
SMAD4 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SMAD4
Entrez Gene ID 4089
Full Name SMAD family member 4
Synonyms DPC4, JIP, MADH4, MYHRS
General protein information
Preferred Names
mothers against decapentaplegic homolog 4
mothers against decapentaplegic homolog 4
MAD homolog 4
SMAD, mothers against DPP homolog 4
deleted in pancreatic carcinoma locus 4
deletion target in pancreatic carcinoma 4
mothers against decapentaplegic, Drosophila, homolog of, 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:


Disorder Html: Pancreatic cancer (3); Polyposis, juvenile intestinal, 174900 (3);

mRNA and Protein(s)

mRNA Protein Name
NM_005359 NP_005350 mothers against decapentaplegic homolog 4

hsa04310 Wnt signaling pathway
hsa04350 TGF-beta signaling pathway
hsa04110 Cell cycle
hsa04520 Adherens junction
hsa05212 Pancreatic cancer
hsa05220 Chronic myeloid leukemia
hsa05210 Colorectal cancer
hsa05200 Pathways in cancer
hsa05166 HTLV-I infection
hsa05161 Hepatitis B
hsa04390 Hippo signaling pathway
hsa04068 FoxO signaling pathway
hsa04550 Signaling pathways regulating pluripotency of stem cells
hsa_M00681 Activin signaling
hsa_M00680 TGF-beta signaling
hsa_M00679 BMP signaling
HUMAN_PWY66-11 BMP Signalling Pathway
R-HSA-5663202 Diseases of signal transduction
R-HSA-1643685 Disease
R-HSA-3304347 Loss of Function of SMAD4 in Cancer
R-HSA-3304349 Loss of Function of SMAD2/3 in Cancer
R-HSA-3304351 Signaling by TGF-beta Receptor Complex in Cancer
R-HSA-3311021 SMAD4 MH2 Domain Mutants in Cancer
R-HSA-3315487 SMAD2/3 MH2 Domain Mutants in Cancer
R-HSA-162582 Signal Transduction
R-HSA-2173796 SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
R-HSA-2173793 Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
R-HSA-2173795 Downregulation of SMAD2/3:SMAD4 transcriptional activity
R-HSA-170834 Signaling by TGF-beta Receptor Complex
R-HSA-201451 Signaling by BMP
R-HSA-2173789 TGF-beta receptor signaling activates SMADs
R-HSA-74160 Gene Expression
R-HSA-212436 Generic Transcription Pathway
R-HSA-1502540 Signaling by Activin
R-HSA-1266738 Developmental Biology
R-HSA-452723 Transcriptional regulation of pluripotent stem cells
R-HSA-1181150 Signaling by NODAL
Pathway Interaction Database
myc_activpathway Validated targets of C-MYC transcriptional activation
myc_represspathway Validated targets of C-MYC transcriptional repression
alk2pathway ALK2 signaling events
alk1pathway ALK1 signaling events
bmppathway BMP receptor signaling
smad2_3nuclearpathway Regulation of nuclear SMAD2/3 signaling
smad2_3pathway Regulation of cytoplasmic and nuclear SMAD2/3 signaling
tgfbrpathway TGF-beta receptor signaling
hif1_tfpathway HIF-1-alpha transcription factor network
lkb1_pathway LKB1 signaling events
WP366 TGF-beta Receptor Signaling Pathway
WP560 TGF Beta Signaling Pathway
WP138 Androgen receptor signaling pathway
WP615 Senescence and Autophagy
WP363 Wnt Signaling Pathway NetPath
WP1591 Heart Development
WP179 Cell cycle
WP710 DNA damage response (only ATM dependent)
WP61 Delta-Notch Signaling Pathway
WP1425 BMP signalling and regulation
WP53 Id Signaling Pathway
WP1984 Integrated Breast Cancer Pathway
WP2377 Integrated Pancreatic Cancer Pathway

Homo sapiens (human) SMAD4 NP_005350.1
Pan troglodytes (chimpanzee) SMAD4 XP_001155601.1
Macaca mulatta (Rhesus monkey) SMAD4 XP_001096658.1
Canis lupus familiaris (dog) SMAD4 XP_005615451.1
Bos taurus (cattle) SMAD4 NP_001069677.1
Mus musculus (house mouse) Smad4 NP_032566.2
Rattus norvegicus (Norway rat) Smad4 NP_062148.1
Danio rerio (zebrafish) zmp:0000000768 NP_001116172.1
Drosophila melanogaster (fruit fly) Med NP_524610.1
Xenopus (Silurana) tropicalis (western clawed frog) smad4.1 XP_002934485.1


ID Name Evidence
GO:0005622 intracellular IEA
GO:0005634 nucleus IDA
GO:0005654 nucleoplasm EXP
GO:0005654 nucleoplasm TAS
GO:0005667 transcription factor complex IDA
GO:0005667 transcription factor complex IPI
GO:0005730 nucleolus IDA
GO:0005737 cytoplasm IDA
GO:0005813 centrosome IDA
GO:0005829 cytosol EXP
GO:0005829 cytosol TAS
GO:0032444 activin responsive factor complex IDA


ID Name Evidence
GO:0003677 DNA binding IDA
GO:0003682 chromatin binding IEA
GO:0003700 sequence-specific DNA binding transcription factor activity IDA
GO:0005515 protein binding IPI
GO:0005518 collagen binding IEA
GO:0030616 transforming growth factor beta receptor, common-partner cytoplasmic mediator activity IDA
GO:0042802 identical protein binding IPI
GO:0042803 protein homodimerization activity IPI
GO:0043565 sequence-specific DNA binding IDA
GO:0070411 I-SMAD binding IPI
GO:0070412 R-SMAD binding IPI


ID Name Evidence
GO:0001658 branching involved in ureteric bud morphogenesis IEA
GO:0001666 response to hypoxia IMP
GO:0001701 in utero embryonic development IEA
GO:0001702 gastrulation with mouth forming second IEA
GO:0001822 kidney development IEA
GO:0006351 transcription, DNA-dependent IDA
GO:0007179 transforming growth factor beta receptor signaling pathway IDA
GO:0007179 transforming growth factor beta receptor signaling pathway TAS
GO:0007183 SMAD protein complex assembly IDA
GO:0007492 endoderm development IEA
GO:0007498 mesoderm development IEA
GO:0008285 negative regulation of cell proliferation IEA
GO:0009952 anterior/posterior pattern formation IEA
GO:0010718 positive regulation of epithelial to mesenchymal transition ISS
GO:0010862 positive regulation of pathway-restricted SMAD protein phosphorylation ISS
GO:0017015 regulation of transforming growth factor beta receptor signaling pathway IMP
GO:0030308 negative regulation of cell growth IDA
GO:0030509 BMP signaling pathway EXP
GO:0030509 BMP signaling pathway IDA
GO:0030511 positive regulation of transforming growth factor beta receptor signaling pathway IDA
GO:0032525 somite rostral/caudal axis specification IEA
GO:0032909 regulation of transforming growth factor-beta2 production IMP
GO:0042177 negative regulation of protein catabolic process IMP
GO:0045892 negative regulation of transcription, DNA-dependent IDA
GO:0045893 positive regulation of transcription, DNA-dependent IDA
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IEA
GO:0048589 developmental growth IEA
GO:0048663 neuron fate commitment IEA
GO:0048729 tissue morphogenesis IEA
GO:0048859 formation of anatomical boundary IEA
GO:0051098 regulation of binding IEA
GO:0060021 palate development ISS
GO:0060391 positive regulation of SMAD protein import into nucleus ISS
GO:0060395 SMAD protein signal transduction IDA
GO:0060548 negative regulation of cell death IEA
GO:0071559 response to transforming growth factor beta stimulus IDA
GO:0072133 metanephric mesenchyme morphogenesis IEA
GO:0072134 nephrogenic mesenchyme morphogenesis IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SMAD4 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SMAD4 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_005359 Homo sapiens SMAD family member 4 (SMAD4), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu26813
Accession Version NM_005359.5 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1659bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mothers against decapentaplegic homolog 4
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AU120224.1, BC002379.2, AC091551.14 and BM701399.1. This sequence is a reference standard in the RefSeqGene project. On Aug 8, 2008 this sequence version replaced gi:164565433. Summary: This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to TGF-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Oct 2009]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC002379.2, U44378.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)518..520(+)
Misc Feature(2)578..952(+)
Misc Feature(3)647..649(+)
Misc Feature(4)650..859(+)
Misc Feature(5)749..934(+)
Misc Feature(6)875..877(+)
Misc Feature(7)875..877(+)
Misc Feature(8)1013..1015(+)
Misc Feature(9)1013..1015(+)
Misc Feature(10)1361..1498(+)
Misc Feature(11)1367..1369(+)
Misc Feature(12)1496..2161(+)
Misc Feature(13)1523..2161(+)
Misc Feature(14)1820..1822(+)
Misc Feature(15)2057..2059(+)
Misc Feature(16)2081..2083(+)
Exon (1)1..411
Gene Synonym:
Exon (2)412..787
Gene Synonym:
Exon (3)788..962
Gene Synonym:
Exon (4)963..992
Gene Synonym:
Exon (5)993..1205
Gene Synonym:
Exon (6)1206..1325
Gene Synonym:
Exon (7)1326..1442
Gene Synonym:
Exon (8)1443..1493
Gene Synonym:
Exon (9)1494..1677
Gene Synonym:
Exon (10)1678..1846
Gene Synonym:
Exon (11)1847..1985
Gene Synonym:
Exon (12)1986..8772
Gene Synonym:
Position Chain Variation Link
7 7 a, g dbSNP:537319496
39 39 c, g dbSNP:557246609
56 56 a, g dbSNP:570695602
69 69 a, c dbSNP:540072311
80 80 c, g dbSNP:772538273
86 86 c, t dbSNP:552784408
89 89 a, c dbSNP:572855606
92 92 c, g dbSNP:546363148
96 96 c, g dbSNP:535203415
109 109 c, t dbSNP:763537410
116 116 c, t dbSNP:746493435
117 117 c, t dbSNP:774804844
124 124 g, t dbSNP:562907377
138 138 c, t dbSNP:555375675
177 177 a, g dbSNP:377412110
291 291 a, g dbSNP:575329715
428 428 a, g, t dbSNP:764439383
430 430 c, g dbSNP:757567812
435 435 a, c dbSNP:767842443
436 436 a, g dbSNP:750823020
438 438 c, t dbSNP:755756863
442 442 c, t dbSNP:779811141
450 450 a, g dbSNP:748692094
457 457 g, t dbSNP:754523299
459 459 c, t dbSNP:778679766
467 467 a, g dbSNP:748143311
470 470 a, g dbSNP:772186355
483 483 c, t dbSNP:773111265
488 488 c, t dbSNP:369978812
504 504 a, c dbSNP:770128265
508 508 -, at dbSNP:749026885
508 508 a, t dbSNP:200236229
511 511 c, t dbSNP:762899211
529 529 a, c dbSNP:768803926
545 545 a, g dbSNP:774342820
546 546 a, g dbSNP:757702252
547 547 c, t dbSNP:762273127
558 558 c, t dbSNP:372316981
559 559 a, g dbSNP:142292491
568 568 a, t dbSNP:761044209
569 569 a, g dbSNP:587780791
576 576 a, g dbSNP:281875323
577 577 c, t dbSNP:376371717
595 595 c, t dbSNP:754401427
622 622 a, g dbSNP:778465458
640 640 a, g dbSNP:146104321
642 642 c, t dbSNP:786202127
653 653 a, g dbSNP:758408642
655 655 a, g dbSNP:777917225
668 668 a, g dbSNP:746732669
677 677 c, g dbSNP:770789755
684 684 a, g dbSNP:780090544
688 688 a, g dbSNP:749503989
691 691 -, a dbSNP:786203560
697 697 a, g dbSNP:768796731
710 710 a, g dbSNP:786204166
713 713 a, g dbSNP:587781977
715 715 a, g dbSNP:774480995
718 718 c, t dbSNP:201239868
721 721 a, c dbSNP:761937143
727 727 aaatggagc, nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:672601247
758 758 a, g dbSNP:772506979
766 766 a, g dbSNP:587780556
769 769 a, g dbSNP:760990830
814 814 c, t dbSNP:762501162
832 832 c, t dbSNP:202126703
836 836 a, c dbSNP:751154230
839 839 g, t dbSNP:2229083
840 840 a, g dbSNP:377767323
864 864 aaatatgaac, t dbSNP:727504151
880 880 c, t dbSNP:757211048
892 892 a, g dbSNP:145988618
907 907 c, t dbSNP:140926102
909 909 a, c dbSNP:750172880
911 911 -, at dbSNP:377767324
912 912 c, g dbSNP:771808272
919 919 -, tgtctgt dbSNP:377767325
925 925 c, t dbSNP:150229208
928 928 a, g dbSNP:755862230
937 937 c, t dbSNP:779069779
938 938 c, g dbSNP:748395067
941 941 c, t dbSNP:377767326
949 949 a, g dbSNP:201296880
968 968 -, tc dbSNP:377767328
975 975 a, t dbSNP:377767329
987 987 a, g dbSNP:750355699
995 995 c, t dbSNP:751763157
1002 1002 a, c, g dbSNP:199790852
1004 1004 a, t dbSNP:534355764
1007 1007 -, atg dbSNP:786201939
1008 1008 c, t dbSNP:756675590
1009 1009 a, g dbSNP:780716382
1012 1012 a, g dbSNP:749594930
1021 1021 a, g dbSNP:786201120
1022 1022 c, t dbSNP:786203155
1048 1048 a, g dbSNP:144226135
1054 1054 -, gtccactgaagg dbSNP:377767330
1057 1057 c, t dbSNP:778576111
1059 1059 a, c dbSNP:138800446
1061 1061 -, g dbSNP:748018891
1063 1063 a, g dbSNP:368528856
1071 1071 c, g dbSNP:377767331
1073 1073 a, g dbSNP:542392980
1076 1076 c, t dbSNP:377767332
1089 1089 a, c dbSNP:760236686
1092 1092 c, t dbSNP:770798845
1103 1103 c, t dbSNP:140743238
1104 1104 a, g dbSNP:759288477
1106 1106 c, g dbSNP:61751988
1108 1108 a, c dbSNP:200717327
1110 1110 c, t dbSNP:752575871
1111 1111 a, g dbSNP:761936246
1113 1113 c, t dbSNP:587780792
1120 1120 a, g dbSNP:145805120
1132 1132 a, c dbSNP:547278031
1137 1137 c, t dbSNP:786203737
1144 1144 c, g dbSNP:780665234
1145 1145 a, c, g, t dbSNP:199809905
1146 1146 -, c dbSNP:377767333
1146 1146 c, t dbSNP:779119136
1152 1152 a, c dbSNP:748615724
1176 1176 a, g dbSNP:757977781
1182 1182 c, g dbSNP:777495692
1185 1185 a, g dbSNP:138386557
1198 1198 c, t dbSNP:112891188
1202 1202 a, g dbSNP:770461626
1206 1206 a, g dbSNP:774334251
1209 1209 a, t dbSNP:587780793
1215 1215 c, t dbSNP:539739051
1224 1224 g, t dbSNP:75667697
1225 1225 g, t dbSNP:776840348
1230 1230 -, g dbSNP:377767334
1230 1230 c, g dbSNP:759679579
1231 1231 c, t dbSNP:765597059
1235 1235 a, c dbSNP:552880257
1237 1237 c, t dbSNP:367964910
1238 1238 a, c dbSNP:758642067
1267 1267 -, ccgc dbSNP:377767335
1269 1269 a, c dbSNP:764421512
1281 1281 a, t dbSNP:751985298
1284 1284 ag, cc dbSNP:587782209
1284 1284 a, c dbSNP:371536364
1285 1285 a, c, g dbSNP:372095620
1306 1306 a, g dbSNP:755677513
1314 1314 c, t dbSNP:786202113
1327 1327 c, t dbSNP:763510526
1328 1328 a, g dbSNP:587780125
1347 1347 a, g dbSNP:143082783
1357 1357 c, t dbSNP:764640081
1358 1358 a, g dbSNP:751860447
1363 1363 a, g dbSNP:762166596
1367 1367 -, ac dbSNP:377767336
1369 1369 -, ac dbSNP:377767337
1390 1390 a, g dbSNP:144378484
1394 1394 a, g dbSNP:750111831
1407 1407 a, c dbSNP:755770046
1410 1410 a, c dbSNP:779583608
1413 1413 c, t dbSNP:786201404
1414 1414 a, g dbSNP:753358186
1418 1418 a, g dbSNP:7238500
1422 1422 a, c, g, t dbSNP:370176106
1423 1423 a, g dbSNP:772028872
1432 1432 c, t dbSNP:781519690
1441 1441 c, t dbSNP:746084369
1447 1447 c, g, t dbSNP:141149381
1448 1448 a, g dbSNP:375185293
1455 1455 a, g dbSNP:730881953
1463 1463 c, g dbSNP:774463256
1465 1465 a, g dbSNP:369088915
1466 1466 -, gcat dbSNP:377767338
1478 1478 a, g dbSNP:748622028
1485 1485 a, g dbSNP:377119288
1492 1492 c, t dbSNP:773615487
1507 1507 c, g dbSNP:772575670
1508 1508 c, t dbSNP:377767339
1509 1509 -, g dbSNP:377767340
1520 1520 -, t dbSNP:377767341
1525 1525 g, t dbSNP:572960016
1526 1526 a, g dbSNP:377767342
1527 1527 a, g dbSNP:281875324
1540 1540 a, g dbSNP:773598775
1575 1575 -, c dbSNP:377767343
1577 1577 a, g, t dbSNP:747360831
1580 1580 -, gt dbSNP:377767344
1584 1584 c, t dbSNP:564408927
1592 1592 a, g dbSNP:121912581
1593 1593 a, g dbSNP:377767345
1596 1596 a, c dbSNP:377767346
1610 1610 g, t dbSNP:121912576
1619 1619 a, c, g, t dbSNP:80338963
1620 1620 a, g, t dbSNP:377767347
1624 1624 c, t dbSNP:1801250
1625 1625 c, t dbSNP:377767348
1626 1626 -, gtt dbSNP:377767349
1629 1629 g, t dbSNP:377767350
1639 1639 a, c, g dbSNP:765051479
1640 1640 -, tc dbSNP:377767351
1644 1644 a, g dbSNP:139569694
1645 1645 c, t dbSNP:764049211
1651 1651 -, c dbSNP:377767352
1651 1651 c, t dbSNP:751470394
1652 1652 a, g dbSNP:761858248
1658 1658 a, g dbSNP:201092541
1660 1660 a, g dbSNP:373141146
1675 1675 a, g dbSNP:755178619
1677 1677 a, g dbSNP:377767353
1686 1686 a, t dbSNP:377767355
1690 1690 c, g dbSNP:765405495
1693 1693 a, g dbSNP:752938351
1695 1695 a, g dbSNP:121912580
1700 1700 c, t dbSNP:80338964
1706 1706 a, g dbSNP:377767356
1731 1731 a, g dbSNP:377767357
1744 1744 a, c, t dbSNP:758696549
1753 1753 c, t dbSNP:751732234
1756 1756 a, c, g dbSNP:145097078
1757 1757 c, g dbSNP:147621330
1769 1769 -, ag dbSNP:730881952
1774 1774 c, g dbSNP:121912577
1777 1777 a, c dbSNP:730881954
1780 1780 -, a dbSNP:786201200
1780 1780 -, a dbSNP:377767358
1782 1782 -, acag dbSNP:80338965
1783 1783 -, caga dbSNP:587782338
1786 1786 a, g dbSNP:786202472
1797 1797 -, cg dbSNP:730881956
1806 1806 -, g dbSNP:377767359
1833 1833 c, g, t dbSNP:770301659
1837 1837 a, g dbSNP:370558697
1839 1839 a, t dbSNP:780610518
1848 1848 g, t dbSNP:786203940
1849 1849 c, g dbSNP:751539807
1871 1871 c, t dbSNP:377767360
1876 1876 -, ga dbSNP:730881957
1876 1876 a, g dbSNP:372065822
1880 1880 c, t dbSNP:377767361
1881 1881 -, agcagcaggcggctactgcacaa dbSNP:377767362
1882 1882 -, gcagcaggcggctactgcacaagct dbSNP:587782540
1883 1883 c, t dbSNP:587781359
1888 1888 a, g dbSNP:751279659
1889 1889 -, gcggctactgcacaagctgcagcag dbSNP:587780124
1891 1891 -, gctactgcacaagctgcagcagctgccc dbSNP:786204125
1895 1895 a, g dbSNP:768086109
1896 1896 c, t dbSNP:786205514
1899 1899 -, caca dbSNP:377767363
1909 1909 a, g dbSNP:750933193
1915 1915 a, t dbSNP:756723838
1930 1930 c, t dbSNP:140487104
1931 1931 a, g dbSNP:786201798
1941 1941 a, g dbSNP:569981255
1947 1947 -, ccct dbSNP:377767364
1949 1949 -, ggcccaggatcagtaggtggaatag dbSNP:377767365
1959 1959 -, c dbSNP:377767366
1960 1960 a, c dbSNP:786201261
1986 1986 a, g dbSNP:786204060
1987 1987 g, t dbSNP:745598003
1999 1999 a, t dbSNP:769607309
2010 2010 g, t dbSNP:377767367
2015 2015 c, g dbSNP:121912578
2016 2016 a, c dbSNP:377767368
2024 2024 c, t dbSNP:397518413
2027 2027 c, t dbSNP:762118751
2032 2032 a, g dbSNP:772479430
2036 2036 a, g dbSNP:281875322
2037 2037 c, t dbSNP:281875321
2038 2038 a, g dbSNP:281875320
2041 2041 c, t dbSNP:762637015
2063 2063 a, t dbSNP:377767369
2065 2065 a, g dbSNP:377767370
2067 2067 g, t dbSNP:377767371
2070 2070 c, t dbSNP:773367516
2081 2081 a, t dbSNP:121912579
2082 2082 -, g dbSNP:377767372
2083 2083 a, g dbSNP:760840557
2085 2085 -, a dbSNP:587783060
2085 2085 a, g dbSNP:786202496
2088 2088 -, agag dbSNP:377767373
2099 2099 a, c dbSNP:786203930
2102 2102 -, cc dbSNP:377767374
2109 2109 ggat, nnnnnnnnnnnnnnnnnnn dbSNP:786202622
2109 2109 g, t dbSNP:377767375
2111 2111 a, g dbSNP:149755320
2125 2125 -, a, ta dbSNP:377767376
2126 2126 a, c dbSNP:754393017
2126 2126 -, c dbSNP:377767377
2129 2129 c, t dbSNP:766833269
2132 2132 -, g dbSNP:377767378
2134 2134 cc, t dbSNP:377767379
2134 2134 -, c dbSNP:377767380
2134 2134 c, t dbSNP:765606080
2135 2135 c, g dbSNP:377767381
2136 2136 c, g, t dbSNP:377767382
2138 2138 c, t dbSNP:377767383
2144 2144 c, t dbSNP:587780790
2145 2145 -, t dbSNP:377767384
2146 2146 a, g dbSNP:753128184
2149 2149 c, t dbSNP:369598262
2150 2150 -, gaagtacttcatac dbSNP:377767385
2170 2170 a, g, t dbSNP:549489716
2172 2172 a, t dbSNP:730881955
2173 2173 g, t dbSNP:200595795
2182 2182 a, g dbSNP:756795016
2185 2185 a, g dbSNP:113545983
2191 2191 a, g dbSNP:199526820
2208 2208 c, t dbSNP:11663402
2209 2209 a, g, t dbSNP:148687037
2213 2213 c, g dbSNP:772351886
2223 2223 c, t dbSNP:374562658
2227 2227 a, c, t dbSNP:767288576
2231 2231 c, g dbSNP:771022919
2233 2233 a, t dbSNP:776614361
2236 2236 a, g dbSNP:760084081
2242 2242 g, t dbSNP:765726171
2288 2288 a, c, g dbSNP:1049875
2325 2325 -, t dbSNP:753087904
2366 2366 a, t dbSNP:563321159
2367 2367 -, t dbSNP:571626382
2377 2377 -, t dbSNP:199787250
2386 2386 g, t dbSNP:550836152
2391 2391 g, t dbSNP:755748098
2399 2399 a, g dbSNP:765823244
2401 2401 a, g dbSNP:532149207
2419 2419 g, t dbSNP:766473122
2442 2442 c, t dbSNP:753295366
2503 2503 a, g dbSNP:552459667
2518 2518 a, g dbSNP:565996294
2531 2531 c, t dbSNP:534790830
2536 2536 c, t dbSNP:548116204
2570 2570 a, g dbSNP:751626446
2609 2609 a, g dbSNP:28403611
2610 2610 c, t dbSNP:529429248
2647 2647 -, t dbSNP:764693044
2659 2659 a, g dbSNP:191822473
2668 2668 a, g dbSNP:529897551
2686 2686 a, g dbSNP:556134005
2718 2718 -, t dbSNP:757935348
2780 2780 g, t dbSNP:142236156
2786 2786 a, g dbSNP:79955608
2791 2791 a, g dbSNP:537321708
2823 2823 a, c dbSNP:758658410
2834 2834 -, ct dbSNP:751277312
2855 2855 c, g dbSNP:538654348
2882 2882 a, c dbSNP:16952798
2883 2883 aaa, t dbSNP:386803201
2895 2895 a, g dbSNP:747355315
2911 2911 a, g dbSNP:371124732
2934 2934 a, g dbSNP:757405718
2948 2948 a, g dbSNP:781461730
2959 2959 a, g dbSNP:371163706
2972 2972 c, t dbSNP:556941805
3005 3005 a, g dbSNP:183984903
3031 3031 c, t dbSNP:190076139
3063 3063 -, a dbSNP:35675831
3072 3072 c, t dbSNP:561356108
3096 3096 -, t dbSNP:781016570
3166 3166 a, g dbSNP:745934938
3177 3177 c, t dbSNP:769911817
3198 3198 -, a dbSNP:543950258
3211 3211 a, g dbSNP:574464949
3236 3236 a, g dbSNP:567638921
3249 3249 -, tt dbSNP:541221575
3254 3254 c, t dbSNP:563382618
3264 3264 a, g dbSNP:542839921
3318 3318 a, g dbSNP:552224002
3366 3366 -, ccatc dbSNP:138404813
3376 3376 c, t dbSNP:10470
3378 3378 a, g dbSNP:762480216
3381 3381 c, t dbSNP:375691219
3384 3384 a, g dbSNP:181664459
3444 3444 c, g dbSNP:763995065
3469 3469 a, g dbSNP:749213039
3503 3503 a, t dbSNP:548358195
3553 3553 g, t dbSNP:78407704
3554 3554 g, t dbSNP:568213415
3556 3556 a, g dbSNP:185104256
3567 3567 c, g dbSNP:753807499
3569 3569 a, g dbSNP:549821029
3583 3583 g, t dbSNP:553408737
3607 3607 a, c dbSNP:199846258
3639 3639 c, t dbSNP:569828346
3654 3654 -, g dbSNP:34542515
3695 3695 -, t dbSNP:755827115
3710 3710 a, t dbSNP:75142398
3725 3725 a, g dbSNP:538619979
3773 3773 a, g dbSNP:558556719
3793 3793 c, t dbSNP:566346771
3794 3794 a, c dbSNP:535046633
3814 3814 a, g dbSNP:555248411
3815 3815 a, g dbSNP:56734884
3856 3856 a, c dbSNP:574896468
3866 3866 a, t dbSNP:145643623
3881 3881 a, c dbSNP:146563723
3949 3949 a, t dbSNP:79279451
4009 4009 g, t dbSNP:557065270
4017 4017 g, t dbSNP:141309481
4029 4029 c, t dbSNP:190742750
4049 4049 a, c dbSNP:182092812
4061 4061 a, c, t dbSNP:561442548
4063 4063 a, c, g dbSNP:4940037
4071 4071 c, g dbSNP:761701805
4091 4091 c, t dbSNP:185229497
4099 4099 a, t dbSNP:767272084
4101 4101 g, t dbSNP:562023794
4126 4126 -, tt dbSNP:151147707
4138 4138 g, t dbSNP:138909220
4207 4207 a, g dbSNP:12327465
4247 4247 a, c dbSNP:760239719
4295 4295 a, g dbSNP:766026458
4317 4317 a, g dbSNP:753317438
4319 4319 a, g dbSNP:149424787
4333 4333 a, g dbSNP:764514852
4340 4340 c, g dbSNP:751950834
4344 4344 c, t dbSNP:569791739
4391 4391 c, t dbSNP:778792959
4415 4415 g, t dbSNP:532503813
4460 4460 c, t dbSNP:552142907
4469 4469 c, g dbSNP:189547031
4491 4491 g, t dbSNP:541243260
4532 4532 a, g dbSNP:181201259
4534 4534 c, g dbSNP:781371523
4546 4546 c, t dbSNP:554931269
4550 4550 c, t dbSNP:550660083
4558 4558 a, g dbSNP:143842829
4559 4559 c, g dbSNP:557624286
4570 4570 c, t dbSNP:577005548
4580 4580 c, t dbSNP:545968890
4631 4631 a, g dbSNP:746132672
4661 4661 c, t dbSNP:756364354
4665 4665 g, t dbSNP:538182527
4666 4666 c, t dbSNP:780135239
4685 4685 a, t dbSNP:148190627
4691 4691 c, g dbSNP:749343352
4698 4698 a, g dbSNP:185349233
4733 4733 a, g dbSNP:541823078
4736 4736 c, t dbSNP:561803545
4827 4827 a, g dbSNP:768569083
4835 4835 a, g dbSNP:530741382
4859 4859 a, t dbSNP:191637734
4873 4873 a, c dbSNP:563979705
4879 4879 c, t dbSNP:557955183
4884 4884 a, g dbSNP:78321956
4890 4890 a, g dbSNP:778780100
4902 4902 -, tactt dbSNP:769541605
4928 4928 a, g dbSNP:747938644
4950 4950 a, t dbSNP:578001265
4967 4967 -, aaag dbSNP:749122500
4993 4993 g, t dbSNP:4939651
5030 5030 c, t dbSNP:566182609
5065 5065 a, c dbSNP:528447677
5094 5094 a, g dbSNP:772039050
5108 5108 g, t dbSNP:548592610
5111 5111 c, t dbSNP:147352474
5112 5112 a, g dbSNP:537785003
5116 5116 a, g dbSNP:183785604
5124 5124 a, g dbSNP:186751378
5128 5128 -, a dbSNP:774291794
5159 5159 c, t dbSNP:543699844
5163 5163 c, g dbSNP:540044887
5165 5165 -, t dbSNP:574286440
5167 5167 a, g dbSNP:192485057
5186 5186 a, g dbSNP:139526377
5198 5198 c, t dbSNP:770509560
5215 5215 -, c dbSNP:35658729
5218 5218 a, g dbSNP:776146914
5230 5230 -, gttttttt dbSNP:144777629
5232 5232 g, t dbSNP:535081684
5237 5237 a, g dbSNP:759036026
5245 5245 a, g dbSNP:555375214
5283 5283 a, g dbSNP:575178510
5366 5366 a, g dbSNP:563178120
5373 5373 a, g dbSNP:779727426
5400 5400 c, g dbSNP:183255810
5412 5412 g, t dbSNP:186807250
5423 5423 c, g dbSNP:528878031
5458 5458 a, g dbSNP:746551930
5485 5485 c, t dbSNP:191317135
5534 5534 -, tatctt dbSNP:761125154
5557 5557 a, g dbSNP:540445660
5564 5564 a, g dbSNP:768203013
5573 5573 a, g dbSNP:559571514
5595 5595 a, g dbSNP:182735651
5598 5598 a, g dbSNP:762135891
5602 5602 a, g dbSNP:767832093
5640 5640 c, g dbSNP:750812933
5666 5666 -, tc dbSNP:777249272
5729 5729 g, t dbSNP:756274309
5756 5756 -, g dbSNP:559385300
5765 5765 -, g dbSNP:528143337
5791 5791 c, t dbSNP:548283262
5846 5846 c, t dbSNP:780147709
5854 5854 c, g dbSNP:753944813
5859 5859 c, t dbSNP:114852346
5883 5883 c, t dbSNP:530933836
5892 5892 c, g dbSNP:755068847
5925 5925 a, g dbSNP:551257153
5948 5948 -, t dbSNP:202070730
5957 5957 c, t dbSNP:12961857
5960 5960 c, t dbSNP:571174422
5977 5977 g, t dbSNP:748132746
6018 6018 c, t dbSNP:540009734
6068 6068 -, t dbSNP:575160530
6069 6069 -, t dbSNP:373831598
6090 6090 c, t dbSNP:547197185
6177 6177 g, t dbSNP:773522198
6181 6181 a, g dbSNP:376846816
6206 6206 c, t dbSNP:566427445
6263 6263 c, t dbSNP:772166247
6323 6323 c, t dbSNP:777659974
6390 6390 c, g dbSNP:746812265
6411 6411 c, t dbSNP:368065509
6415 6415 a, g dbSNP:143563979
6418 6418 g, t dbSNP:150556996
6447 6447 a, g dbSNP:537464619
6459 6459 g, t dbSNP:371901376
6462 6462 -, t dbSNP:559471969
6524 6524 a, t dbSNP:557604175
6536 6536 a, g dbSNP:577544360
6570 6570 c, t dbSNP:770614095
6575 6575 g, t dbSNP:540039847
6584 6584 c, t dbSNP:560338410
6628 6628 c, t dbSNP:188404885
6642 6642 c, t dbSNP:776206938
6676 6676 c, t dbSNP:570306736
6677 6677 c, t dbSNP:551582129
6713 6713 c, t dbSNP:763269343
6732 6732 g, t dbSNP:377120415
6737 6737 a, t dbSNP:573256272
6769 6769 a, g dbSNP:542263546
6780 6780 -, a dbSNP:780198143
6781 6781 -, agag dbSNP:577389739
6781 6781 -, a dbSNP:138276731
6782 6782 c, g dbSNP:192635281
6784 6784 -, gaga dbSNP:374333786
6822 6822 a, g dbSNP:759064132
6840 6840 c, t dbSNP:369040052
6866 6866 a, c, t dbSNP:769227954
6880 6880 a, g dbSNP:530890237
6883 6883 a, g dbSNP:185468281
6884 6884 g, t dbSNP:775015489
6917 6917 a, g dbSNP:189948351
6926 6926 c, t dbSNP:564744587
6945 6945 c, t dbSNP:375580807
6950 6950 c, t dbSNP:112739300
6951 6951 a, g dbSNP:774615490
6992 6992 -, t dbSNP:562882783
7044 7044 a, g dbSNP:192532745
7059 7059 a, g dbSNP:139595540
7063 7063 -, t dbSNP:571773833
7071 7071 a, t dbSNP:372089678
7078 7078 c, t dbSNP:184516281
7136 7136 -, c dbSNP:34159851
7165 7165 c, t dbSNP:149743165
7184 7184 g, t dbSNP:188228460
7191 7191 -, t dbSNP:113155703
7192 7192 -, t dbSNP:770172863
7198 7198 c, t dbSNP:557367090
7202 7202 c, t dbSNP:768028273
7259 7259 a, g dbSNP:571200212
7269 7269 c, g dbSNP:534145759
7277 7277 a, g dbSNP:532965680
7280 7280 a, g dbSNP:145596898
7293 7293 a, c dbSNP:761008429
7302 7302 a, t dbSNP:542474644
7328 7328 a, g dbSNP:12456284
7347 7347 g, t dbSNP:575833902
7367 7367 c, t dbSNP:117142232
7369 7369 c, t dbSNP:369615750
7379 7379 g, t dbSNP:564511695
7393 7393 a, t dbSNP:74878872
7432 7432 c, g dbSNP:755051361
7456 7456 a, t dbSNP:139414609
7467 7467 c, g dbSNP:560631263
7531 7531 g, t dbSNP:529462368
7533 7533 c, g dbSNP:750283122
7556 7556 c, t dbSNP:144187949
7585 7585 c, t dbSNP:180715759
7616 7616 c, t dbSNP:146551171
7634 7634 a, t dbSNP:531346506
7705 7705 c, t dbSNP:758246980
7715 7715 a, c dbSNP:550961604
7727 7727 -, gcgcacgc dbSNP:755013043
7728 7728 -, gcgcacgcgcgc dbSNP:779631454
7728 7728 -, gcgcacgcgc dbSNP:757113345
7728 7728 -, gcgcacgc dbSNP:112458358
7728 7728 -, gcgcac dbSNP:147193925
7729 7729 -, cgca dbSNP:780699281
7730 7730 -, gcacgcgc dbSNP:771936680
7732 7732 -, cg, cgcg dbSNP:772211214
7732 7732 a, g dbSNP:75712226
7733 7733 -, cg dbSNP:147683428
7735 7735 -, cgcgcgcgcacacaca dbSNP:762428135
7735 7735 -, cgcgcgcgcacaca dbSNP:144218127
7736 7736 -, gcgcgcgcacacac dbSNP:746980771
7737 7737 -, cgcgcgcacacaca dbSNP:773673392
7738 7738 -, gcgcgcacacac dbSNP:775710169
7739 7739 -, cgcgcacacaca dbSNP:749345012
7739 7739 c, t dbSNP:778816929
7740 7740 a, g dbSNP:533565288
7742 7742 -, ca dbSNP:372635676
7742 7742 a, g dbSNP:752846586
7743 7743 -, gc dbSNP:68159021
7744 7744 a, g dbSNP:11662245
7746 7746 a, g dbSNP:777856072
7748 7748 acgcgcgcgcgcgcacaca, gcg dbSNP:74169183
7748 7748 a, g dbSNP:202140561
7773 7773 (ca)7, 11, 12, 14, 15, 16, 17, 18, 8 dbSNP:3220198
7794 7794 c, t dbSNP:554002554
7823 7823 c, g dbSNP:75998234
7824 7824 a, g dbSNP:185010226
7827 7827 -, caca dbSNP:146919169
7829 7829 -, ca dbSNP:768950169
7834 7834 -, acac dbSNP:368759758
7836 7836 -, ac dbSNP:372401829
7837 7837 c, t dbSNP:536422982
7838 7838 g, t dbSNP:376879710
7841 7841 c, t dbSNP:746789530
7870 7870 g, t dbSNP:556426217
7875 7875 c, t dbSNP:757053014
7886 7886 -, att dbSNP:149335502
7887 7887 a, t dbSNP:575797348
7888 7888 -, tat dbSNP:374306389
7888 7888 c, t dbSNP:544762312
7889 7889 a, g dbSNP:558284896
7942 7942 c, t dbSNP:780866822
7971 7971 a, t dbSNP:745472198
7998 7998 c, t dbSNP:577928234
8030 8030 a, g dbSNP:190039588
8057 8057 -, aagaa dbSNP:767658962
8058 8058 -, aagaa dbSNP:140241965
8060 8060 -, gaaaa dbSNP:78989198
8060 8060 c, g dbSNP:200482328
8110 8110 a, g dbSNP:370152218
8143 8143 a, g dbSNP:529594222
8184 8184 a, t dbSNP:12954419
8191 8191 a, c dbSNP:3819122
8206 8206 c, g dbSNP:181250637
8210 8210 g, t dbSNP:544227756
8238 8238 a, g dbSNP:539087053
8241 8241 c, g dbSNP:551023050
8259 8259 g, t dbSNP:12959147
8261 8261 g, t dbSNP:12960005
8267 8267 c, t dbSNP:561194988
8347 8347 c, t dbSNP:187018810
8376 8376 -, a dbSNP:35671610
8405 8405 c, t dbSNP:191403347
8461 8461 a, g dbSNP:772566289
8494 8494 -, aga dbSNP:768723885
8548 8548 -, t dbSNP:573785159
8597 8597 c, g dbSNP:547102720
8605 8605 c, t dbSNP:557992238
8606 8606 a, g dbSNP:76830638
8620 8620 c, g dbSNP:2282544
8623 8623 a, g dbSNP:549995868
8689 8689 a, t dbSNP:569819237
8710 8710 c, t dbSNP:76020793
8711 8711 g, t dbSNP:558196623
8719 8719 c, t dbSNP:183472455
8758 8758 a, c dbSNP:777081844

Target ORF information:

RefSeq Version NM_005359
Organism Homo sapiens (human)
Definition Homo sapiens SMAD family member 4 (SMAD4), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Zinc finger protein 451 is a novel Smad corepressor in transforming growth factor-beta signaling
J. Biol. Chem. 289 (4), 2072-2083 (2014)
Feng Y, Wu H, Xu Y, Zhang Z, Liu T, Lin X and Feng XH.


A study of Smad4 and Smad7 expression in surgically resected samples of gastric adenocarcinoma and their correlation with clinicopathological parameters and patient survival
J BUON 19 (1), 221-227 (2014)
Zizi-Sermpetzoglou A, Myoteri D, Arkoumani E, Voultsos M and Marinis A.


Targeted deletion of Smad4 shows it is required for transforming growth factor beta and activin signaling in colorectal cancer cells
Proc. Natl. Acad. Sci. U.S.A. 95 (5), 2412-2416 (1998)
Zhou S, Buckhaults P, Zawel L, Bunz F, Riggins G, Dai JL, Kern SE, Kinzler KW and Vogelstein B.


Human Smad3 and Smad4 are sequence-specific transcription activators
Mol. Cell 1 (4), 611-617 (1998)
Zawel L, Dai JL, Buckhaults P, Zhou S, Kinzler KW, Vogelstein B and Kern SE.


Nomenclature: vertebrate mediators of TGFbeta family signals
Cell 87 (2), 173 (1996)
Derynck,R., Gelbart,W.M., Harland,R.M., Heldin,C.H., Kern,S.E., Massague,J., Melton,D.A., Mlodzik,M., Padgett,R.W., Roberts,A.B., Smith,J., Thomsen,G.H., Vogelstein,B. and Wang,X.F.


Receptor-associated Mad homologues synergize as effectors of the TGF-beta response
Nature 383 (6596), 168-172 (1996)
Zhang Y, Feng X, We R and Derynck R.


DPC4, a candidate tumor suppressor gene at human chromosome 18q21.1
Science 271 (5247), 350-353 (1996)
Hahn SA, Schutte M, Hoque AT, Moskaluk CA, da Costa LT, Rozenblum E, Weinstein CL, Fischer A, Yeo CJ, Hruban RH and Kern SE.


E2F-4, a new member of the E2F transcription factor family, interacts with p107
Genes Dev. 8 (22), 2665-2679 (1994)
Ginsberg D, Vairo G, Chittenden T, Xiao ZX, Xu G, Wydner KL, DeCaprio JA, Lawrence JB and Livingston DM.


Juvenile Polyposis Syndrome
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Larsen Haidle,J. and Howe,J.R.


Hereditary Hemorrhagic Telangiectasia
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
McDonald,J. and Pyeritz,R.E.
