g dbSNP:551779423
3373 3373 c, g dbSNP:188001329
3441 3441 c, g dbSNP:533635017
3451 3451 -, cct dbSNP:369386357
3456 3456 c, t dbSNP:748749707
3464 3464 a, g dbSNP:530788405
3471 3471 -, gaca dbSNP:141408841
3479 3479 c, t dbSNP:191114875
3502 3502 a, g dbSNP:770567861
3542 3542 -, c dbSNP:760948248
3554 3554 c, t dbSNP:144205938
3576 3576 a, g dbSNP:745490452
3602 3602 g, t dbSNP:759130087
3637 3637 g, t dbSNP:772457638
3643 3643 c, t dbSNP:771658087
3687 3687 c, t dbSNP:183913368
3692 3692 -, t dbSNP:777061255
3702 3702 c, t dbSNP:549152312
3716 3716 c, t dbSNP:368370773
3720 3720 c, t dbSNP:761162475
3751 3751 c, t dbSNP:113309733
3752 3752 a, g dbSNP:147761102
3779 3779 c, t dbSNP:557746378
3786 3786 a, g dbSNP:115307123
3798 3798 c, t dbSNP:536610569
3856 3856 c, t dbSNP:556660083
3870 3870 a, g dbSNP:777131267
3879 3879 a, g dbSNP:573356440
3884 3884 -, tt dbSNP:556655485
3901 3901 a, g dbSNP:11638476
3903 3903 -, aaaa dbSNP:762028441
3903 3903 -, a dbSNP:573496525
3903 3903 a, g dbSNP:188412401
3916 3916 a, g dbSNP:117707762
3956 3956 c, t dbSNP:12595334
3958 3958 c, t dbSNP:139575773
3959 3959 c, g dbSNP:62014609
3967 3967 c, g dbSNP:565420956
3982 3982 c, g dbSNP:767340373
4004 4004 c, t dbSNP:555997375
4033 4033 c, t dbSNP:193013035
4060 4060 c, t dbSNP:752493489
4063 4063 -, c dbSNP:750918524
4077 4077 c, t dbSNP:755985886
4087 4087 g, t dbSNP:777786341
4118 4118 a, g dbSNP:145102966
4125 4125 c, t dbSNP:372633359
4126 4126 c, t dbSNP:561370577
4153 4153 c, t dbSNP:530174899
4163 4163 c, t dbSNP:80226876
4169 4169 c, g dbSNP:565929299
4221 4221 c, g, t dbSNP:72661161
4222 4222 a, g dbSNP:186967388
4234 4234 a, c dbSNP:571423885
4400 4400 c, t dbSNP:191410394
4421 4421 c, t dbSNP:112868185
4424 4424 g, t dbSNP:566917040
4426 4426 a, g dbSNP:771684858
4460 4460 a, t dbSNP:775905689
4467 4467 c, t dbSNP:3743342
4494 4494 a, g dbSNP:552626399
4541 4541 a, g dbSNP:573415984
4564 4564 c, g dbSNP:149202238
4569 4569 -, ctc dbSNP:765590258
4618 4618 a, g dbSNP:769044614
4622 4622 c, t dbSNP:183703685
4626 4626 c, g dbSNP:777076242
4631 4631 c, g dbSNP:143339480
4634 4634 c, g dbSNP:151326457
4636 4636 c, t dbSNP:188022958
4642 4642 a, g dbSNP:28613415
4646 4646 a, g dbSNP:751685913
4669 4669 a, g dbSNP:140694679
4711 4711 c, g dbSNP:145645018
4730 4730 a, c dbSNP:111386789
4732 4732 c, t dbSNP:560350281
4734 4734 -, gag dbSNP:3833027
4736 4736 a, g dbSNP:76820462
4736 4736 -, gag dbSNP:398118956
4737 4737 -, gag dbSNP:397772980
4800 4800 c, t dbSNP:62014610
4801 4801 a, g dbSNP:138185890
4832 4832 -, t dbSNP:747191952
4845 4845 a, t dbSNP:551241364
4853 4853 a, g dbSNP:571529451
4877 4877 c, t dbSNP:142744440
4878 4878 a, g dbSNP:11556089
4899 4899 a, g dbSNP:182172002
4920 4920 -, gttt dbSNP:751100931
4955 4955 c, t dbSNP:763223581
4956 4956 a, g dbSNP:185512187
4992 4992 -, a dbSNP:543558759
4994 4994 -, a dbSNP:375106285
5035 5035 c, t dbSNP:531928122
5039 5039 c, t dbSNP:77620237
5040 5040 g, t dbSNP:566415298
5061 5061 c, t dbSNP:138798418
5063 5063 a, g dbSNP:766453915
5104 5104 c, t dbSNP:558843294
5113 5113 c, g dbSNP:751835194
5129 5129 c, g dbSNP:574634185
5131 5131 a, g dbSNP:190177128
5133 5133 g, t dbSNP:544968102
5138 5138 c, t dbSNP:754298690
5139 5139 a, g dbSNP:181812913
5183 5183 a, g dbSNP:11556090
5218 5218 g, t dbSNP:185838563
5227 5227 c, g, t dbSNP:61740807
5228 5228 a, g dbSNP:190155838
5233 5233 c, g dbSNP:745696109
5243 5243 -, ct dbSNP:754727381
5251 5251 a, t dbSNP:546271180
5268 5268 a, g dbSNP:757298218
5295 5295 a, g dbSNP:373340382
5328 5328 c, t dbSNP:530600662
5331 5331 c, t dbSNP:550493563
5332 5332 a, g dbSNP:143991135
5343 5343 a, g dbSNP:529661153
5390 5390 c, t dbSNP:12900401
5417 5417 c, t dbSNP:757935047
5434 5434 a, g dbSNP:140620343
5465 5465 c, t dbSNP:779537026
5470 5470 g, t dbSNP:528457487
5480 5480 a, g dbSNP:746688800
5491 5491 -, atg dbSNP:747987943
5532 5532 a, g dbSNP:538394494
5536 5536 -, t dbSNP:567028715
5575 5575 c, t dbSNP:3743343
5629 5629 c, g dbSNP:142857253
5647 5647 c, t dbSNP:1052488
5662 5662 -, tactc dbSNP:563622482
5666 5666 c, g dbSNP:529386438
5674 5674 a, c, g dbSNP:28473647
5712 5712 a, t dbSNP:748650960
5726 5726 -, tat dbSNP:544954467
5784 5784 a, g dbSNP:200460714
5812 5812 g, t dbSNP:555324405
5838 5838 g, t dbSNP:199952886
5883 5883 a, c dbSNP:770243847
5884 5884 c, t dbSNP:181158603
5885 5885 a, g dbSNP:534195237
5886 5886 c, t dbSNP:529870126
5896 5896 c, t dbSNP:763293444
5920 5920 g, t dbSNP:577168621
5975 5975 -, catta dbSNP:766854989
6001 6001 c, t dbSNP:763963889
6009 6009 c, g dbSNP:75971163
6020 6020 c, t dbSNP:562987448
6029 6029 a, t dbSNP:774655154
6075 6075 c, t dbSNP:72661162
6079 6079 a, g dbSNP:185374880
6081 6081 a, g dbSNP:543972601
6087 6087 c, t dbSNP:762874455
6089 6089 c, t dbSNP:560849755
6116 6116 c, t dbSNP:189685754
6117 6117 a, c, g dbSNP:577952011
6124 6124 c, g dbSNP:757151117
6132 6132 c, t dbSNP:546862904
6135 6135 -, taac dbSNP:749273217
6135 6135 a, g dbSNP:559937993
6181 6181 c, t dbSNP:183877342
6192 6192 -, atc dbSNP:548861227
6227 6227 c, t dbSNP:774665276
6246 6246 c, g dbSNP:759884384
6314 6314 c, g dbSNP:552020020

Target ORF information:

RefSeq Version XM_011521559
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu58828
Accession Version XM_011521560.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1131bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 3 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)445..633(+)
Misc Feature(2)457..537(+)
Misc Feature(3)562..615(+)
Misc Feature(4)907..1479(+)
Misc Feature(5)958..1473(+)
Position Chain Variation Link
43 43 c, g dbSNP:185101832
51 51 c, t dbSNP:141026314
66 66 a, g dbSNP:189286879
78 78 c, g dbSNP:559192670
106 106 c, t dbSNP:374153657
110 110 a, g dbSNP:576351826
133 133 c, t dbSNP:377193665
178 178 c, t dbSNP:368049449
183 183 a, g dbSNP:764148139
188 188 a, g dbSNP:566294050
191 191 a, g dbSNP:553705278
202 202 g, t dbSNP:73481469
207 207 a, g dbSNP:150828909
208 208 a, c dbSNP:371619137
216 216 a, g dbSNP:554180160
217 217 c, t dbSNP:779985608
218 218 a, g dbSNP:541468340
227 227 a, g dbSNP:574163994
229 229 a, g dbSNP:181631282
241 241 a, g dbSNP:576933372
242 242 c, t dbSNP:545700331
243 243 c, t dbSNP:532547337
263 263 c, g, t dbSNP:531669319
273 273 c, t dbSNP:773776412
274 274 a, g dbSNP:74811524
277 277 a, g dbSNP:77725250
289 289 a, g dbSNP:771217356
305 305 a, c dbSNP:774736734
309 309 c, t dbSNP:759646632
310 310 a, g dbSNP:561709243
322 322 g, t dbSNP:551096373
345 345 a, g dbSNP:747409411
348 348 c, t dbSNP:547430813
370 370 c, t dbSNP:769106246
400 400 c, t dbSNP:760598093
417 417 c, t dbSNP:184408275
418 418 a, g dbSNP:117345612
423 423 c, t dbSNP:757069251
430 430 c, t dbSNP:549990981
431 431 a, g dbSNP:139240383
434 434 g, t dbSNP:535786992
466 466 a, g dbSNP:779576954
475 475 a, c dbSNP:750707381
476 476 a, g dbSNP:758823376
486 486 c, t dbSNP:780111111
508 508 c, t dbSNP:747307840
514 514 c, t dbSNP:768713596
531 531 c, t dbSNP:781320332
540 540 c, t dbSNP:762889441
546 546 a, g dbSNP:1065080
548 548 a, g dbSNP:769657093
550 550 -, g dbSNP:587776882
553 553 a, g dbSNP:138550573
570 570 c, t dbSNP:762612490
571 571 a, g dbSNP:770798158
572 572 c, t dbSNP:387906854
578 578 a, g dbSNP:369221296
579 579 c, t dbSNP:759319479
581 581 c, t dbSNP:767284328
591 591 c, t dbSNP:752196822
600 600 c, t dbSNP:760286714
601 601 a, g dbSNP:587782977
609 609 a, c dbSNP:765624013
616 616 -, t dbSNP:751304511
628 628 c, g dbSNP:750982529
631 631 a, g dbSNP:371876622
651 651 a, g dbSNP:771802144
654 654 c, g dbSNP:775315777
663 663 c, g dbSNP:760233525
669 669 a, g dbSNP:763712900
677 677 c, t dbSNP:377026877
678 678 a, g dbSNP:140275295
681 681 c, t dbSNP:563100221
685 685 c, t dbSNP:751860407
687 687 c, t dbSNP:755354518
692 692 a, c dbSNP:375574124
694 694 c, t dbSNP:145380987
699 699 c, t dbSNP:756124653
720 720 c, t dbSNP:202203039
721 721 a, g dbSNP:749178459
732 732 c, t dbSNP:374111837
738 738 c, t dbSNP:138395233
739 739 a, g dbSNP:548756379
743 743 a, g dbSNP:772034969
745 745 a, g dbSNP:35874463
747 747 c, t dbSNP:375925515
748 748 a, g dbSNP:768050588
753 753 c, t dbSNP:776144459
755 755 a, g dbSNP:763901509
790 790 c, t dbSNP:768301198
809 809 c, t dbSNP:780727302
811 811 a, g dbSNP:555538965
825 825 a, g dbSNP:368710091
829 829 c, t dbSNP:553009515
834 834 c, t dbSNP:769225687
840 840 c, t dbSNP:774814963
841 841 a, g dbSNP:760091844
850 850 c, t dbSNP:150682850
869 869 c, t dbSNP:772510704
870 870 a, g dbSNP:776009102
873 873 a, g dbSNP:202094530
876 876 c, t dbSNP:768951907
881 881 c, g dbSNP:376353913
885 885 c, t dbSNP:776900159
887 887 a, g dbSNP:762010050
890 890 -, a dbSNP:587776881
902 902 a, g dbSNP:755924969
912 912 c, t dbSNP:763705336
918 918 c, t dbSNP:753539358
922 922 -, c dbSNP:779179350
924 924 a, g dbSNP:138940179
933 933 a, g dbSNP:778356642
945 945 c, t dbSNP:745390727
951 951 c, t dbSNP:149443777
952 952 a, g dbSNP:387906853
960 960 c, t dbSNP:144667334
962 962 a, t dbSNP:748488255
966 966 c, t dbSNP:569358776
967 967 a, g dbSNP:773543026
969 969 c, t dbSNP:749576770
975 975 a, g dbSNP:771037017
978 978 -, at dbSNP:587776880
978 978 a, t dbSNP:201614771
981 981 c, t dbSNP:376023379
984 984 c, t dbSNP:139907582
987 987 c, t dbSNP:771854466
1014 1014 c, t dbSNP:145414319
1019 1019 c, t dbSNP:387906851
1020 1020 c, t dbSNP:370620091
1025 1025 c, t dbSNP:387906855
1029 1029 c, t dbSNP:763936253
1034 1034 c, t dbSNP:753486471
1035 1035 a, g, t dbSNP:761391442
1038 1038 a, g dbSNP:764958567
1041 1041 c, t dbSNP:749855793
1048 1048 c, t dbSNP:757961683
1054 1054 c, t dbSNP:781515462
1064 1064 a, g dbSNP:753302359
1073 1073 a, g dbSNP:387906852
1092 1092 a, c, g dbSNP:756530470
1096 1096 c, t dbSNP:387906850
1097 1097 a, g dbSNP:730880214
1105 1105 a, g dbSNP:778345732
1107 1107 c, t dbSNP:117185005
1108 1108 a, g dbSNP:730880215
1115 1115 a, g dbSNP:747862625
1116 1116 c, t dbSNP:769683236
1121 1121 a, g dbSNP:772730200
1122 1122 a, g dbSNP:139616052
1127 1127 a, c dbSNP:142620875
1134 1134 c, t dbSNP:773943578
1149 1149 c, t dbSNP:759140708
1159 1159 c, t dbSNP:764656928
1162 1162 a, g dbSNP:754409301
1168 1168 a, g dbSNP:757548494
1170 1170 c, t dbSNP:771384141
1171 1171 c, g dbSNP:750756638
1205 1205 a, g dbSNP:758586312
1218 1218 c, g dbSNP:780274581
1221 1221 a, g dbSNP:150994304
1227 1227 c, t dbSNP:774470515
1236 1236 a, g dbSNP:781081744
1239 1239 a, c dbSNP:748178271
1242 1242 a, c dbSNP:34188464
1243 1243 c, g dbSNP:769475136
1248 1248 a, g dbSNP:556975942
1269 1269 a, c dbSNP:202098340
1281 1281 c, t dbSNP:751780616
1293 1293 c, g dbSNP:759691171
1296 1296 a, c dbSNP:767649515
1301 1301 c, t dbSNP:752776110
1302 1302 a, g dbSNP:756181827
1307 1307 a, g dbSNP:140880290
1318 1318 g, t dbSNP:387906856
1329 1329 c, t dbSNP:753875974
1339 1339 a, c dbSNP:757106110
1357 1357 a, g dbSNP:370394986
1362 1362 c, t dbSNP:144245324
1365 1365 c, t dbSNP:560348826
1366 1366 a, g dbSNP:730880216
1382 1382 c, t dbSNP:779602560
1383 1383 a, g dbSNP:746494089
1389 1389 c, t dbSNP:768097258
1406 1406 c, t dbSNP:772373466
1431 1431 g, t dbSNP:539999192
1434 1434 c, t dbSNP:760873147
1452 1452 c, g dbSNP:375243021
1459 1459 -, gaca dbSNP:748703880
1459 1459 g, t dbSNP:201263330
1460 1460 a, t dbSNP:776802892
1462 1462 -, tttc dbSNP:769280104
1467 1467 a, c dbSNP:375738035
1482 1482 c, t dbSNP:146659831
1496 1496 a, g, t dbSNP:762012589
1503 1503 c, g dbSNP:750432084
1521 1521 -, t dbSNP:772778568
1531 1531 g, t dbSNP:758196703
1535 1535 a, g dbSNP:766151342
1540 1540 c, g dbSNP:189249001
1542 1542 a, g dbSNP:754534264
1544 1544 a, g dbSNP:780848724
1545 1545 c, g, t dbSNP:201206131
1548 1548 c, g dbSNP:779372678
1557 1557 c, g dbSNP:746421127
1561 1561 a, g dbSNP:772481721
1562 1562 c, t dbSNP:775658712
1565 1565 -, t dbSNP:762375788
1566 1566 c, g dbSNP:368655036
1568 1568 a, t dbSNP:535477771
1580 1580 c, t dbSNP:182280596
1639 1639 a, g dbSNP:565727784
1641 1641 g, t dbSNP:563970330
1647 1647 a, t dbSNP:777850257
1670 1670 c, t dbSNP:534838557
1680 1680 c, t dbSNP:111695641
1730 1730 c, g dbSNP:576999514
1750 1750 a, g dbSNP:79827660
1757 1757 c, t dbSNP:56036573
1758 1758 a, g dbSNP:115213021
1765 1765 a, c dbSNP:754034578
1806 1806 a, g dbSNP:146287966
1816 1816 c, t dbSNP:72661159
1819 1819 c, t dbSNP:565932125
1823 1823 c, t dbSNP:561705330
1833 1833 a, g dbSNP:79368607
1839 1839 c, t dbSNP:746763813
1917 1917 c, t dbSNP:8025774
1929 1929 g, t dbSNP:562488816
1934 1934 g, t dbSNP:78329172
1937 1937 c, g dbSNP:781146835
1944 1944 c, t dbSNP:556034412
1988 1988 -, tct dbSNP:556033972
2013 2013 a, c, g dbSNP:533376218
2018 2018 c, t dbSNP:369493674
2024 2024 a, g dbSNP:765527642
2025 2025 -, ccccgccccaccactccagcagaccttgcccc dbSNP:55978804
2029 2029 a, g dbSNP:529503181
2047 2047 a, t dbSNP:748060441
2057 2057 c, t dbSNP:530801416
2067 2067 g, t dbSNP:769408016
2094 2094 -, g dbSNP:550707472
2099 2099 a, g dbSNP:549263304
2111 2111 c, g dbSNP:565764510
2124 2124 a, g dbSNP:564556206
2140 2140 g, t dbSNP:557988479
2169 2169 a, g dbSNP:571689385
2180 2180 a, t dbSNP:186841203
2213 2213 c, t dbSNP:556286103
2220 2220 c, t dbSNP:762690517
2293 2293 c, g dbSNP:78383292
2304 2304 a, g dbSNP:191679355
2313 2313 a, g dbSNP:138327222
2320 2320 a, g dbSNP:770764038
2330 2330 c, t dbSNP:555675656
2332 2332 c, t dbSNP:572102859
2341 2341 a, g dbSNP:540986513
2358 2358 a, g dbSNP:55970514
2389 2389 a, g dbSNP:532996307
2394 2394 c, t dbSNP:543663488
2395 2395 a, g dbSNP:759877290
2432 2432 a, t dbSNP:181289276
2439 2439 c, t dbSNP:751729329
2489 2489 a, g dbSNP:186538259
2509 2509 a, g dbSNP:190014997
2533 2533 a, c dbSNP:142827677
2595 2595 c, g dbSNP:528490702
2620 2620 a, g dbSNP:8031440
2625 2625 a, g dbSNP:571662141
2631 2631 a, g dbSNP:537594091
2664 2664 g, t dbSNP:550791512
2680 2680 a, g dbSNP:567052377
2696 2696 c, t dbSNP:72661160
2700 2700 g, t dbSNP:764124750
2711 2711 a, g dbSNP:142609762
2732 2732 a, g dbSNP:150600147
2745 2745 c, g dbSNP:112747060
2760 2760 a, g dbSNP:8031627
2764 2764 c, g dbSNP:757346607
2770 2770 a, g dbSNP:569581429
2775 2775 g, t dbSNP:577556064
2781 2781 c, t dbSNP:1061341
2801 2801 a, t dbSNP:537802993
2840 2840 c, t dbSNP:139620908
2864 2864 g, t dbSNP:182242274
2917 2917 -, gaaaaaa dbSNP:752492048
2918 2918 a, t dbSNP:750644411
2936 2936 c, t dbSNP:372217473
2938 2938 c, t dbSNP:2278670
2992 2992 c, g dbSNP:542786788
3028 3028 g, t dbSNP:559626107
3040 3040 a, g dbSNP:778591910
3057 3057 c, t dbSNP:28363812
3098 3098 g, t dbSNP:577631492
3102 3102 c, g, t dbSNP:748088336
3121 3121 c, t dbSNP:777408805
3141 3141 c, g dbSNP:528721359
3169 3169 a, g dbSNP:551779423
3214 3214 c, g dbSNP:188001329
3282 3282 c, g dbSNP:533635017
3292 3292 -, cct dbSNP:369386357
3297 3297 c, t dbSNP:748749707
3305 3305 a, g dbSNP:530788405
3312 3312 -, gaca dbSNP:141408841
3320 3320 c, t dbSNP:191114875
3343 3343 a, g dbSNP:770567861
3383 3383 -, c dbSNP:760948248
3395 3395 c, t dbSNP:144205938
3417 3417 a, g dbSNP:745490452
3443 3443 g, t dbSNP:759130087
3478 3478 g, t dbSNP:772457638
3484 3484 c, t dbSNP:771658087
3528 3528 c, t dbSNP:183913368
3533 3533 -, t dbSNP:777061255
3543 3543 c, t dbSNP:549152312
3557 3557 c, t dbSNP:368370773
3561 3561 c, t dbSNP:761162475
3592 3592 c, t dbSNP:113309733
3593 3593 a, g dbSNP:147761102
3620 3620 c, t dbSNP:557746378
3627 3627 a, g dbSNP:115307123
3639 3639 c, t dbSNP:536610569
3697 3697 c, t dbSNP:556660083
3711 3711 a, g dbSNP:777131267
3720 3720 a, g dbSNP:573356440
3725 3725 -, tt dbSNP:556655485
3742 3742 a, g dbSNP:11638476
3744 3744 -, aaaa dbSNP:762028441
3744 3744 -, a dbSNP:573496525
3744 3744 a, g dbSNP:188412401
3757 3757 a, g dbSNP:117707762
3797 3797 c, t dbSNP:12595334
3799 3799 c, t dbSNP:139575773
3800 3800 c, g dbSNP:62014609
3808 3808 c, g dbSNP:565420956
3823 3823 c, g dbSNP:767340373
3845 3845 c, t dbSNP:555997375
3874 3874 c, t dbSNP:193013035
3901 3901 c, t dbSNP:752493489
3904 3904 -, c dbSNP:750918524
3918 3918 c, t dbSNP:755985886
3928 3928 g, t dbSNP:777786341
3959 3959 a, g dbSNP:145102966
3966 3966 c, t dbSNP:372633359
3967 3967 c, t dbSNP:561370577
3994 3994 c, t dbSNP:530174899
4004 4004 c, t dbSNP:80226876
4010 4010 c, g dbSNP:565929299
4062 4062 c, g, t dbSNP:72661161
4063 4063 a, g dbSNP:186967388
4075 4075 a, c dbSNP:571423885
4241 4241 c, t dbSNP:191410394
4262 4262 c, t dbSNP:112868185
4265 4265 g, t dbSNP:566917040
4267 4267 a, g dbSNP:771684858
4301 4301 a, t dbSNP:775905689
4308 4308 c, t dbSNP:3743342
4335 4335 a, g dbSNP:552626399
4382 4382 a, g dbSNP:573415984
4405 4405 c, g dbSNP:149202238
4410 4410 -, ctc dbSNP:765590258
4459 4459 a, g dbSNP:769044614
4463 4463 c, t dbSNP:183703685
4467 4467 c, g dbSNP:777076242
4472 4472 c, g dbSNP:143339480
4475 4475 c, g dbSNP:151326457
4477 4477 c, t dbSNP:188022958
4483 4483 a, g dbSNP:28613415
4487 4487 a, g dbSNP:751685913
4510 4510 a, g dbSNP:140694679
4552 4552 c, g dbSNP:145645018
4571 4571 a, c dbSNP:111386789
4573 4573 c, t dbSNP:560350281
4575 4575 -, gag dbSNP:3833027
4577 4577 a, g dbSNP:76820462
4577 4577 -, gag dbSNP:398118956
4578 4578 -, gag dbSNP:397772980
4641 4641 c, t dbSNP:62014610
4642 4642 a, g dbSNP:138185890
4673 4673 -, t dbSNP:747191952
4686 4686 a, t dbSNP:551241364
4694 4694 a, g dbSNP:571529451
4718 4718 c, t dbSNP:142744440
4719 4719 a, g dbSNP:11556089
4740 4740 a, g dbSNP:182172002
4761 4761 -, gttt dbSNP:751100931
4796 4796 c, t dbSNP:763223581
4797 4797 a, g dbSNP:185512187
4833 4833 -, a dbSNP:543558759
4835 4835 -, a dbSNP:375106285
4876 4876 c, t dbSNP:531928122
4880 4880 c, t dbSNP:77620237
4881 4881 g, t dbSNP:566415298
4902 4902 c, t dbSNP:138798418
4904 4904 a, g dbSNP:766453915
4945 4945 c, t dbSNP:558843294
4954 4954 c, g dbSNP:751835194
4970 4970 c, g dbSNP:574634185
4972 4972 a, g dbSNP:190177128
4974 4974 g, t dbSNP:544968102
4979 4979 c, t dbSNP:754298690
4980 4980 a, g dbSNP:181812913
5024 5024 a, g dbSNP:11556090
5059 5059 g, t dbSNP:185838563
5068 5068 c, g, t dbSNP:61740807
5069 5069 a, g dbSNP:190155838
5074 5074 c, g dbSNP:745696109
5084 5084 -, ct dbSNP:754727381
5092 5092 a, t dbSNP:546271180
5109 5109 a, g dbSNP:757298218
5136 5136 a, g dbSNP:373340382
5169 5169 c, t dbSNP:530600662
5172 5172 c, t dbSNP:550493563
5173 5173 a, g dbSNP:143991135
5184 5184 a, g dbSNP:529661153
5231 5231 c, t dbSNP:12900401
5258 5258 c, t dbSNP:757935047
5275 5275 a, g dbSNP:140620343
5306 5306 c, t dbSNP:779537026
5311 5311 g, t dbSNP:528457487
5321 5321 a, g dbSNP:746688800
5332 5332 -, atg dbSNP:747987943
5373 5373 a, g dbSNP:538394494
5377 5377 -, t dbSNP:567028715
5416 5416 c, t dbSNP:3743343
5470 5470 c, g dbSNP:142857253
5488 5488 c, t dbSNP:1052488
5503 5503 -, tactc dbSNP:563622482
5507 5507 c, g dbSNP:529386438
5515 5515 a, c, g dbSNP:28473647
5553 5553 a, t dbSNP:748650960
5567 5567 -, tat dbSNP:544954467
5625 5625 a, g dbSNP:200460714
5653 5653 g, t dbSNP:555324405
5679 5679 g, t dbSNP:199952886
5724 5724 a, c dbSNP:770243847
5725 5725 c, t dbSNP:181158603
5726 5726 a, g dbSNP:534195237
5727 5727 c, t dbSNP:529870126
5737 5737 c, t dbSNP:763293444
5761 5761 g, t dbSNP:577168621
5816 5816 -, catta dbSNP:766854989
5842 5842 c, t dbSNP:763963889
5850 5850 c, g dbSNP:75971163
5861 5861 c, t dbSNP:562987448
5870 5870 a, t dbSNP:774655154
5916 5916 c, t dbSNP:72661162
5920 5920 a, g dbSNP:185374880
5922 5922 a, g dbSNP:543972601
5928 5928 c, t dbSNP:762874455
5930 5930 c, t dbSNP:560849755
5957 5957 c, t dbSNP:189685754
5958 5958 a, c, g dbSNP:577952011
5965 5965 c, g dbSNP:757151117
5973 5973 c, t dbSNP:546862904
5976 5976 -, taac dbSNP:749273217
5976 5976 a, g dbSNP:559937993
6022 6022 c, t dbSNP:183877342
6033 6033 -, atc dbSNP:548861227
6068 6068 c, t dbSNP:774665276
6087 6087 c, g dbSNP:759884384
6155 6155 c, g dbSNP:552020020

Target ORF information:

RefSeq Version XM_011521560
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens SMAD family member 3 (SMAD3), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19966
Accession Version NM_005902.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1278bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu19966D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 3 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BF058230.1, BC050743.1, U76622.1, AI991957.1, BG251847.1, BX506233.1, BQ917888.1, BM551682.1, BM722372.1, BE905995.1, AL110265.1, AF151027.1 and AA493306.1. This sequence is a reference standard in the RefSeqGene project. On or before Sep 20, 2004 this sequence version replaced gi:7661691, gi:42476202. Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC050743.1, U68019.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)179..181(+)
Misc Feature(2)302..304(+)
Misc Feature(3)320..694(+)
Misc Feature(4)320..322(+)
Misc Feature(5)320..322(+)
Misc Feature(6)320..322(+)
Misc Feature(7)395..601(+)
Misc Feature(8)416..418(+)
Misc Feature(9)419..421(+)
Misc Feature(10)488..676(+)
Misc Feature(11)707..991(+)
Misc Feature(12)833..835(+)
Misc Feature(13)833..835(+)
Misc Feature(14)833..835(+)
Misc Feature(15)833..835(+)
Misc Feature(16)908..910(+)
Misc Feature(17)908..910(+)
Misc Feature(18)908..910(+)
Misc Feature(19)908..910(+)
Misc Feature(20)920..922(+)
Misc Feature(21)920..922(+)
Misc Feature(22)920..922(+)
Misc Feature(23)920..922(+)
Misc Feature(24)920..922(+)
Misc Feature(25)935..937(+)
Misc Feature(26)935..937(+)
Misc Feature(27)935..937(+)
Misc Feature(28)935..937(+)
Misc Feature(29)935..937(+)
Misc Feature(30)968..1540(+)
Misc Feature(31)1019..1534(+)
Misc Feature(32)1109..1270(+)
Misc Feature(33)1430..1432(+)
Misc Feature(34)1544..1546(+)
Misc Feature(35)1550..1552(+)
Misc Feature(36)1562..1564(+)
Misc Feature(37)1565..1567(+)
Misc Feature(38)1571..1573(+)
Exon (1)1..504
Gene Synonym:
Exon (2)505..698
Gene Synonym:
Exon (3)699..830
Gene Synonym:
Exon (4)831..905
Gene Synonym:
Exon (5)906..956
Gene Synonym:
Exon (6)957..1169
Gene Synonym:
Exon (7)1170..1307
Gene Synonym:
Exon (8)1308..1452
Gene Synonym:
Exon (9)1453..6232
Gene Synonym:
Position Chain Variation Link
54 54 c, g dbSNP:539333807
184 184 c, t dbSNP:556470157
258 258 c, t dbSNP:760998942
259 259 g, t dbSNP:764492850
271 271 c, t dbSNP:144374592
272 272 a, c dbSNP:757567277
274 274 c, g dbSNP:765385701
276 276 c, t dbSNP:36221703
277 277 c, g dbSNP:758575599
278 278 g, t dbSNP:780103267
280 280 c, t dbSNP:368637535
281 281 c, t dbSNP:754796428
282 282 g, t dbSNP:781095541
284 284 a, g dbSNP:1061427
288 288 c, t dbSNP:769421223
289 289 c, t dbSNP:777303695
290 290 c, t dbSNP:748781102
298 298 c, t dbSNP:770457783
304 304 a, g dbSNP:775955959
305 305 a, t dbSNP:761230207
307 307 c, t dbSNP:149022137
313 313 a, g dbSNP:776987925
316 316 c, t dbSNP:191495317
324 324 c, t dbSNP:762101727
325 325 c, t dbSNP:765454938
331 331 c, g dbSNP:750644348
334 334 a, g dbSNP:201824839
347 347 a, g dbSNP:183418982
361 361 a, c dbSNP:751526306
364 364 a, g dbSNP:187952791
370 370 c, t dbSNP:780995229
372 372 g, t dbSNP:191612061
379 379 a, g dbSNP:755882401
384 384 a, g dbSNP:777440658
400 400 g, t dbSNP:748990258
410 410 c, t dbSNP:770416788
433 433 g, t dbSNP:778462473
467 467 a, c dbSNP:730880213
473 473 a, g dbSNP:745387614
475 475 c, t dbSNP:769153458
478 478 c, g dbSNP:368132899
493 493 c, t dbSNP:368462984
497 497 a, g dbSNP:762200897
527 527 a, g dbSNP:779576954
536 536 a, c dbSNP:750707381
537 537 a, g dbSNP:758823376
547 547 c, t dbSNP:780111111
569 569 c, t dbSNP:747307840
575 575 c, t dbSNP:768713596
592 592 c, t dbSNP:781320332
601 601 c, t dbSNP:762889441
607 607 a, g dbSNP:1065080
609 609 a, g dbSNP:769657093
611 611 -, g dbSNP:587776882
614 614 a, g dbSNP:138550573
631 631 c, t dbSNP:762612490
632 632 a, g dbSNP:770798158
633 633 c, t dbSNP:387906854
639 639 a, g dbSNP:369221296
640 640 c, t dbSNP:759319479
642 642 c, t dbSNP:767284328
652 652 c, t dbSNP:752196822
661 661 c, t dbSNP:760286714
662 662 a, g dbSNP:587782977
670 670 a, c dbSNP:765624013
677 677 -, t dbSNP:751304511
689 689 c, g dbSNP:750982529
692 692 a, g dbSNP:371876622
712 712 a, g dbSNP:771802144
715 715 c, g dbSNP:775315777
724 724 c, g dbSNP:760233525
730 730 a, g dbSNP:763712900
738 738 c, t dbSNP:377026877
739 739 a, g dbSNP:140275295
742 742 c, t dbSNP:563100221
746 746 c, t dbSNP:751860407
748 748 c, t dbSNP:755354518
753 753 a, c dbSNP:375574124
755 755 c, t dbSNP:145380987
760 760 c, t dbSNP:756124653
781 781 c, t dbSNP:202203039
782 782 a, g dbSNP:749178459
793 793 c, t dbSNP:374111837
799 799 c, t dbSNP:138395233
800 800 a, g dbSNP:548756379
804 804 a, g dbSNP:772034969
806 806 a, g dbSNP:35874463
808 808 c, t dbSNP:375925515
809 809 a, g dbSNP:768050588
814 814 c, t dbSNP:776144459
816 816 a, g dbSNP:763901509
851 851 c, t dbSNP:768301198
870 870 c, t dbSNP:780727302
872 872 a, g dbSNP:555538965
886 886 a, g dbSNP:368710091
890 890 c, t dbSNP:553009515
895 895 c, t dbSNP:769225687
901 901 c, t dbSNP:774814963
902 902 a, g dbSNP:760091844
911 911 c, t dbSNP:150682850
930 930 c, t dbSNP:772510704
931 931 a, g dbSNP:776009102
934 934 a, g dbSNP:202094530
937 937 c, t dbSNP:768951907
942 942 c, g dbSNP:376353913
946 946 c, t dbSNP:776900159
948 948 a, g dbSNP:762010050
951 951 -, a dbSNP:587776881
963 963 a, g dbSNP:755924969
973 973 c, t dbSNP:763705336
979 979 c, t dbSNP:753539358
983 983 -, c dbSNP:779179350
985 985 a, g dbSNP:138940179
994 994 a, g dbSNP:778356642
1006 1006 c, t dbSNP:745390727
1012 1012 c, t dbSNP:149443777
1013 1013 a, g dbSNP:387906853
1021 1021 c, t dbSNP:144667334
1023 1023 a, t dbSNP:748488255
1027 1027 c, t dbSNP:569358776
1028 1028 a, g dbSNP:773543026
1030 1030 c, t dbSNP:749576770
1036 1036 a, g dbSNP:771037017
1039 1039 -, at dbSNP:587776880
1039 1039 a, t dbSNP:201614771
1042 1042 c, t dbSNP:376023379
1045 1045 c, t dbSNP:139907582
1048 1048 c, t dbSNP:771854466
1075 1075 c, t dbSNP:145414319
1080 1080 c, t dbSNP:387906851
1081 1081 c, t dbSNP:370620091
1086 1086 c, t dbSNP:387906855
1090 1090 c, t dbSNP:763936253
1095 1095 c, t dbSNP:753486471
1096 1096 a, g, t dbSNP:761391442
1099 1099 a, g dbSNP:764958567
1102 1102 c, t dbSNP:749855793
1109 1109 c, t dbSNP:757961683
1115 1115 c, t dbSNP:781515462
1125 1125 a, g dbSNP:753302359
1134 1134 a, g dbSNP:387906852
1153 1153 a, c, g dbSNP:756530470
1157 1157 c, t dbSNP:387906850
1158 1158 a, g dbSNP:730880214
1166 1166 a, g dbSNP:778345732
1168 1168 c, t dbSNP:117185005
1169 1169 a, g dbSNP:730880215
1176 1176 a, g dbSNP:747862625
1177 1177 c, t dbSNP:769683236
1182 1182 a, g dbSNP:772730200
1183 1183 a, g dbSNP:139616052
1188 1188 a, c dbSNP:142620875
1195 1195 c, t dbSNP:773943578
1210 1210 c, t dbSNP:759140708
1220 1220 c, t dbSNP:764656928
1223 1223 a, g dbSNP:754409301
1229 1229 a, g dbSNP:757548494
1231 1231 c, t dbSNP:771384141
1232 1232 c, g dbSNP:750756638
1266 1266 a, g dbSNP:758586312
1279 1279 c, g dbSNP:780274581
1282 1282 a, g dbSNP:150994304
1288 1288 c, t dbSNP:774470515
1297 1297 a, g dbSNP:781081744
1300 1300 a, c dbSNP:748178271
1303 1303 a, c dbSNP:34188464
1304 1304 c, g dbSNP:769475136
1309 1309 a, g dbSNP:556975942
1330 1330 a, c dbSNP:202098340
1342 1342 c, t dbSNP:751780616
1354 1354 c, g dbSNP:759691171
1357 1357 a, c dbSNP:767649515
1362 1362 c, t dbSNP:752776110
1363 1363 a, g dbSNP:756181827
1368 1368 a, g dbSNP:140880290
1379 1379 g, t dbSNP:387906856
1390 1390 c, t dbSNP:753875974
1400 1400 a, c dbSNP:757106110
1418 1418 a, g dbSNP:370394986
1423 1423 c, t dbSNP:144245324
1426 1426 c, t dbSNP:560348826
1427 1427 a, g dbSNP:730880216
1443 1443 c, t dbSNP:779602560
1444 1444 a, g dbSNP:746494089
1450 1450 c, t dbSNP:768097258
1467 1467 c, t dbSNP:772373466
1492 1492 g, t dbSNP:539999192
1495 1495 c, t dbSNP:760873147
1513 1513 c, g dbSNP:375243021
1520 1520 -, gaca dbSNP:748703880
1520 1520 g, t dbSNP:201263330
1521 1521 a, t dbSNP:776802892
1523 1523 -, tttc dbSNP:769280104
1528 1528 a, c dbSNP:375738035
1543 1543 c, t dbSNP:146659831
1557 1557 a, g, t dbSNP:762012589
1564 1564 c, g dbSNP:750432084
1582 1582 -, t dbSNP:772778568
1592 1592 g, t dbSNP:758196703
1596 1596 a, g dbSNP:766151342
1601 1601 c, g dbSNP:189249001
1603 1603 a, g dbSNP:754534264
1605 1605 a, g dbSNP:780848724
1606 1606 c, g, t dbSNP:201206131
1609 1609 c, g dbSNP:779372678
1618 1618 c, g dbSNP:746421127
1622 1622 a, g dbSNP:772481721
1623 1623 c, t dbSNP:775658712
1626 1626 -, t dbSNP:762375788
1627 1627 c, g dbSNP:368655036
1629 1629 a, t dbSNP:535477771
1641 1641 c, t dbSNP:182280596
1700 1700 a, g dbSNP:565727784
1702 1702 g, t dbSNP:563970330
1708 1708 a, t dbSNP:777850257
1731 1731 c, t dbSNP:534838557
1741 1741 c, t dbSNP:111695641
1791 1791 c, g dbSNP:576999514
1811 1811 a, g dbSNP:79827660
1818 1818 c, t dbSNP:56036573
1819 1819 a, g dbSNP:115213021
1826 1826 a, c dbSNP:754034578
1867 1867 a, g dbSNP:146287966
1877 1877 c, t dbSNP:72661159
1880 1880 c, t dbSNP:565932125
1884 1884 c, t dbSNP:561705330
1894 1894 a, g dbSNP:79368607
1900 1900 c, t dbSNP:746763813
1978 1978 c, t dbSNP:8025774
1990 1990 g, t dbSNP:562488816
1995 1995 g, t dbSNP:78329172
1998 1998 c, g dbSNP:781146835
2005 2005 c, t dbSNP:556034412
2049 2049 -, tct dbSNP:556033972
2074 2074 a, c, g dbSNP:533376218
2079 2079 c, t dbSNP:369493674
2085 2085 a, g dbSNP:765527642
2086 2086 -, ccccgccccaccactccagcagaccttgcccc dbSNP:55978804
2090 2090 a, g dbSNP:529503181
2108 2108 a, t dbSNP:748060441
2118 2118 c, t dbSNP:530801416
2128 2128 g, t dbSNP:769408016
2155 2155 -, g dbSNP:550707472
2160 2160 a, g dbSNP:549263304
2172 2172 c, g dbSNP:565764510
2185 2185 a, g dbSNP:564556206
2201 2201 g, t dbSNP:557988479
2230 2230 a, g dbSNP:571689385
2241 2241 a, t dbSNP:186841203
2274 2274 c, t dbSNP:556286103
2281 2281 c, t dbSNP:762690517
2354 2354 c, g dbSNP:78383292
2365 2365 a, g dbSNP:191679355
2374 2374 a, g dbSNP:138327222
2381 2381 a, g dbSNP:770764038
2391 2391 c, t dbSNP:555675656
2393 2393 c, t dbSNP:572102859
2402 2402 a, g dbSNP:540986513
2419 2419 a, g dbSNP:55970514
2450 2450 a, g dbSNP:532996307
2455 2455 c, t dbSNP:543663488
2456 2456 a, g dbSNP:759877290
2493 2493 a, t dbSNP:181289276
2500 2500 c, t dbSNP:751729329
2550 2550 a, g dbSNP:186538259
2570 2570 a, g dbSNP:190014997
2594 2594 a, c dbSNP:142827677
2656 2656 c, g dbSNP:528490702
2681 2681 a, g dbSNP:8031440
2686 2686 a, g dbSNP:571662141
2692 2692 a, g dbSNP:537594091
2725 2725 g, t dbSNP:550791512
2741 2741 a, g dbSNP:567052377
2757 2757 c, t dbSNP:72661160
2761 2761 g, t dbSNP:764124750
2772 2772 a, g dbSNP:142609762
2793 2793 a, g dbSNP:150600147
2806 2806 c, g dbSNP:112747060
2821 2821 a, g dbSNP:8031627
2825 2825 c, g dbSNP:757346607
2831 2831 a, g dbSNP:569581429
2836 2836 g, t dbSNP:577556064
2842 2842 c, t dbSNP:1061341
2862 2862 a, t dbSNP:537802993
2901 2901 c, t dbSNP:139620908
2925 2925 g, t dbSNP:182242274
2978 2978 -, gaaaaaa dbSNP:752492048
2979 2979 a, t dbSNP:750644411
2997 2997 c, t dbSNP:372217473
2999 2999 c, t dbSNP:2278670
3053 3053 c, g dbSNP:542786788
3089 3089 g, t dbSNP:559626107
3101 3101 a, g dbSNP:778591910
3118 3118 c, t dbSNP:28363812
3159 3159 g, t dbSNP:577631492
3163 3163 c, g, t dbSNP:748088336
3182 3182 c, t dbSNP:777408805
3202 3202 c, g dbSNP:528721359
3230 3230 a, g dbSNP:551779423
3275 3275 c, g dbSNP:188001329
3343 3343 c, g dbSNP:533635017
3353 3353 -, cct dbSNP:369386357
3358 3358 c, t dbSNP:748749707
3366 3366 a, g dbSNP:530788405
3373 3373 -, gaca dbSNP:141408841
3381 3381 c, t dbSNP:191114875
3404 3404 a, g dbSNP:770567861
3444 3444 -, c dbSNP:760948248
3456 3456 c, t dbSNP:144205938
3478 3478 a, g dbSNP:745490452
3504 3504 g, t dbSNP:759130087
3539 3539 g, t dbSNP:772457638
3545 3545 c, t dbSNP:771658087
3589 3589 c, t dbSNP:183913368
3594 3594 -, t dbSNP:777061255
3604 3604 c, t dbSNP:549152312
3618 3618 c, t dbSNP:368370773
3622 3622 c, t dbSNP:761162475
3653 3653 c, t dbSNP:113309733
3654 3654 a, g dbSNP:147761102
3681 3681 c, t dbSNP:557746378
3688 3688 a, g dbSNP:115307123
3700 3700 c, t dbSNP:536610569
3758 3758 c, t dbSNP:556660083
3772 3772 a, g dbSNP:777131267
3781 3781 a, g dbSNP:573356440
3786 3786 -, tt dbSNP:556655485
3803 3803 a, g dbSNP:11638476
3805 3805 -, aaaa dbSNP:762028441
3805 3805 -, a dbSNP:573496525
3805 3805 a, g dbSNP:188412401
3818 3818 a, g dbSNP:117707762
3858 3858 c, t dbSNP:12595334
3860 3860 c, t dbSNP:139575773
3861 3861 c, g dbSNP:62014609
3869 3869 c, g dbSNP:565420956
3884 3884 c, g dbSNP:767340373
3906 3906 c, t dbSNP:555997375
3935 3935 c, t dbSNP:193013035
3962 3962 c, t dbSNP:752493489
3965 3965 -, c dbSNP:750918524
3979 3979 c, t dbSNP:755985886
3989 3989 g, t dbSNP:777786341
4020 4020 a, g dbSNP:145102966
4027 4027 c, t dbSNP:372633359
4028 4028 c, t dbSNP:561370577
4055 4055 c, t dbSNP:530174899
4065 4065 c, t dbSNP:80226876
4071 4071 c, g dbSNP:565929299
4123 4123 c, g, t dbSNP:72661161
4124 4124 a, g dbSNP:186967388
4136 4136 a, c dbSNP:571423885
4302 4302 c, t dbSNP:191410394
4323 4323 c, t dbSNP:112868185
4326 4326 g, t dbSNP:566917040
4328 4328 a, g dbSNP:771684858
4362 4362 a, t dbSNP:775905689
4369 4369 c, t dbSNP:3743342
4396 4396 a, g dbSNP:552626399
4443 4443 a, g dbSNP:573415984
4466 4466 c, g dbSNP:149202238
4471 4471 -, ctc dbSNP:765590258
4520 4520 a, g dbSNP:769044614
4524 4524 c, t dbSNP:183703685
4528 4528 c, g dbSNP:777076242
4533 4533 c, g dbSNP:143339480
4536 4536 c, g dbSNP:151326457
4538 4538 c, t dbSNP:188022958
4544 4544 a, g dbSNP:28613415
4548 4548 a, g dbSNP:751685913
4571 4571 a, g dbSNP:140694679
4613 4613 c, g dbSNP:145645018
4632 4632 a, c dbSNP:111386789
4634 4634 c, t dbSNP:560350281
4636 4636 -, gag dbSNP:3833027
4636 4636 -, gag dbSNP:397772980
4638 4638 a, g dbSNP:76820462
4638 4638 -, gag dbSNP:398118956
4699 4699 c, t dbSNP:62014610
4700 4700 a, g dbSNP:138185890
4731 4731 -, t dbSNP:747191952
4744 4744 a, t dbSNP:551241364
4752 4752 a, g dbSNP:571529451
4776 4776 c, t dbSNP:142744440
4777 4777 a, g dbSNP:11556089
4798 4798 a, g dbSNP:182172002
4819 4819 -, gttt dbSNP:751100931
4854 4854 c, t dbSNP:763223581
4855 4855 a, g dbSNP:185512187
4891 4891 -, a dbSNP:543558759
4893 4893 -, a dbSNP:375106285
4934 4934 c, t dbSNP:531928122
4938 4938 c, t dbSNP:77620237
4939 4939 g, t dbSNP:566415298
4960 4960 c, t dbSNP:138798418
4962 4962 a, g dbSNP:766453915
5003 5003 c, t dbSNP:558843294
5012 5012 c, g dbSNP:751835194
5028 5028 c, g dbSNP:574634185
5030 5030 a, g dbSNP:190177128
5032 5032 g, t dbSNP:544968102
5037 5037 c, t dbSNP:754298690
5038 5038 a, g dbSNP:181812913
5082 5082 a, g dbSNP:11556090
5117 5117 g, t dbSNP:185838563
5126 5126 c, g, t dbSNP:61740807
5127 5127 a, g dbSNP:190155838
5132 5132 c, g dbSNP:745696109
5142 5142 -, ct dbSNP:754727381
5150 5150 a, t dbSNP:546271180
5167 5167 a, g dbSNP:757298218
5194 5194 a, g dbSNP:373340382
5227 5227 c, t dbSNP:530600662
5230 5230 c, t dbSNP:550493563
5231 5231 a, g dbSNP:143991135
5242 5242 a, g dbSNP:529661153
5289 5289 c, t dbSNP:12900401
5316 5316 c, t dbSNP:757935047
5333 5333 a, g dbSNP:140620343
5364 5364 c, t dbSNP:779537026
5369 5369 g, t dbSNP:528457487
5379 5379 a, g dbSNP:746688800
5390 5390 -, atg dbSNP:747987943
5431 5431 a, g dbSNP:538394494
5435 5435 -, t dbSNP:567028715
5474 5474 c, t dbSNP:3743343
5528 5528 c, g dbSNP:142857253
5546 5546 c, t dbSNP:1052488
5561 5561 -, tactc dbSNP:563622482
5565 5565 c, g dbSNP:529386438
5573 5573 a, c, g dbSNP:28473647
5611 5611 a, t dbSNP:748650960
5625 5625 -, tat dbSNP:544954467
5683 5683 a, g dbSNP:200460714
5711 5711 g, t dbSNP:555324405
5737 5737 g, t dbSNP:199952886
5782 5782 a, c dbSNP:770243847
5783 5783 c, t dbSNP:181158603
5784 5784 a, g dbSNP:534195237
5785 5785 c, t dbSNP:529870126
5795 5795 c, t dbSNP:763293444
5819 5819 g, t dbSNP:577168621
5874 5874 -, catta dbSNP:766854989
5900 5900 c, t dbSNP:763963889
5908 5908 c, g dbSNP:75971163
5919 5919 c, t dbSNP:562987448
5928 5928 a, t dbSNP:774655154
5974 5974 c, t dbSNP:72661162
5978 5978 a, g dbSNP:185374880
5980 5980 a, g dbSNP:543972601
5986 5986 c, t dbSNP:762874455
5988 5988 c, t dbSNP:560849755
6015 6015 c, t dbSNP:189685754
6016 6016 a, c, g dbSNP:577952011
6023 6023 c, g dbSNP:757151117
6031 6031 c, t dbSNP:546862904
6034 6034 -, taac dbSNP:749273217
6034 6034 a, g dbSNP:559937993
6080 6080 c, t dbSNP:183877342
6091 6091 -, atc dbSNP:548861227
6126 6126 c, t dbSNP:774665276
6145 6145 c, g dbSNP:759884384
6213 6213 c, g dbSNP:552020020

Target ORF information:

RefSeq Version NM_005902
Organism Homo sapiens (human)
Definition Homo sapiens SMAD family member 3 (SMAD3), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23553
Accession Version NM_001145104.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 693bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu23553D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 3 isoform 4
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA977882.1, DA755047.1 and AC012568.7. Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK300614.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA2147975 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)21..23(+)
Misc Feature(2)177..749(+)
Misc Feature(3)228..743(+)
Exon (1)1..39
Gene Synonym:
Exon (2)40..114
Gene Synonym:
Exon (3)115..165
Gene Synonym:
Exon (4)166..378
Gene Synonym:
Exon (5)379..516
Gene Synonym:
Exon (6)517..661
Gene Synonym:
Exon (7)662..5441
Gene Synonym:
Position Chain Variation Link
19 19 c, g dbSNP:556105859
26 26 c, t dbSNP:765199044
36 36 a, g dbSNP:112991343
60 60 c, t dbSNP:768301198
79 79 c, t dbSNP:780727302
81 81 a, g dbSNP:555538965
95 95 a, g dbSNP:368710091
99 99 c, t dbSNP:553009515
104 104 c, t dbSNP:769225687
110 110 c, t dbSNP:774814963
111 111 a, g dbSNP:760091844
120 120 c, t dbSNP:150682850
139 139 c, t dbSNP:772510704
140 140 a, g dbSNP:776009102
143 143 a, g dbSNP:202094530
146 146 c, t dbSNP:768951907
151 151 c, g dbSNP:376353913
155 155 c, t dbSNP:776900159
157 157 a, g dbSNP:762010050
160 160 -, a dbSNP:587776881
172 172 a, g dbSNP:755924969
182 182 c, t dbSNP:763705336
188 188 c, t dbSNP:753539358
192 192 -, c dbSNP:779179350
194 194 a, g dbSNP:138940179
203 203 a, g dbSNP:778356642
215 215 c, t dbSNP:745390727
221 221 c, t dbSNP:149443777
222 222 a, g dbSNP:387906853
230 230 c, t dbSNP:144667334
232 232 a, t dbSNP:748488255
236 236 c, t dbSNP:569358776
237 237 a, g dbSNP:773543026
239 239 c, t dbSNP:749576770
245 245 a, g dbSNP:771037017
248 248 -, at dbSNP:587776880
248 248 a, t dbSNP:201614771
251 251 c, t dbSNP:376023379
254 254 c, t dbSNP:139907582
257 257 c, t dbSNP:771854466
284 284 c, t dbSNP:145414319
289 289 c, t dbSNP:387906851
290 290 c, t dbSNP:370620091
295 295 c, t dbSNP:387906855
299 299 c, t dbSNP:763936253
304 304 c, t dbSNP:753486471
305 305 a, g, t dbSNP:761391442
308 308 a, g dbSNP:764958567
311 311 c, t dbSNP:749855793
318 318 c, t dbSNP:757961683
324 324 c, t dbSNP:781515462
334 334 a, g dbSNP:753302359
343 343 a, g dbSNP:387906852
362 362 a, c, g dbSNP:756530470
366 366 c, t dbSNP:387906850
367 367 a, g dbSNP:730880214
375 375 a, g dbSNP:778345732
377 377 c, t dbSNP:117185005
378 378 a, g dbSNP:730880215
385 385 a, g dbSNP:747862625
386 386 c, t dbSNP:769683236
391 391 a, g dbSNP:772730200
392 392 a, g dbSNP:139616052
397 397 a, c dbSNP:142620875
404 404 c, t dbSNP:773943578
419 419 c, t dbSNP:759140708
429 429 c, t dbSNP:764656928
432 432 a, g dbSNP:754409301
438 438 a, g dbSNP:757548494
440 440 c, t dbSNP:771384141
441 441 c, g dbSNP:750756638
475 475 a, g dbSNP:758586312
488 488 c, g dbSNP:780274581
491 491 a, g dbSNP:150994304
497 497 c, t dbSNP:774470515
506 506 a, g dbSNP:781081744
509 509 a, c dbSNP:748178271
512 512 a, c dbSNP:34188464
513 513 c, g dbSNP:769475136
518 518 a, g dbSNP:556975942
539 539 a, c dbSNP:202098340
551 551 c, t dbSNP:751780616
563 563 c, g dbSNP:759691171
566 566 a, c dbSNP:767649515
571 571 c, t dbSNP:752776110
572 572 a, g dbSNP:756181827
577 577 a, g dbSNP:140880290
588 588 g, t dbSNP:387906856
599 599 c, t dbSNP:753875974
609 609 a, c dbSNP:757106110
627 627 a, g dbSNP:370394986
632 632 c, t dbSNP:144245324
635 635 c, t dbSNP:560348826
636 636 a, g dbSNP:730880216
652 652 c, t dbSNP:779602560
653 653 a, g dbSNP:746494089
659 659 c, t dbSNP:768097258
676 676 c, t dbSNP:772373466
701 701 g, t dbSNP:539999192
704 704 c, t dbSNP:760873147
722 722 c, g dbSNP:375243021
729 729 -, gaca dbSNP:748703880
729 729 g, t dbSNP:201263330
730 730 a, t dbSNP:776802892
732 732 -, tttc dbSNP:769280104
737 737 a, c dbSNP:375738035
752 752 c, t dbSNP:146659831
766 766 a, g, t dbSNP:762012589
773 773 c, g dbSNP:750432084
791 791 -, t dbSNP:772778568
801 801 g, t dbSNP:758196703
805 805 a, g dbSNP:766151342
810 810 c, g dbSNP:189249001
812 812 a, g dbSNP:754534264
814 814 a, g dbSNP:780848724
815 815 c, g, t dbSNP:201206131
818 818 c, g dbSNP:779372678
827 827 c, g dbSNP:746421127
831 831 a, g dbSNP:772481721
832 832 c, t dbSNP:775658712
835 835 -, t dbSNP:762375788
836 836 c, g dbSNP:368655036
838 838 a, t dbSNP:535477771
850 850 c, t dbSNP:182280596
909 909 a, g dbSNP:565727784
911 911 g, t dbSNP:563970330
917 917 a, t dbSNP:777850257
940 940 c, t dbSNP:534838557
950 950 c, t dbSNP:111695641
1000 1000 c, g dbSNP:576999514
1020 1020 a, g dbSNP:79827660
1027 1027 c, t dbSNP:56036573
1028 1028 a, g dbSNP:115213021
1035 1035 a, c dbSNP:754034578
1076 1076 a, g dbSNP:146287966
1086 1086 c, t dbSNP:72661159
1089 1089 c, t dbSNP:565932125
1093 1093 c, t dbSNP:561705330
1103 1103 a, g dbSNP:79368607
1109 1109 c, t dbSNP:746763813
1187 1187 c, t dbSNP:8025774
1199 1199 g, t dbSNP:562488816
1204 1204 g, t dbSNP:78329172
1207 1207 c, g dbSNP:781146835
1214 1214 c, t dbSNP:556034412
1258 1258 -, tct dbSNP:556033972
1283 1283 a, c, g dbSNP:533376218
1288 1288 c, t dbSNP:369493674
1294 1294 a, g dbSNP:765527642
1295 1295 -, ccccgccccaccactccagcagaccttgcccc dbSNP:55978804
1299 1299 a, g dbSNP:529503181
1317 1317 a, t dbSNP:748060441
1327 1327 c, t dbSNP:530801416
1337 1337 g, t dbSNP:769408016
1364 1364 -, g dbSNP:550707472
1369 1369 a, g dbSNP:549263304
1381 1381 c, g dbSNP:565764510
1394 1394 a, g dbSNP:564556206
1410 1410 g, t dbSNP:557988479
1439 1439 a, g dbSNP:571689385
1450 1450 a, t dbSNP:186841203
1483 1483 c, t dbSNP:556286103
1490 1490 c, t dbSNP:762690517
1563 1563 c, g dbSNP:78383292
1574 1574 a, g dbSNP:191679355
1583 1583 a, g dbSNP:138327222
1590 1590 a, g dbSNP:770764038
1600 1600 c, t dbSNP:555675656
1602 1602 c, t dbSNP:572102859
1611 1611 a, g dbSNP:540986513
1628 1628 a, g dbSNP:55970514
1659 1659 a, g dbSNP:532996307
1664 1664 c, t dbSNP:543663488
1665 1665 a, g dbSNP:759877290
1702 1702 a, t dbSNP:181289276
1709 1709 c, t dbSNP:751729329
1759 1759 a, g dbSNP:186538259
1779 1779 a, g dbSNP:190014997
1803 1803 a, c dbSNP:142827677
1865 1865 c, g dbSNP:528490702
1890 1890 a, g dbSNP:8031440
1895 1895 a, g dbSNP:571662141
1901 1901 a, g dbSNP:537594091
1934 1934 g, t dbSNP:550791512
1950 1950 a, g dbSNP:567052377
1966 1966 c, t dbSNP:72661160
1970 1970 g, t dbSNP:764124750
1981 1981 a, g dbSNP:142609762
2002 2002 a, g dbSNP:150600147
2015 2015 c, g dbSNP:112747060
2030 2030 a, g dbSNP:8031627
2034 2034 c, g dbSNP:757346607
2040 2040 a, g dbSNP:569581429
2045 2045 g, t dbSNP:577556064
2051 2051 c, t dbSNP:1061341
2071 2071 a, t dbSNP:537802993
2110 2110 c, t dbSNP:139620908
2134 2134 g, t dbSNP:182242274
2187 2187 -, gaaaaaa dbSNP:752492048
2188 2188 a, t dbSNP:750644411
2206 2206 c, t dbSNP:372217473
2208 2208 c, t dbSNP:2278670
2262 2262 c, g dbSNP:542786788
2298 2298 g, t dbSNP:559626107
2310 2310 a, g dbSNP:778591910
2327 2327 c, t dbSNP:28363812
2368 2368 g, t dbSNP:577631492
2372 2372 c, g, t dbSNP:748088336
2391 2391 c, t dbSNP:777408805
2411 2411 c, g dbSNP:528721359
2439 2439 a, g dbSNP:551779423
2484 2484 c, g dbSNP:188001329
2552 2552 c, g dbSNP:533635017
2562 2562 -, cct dbSNP:369386357
2567 2567 c, t dbSNP:748749707
2575 2575 a, g dbSNP:530788405
2582 2582 -, gaca dbSNP:141408841
2590 2590 c, t dbSNP:191114875
2613 2613 a, g dbSNP:770567861
2653 2653 -, c dbSNP:760948248
2665 2665 c, t dbSNP:144205938
2687 2687 a, g dbSNP:745490452
2713 2713 g, t dbSNP:759130087
2748 2748 g, t dbSNP:772457638
2754 2754 c, t dbSNP:771658087
2798 2798 c, t dbSNP:183913368
2803 2803 -, t dbSNP:777061255
2813 2813 c, t dbSNP:549152312
2827 2827 c, t dbSNP:368370773
2831 2831 c, t dbSNP:761162475
2862 2862 c, t dbSNP:113309733
2863 2863 a, g dbSNP:147761102
2890 2890 c, t dbSNP:557746378
2897 2897 a, g dbSNP:115307123
2909 2909 c, t dbSNP:536610569
2967 2967 c, t dbSNP:556660083
2981 2981 a, g dbSNP:777131267
2990 2990 a, g dbSNP:573356440
2995 2995 -, tt dbSNP:556655485
3012 3012 a, g dbSNP:11638476
3014 3014 -, aaaa dbSNP:762028441
3014 3014 -, a dbSNP:573496525
3014 3014 a, g dbSNP:188412401
3027 3027 a, g dbSNP:117707762
3067 3067 c, t dbSNP:12595334
3069 3069 c, t dbSNP:139575773
3070 3070 c, g dbSNP:62014609
3078 3078 c, g dbSNP:565420956
3093 3093 c, g dbSNP:767340373
3115 3115 c, t dbSNP:555997375
3144 3144 c, t dbSNP:193013035
3171 3171 c, t dbSNP:752493489
3174 3174 -, c dbSNP:750918524
3188 3188 c, t dbSNP:755985886
3198 3198 g, t dbSNP:777786341
3229 3229 a, g dbSNP:145102966
3236 3236 c, t dbSNP:372633359
3237 3237 c, t dbSNP:561370577
3264 3264 c, t dbSNP:530174899
3274 3274 c, t dbSNP:80226876
3280 3280 c, g dbSNP:565929299
3332 3332 c, g, t dbSNP:72661161
3333 3333 a, g dbSNP:186967388
3345 3345 a, c dbSNP:571423885
3511 3511 c, t dbSNP:191410394
3532 3532 c, t dbSNP:112868185
3535 3535 g, t dbSNP:566917040
3537 3537 a, g dbSNP:771684858
3571 3571 a, t dbSNP:775905689
3578 3578 c, t dbSNP:3743342
3605 3605 a, g dbSNP:552626399
3652 3652 a, g dbSNP:573415984
3675 3675 c, g dbSNP:149202238
3680 3680 -, ctc dbSNP:765590258
3729 3729 a, g dbSNP:769044614
3733 3733 c, t dbSNP:183703685
3737 3737 c, g dbSNP:777076242
3742 3742 c, g dbSNP:143339480
3745 3745 c, g dbSNP:151326457
3747 3747 c, t dbSNP:188022958
3753 3753 a, g dbSNP:28613415
3757 3757 a, g dbSNP:751685913
3780 3780 a, g dbSNP:140694679
3822 3822 c, g dbSNP:145645018
3841 3841 a, c dbSNP:111386789
3843 3843 c, t dbSNP:560350281
3845 3845 -, gag dbSNP:3833027
3845 3845 -, gag dbSNP:397772980
3847 3847 a, g dbSNP:76820462
3847 3847 -, gag dbSNP:398118956
3908 3908 c, t dbSNP:62014610
3909 3909 a, g dbSNP:138185890
3940 3940 -, t dbSNP:747191952
3953 3953 a, t dbSNP:551241364
3961 3961 a, g dbSNP:571529451
3985 3985 c, t dbSNP:142744440
3986 3986 a, g dbSNP:11556089
4007 4007 a, g dbSNP:182172002
4028 4028 -, gttt dbSNP:751100931
4063 4063 c, t dbSNP:763223581
4064 4064 a, g dbSNP:185512187
4100 4100 -, a dbSNP:543558759
4102 4102 -, a dbSNP:375106285
4143 4143 c, t dbSNP:531928122
4147 4147 c, t dbSNP:77620237
4148 4148 g, t dbSNP:566415298
4169 4169 c, t dbSNP:138798418
4171 4171 a, g dbSNP:766453915
4212 4212 c, t dbSNP:558843294
4221 4221 c, g dbSNP:751835194
4237 4237 c, g dbSNP:574634185
4239 4239 a, g dbSNP:190177128
4241 4241 g, t dbSNP:544968102
4246 4246 c, t dbSNP:754298690
4247 4247 a, g dbSNP:181812913
4291 4291 a, g dbSNP:11556090
4326 4326 g, t dbSNP:185838563
4335 4335 c, g, t dbSNP:61740807
4336 4336 a, g dbSNP:190155838
4341 4341 c, g dbSNP:745696109
4351 4351 -, ct dbSNP:754727381
4359 4359 a, t dbSNP:546271180
4376 4376 a, g dbSNP:757298218
4403 4403 a, g dbSNP:373340382
4436 4436 c, t dbSNP:530600662
4439 4439 c, t dbSNP:550493563
4440 4440 a, g dbSNP:143991135
4451 4451 a, g dbSNP:529661153
4498 4498 c, t dbSNP:12900401
4525 4525 c, t dbSNP:757935047
4542 4542 a, g dbSNP:140620343
4573 4573 c, t dbSNP:779537026
4578 4578 g, t dbSNP:528457487
4588 4588 a, g dbSNP:746688800
4599 4599 -, atg dbSNP:747987943
4640 4640 a, g dbSNP:538394494
4644 4644 -, t dbSNP:567028715
4683 4683 c, t dbSNP:3743343
4737 4737 c, g dbSNP:142857253
4755 4755 c, t dbSNP:1052488
4770 4770 -, tactc dbSNP:563622482
4774 4774 c, g dbSNP:529386438
4782 4782 a, c, g dbSNP:28473647
4820 4820 a, t dbSNP:748650960
4834 4834 -, tat dbSNP:544954467
4892 4892 a, g dbSNP:200460714
4920 4920 g, t dbSNP:555324405
4946 4946 g, t dbSNP:199952886
4991 4991 a, c dbSNP:770243847
4992 4992 c, t dbSNP:181158603
4993 4993 a, g dbSNP:534195237
4994 4994 c, t dbSNP:529870126
5004 5004 c, t dbSNP:763293444
5028 5028 g, t dbSNP:577168621
5083 5083 -, catta dbSNP:766854989
5109 5109 c, t dbSNP:763963889
5117 5117 c, g dbSNP:75971163
5128 5128 c, t dbSNP:562987448
5137 5137 a, t dbSNP:774655154
5183 5183 c, t dbSNP:72661162
5187 5187 a, g dbSNP:185374880
5189 5189 a, g dbSNP:543972601
5195 5195 c, t dbSNP:762874455
5197 5197 c, t dbSNP:560849755
5224 5224 c, t dbSNP:189685754
5225 5225 a, c, g dbSNP:577952011
5232 5232 c, g dbSNP:757151117
5240 5240 c, t dbSNP:546862904
5243 5243 -, taac dbSNP:749273217
5243 5243 a, g dbSNP:559937993
5289 5289 c, t dbSNP:183877342
5300 5300 -, atc dbSNP:548861227
5335 5335 c, t dbSNP:774665276
5354 5354 c, g dbSNP:759884384
5422 5422 c, g dbSNP:552020020

Target ORF information:

RefSeq Version NM_001145104
Organism Homo sapiens (human)
Definition Homo sapiens SMAD family member 3 (SMAD3), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23848
Accession Version NM_001145103.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1146bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 3 isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK298139.1, U76622.1 and AC012568.7. Summary: The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions as a transcriptional modulator activated by transforming growth factor-beta and is thought to play a role in the regulation of carcinogenesis. [provided by RefSeq, Apr 2009]. Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK298139.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)79..270(+)
Misc Feature(2)94..174(+)
Misc Feature(3)199..252(+)
Misc Feature(4)544..1116(+)
Misc Feature(5)595..1110(+)
Exon (1)1..80
Gene Synonym:
Exon (2)81..274
Gene Synonym:
Exon (3)275..406
Gene Synonym:
Exon (4)407..481
Gene Synonym:
Exon (5)482..532
Gene Synonym:
Exon (6)533..745
Gene Synonym:
Exon (7)746..883
Gene Synonym:
Exon (8)884..1028
Gene Synonym:
Exon (9)1029..5808
Gene Synonym:
Position Chain Variation Link
14 14 g, t dbSNP:567176722
22 22 c, t dbSNP:774681792
24 24 g, t dbSNP:537831359
27 27 a, g dbSNP:576157357
59 59 a, g dbSNP:746123640
103 103 a, g dbSNP:779576954
112 112 a, c dbSNP:750707381
113 113 a, g dbSNP:758823376
123 123 c, t dbSNP:780111111
145 145 c, t dbSNP:747307840
151 151 c, t dbSNP:768713596
168 168 c, t dbSNP:781320332
177 177 c, t dbSNP:762889441
183 183 a, g dbSNP:1065080
185 185 a, g dbSNP:769657093
187 187 -, g dbSNP:587776882
190 190 a, g dbSNP:138550573
207 207 c, t dbSNP:762612490
208 208 a, g dbSNP:770798158
209 209 c, t dbSNP:387906854
215 215 a, g dbSNP:369221296
216 216 c, t dbSNP:759319479
218 218 c, t dbSNP:767284328
228 228 c, t dbSNP:752196822
237 237 c, t dbSNP:760286714
238 238 a, g dbSNP:587782977
246 246 a, c dbSNP:765624013
253 253 -, t dbSNP:751304511
265 265 c, g dbSNP:750982529
268 268 a, g dbSNP:371876622
288 288 a, g dbSNP:771802144
291 291 c, g dbSNP:775315777
300 300 c, g dbSNP:760233525
306 306 a, g dbSNP:763712900
314 314 c, t dbSNP:377026877
315 315 a, g dbSNP:140275295
318 318 c, t dbSNP:563100221
322 322 c, t dbSNP:751860407
324 324 c, t dbSNP:755354518
329 329 a, c dbSNP:375574124
331 331 c, t dbSNP:145380987
336 336 c, t dbSNP:756124653
357 357 c, t dbSNP:202203039
358 358 a, g dbSNP:749178459
369 369 c, t dbSNP:374111837
375 375 c, t dbSNP:138395233
376 376 a, g dbSNP:548756379
380 380 a, g dbSNP:772034969
382 382 a, g dbSNP:35874463
384 384 c, t dbSNP:375925515
385 385 a, g dbSNP:768050588
390 390 c, t dbSNP:776144459
392 392 a, g dbSNP:763901509
427 427 c, t dbSNP:768301198
446 446 c, t dbSNP:780727302
448 448 a, g dbSNP:555538965
462 462 a, g dbSNP:368710091
466 466 c, t dbSNP:553009515
471 471 c, t dbSNP:769225687
477 477 c, t dbSNP:774814963
478 478 a, g dbSNP:760091844
487 487 c, t dbSNP:150682850
506 506 c, t dbSNP:772510704
507 507 a, g dbSNP:776009102
510 510 a, g dbSNP:202094530
513 513 c, t dbSNP:768951907