
MECP2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MECP2
Entrez Gene ID 4204
Full Name methyl CpG binding protein 2
General protein information
Preferred Names
methyl-CpG-binding protein 2
methyl-CpG-binding protein 2
meCp-2 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of mental retardation in females. [provided by RefSeq, Jul 2009]. lac of sum
Disorder MIM:


Disorder Html: Rett syndrome, 312750 (3); Mental retardation, X-linked, syndromic

The following MECP2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MECP2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_005274681 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu54402 XM_005274683 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
OHu54402 XM_005274682 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
OHu54402 XM_011531165 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
OHu54402 XM_011531166 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
OHu54403 XM_006724819 PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199.00
NM_004992 Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001110792 Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu28311
Accession Version XM_005274681.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1461bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methyl-CpG-binding protein 2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838853. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)535..759(+)
Misc Feature(2)574..666(+)
Position Chain Variation Link
241 241 c, t dbSNP:267608324
246 246 a, g dbSNP:202057538
256 256 -, atggtagctgggatgttagggctcag dbSNP:267608407
256 256 -, a dbSNP:267608408
256 256 a, t dbSNP:786205892
283 283 c, g, t dbSNP:61754421
291 291 a, c, g, t dbSNP:61754422
297 297 -, agtcagaa dbSNP:63749008
301 301 c, t dbSNP:61754424
305 305 -, a dbSNP:267608416
310 310 c, t dbSNP:61754425
311 311 -, a dbSNP:267608417
319 319 a, t dbSNP:62641234
331 331 -, c dbSNP:61754426
345 345 a, g dbSNP:398124187
346 346 -, g dbSNP:61754427
355 355 -, gata dbSNP:61754428
362 362 -, aagaaga dbSNP:267608424
362 362 -, aa dbSNP:267608425
363 363 -, agaa dbSNP:267608426
372 372 -, a dbSNP:267608427
374 374 -, ag dbSNP:267608428
381 381 -, g dbSNP:61754430
391 391 a, c, g dbSNP:587783134
395 395 -, a dbSNP:61754431
401 401 a, c, g dbSNP:61754432
408 408 c, g, t dbSNP:267608432
410 410 a, g dbSNP:61754433
422 422 -, cc dbSNP:267608434
423 423 c, t dbSNP:61754435
444 444 -, ga dbSNP:61754436
449 449 c, g dbSNP:61754437
456 456 -, g dbSNP:61754438
458 458 c, g dbSNP:267608438
465 465 c, t dbSNP:61754439
470 470 -, c, t dbSNP:61754441
470 470 c, t dbSNP:61754440
479 479 c, t dbSNP:267608440
480 480 a, g dbSNP:61754442
484 484 -, gcttctgcct dbSNP:63749009
488 488 -, c dbSNP:267608442
498 498 -, c dbSNP:267608443
500 500 a, g dbSNP:61754444
504 504 -, nnnnnnn dbSNP:786205024
512 512 c, g dbSNP:61754445
513 513 -, ca dbSNP:267608444
528 528 a, g dbSNP:200629699
529 529 g, t dbSNP:267608445
530 530 -, g dbSNP:267608446
530 530 -, g dbSNP:587783090
531 531 -, g dbSNP:267608405
532 532 c, t dbSNP:61754447
534 534 c, t dbSNP:267608447
544 544 g, t dbSNP:61754448
546 546 a, c dbSNP:61754449
550 550 -, acc dbSNP:267608449
552 552 c, g dbSNP:61754450
553 553 c, g dbSNP:28935168
554 554 g, t dbSNP:61754451
556 556 c, t dbSNP:61754452
557 557 a, c, g, t dbSNP:61754453
563 563 a, g dbSNP:267608450
565 565 c, t dbSNP:267608451
566 566 -, ggacacggaagct dbSNP:63749010
566 566 a, g dbSNP:61754455
570 570 -, a dbSNP:61754456
571 571 c, g, t dbSNP:28934907
572 572 a, g, t dbSNP:61754457
576 576 -, gaag dbSNP:786205025
578 578 a, c, t dbSNP:61754458
581 581 -, a dbSNP:267608452
586 586 a, g dbSNP:61754459
589 589 a, t dbSNP:267608398
596 596 c, g dbSNP:61755760
598 598 c, t dbSNP:267608388
600 600 -, c dbSNP:61755761
613 613 g, t dbSNP:267608454
617 617 a, g dbSNP:61755762
619 619 a, g dbSNP:267608455
620 620 c, t dbSNP:267608456
627 627 c, g, t dbSNP:61755763
630 630 a, c dbSNP:146107517
630 630 -, c dbSNP:267608457
632 632 a, g dbSNP:786205037
635 635 c, t dbSNP:267608387
637 637 c, g, t dbSNP:267608469
638 638 a, c dbSNP:61748383
641 641 g, t dbSNP:61748384
645 645 -, a dbSNP:786205895
647 647 a, c dbSNP:267608470
648 648 c, g, t dbSNP:61748385
652 652 c, g, t dbSNP:28934904
653 653 a, g, t dbSNP:61748389
655 655 c, t dbSNP:267608471
656 656 c, g, t dbSNP:61748390
658 658 a, g dbSNP:61748391
665 665 a, g dbSNP:61748392
666 666 -, g dbSNP:61748393
668 668 a, c, t dbSNP:267608475
674 674 a, c, t dbSNP:28934908
675 675 -, g dbSNP:267608476
677 677 -, a dbSNP:61748394
677 677 a, g dbSNP:61748395
678 678 a, c, g dbSNP:61748396
681 681 c, t dbSNP:61748397
683 683 -, t dbSNP:61748398
685 685 a, t dbSNP:61748399
686 686 -, a dbSNP:61748400
686 686 a, g dbSNP:786205016
693 693 c, t dbSNP:61748386
694 694 a, g dbSNP:61748401
694 694 -, g dbSNP:62952161
706 706 -, g dbSNP:61748402
707 707 a, g dbSNP:61748403
709 709 c, g dbSNP:179363900
710 710 c, g dbSNP:61748404
718 718 a, t dbSNP:61748406
719 719 c, g, t dbSNP:28934905
722 722 a, c, g dbSNP:61748407
723 723 c, g, t dbSNP:61748408
724 724 a, t dbSNP:61748410
725 725 -, t dbSNP:267608482
725 725 -, tc dbSNP:267608483
726 726 c, g dbSNP:267608484
727 727 a, g dbSNP:61748411
728 728 c, t dbSNP:28934906
729 729 a, g dbSNP:61748413
730 730 -, g dbSNP:267608485
734 734 c, g dbSNP:61748414
735 735 -, tg dbSNP:267608486
735 735 -, t dbSNP:61748415
736 736 g, t dbSNP:61748416
737 737 a, g, t dbSNP:61748417
738 738 -, g dbSNP:61748418
739 739 -, a dbSNP:267608487
739 739 a, g dbSNP:727505391
743 743 -, gg dbSNP:267608488
750 750 -, c dbSNP:267608489
754 754 c, t dbSNP:61748420
757 757 a, c, t dbSNP:61748421
761 761 a, g dbSNP:587783745
763 763 c, t dbSNP:61748425
769 769 c, t dbSNP:61748426
770 770 c, t dbSNP:267608491
772 772 c, g dbSNP:61748427
773 773 c, g dbSNP:267608492
778 778 a, t dbSNP:61748428
782 782 a, c, g dbSNP:61749701
783 783 c, g dbSNP:61754420
784 784 a, g, t dbSNP:61749702
786 786 -, a dbSNP:61749703
793 793 a, t dbSNP:267608495
797 797 c, t dbSNP:61749705
798 798 -, tc dbSNP:267608496
802 802 c, g dbSNP:61749706
808 808 a, g dbSNP:587783135
809 809 -, g dbSNP:61749707
811 811 a, t dbSNP:587783136
821 821 -, g dbSNP:267608499
821 821 -, g dbSNP:61749708
822 822 -, a dbSNP:61749709
823 823 c, t dbSNP:587783137
828 828 -, c dbSNP:786204307
828 828 c, g, t dbSNP:61749710
829 829 a, t dbSNP:193922679
837 837 c, t dbSNP:61749711
838 838 a, g dbSNP:786204308
840 840 c, t dbSNP:61749712
842 842 a, c, g dbSNP:61749713
845 845 c, t dbSNP:61749714
846 846 a, c, g dbSNP:61749716
847 847 a, c, t dbSNP:61749717
851 851 a, c, g dbSNP:267608502
853 853 a, t dbSNP:61749718
856 856 -, g dbSNP:267608503
857 857 c, t dbSNP:61748381
858 858 a, g dbSNP:267608504
860 860 c, t dbSNP:587783138
863 863 -, a dbSNP:267608506
863 863 c, t dbSNP:61749720
864 864 a, g dbSNP:61749722
866 866 ag, ca dbSNP:267608507
866 866 c, g dbSNP:61749724
868 868 c, g, t dbSNP:61749726
872 872 a, c, g dbSNP:63485860
872 872 -, g dbSNP:61749727
875 875 -, t dbSNP:61749728
877 877 c, t dbSNP:61749729
882 882 a, g dbSNP:786205017
884 884 a, t dbSNP:61749730
886 886 -, agggtcctggagaaaagtcctgggaag dbSNP:267608508
888 888 c, g dbSNP:61749731
890 890 -, tcctggagaaaagtcctggga dbSNP:267608509
896 896 -, agaaaagtcctgg dbSNP:267608386
904 904 c, t dbSNP:786205894
906 906 -, tg dbSNP:267608510
909 909 -, gaag dbSNP:61749734
915 915 c, g, t dbSNP:267608512
921 921 c, g, t dbSNP:61749735
928 928 a, c, g dbSNP:267608513
929 929 c, g, t dbSNP:61749715
931 931 -, a dbSNP:267608514
932 932 -, a dbSNP:61749736
934 934 c, g dbSNP:61749737
938 938 c, g dbSNP:61749738
941 941 a, c, t dbSNP:61749739
945 945 a, c dbSNP:61749740
946 946 a, g dbSNP:587783139
950 950 -, g dbSNP:267608516
950 950 c, g dbSNP:61748422
950 950 -, g dbSNP:63260260
951 951 -, c dbSNP:61749741
956 956 c, g dbSNP:138211345
957 957 -, tgaggggggtggggc dbSNP:786204309
965 965 -, g dbSNP:267608517
965 965 -, g dbSNP:61749743
965 965 g, t dbSNP:62846063
970 970 -, g dbSNP:61749744
975 975 -, c dbSNP:267608518
975 975 c, g, t dbSNP:61749746
985 985 c, t dbSNP:61749747
989 989 -, tcatggtgatcaaacgccccggcagg dbSNP:267608519
991 991 atggtgat, gtg dbSNP:267608520
991 991 -, at dbSNP:61749749
994 994 -, g dbSNP:61749750
1003 1003 cgcccc, ggccg dbSNP:61750225
1003 1003 -, c, t dbSNP:61749752
1004 1004 a, g dbSNP:61750227
1005 1005 a, c, t dbSNP:61748424
1005 1005 c, tcaggaagctt dbSNP:267608521
1006 1006 -, acgcc, c dbSNP:61749751
1007 1007 c, t dbSNP:61750229
1008 1008 -, c, cc dbSNP:267608522
1008 1008 -, c dbSNP:61750231
1008 1008 c, t dbSNP:63582063
1009 1009 -, ggcaggaagcgaaaagctgaggccgaccc dbSNP:786204310
1010 1010 -, g dbSNP:61750232
1010 1010 -, g dbSNP:61750233
1011 1011 -, cagg dbSNP:267608523
1015 1015 a, t dbSNP:63259763
1018 1018 -, caggaagc dbSNP:61750235
1018 1018 c, t dbSNP:61749721
1019 1019 -, nnnnnnnn dbSNP:786205026
1021 1021 a, t dbSNP:786205027
1032 1032 c, t dbSNP:1042870
1034 1034 -, aaagctgaggccga dbSNP:267608524
1039 1039 c, t dbSNP:267608525
1040 1040 -, aggccattcccaagaaacggggccgaaagccggg dbSNP:786205028
1047 1047 -, tc dbSNP:267608526
1050 1050 c, g dbSNP:267608527
1054 1054 a, t dbSNP:61750238
1057 1057 c, t dbSNP:61750239
1061 1061 -, g dbSNP:61750241
1063 1063 -, c dbSNP:62931162
1063 1063 c, g, t dbSNP:61750240
1065 1065 -, aaag dbSNP:267608529
1067 1067 -, agccggg dbSNP:61750242
1070 1070 c, t dbSNP:61750243
1071 1071 -, ggggagtgtggtggcag dbSNP:63749012
1071 1071 a, g dbSNP:587783746
1074 1074 -, ccgaaagccgggg dbSNP:587783091
1074 1074 a, g, t dbSNP:61750245
1074 1074 -, g dbSNP:267608530
1085 1085 -, nnnnnnnnnnnnnnnnnnnnnnn dbSNP:786205029
1085 1085 -, c dbSNP:61750247
1087 1087 a, g dbSNP:786205018
1089 1089 c, t dbSNP:61750248
1090 1090 -, gggagtgtggtggcagccg dbSNP:786204311
1091 1091 c, t dbSNP:61750249
1095 1095 c, t dbSNP:61750251
1098 1098 c, g, t dbSNP:61750252
1104 1104 c, g dbSNP:61750253
1105 1105 a, g dbSNP:61750255
1109 1109 -, a dbSNP:267608531
1110 1110 aaaaaaaagact, gaaag dbSNP:786205030
1111 1111 -, aaag dbSNP:61750256
1112 1112 a, g dbSNP:267608533
1114 1114 c, g dbSNP:61750257
1119 1119 -, g dbSNP:267608535
1120 1120 -, aa dbSNP:267608536
1120 1120 a, t dbSNP:61750259
1124 1124 agtcttctatcc, caca dbSNP:786205031
1124 1124 -, a dbSNP:267608538
1125 1125 a, g dbSNP:587781032
1126 1126 g, t dbSNP:61751360
1129 1129 -, a dbSNP:61751361
1134 1134 c, g dbSNP:587783140
1135 1135 -, cgatc dbSNP:61751364
1135 1135 c, g, t dbSNP:61751362
1136 1136 -, gatctgtgcaggagaccgtact dbSNP:267608540
1136 1136 a, c, g dbSNP:61751366
1138 1138 -, t dbSNP:267608541
1144 1144 c, t dbSNP:61751367
1152 1152 c, g, t dbSNP:61748423
1153 1153 -, gtactcc dbSNP:267608543
1153 1153 -, gtac dbSNP:62701461
1153 1153 a, g dbSNP:61751370
1153 1153 -, g dbSNP:267608544
1155 1155 -, actccccat dbSNP:267608545
1158 1158 c, g, t dbSNP:61751372
1159 1159 a, c, g, t dbSNP:61751373
1160 1160 a, c, g, t dbSNP:61749723
1161 1161 -, c dbSNP:267608548
1161 1161 c, g dbSNP:61751438
1163 1163 g, t dbSNP:267608549
1164 1164 c, g dbSNP:61751439
1165 1165 a, g dbSNP:61751440
1166 1166 a, c, g dbSNP:267608550
1168 1168 a, g dbSNP:267608551
1169 1169 a, g dbSNP:61751441
1171 1171 a, c, g, t dbSNP:28935468
1172 1172 a, g, t dbSNP:61751443
1180 1180 c, t dbSNP:61751444
1187 1187 c, t dbSNP:61751445
1191 1191 c, t dbSNP:398124188
1197 1197 c, t dbSNP:61751446
1203 1203 c, g, t dbSNP:61751447
1208 1208 a, c dbSNP:61751448
1219 1219 c, g, t dbSNP:61751449
1220 1220 -, ccctgc dbSNP:61751452
1220 1220 c, t dbSNP:61751450
1237 1237 c, g dbSNP:267608556
1239 1239 a, c, t dbSNP:61751442
1240 1240 a, g dbSNP:201871183
1242 1242 nnnnnnnnnnnnn, tgagaag dbSNP:786204312
1244 1244 agaagagc, nnnnnnnnnnnnnnnnnn dbSNP:672601302
1247 1247 -, aga dbSNP:61751456
1247 1247 a, g dbSNP:267608557
1249 1249 -, agcgg dbSNP:267608558
1251 1251 c, t dbSNP:148744894
1254 1254 g, t dbSNP:61751451
1259 1259 -, gactgaagacctgtaagagccctgggcggaaaag dbSNP:267608376
1261 1261 c, g dbSNP:587783104
1264 1264 -, aagacctgtaagagccctg dbSNP:267608559
1268 1268 c, g dbSNP:786204313
1269 1269 c, t dbSNP:267608400
1270 1270 c, t dbSNP:267608560
1284 1284 -, g dbSNP:267608331
1284 1284 -, g dbSNP:61751457
1285 1285 c, g, t dbSNP:61752361
1290 1290 a, g dbSNP:61752362
1293 1293 c, g dbSNP:61752365
1298 1298 -, agagcagccccaag dbSNP:267608380
1303 1303 -, agccccaaggggcgcagcagcagcgcctcctcaccccccaagaaggag dbSNP:267608562
1306 1306 -, cccaaggggcgcagc dbSNP:267608384
1306 1306 -, ccca dbSNP:267608377
1308 1308 c, g dbSNP:786205013
1314 1314 -, gcgcagcagcagcg dbSNP:267608378
1315 1315 c, t dbSNP:143876280
1316 1316 -, gcagcagcagcgcc dbSNP:267608381
1316 1316 a, g, t dbSNP:61748387
1320 1320 a, c, t dbSNP:267608563
1324 1324 -, agc dbSNP:267608564
1326 1326 c, t dbSNP:61750236
1327 1327 a, g dbSNP:147017239
1330 1330 c, t dbSNP:61752371
1334 1334 a, c dbSNP:61752372
1336 1336 a, c, g dbSNP:61752373
1340 1340 a, c, t dbSNP:587783105
1341 1341 -, c dbSNP:587783092
1342 1342 a, t dbSNP:61752375
1343 1343 -, agaaggagcaccaccaccatcaccacca dbSNP:267608385
1348 1348 -, gag dbSNP:786205032
1354 1354 -, caccaccatcaccaccactc dbSNP:267608567
1356 1356 -, ccacca dbSNP:587783093
1359 1359 -, cca dbSNP:61752381
1359 1359 c, g, t dbSNP:61752382
1360 1360 -, catcaccaccac dbSNP:267608371
1360 1360 -, c dbSNP:267608568
1373 1373 a, c, g dbSNP:267608569
1380 1380 -, cccaaaggccccc dbSNP:267608340
1381 1381 c, t dbSNP:61752387
1382 1382 -, caaaggccccc dbSNP:267608570
1382 1382 c, g dbSNP:61752976
1384 1384 aaggc, gagt dbSNP:267608379
1384 1384 a, c, g, t dbSNP:368461080
1387 1387 -, gcccccgtgccactgctcccacccctgc dbSNP:267608348
1387 1387 g, t dbSNP:587783106
1388 1388 a, c, g, t dbSNP:201314910
1390 1390 -, cccgtgcc dbSNP:267608571
1391 1391 -, ccgtgcc dbSNP:267608389
1392 1392 c, t dbSNP:61752980
1393 1393 -, gtgccactgctcccacccctgccccc dbSNP:267608382
1393 1393 a, g dbSNP:267608572
1395 1395 a, g dbSNP:201711454
1396 1396 c, g, t dbSNP:61752981
1400 1400 -, tgctcccacccctgcccccacctccacctgagcccgagagctccgagg ac dbSNP:267608573
1400 1400 -, tgctcccacccctgcccccacctccac dbSNP:587783094
1402 1402 -, ctcccacccctgcccccacctccacctgag dbSNP:267608350
1405 1405 -, ccacccctgcccccacctccacctgagcccgagagctccgagg dbSNP:63749023
1406 1406 -, cacccctgcccccacctccacctgagcccgagagctccgag dbSNP:63749024
1406 1406 -, cacccctgcccccacctccacctgagcccgagagctcc dbSNP:267608574
1406 1406 -, cacccctgcccccacctccacctgagcccgaga dbSNP:267608575
1406 1406 c, t dbSNP:193922676
1407 1407 -, acccctgcccccacctccacctgagcccgagagctccgaggacc dbSNP:267608372
1407 1407 -, accc dbSNP:267608576
1408 1408 -, cccctgcccccacctccacctgagcccgagagctccga dbSNP:267608577
1408 1408 -, cccctgcccccacctccacctgagcccgagagctcc dbSNP:786205033
1409 1409 -, ccctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608579
1409 1409 -, ccctgcccccacctccacctgagcccgagagc dbSNP:267608578
1409 1409 a, c, t dbSNP:111302745
1410 1410 -, cctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608329
1410 1410 -, cctgcccccacctccacctgagcccgaga dbSNP:267608580
1410 1410 -, cctgcccccacctccacc dbSNP:267608392
1410 1410 -, cctgcccccacc dbSNP:786205034
1411 1411 -, ctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608581
1411 1411 -, ctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608583
1411 1411 -, ctgcccccacctccacc dbSNP:267608582
1412 1412 -, tgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63749748
1412 1412 -, tgcccccacctccacctgagcccgagagctccgaggaccccac dbSNP:267608587
1412 1412 -, tgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608327
1412 1412 -, tgcccccacctccacctgagcccgagagctccgagg dbSNP:63749028
1412 1412 -, tgcccccacctccacctgagcccgagagctccgag dbSNP:267608586
1412 1412 -, tgcccccacctccacctgagcccgagagctcc dbSNP:267608585
1412 1412 -, tgcccccacctccacctgagcccgagagctc dbSNP:61754419
1412 1412 -, ct dbSNP:267608584
1413 1413 -, gcccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:61752992
1413 1413 -, gcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63009262
1413 1413 -, gcccccacctccacctgagcccgagagctccgaggacccca dbSNP:267608588
1413 1413 cca, gcccccacctccacctgagcccgagagct dbSNP:386134271
1413 1413 -, gcccccacctccacctgagcccgagagct dbSNP:63749029
1413 1413 -, gcccccacct dbSNP:63583161
1414 1414 -, cccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:63749030
1414 1414 -, cccccacctccacctgagcccgagagctccgagga dbSNP:267608589
1414 1414 -, cccccacctccacctg dbSNP:267608373
1414 1414 cc, t dbSNP:267608590
1415 1415 aggggtgg, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:786205035
1415 1415 -, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608592
1415 1415 -, ccccacctccacctgagcccgagagctcc dbSNP:267608593
1415 1415 -, ccccacctccacctgagcccgagagc dbSNP:267608591
1415 1415 -, ccccacctccacctgagcccg dbSNP:267608594
1415 1415 -, ccccacc dbSNP:267608595
1415 1415 c, t dbSNP:63390262
1416 1416 a, cccacctccacctgagcccgagagctccgaggaccccaccagccc dbSNP:267608596
1416 1416 -, cccacctccacctgagcccgagagctcc dbSNP:786204314
1416 1416 -, cccacctcc dbSNP:267608401
1416 1416 -, cccacc dbSNP:267608332
1416 1416 -, ccc dbSNP:267608339
1416 1416 c, t dbSNP:61750246
1417 1417 -, ccacctccacctgagcccgagagctccgag dbSNP:63749034
1417 1417 -, ccacctccacctgagccc dbSNP:267608406
1417 1417 -, cc dbSNP:267608598
1417 1417 cc, ta dbSNP:267608597
1417 1417 c, g, t dbSNP:61753000
1418 1418 -, cacctccacctgagcccgagagctccgaggaccccacca dbSNP:267608602
1418 1418 -, cacctccacctgagcccgagagctccgaggacccc dbSNP:267608599
1418 1418 -, cacctccacctgagcccgagagctcc dbSNP:267608600
1418 1418 -, cacctccacctgagccc dbSNP:267608601
1418 1418 -, cacctccacct dbSNP:267608334
1418 1418 c, t dbSNP:61753006
1419 1419 -, acctccacctgagcccgagagctccgaggaccccaccagcccccc dbSNP:267608605
1419 1419 -, acctccacctgagcccgagagctccgaggaccccaccagccccc dbSNP:63749749
1419 1419 -, acctccacctgagcccgagagctccgaggaccccaccagcccc dbSNP:267608603
1419 1419 -, acctccacctgagcccgagagctccgaggac dbSNP:786205020
1419 1419 acctccacctgagcccgagag, ctgagccccaggacttgagca dbSNP:786205019
1419 1419 -, acctccacc dbSNP:267608604
1419 1419 -, a dbSNP:267608606
1420 1420 -, cctccacctgagcccgagagctccga dbSNP:267608607
1422 1422 -, tccacctgagcccgagagctccgaggaccccacc dbSNP:267608343
1422 1422 -, tccacctgag dbSNP:267608349
1423 1423 -, ccacct dbSNP:61753008
1424 1424 -, ca dbSNP:267608608
1425 1425 -, acctgagcccgagagctccgaggaccccaccagccccc dbSNP:267608609
1428 1428 -, tgagcccgagagctcc dbSNP:267608369
1431 1431 -, gcccgagagctccgagga dbSNP:267608335
1431 1431 a, g dbSNP:61753009
1433 1433 -, ccgagagc dbSNP:267608383
1433 1433 c, t dbSNP:267608402
1435 1435 -, gagagctccgaggaccccaccagccc dbSNP:267608333
1435 1435 -, t dbSNP:786205021
1435 1435 a, g, t dbSNP:63094662
1436 1436 -, agagctccgag dbSNP:267608403
1440 1440 -, ctccgag dbSNP:63749018
1444 1444 -, gaggaccc dbSNP:267608338
1444 1444 a, g, t dbSNP:56268439
1445 1445 -, a dbSNP:267608610
1449 1449 -, t dbSNP:61753011
1451 1451 c, t dbSNP:62915962
1452 1452 -, c dbSNP:267608612
1452 1452 c, t dbSNP:61753012
1455 1455 -, c dbSNP:267608613
1457 1457 -, g dbSNP:267608614
1457 1457 a, c, g dbSNP:62707562
1460 1460 a, c, t dbSNP:61753014
1461 1461 c, t dbSNP:63586860
1463 1463 a, c, t dbSNP:587783107
1469 1469 -, cccaggacttgagcagc dbSNP:267608615
1469 1469 c, t dbSNP:61753016
1470 1470 c, t dbSNP:61753964
1471 1471 c, t dbSNP:61753965
1478 1478 -, tgagcagcagcgtctgcaaagaggagaagatgcccagaggagg dbSNP:63749038
1479 1479 c, g dbSNP:786204315
1484 1484 a, g dbSNP:267608616
1487 1487 -, gcgtctgca dbSNP:63749027
1487 1487 -, gcgtc dbSNP:267608351
1488 1488 -, cgtctgcaaag dbSNP:786205036
1488 1488 c, t dbSNP:3027928
1489 1489 a, g dbSNP:61753966
1490 1490 -, tctgcaaagaggagaagatgcccaga dbSNP:267608617
1493 1493 -, gcaaagaggagaagatgcccagaggaggc dbSNP:267608374
1494 1494 c, t dbSNP:61753967
1505 1505 a, t dbSNP:61753968
1510 1510 c, t dbSNP:140258520
1520 1520 agcggccg, gctcactggagagcgacggctgccc dbSNP:63749064
1521 1521 c, g, t dbSNP:61753970
1533 1533 c, t dbSNP:267608619
1537 1537 a, g dbSNP:61753971
1539 1539 c, t dbSNP:267608621
1543 1543 c, t dbSNP:267608622
1545 1545 -, c dbSNP:587783095
1563 1563 -, tc dbSNP:61753972
1570 1570 a, g, t dbSNP:61753973
1575 1575 -, t dbSNP:267608624
1577 1577 -, ccaccgccg dbSNP:267608404
1579 1579 -, accgccgccacggccgcagaaaagtacaaacaccgagggga dbSNP:267608625
1579 1579 a, g dbSNP:61753974
1581 1581 c, t dbSNP:61751363
1582 1582 a, g dbSNP:193922677
1585 1585 -, gccacggccgcag dbSNP:63749065
1585 1585 a, g dbSNP:61753975
1590 1590 a, g dbSNP:3027927
1593 1593 -, cgcaga dbSNP:786205022
1594 1594 a, g dbSNP:267608626
1595 1595 c, t dbSNP:61753978
1612 1612 c, t dbSNP:61753979
1613 1613 a, g dbSNP:61753980
1618 1618 g, t dbSNP:104894864
1619 1619 -, c dbSNP:267608627
1627 1627 c, t dbSNP:267608628
1628 1628 a, g dbSNP:185957513
1651 1651 -, at dbSNP:267608630
1658 1658 -, ggccaa dbSNP:267608632
1659 1659 a, g dbSNP:267608633
1663 1663 aaca, tg dbSNP:786205023
1665 1665 -, ca dbSNP:786204316
1670 1670 -, ag dbSNP:267608634
1675 1675 c, t dbSNP:587783108
1685 1685 c, g dbSNP:267608328
1688 1688 a, g dbSNP:145790362
1691 1691 c, t dbSNP:267608635
1692 1692 a, g dbSNP:587781033
1693 1693 c, t dbSNP:267608636
1696 1696 a, g dbSNP:193922678
1701 1701 c, t dbSNP:76895094
1702 1702 g, t dbSNP:587777421
1703 1703 -, agagagttagctgactttacacggagcggattgcaaagcaaac dbSNP:267608393
1704 1704 c, g dbSNP:267608336
1705 1705 -, agagttagctgactttacacggag dbSNP:267608637
1705 1705 -, agag dbSNP:267608638
1706 1706 c, g dbSNP:267608370
1708 1708 -, ag dbSNP:267608639
1709 1709 -, ttag dbSNP:267608640
1711 1711 -, ta dbSNP:267608641
1714 1714 c, t dbSNP:267608337
1715 1715 g, t dbSNP:267608399
1716 1716 a, c, g dbSNP:267608642
1724 1724 c, t dbSNP:267608330
1725 1725 a, g dbSNP:144008995
1730 1730 a, g dbSNP:199963992
1752 1752 c, g dbSNP:267608347
1771 1771 c, g dbSNP:267608344
1808 1808 c, g, t dbSNP:62621672
1809 1809 a, g dbSNP:267608326
1814 1814 -, a dbSNP:267608341
1838 1838 -, t dbSNP:267608342
1872 1872 g, t dbSNP:73627291
1893 1893 c, g dbSNP:267608345
1920 1920 a, g dbSNP:267608352
2044 2044 a, g dbSNP:62621673
2075 2075 c, g dbSNP:62621674
2079 2079 c, g dbSNP:62621675
2083 2083 a, g dbSNP:62620967
2087 2087 c, g dbSNP:187851059
2109 2109 a, g dbSNP:267608361
2203 2203 c, g dbSNP:267608325
2205 2205 c, g dbSNP:111565519
2245 2245 g, t dbSNP:267608362
2260 2260 a, g dbSNP:183349022
2270 2270 a, g dbSNP:267608353
2483 2483 g, t dbSNP:267608354
2512 2512 -, acaaggtgcaggcaggctggcctgggg dbSNP:267608375
2522 2522 a, g dbSNP:267608363
2547 2547 c, g dbSNP:190920575
2577 2577 g, t dbSNP:187614438
2591 2591 -, a dbSNP:267608364
2594 2594 c, g dbSNP:3027924
2850 2850 a, g dbSNP:267608390
2953 2953 c, t dbSNP:267608365
2992 2992 a, g dbSNP:2853337
3084 3084 a, c dbSNP:267608355
3116 3116 c, g dbSNP:3027923
3226 3226 c, t dbSNP:112674002

Target ORF information:

RefSeq Version XM_005274681
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54402
Accession Version XM_005274683.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1182bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methyl-CpG-binding protein 2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838855. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)792..1016(+)
Misc Feature(2)831..923(+)
Position Chain Variation Link
540 540 c, g, t dbSNP:61754421
548 548 a, c, g, t dbSNP:61754422
554 554 -, agtcagaa dbSNP:63749008
558 558 c, t dbSNP:61754424
562 562 -, a dbSNP:267608416
567 567 c, t dbSNP:61754425
568 568 -, a dbSNP:267608417
576 576 a, t dbSNP:62641234
588 588 -, c dbSNP:61754426
602 602 a, g dbSNP:398124187
603 603 -, g dbSNP:61754427
612 612 -, gata dbSNP:61754428
619 619 -, aagaaga dbSNP:267608424
619 619 -, aa dbSNP:267608425
620 620 -, agaa dbSNP:267608426
629 629 -, a dbSNP:267608427
631 631 -, ag dbSNP:267608428
638 638 -, g dbSNP:61754430
648 648 a, c, g dbSNP:587783134
652 652 -, a dbSNP:61754431
658 658 a, c, g dbSNP:61754432
665 665 c, g, t dbSNP:267608432
667 667 a, g dbSNP:61754433
679 679 -, cc dbSNP:267608434
680 680 c, t dbSNP:61754435
701 701 -, ga dbSNP:61754436
706 706 c, g dbSNP:61754437
713 713 -, g dbSNP:61754438
715 715 c, g dbSNP:267608438
722 722 c, t dbSNP:61754439
727 727 -, c, t dbSNP:61754441
727 727 c, t dbSNP:61754440
736 736 c, t dbSNP:267608440
737 737 a, g dbSNP:61754442
741 741 -, gcttctgcct dbSNP:63749009
745 745 -, c dbSNP:267608442
755 755 -, c dbSNP:267608443
757 757 a, g dbSNP:61754444
761 761 -, nnnnnnn dbSNP:786205024
769 769 c, g dbSNP:61754445
770 770 -, ca dbSNP:267608444
785 785 a, g dbSNP:200629699
786 786 g, t dbSNP:267608445
787 787 -, g dbSNP:267608446
787 787 -, g dbSNP:587783090
788 788 -, g dbSNP:267608405
789 789 c, t dbSNP:61754447
791 791 c, t dbSNP:267608447
801 801 g, t dbSNP:61754448
803 803 a, c dbSNP:61754449
807 807 -, acc dbSNP:267608449
809 809 c, g dbSNP:61754450
810 810 c, g dbSNP:28935168
811 811 g, t dbSNP:61754451
813 813 c, t dbSNP:61754452
814 814 a, c, g, t dbSNP:61754453
820 820 a, g dbSNP:267608450
822 822 c, t dbSNP:267608451
823 823 -, ggacacggaagct dbSNP:63749010
823 823 a, g dbSNP:61754455
827 827 -, a dbSNP:61754456
828 828 c, g, t dbSNP:28934907
829 829 a, g, t dbSNP:61754457
833 833 -, gaag dbSNP:786205025
835 835 a, c, t dbSNP:61754458
838 838 -, a dbSNP:267608452
843 843 a, g dbSNP:61754459
846 846 a, t dbSNP:267608398
853 853 c, g dbSNP:61755760
855 855 c, t dbSNP:267608388
857 857 -, c dbSNP:61755761
870 870 g, t dbSNP:267608454
874 874 a, g dbSNP:61755762
876 876 a, g dbSNP:267608455
877 877 c, t dbSNP:267608456
884 884 c, g, t dbSNP:61755763
887 887 a, c dbSNP:146107517
887 887 -, c dbSNP:267608457
889 889 a, g dbSNP:786205037
892 892 c, t dbSNP:267608387
894 894 c, g, t dbSNP:267608469
895 895 a, c dbSNP:61748383
898 898 g, t dbSNP:61748384
902 902 -, a dbSNP:786205895
904 904 a, c dbSNP:267608470
905 905 c, g, t dbSNP:61748385
909 909 c, g, t dbSNP:28934904
910 910 a, g, t dbSNP:61748389
912 912 c, t dbSNP:267608471
913 913 c, g, t dbSNP:61748390
915 915 a, g dbSNP:61748391
922 922 a, g dbSNP:61748392
923 923 -, g dbSNP:61748393
925 925 a, c, t dbSNP:267608475
931 931 a, c, t dbSNP:28934908
932 932 -, g dbSNP:267608476
934 934 -, a dbSNP:61748394
934 934 a, g dbSNP:61748395
935 935 a, c, g dbSNP:61748396
938 938 c, t dbSNP:61748397
940 940 -, t dbSNP:61748398
942 942 a, t dbSNP:61748399
943 943 -, a dbSNP:61748400
943 943 a, g dbSNP:786205016
950 950 c, t dbSNP:61748386
951 951 a, g dbSNP:61748401
951 951 -, g dbSNP:62952161
963 963 -, g dbSNP:61748402
964 964 a, g dbSNP:61748403
966 966 c, g dbSNP:179363900
967 967 c, g dbSNP:61748404
975 975 a, t dbSNP:61748406
976 976 c, g, t dbSNP:28934905
979 979 a, c, g dbSNP:61748407
980 980 c, g, t dbSNP:61748408
981 981 a, t dbSNP:61748410
982 982 -, t dbSNP:267608482
982 982 -, tc dbSNP:267608483
983 983 c, g dbSNP:267608484
984 984 a, g dbSNP:61748411
985 985 c, t dbSNP:28934906
986 986 a, g dbSNP:61748413
987 987 -, g dbSNP:267608485
991 991 c, g dbSNP:61748414
992 992 -, tg dbSNP:267608486
992 992 -, t dbSNP:61748415
993 993 g, t dbSNP:61748416
994 994 a, g, t dbSNP:61748417
995 995 -, g dbSNP:61748418
996 996 -, a dbSNP:267608487
996 996 a, g dbSNP:727505391
1000 1000 -, gg dbSNP:267608488
1007 1007 -, c dbSNP:267608489
1011 1011 c, t dbSNP:61748420
1014 1014 a, c, t dbSNP:61748421
1018 1018 a, g dbSNP:587783745
1020 1020 c, t dbSNP:61748425
1026 1026 c, t dbSNP:61748426
1027 1027 c, t dbSNP:267608491
1029 1029 c, g dbSNP:61748427
1030 1030 c, g dbSNP:267608492
1035 1035 a, t dbSNP:61748428
1039 1039 a, c, g dbSNP:61749701
1040 1040 c, g dbSNP:61754420
1041 1041 a, g, t dbSNP:61749702
1043 1043 -, a dbSNP:61749703
1050 1050 a, t dbSNP:267608495
1054 1054 c, t dbSNP:61749705
1055 1055 -, tc dbSNP:267608496
1059 1059 c, g dbSNP:61749706
1065 1065 a, g dbSNP:587783135
1066 1066 -, g dbSNP:61749707
1068 1068 a, t dbSNP:587783136
1078 1078 -, g dbSNP:267608499
1078 1078 -, g dbSNP:61749708
1079 1079 -, a dbSNP:61749709
1080 1080 c, t dbSNP:587783137
1085 1085 -, c dbSNP:786204307
1085 1085 c, g, t dbSNP:61749710
1086 1086 a, t dbSNP:193922679
1094 1094 c, t dbSNP:61749711
1095 1095 a, g dbSNP:786204308
1097 1097 c, t dbSNP:61749712
1099 1099 a, c, g dbSNP:61749713
1102 1102 c, t dbSNP:61749714
1103 1103 a, c, g dbSNP:61749716
1104 1104 a, c, t dbSNP:61749717
1108 1108 a, c, g dbSNP:267608502
1110 1110 a, t dbSNP:61749718
1113 1113 -, g dbSNP:267608503
1114 1114 c, t dbSNP:61748381
1115 1115 a, g dbSNP:267608504
1117 1117 c, t dbSNP:587783138
1120 1120 -, a dbSNP:267608506
1120 1120 c, t dbSNP:61749720
1121 1121 a, g dbSNP:61749722
1123 1123 ag, ca dbSNP:267608507
1123 1123 c, g dbSNP:61749724
1125 1125 c, g, t dbSNP:61749726
1129 1129 a, c, g dbSNP:63485860
1129 1129 -, g dbSNP:61749727
1132 1132 -, t dbSNP:61749728
1134 1134 c, t dbSNP:61749729
1139 1139 a, g dbSNP:786205017
1141 1141 a, t dbSNP:61749730
1143 1143 -, agggtcctggagaaaagtcctgggaag dbSNP:267608508
1145 1145 c, g dbSNP:61749731
1147 1147 -, tcctggagaaaagtcctggga dbSNP:267608509
1153 1153 -, agaaaagtcctgg dbSNP:267608386
1161 1161 c, t dbSNP:786205894
1163 1163 -, tg dbSNP:267608510
1166 1166 -, gaag dbSNP:61749734
1172 1172 c, g, t dbSNP:267608512
1178 1178 c, g, t dbSNP:61749735
1185 1185 a, c, g dbSNP:267608513
1186 1186 c, g, t dbSNP:61749715
1188 1188 -, a dbSNP:267608514
1189 1189 -, a dbSNP:61749736
1191 1191 c, g dbSNP:61749737
1195 1195 c, g dbSNP:61749738
1198 1198 a, c, t dbSNP:61749739
1202 1202 a, c dbSNP:61749740
1203 1203 a, g dbSNP:587783139
1207 1207 -, g dbSNP:267608516
1207 1207 c, g dbSNP:61748422
1207 1207 -, g dbSNP:63260260
1208 1208 -, c dbSNP:61749741
1213 1213 c, g dbSNP:138211345
1214 1214 -, tgaggggggtggggc dbSNP:786204309
1222 1222 -, g dbSNP:267608517
1222 1222 -, g dbSNP:61749743
1222 1222 g, t dbSNP:62846063
1227 1227 -, g dbSNP:61749744
1232 1232 -, c dbSNP:267608518
1232 1232 c, g, t dbSNP:61749746
1242 1242 c, t dbSNP:61749747
1246 1246 -, tcatggtgatcaaacgccccggcagg dbSNP:267608519
1248 1248 atggtgat, gtg dbSNP:267608520
1248 1248 -, at dbSNP:61749749
1251 1251 -, g dbSNP:61749750
1260 1260 cgcccc, ggccg dbSNP:61750225
1260 1260 -, c, t dbSNP:61749752
1261 1261 a, g dbSNP:61750227
1262 1262 a, c, t dbSNP:61748424
1262 1262 c, tcaggaagctt dbSNP:267608521
1263 1263 -, acgcc, c dbSNP:61749751
1264 1264 c, t dbSNP:61750229
1265 1265 -, c, cc dbSNP:267608522
1265 1265 -, c dbSNP:61750231
1265 1265 c, t dbSNP:63582063
1266 1266 -, ggcaggaagcgaaaagctgaggccgaccc dbSNP:786204310
1267 1267 -, g dbSNP:61750232
1267 1267 -, g dbSNP:61750233
1268 1268 -, cagg dbSNP:267608523
1272 1272 a, t dbSNP:63259763
1275 1275 -, caggaagc dbSNP:61750235
1275 1275 c, t dbSNP:61749721
1276 1276 -, nnnnnnnn dbSNP:786205026
1278 1278 a, t dbSNP:786205027
1289 1289 c, t dbSNP:1042870
1291 1291 -, aaagctgaggccga dbSNP:267608524
1296 1296 c, t dbSNP:267608525
1297 1297 -, aggccattcccaagaaacggggccgaaagccggg dbSNP:786205028
1304 1304 -, tc dbSNP:267608526
1307 1307 c, g dbSNP:267608527
1311 1311 a, t dbSNP:61750238
1314 1314 c, t dbSNP:61750239
1318 1318 -, g dbSNP:61750241
1320 1320 -, c dbSNP:62931162
1320 1320 c, g, t dbSNP:61750240
1322 1322 -, aaag dbSNP:267608529
1324 1324 -, agccggg dbSNP:61750242
1327 1327 c, t dbSNP:61750243
1328 1328 -, ggggagtgtggtggcag dbSNP:63749012
1328 1328 a, g dbSNP:587783746
1331 1331 -, ccgaaagccgggg dbSNP:587783091
1331 1331 a, g, t dbSNP:61750245
1331 1331 -, g dbSNP:267608530
1342 1342 -, nnnnnnnnnnnnnnnnnnnnnnn dbSNP:786205029
1342 1342 -, c dbSNP:61750247
1344 1344 a, g dbSNP:786205018
1346 1346 c, t dbSNP:61750248
1347 1347 -, gggagtgtggtggcagccg dbSNP:786204311
1348 1348 c, t dbSNP:61750249
1352 1352 c, t dbSNP:61750251
1355 1355 c, g, t dbSNP:61750252
1361 1361 c, g dbSNP:61750253
1362 1362 a, g dbSNP:61750255
1366 1366 -, a dbSNP:267608531
1367 1367 aaaaaaaagact, gaaag dbSNP:786205030
1368 1368 -, aaag dbSNP:61750256
1369 1369 a, g dbSNP:267608533
1371 1371 c, g dbSNP:61750257
1376 1376 -, g dbSNP:267608535
1377 1377 -, aa dbSNP:267608536
1377 1377 a, t dbSNP:61750259
1381 1381 agtcttctatcc, caca dbSNP:786205031
1381 1381 -, a dbSNP:267608538
1382 1382 a, g dbSNP:587781032
1383 1383 g, t dbSNP:61751360
1386 1386 -, a dbSNP:61751361
1391 1391 c, g dbSNP:587783140
1392 1392 -, cgatc dbSNP:61751364
1392 1392 c, g, t dbSNP:61751362
1393 1393 -, gatctgtgcaggagaccgtact dbSNP:267608540
1393 1393 a, c, g dbSNP:61751366
1395 1395 -, t dbSNP:267608541
1401 1401 c, t dbSNP:61751367
1409 1409 c, g, t dbSNP:61748423
1410 1410 -, gtactcc dbSNP:267608543
1410 1410 -, gtac dbSNP:62701461
1410 1410 a, g dbSNP:61751370
1410 1410 -, g dbSNP:267608544
1412 1412 -, actccccat dbSNP:267608545
1415 1415 c, g, t dbSNP:61751372
1416 1416 a, c, g, t dbSNP:61751373
1417 1417 a, c, g, t dbSNP:61749723
1418 1418 -, c dbSNP:267608548
1418 1418 c, g dbSNP:61751438
1420 1420 g, t dbSNP:267608549
1421 1421 c, g dbSNP:61751439
1422 1422 a, g dbSNP:61751440
1423 1423 a, c, g dbSNP:267608550
1425 1425 a, g dbSNP:267608551
1426 1426 a, g dbSNP:61751441
1428 1428 a, c, g, t dbSNP:28935468
1429 1429 a, g, t dbSNP:61751443
1437 1437 c, t dbSNP:61751444
1444 1444 c, t dbSNP:61751445
1448 1448 c, t dbSNP:398124188
1454 1454 c, t dbSNP:61751446
1460 1460 c, g, t dbSNP:61751447
1465 1465 a, c dbSNP:61751448
1476 1476 c, g, t dbSNP:61751449
1477 1477 -, ccctgc dbSNP:61751452
1477 1477 c, t dbSNP:61751450
1494 1494 c, g dbSNP:267608556
1496 1496 a, c, t dbSNP:61751442
1497 1497 a, g dbSNP:201871183
1499 1499 nnnnnnnnnnnnn, tgagaag dbSNP:786204312
1501 1501 agaagagc, nnnnnnnnnnnnnnnnnn dbSNP:672601302
1504 1504 -, aga dbSNP:61751456
1504 1504 a, g dbSNP:267608557
1506 1506 -, agcgg dbSNP:267608558
1508 1508 c, t dbSNP:148744894
1511 1511 g, t dbSNP:61751451
1516 1516 -, gactgaagacctgtaagagccctgggcggaaaag dbSNP:267608376
1518 1518 c, g dbSNP:587783104
1521 1521 -, aagacctgtaagagccctg dbSNP:267608559
1525 1525 c, g dbSNP:786204313
1526 1526 c, t dbSNP:267608400
1527 1527 c, t dbSNP:267608560
1541 1541 -, g dbSNP:267608331
1541 1541 -, g dbSNP:61751457
1542 1542 c, g, t dbSNP:61752361
1547 1547 a, g dbSNP:61752362
1550 1550 c, g dbSNP:61752365
1555 1555 -, agagcagccccaag dbSNP:267608380
1560 1560 -, agccccaaggggcgcagcagcagcgcctcctcaccccccaagaaggag dbSNP:267608562
1563 1563 -, cccaaggggcgcagc dbSNP:267608384
1563 1563 -, ccca dbSNP:267608377
1565 1565 c, g dbSNP:786205013
1571 1571 -, gcgcagcagcagcg dbSNP:267608378
1572 1572 c, t dbSNP:143876280
1573 1573 -, gcagcagcagcgcc dbSNP:267608381
1573 1573 a, g, t dbSNP:61748387
1577 1577 a, c, t dbSNP:267608563
1581 1581 -, agc dbSNP:267608564
1583 1583 c, t dbSNP:61750236
1584 1584 a, g dbSNP:147017239
1587 1587 c, t dbSNP:61752371
1591 1591 a, c dbSNP:61752372
1593 1593 a, c, g dbSNP:61752373
1597 1597 a, c, t dbSNP:587783105
1598 1598 -, c dbSNP:587783092
1599 1599 a, t dbSNP:61752375
1600 1600 -, agaaggagcaccaccaccatcaccacca dbSNP:267608385
1605 1605 -, gag dbSNP:786205032
1611 1611 -, caccaccatcaccaccactc dbSNP:267608567
1613 1613 -, ccacca dbSNP:587783093
1616 1616 -, cca dbSNP:61752381
1616 1616 c, g, t dbSNP:61752382
1617 1617 -, catcaccaccac dbSNP:267608371
1617 1617 -, c dbSNP:267608568
1630 1630 a, c, g dbSNP:267608569
1637 1637 -, cccaaaggccccc dbSNP:267608340
1638 1638 c, t dbSNP:61752387
1639 1639 -, caaaggccccc dbSNP:267608570
1639 1639 c, g dbSNP:61752976
1641 1641 aaggc, gagt dbSNP:267608379
1641 1641 a, c, g, t dbSNP:368461080
1644 1644 -, gcccccgtgccactgctcccacccctgc dbSNP:267608348
1644 1644 g, t dbSNP:587783106
1645 1645 a, c, g, t dbSNP:201314910
1647 1647 -, cccgtgcc dbSNP:267608571
1648 1648 -, ccgtgcc dbSNP:267608389
1649 1649 c, t dbSNP:61752980
1650 1650 -, gtgccactgctcccacccctgccccc dbSNP:267608382
1650 1650 a, g dbSNP:267608572
1652 1652 a, g dbSNP:201711454
1653 1653 c, g, t dbSNP:61752981
1657 1657 -, tgctcccacccctgcccccacctccacctgagcccgagagctccgagg ac dbSNP:267608573
1657 1657 -, tgctcccacccctgcccccacctccac dbSNP:587783094
1659 1659 -, ctcccacccctgcccccacctccacctgag dbSNP:267608350
1662 1662 -, ccacccctgcccccacctccacctgagcccgagagctccgagg dbSNP:63749023
1663 1663 -, cacccctgcccccacctccacctgagcccgagagctccgag dbSNP:63749024
1663 1663 -, cacccctgcccccacctccacctgagcccgagagctcc dbSNP:267608574
1663 1663 -, cacccctgcccccacctccacctgagcccgaga dbSNP:267608575
1663 1663 c, t dbSNP:193922676
1664 1664 -, acccctgcccccacctccacctgagcccgagagctccgaggacc dbSNP:267608372
1664 1664 -, accc dbSNP:267608576
1665 1665 -, cccctgcccccacctccacctgagcccgagagctccga dbSNP:267608577
1665 1665 -, cccctgcccccacctccacctgagcccgagagctcc dbSNP:786205033
1666 1666 -, ccctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608579
1666 1666 -, ccctgcccccacctccacctgagcccgagagc dbSNP:267608578
1666 1666 a, c, t dbSNP:111302745
1667 1667 -, cctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608329
1667 1667 -, cctgcccccacctccacctgagcccgaga dbSNP:267608580
1667 1667 -, cctgcccccacctccacc dbSNP:267608392
1667 1667 -, cctgcccccacc dbSNP:786205034
1668 1668 -, ctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608581
1668 1668 -, ctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608583
1668 1668 -, ctgcccccacctccacc dbSNP:267608582
1669 1669 -, tgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63749748
1669 1669 -, tgcccccacctccacctgagcccgagagctccgaggaccccac dbSNP:267608587
1669 1669 -, tgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608327
1669 1669 -, tgcccccacctccacctgagcccgagagctccgagg dbSNP:63749028
1669 1669 -, tgcccccacctccacctgagcccgagagctccgag dbSNP:267608586
1669 1669 -, tgcccccacctccacctgagcccgagagctcc dbSNP:267608585
1669 1669 -, tgcccccacctccacctgagcccgagagctc dbSNP:61754419
1669 1669 -, ct dbSNP:267608584
1670 1670 -, gcccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:61752992
1670 1670 -, gcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63009262
1670 1670 -, gcccccacctccacctgagcccgagagctccgaggacccca dbSNP:267608588
1670 1670 cca, gcccccacctccacctgagcccgagagct dbSNP:386134271
1670 1670 -, gcccccacctccacctgagcccgagagct dbSNP:63749029
1670 1670 -, gcccccacct dbSNP:63583161
1671 1671 -, cccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:63749030
1671 1671 -, cccccacctccacctgagcccgagagctccgagga dbSNP:267608589
1671 1671 -, cccccacctccacctg dbSNP:267608373
1671 1671 cc, t dbSNP:267608590
1672 1672 aggggtgg, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:786205035
1672 1672 -, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608592
1672 1672 -, ccccacctccacctgagcccgagagctcc dbSNP:267608593
1672 1672 -, ccccacctccacctgagcccgagagc dbSNP:267608591
1672 1672 -, ccccacctccacctgagcccg dbSNP:267608594
1672 1672 -, ccccacc dbSNP:267608595
1672 1672 c, t dbSNP:63390262
1673 1673 a, cccacctccacctgagcccgagagctccgaggaccccaccagccc dbSNP:267608596
1673 1673 -, cccacctccacctgagcccgagagctcc dbSNP:786204314
1673 1673 -, cccacctcc dbSNP:267608401
1673 1673 -, cccacc dbSNP:267608332
1673 1673 -, ccc dbSNP:267608339
1673 1673 c, t dbSNP:61750246
1674 1674 -, ccacctccacctgagcccgagagctccgag dbSNP:63749034
1674 1674 -, ccacctccacctgagccc dbSNP:267608406
1674 1674 -, cc dbSNP:267608598
1674 1674 cc, ta dbSNP:267608597
1674 1674 c, g, t dbSNP:61753000
1675 1675 -, cacctccacctgagcccgagagctccgaggaccccacca dbSNP:267608602
1675 1675 -, cacctccacctgagcccgagagctccgaggacccc dbSNP:267608599
1675 1675 -, cacctccacctgagcccgagagctcc dbSNP:267608600
1675 1675 -, cacctccacctgagccc dbSNP:267608601
1675 1675 -, cacctccacct dbSNP:267608334
1675 1675 c, t dbSNP:61753006
1676 1676 -, acctccacctgagcccgagagctccgaggaccccaccagcccccc dbSNP:267608605
1676 1676 -, acctccacctgagcccgagagctccgaggaccccaccagccccc dbSNP:63749749
1676 1676 -, acctccacctgagcccgagagctccgaggaccccaccagcccc dbSNP:267608603
1676 1676 -, acctccacctgagcccgagagctccgaggac dbSNP:786205020
1676 1676 acctccacctgagcccgagag, ctgagccccaggacttgagca dbSNP:786205019
1676 1676 -, acctccacc dbSNP:267608604
1676 1676 -, a dbSNP:267608606
1677 1677 -, cctccacctgagcccgagagctccga dbSNP:267608607
1679 1679 -, tccacctgagcccgagagctccgaggaccccacc dbSNP:267608343
1679 1679 -, tccacctgag dbSNP:267608349
1680 1680 -, ccacct dbSNP:61753008
1681 1681 -, ca dbSNP:267608608
1682 1682 -, acctgagcccgagagctccgaggaccccaccagccccc dbSNP:267608609
1685 1685 -, tgagcccgagagctcc dbSNP:267608369
1688 1688 -, gcccgagagctccgagga dbSNP:267608335
1688 1688 a, g dbSNP:61753009
1690 1690 -, ccgagagc dbSNP:267608383
1690 1690 c, t dbSNP:267608402
1692 1692 -, gagagctccgaggaccccaccagccc dbSNP:267608333
1692 1692 -, t dbSNP:786205021
1692 1692 a, g, t dbSNP:63094662
1693 1693 -, agagctccgag dbSNP:267608403
1697 1697 -, ctccgag dbSNP:63749018
1701 1701 -, gaggaccc dbSNP:267608338
1701 1701 a, g, t dbSNP:56268439
1702 1702 -, a dbSNP:267608610
1706 1706 -, t dbSNP:61753011
1708 1708 c, t dbSNP:62915962
1709 1709 -, c dbSNP:267608612
1709 1709 c, t dbSNP:61753012
1712 1712 -, c dbSNP:267608613
1714 1714 -, g dbSNP:267608614
1714 1714 a, c, g dbSNP:62707562
1717 1717 a, c, t dbSNP:61753014
1718 1718 c, t dbSNP:63586860
1720 1720 a, c, t dbSNP:587783107
1726 1726 -, cccaggacttgagcagc dbSNP:267608615
1726 1726 c, t dbSNP:61753016
1727 1727 c, t dbSNP:61753964
1728 1728 c, t dbSNP:61753965
1735 1735 -, tgagcagcagcgtctgcaaagaggagaagatgcccagaggagg dbSNP:63749038
1736 1736 c, g dbSNP:786204315
1741 1741 a, g dbSNP:267608616
1744 1744 -, gcgtctgca dbSNP:63749027
1744 1744 -, gcgtc dbSNP:267608351
1745 1745 -, cgtctgcaaag dbSNP:786205036
1745 1745 c, t dbSNP:3027928
1746 1746 a, g dbSNP:61753966
1747 1747 -, tctgcaaagaggagaagatgcccaga dbSNP:267608617
1750 1750 -, gcaaagaggagaagatgcccagaggaggc dbSNP:267608374
1751 1751 c, t dbSNP:61753967
1762 1762 a, t dbSNP:61753968
1767 1767 c, t dbSNP:140258520
1777 1777 agcggccg, gctcactggagagcgacggctgccc dbSNP:63749064
1778 1778 c, g, t dbSNP:61753970
1790 1790 c, t dbSNP:267608619
1794 1794 a, g dbSNP:61753971
1796 1796 c, t dbSNP:267608621
1800 1800 c, t dbSNP:267608622
1802 1802 -, c dbSNP:587783095
1820 1820 -, tc dbSNP:61753972
1827 1827 a, g, t dbSNP:61753973
1832 1832 -, t dbSNP:267608624
1834 1834 -, ccaccgccg dbSNP:267608404
1836 1836 -, accgccgccacggccgcagaaaagtacaaacaccgagggga dbSNP:267608625
1836 1836 a, g dbSNP:61753974
1838 1838 c, t dbSNP:61751363
1839 1839 a, g dbSNP:193922677
1842 1842 -, gccacggccgcag dbSNP:63749065
1842 1842 a, g dbSNP:61753975
1847 1847 a, g dbSNP:3027927
1850 1850 -, cgcaga dbSNP:786205022
1851 1851 a, g dbSNP:267608626
1852 1852 c, t dbSNP:61753978
1869 1869 c, t dbSNP:61753979
1870 1870 a, g dbSNP:61753980
1875 1875 g, t dbSNP:104894864
1876 1876 -, c dbSNP:267608627
1884 1884 c, t dbSNP:267608628
1885 1885 a, g dbSNP:185957513
1908 1908 -, at dbSNP:267608630
1915 1915 -, ggccaa dbSNP:267608632
1916 1916 a, g dbSNP:267608633
1920 1920 aaca, tg dbSNP:786205023
1922 1922 -, ca dbSNP:786204316
1927 1927 -, ag dbSNP:267608634
1932 1932 c, t dbSNP:587783108
1942 1942 c, g dbSNP:267608328
1945 1945 a, g dbSNP:145790362
1948 1948 c, t dbSNP:267608635
1949 1949 a, g dbSNP:587781033
1950 1950 c, t dbSNP:267608636
1953 1953 a, g dbSNP:193922678
1958 1958 c, t dbSNP:76895094
1959 1959 g, t dbSNP:587777421
1960 1960 -, agagagttagctgactttacacggagcggattgcaaagcaaac dbSNP:267608393
1961 1961 c, g dbSNP:267608336
1962 1962 -, agagttagctgactttacacggag dbSNP:267608637
1962 1962 -, agag dbSNP:267608638
1963 1963 c, g dbSNP:267608370
1965 1965 -, ag dbSNP:267608639
1966 1966 -, ttag dbSNP:267608640
1968 1968 -, ta dbSNP:267608641
1971 1971 c, t dbSNP:267608337
1972 1972 g, t dbSNP:267608399
1973 1973 a, c, g dbSNP:267608642
1981 1981 c, t dbSNP:267608330
1982 1982 a, g dbSNP:144008995
1987 1987 a, g dbSNP:199963992
2009 2009 c, g dbSNP:267608347
2028 2028 c, g dbSNP:267608344
2065 2065 c, g, t dbSNP:62621672
2066 2066 a, g dbSNP:267608326
2071 2071 -, a dbSNP:267608341
2095 2095 -, t dbSNP:267608342
2129 2129 g, t dbSNP:73627291
2150 2150 c, g dbSNP:267608345
2177 2177 a, g dbSNP:267608352
2301 2301 a, g dbSNP:62621673
2332 2332 c, g dbSNP:62621674
2336 2336 c, g dbSNP:62621675
2340 2340 a, g dbSNP:62620967
2344 2344 c, g dbSNP:187851059
2366 2366 a, g dbSNP:267608361
2460 2460 c, g dbSNP:267608325
2462 2462 c, g dbSNP:111565519
2502 2502 g, t dbSNP:267608362
2517 2517 a, g dbSNP:183349022
2527 2527 a, g dbSNP:267608353
2740 2740 g, t dbSNP:267608354
2769 2769 -, acaaggtgcaggcaggctggcctgggg dbSNP:267608375
2779 2779 a, g dbSNP:267608363
2804 2804 c, g dbSNP:190920575
2834 2834 g, t dbSNP:187614438
2848 2848 -, a dbSNP:267608364
2851 2851 c, g dbSNP:3027924
3107 3107 a, g dbSNP:267608390
3210 3210 c, t dbSNP:267608365
3249 3249 a, g dbSNP:2853337
3341 3341 a, c dbSNP:267608355
3373 3373 c, g dbSNP:3027923
3483 3483 c, t dbSNP:112674002

Target ORF information:

RefSeq Version XM_005274683
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54402
Accession Version XM_005274682.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1182bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methyl-CpG-binding protein 2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838854. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)574..798(+)
Misc Feature(2)613..705(+)
Position Chain Variation Link
23 23 a, g, t dbSNP:587783132
27 27 c, t dbSNP:179363901
40 40 -, cgccgc dbSNP:587783129
45 45 -, cgc, cgccgc, cgccgccgc dbSNP:398123566
49 49 -, cgccg dbSNP:786205038
52 52 c, ga dbSNP:786205040
69 69 -, gcgaggaggag dbSNP:786205042
69 69 -, agg, aggagg dbSNP:587783744
70 70 -, cgaggagg dbSNP:786205043
70 70 c, t dbSNP:786205045
71 71 a, g dbSNP:786205046
77 77 -, cgaggagg dbSNP:786205044
79 79 c, g dbSNP:587783133
81 81 -, ga dbSNP:786205047
168 168 c, t dbSNP:267608324
173 173 a, g dbSNP:202057538
183 183 -, atggtagctgggatgttagggctcag dbSNP:267608407
183 183 -, a dbSNP:267608408
183 183 a, t dbSNP:786205892
322 322 c, g, t dbSNP:61754421
330 330 a, c, g, t dbSNP:61754422
336 336 -, agtcagaa dbSNP:63749008
340 340 c, t dbSNP:61754424
344 344 -, a dbSNP:267608416
349 349 c, t dbSNP:61754425
350 350 -, a dbSNP:267608417
358 358 a, t dbSNP:62641234
370 370 -, c dbSNP:61754426
384 384 a, g dbSNP:398124187
385 385 -, g dbSNP:61754427
394 394 -, gata dbSNP:61754428
401 401 -, aagaaga dbSNP:267608424
401 401 -, aa dbSNP:267608425
402 402 -, agaa dbSNP:267608426
411 411 -, a dbSNP:267608427
413 413 -, ag dbSNP:267608428
420 420 -, g dbSNP:61754430
430 430 a, c, g dbSNP:587783134
434 434 -, a dbSNP:61754431
440 440 a, c, g dbSNP:61754432
447 447 c, g, t dbSNP:267608432
449 449 a, g dbSNP:61754433
461 461 -, cc dbSNP:267608434
462 462 c, t dbSNP:61754435
483 483 -, ga dbSNP:61754436
488 488 c, g dbSNP:61754437
495 495 -, g dbSNP:61754438
497 497 c, g dbSNP:267608438
504 504 c, t dbSNP:61754439
509 509 -, c, t dbSNP:61754441
509 509 c, t dbSNP:61754440
518 518 c, t dbSNP:267608440
519 519 a, g dbSNP:61754442
523 523 -, gcttctgcct dbSNP:63749009
527 527 -, c dbSNP:267608442
537 537 -, c dbSNP:267608443
539 539 a, g dbSNP:61754444
543 543 -, nnnnnnn dbSNP:786205024
551 551 c, g dbSNP:61754445
552 552 -, ca dbSNP:267608444
567 567 a, g dbSNP:200629699
568 568 g, t dbSNP:267608445
569 569 -, g dbSNP:267608446
569 569 -, g dbSNP:587783090
570 570 -, g dbSNP:267608405
571 571 c, t dbSNP:61754447
573 573 c, t dbSNP:267608447
583 583 g, t dbSNP:61754448
585 585 a, c dbSNP:61754449
589 589 -, acc dbSNP:267608449
591 591 c, g dbSNP:61754450
592 592 c, g dbSNP:28935168
593 593 g, t dbSNP:61754451
595 595 c, t dbSNP:61754452
596 596 a, c, g, t dbSNP:61754453
602 602 a, g dbSNP:267608450
604 604 c, t dbSNP:267608451
605 605 -, ggacacggaagct dbSNP:63749010
605 605 a, g dbSNP:61754455
609 609 -, a dbSNP:61754456
610 610 c, g, t dbSNP:28934907
611 611 a, g, t dbSNP:61754457
615 615 -, gaag dbSNP:786205025
617 617 a, c, t dbSNP:61754458
620 620 -, a dbSNP:267608452
625 625 a, g dbSNP:61754459
628 628 a, t dbSNP:267608398
635 635 c, g dbSNP:61755760
637 637 c, t dbSNP:267608388
639 639 -, c dbSNP:61755761
652 652 g, t dbSNP:267608454
656 656 a, g dbSNP:61755762
658 658 a, g dbSNP:267608455
659 659 c, t dbSNP:267608456
666 666 c, g, t dbSNP:61755763
669 669 a, c dbSNP:146107517
669 669 -, c dbSNP:267608457
671 671 a, g dbSNP:786205037
674 674 c, t dbSNP:267608387
676 676 c, g, t dbSNP:267608469
677 677 a, c dbSNP:61748383
680 680 g, t dbSNP:61748384
684 684 -, a dbSNP:786205895
686 686 a, c dbSNP:267608470
687 687 c, g, t dbSNP:61748385
691 691 c, g, t dbSNP:28934904
692 692 a, g, t dbSNP:61748389
694 694 c, t dbSNP:267608471
695 695 c, g, t dbSNP:61748390
697 697 a, g dbSNP:61748391
704 704 a, g dbSNP:61748392
705 705 -, g dbSNP:61748393
707 707 a, c, t dbSNP:267608475
713 713 a, c, t dbSNP:28934908
714 714 -, g dbSNP:267608476
716 716 -, a dbSNP:61748394
716 716 a, g dbSNP:61748395
717 717 a, c, g dbSNP:61748396
720 720 c, t dbSNP:61748397
722 722 -, t dbSNP:61748398
724 724 a, t dbSNP:61748399
725 725 -, a dbSNP:61748400
725 725 a, g dbSNP:786205016
732 732 c, t dbSNP:61748386
733 733 a, g dbSNP:61748401
733 733 -, g dbSNP:62952161
745 745 -, g dbSNP:61748402
746 746 a, g dbSNP:61748403
748 748 c, g dbSNP:179363900
749 749 c, g dbSNP:61748404
757 757 a, t dbSNP:61748406
758 758 c, g, t dbSNP:28934905
761 761 a, c, g dbSNP:61748407
762 762 c, g, t dbSNP:61748408
763 763 a, t dbSNP:61748410
764 764 -, t dbSNP:267608482
764 764 -, tc dbSNP:267608483
765 765 c, g dbSNP:267608484
766 766 a, g dbSNP:61748411
767 767 c, t dbSNP:28934906
768 768 a, g dbSNP:61748413
769 769 -, g dbSNP:267608485
773 773 c, g dbSNP:61748414
774 774 -, tg dbSNP:267608486
774 774 -, t dbSNP:61748415
775 775 g, t dbSNP:61748416
776 776 a, g, t dbSNP:61748417
777 777 -, g dbSNP:61748418
778 778 -, a dbSNP:267608487
778 778 a, g dbSNP:727505391
782 782 -, gg dbSNP:267608488
789 789 -, c dbSNP:267608489
793 793 c, t dbSNP:61748420
796 796 a, c, t dbSNP:61748421
800 800 a, g dbSNP:587783745
802 802 c, t dbSNP:61748425
808 808 c, t dbSNP:61748426
809 809 c, t dbSNP:267608491
811 811 c, g dbSNP:61748427
812 812 c, g dbSNP:267608492
817 817 a, t dbSNP:61748428
821 821 a, c, g dbSNP:61749701
822 822 c, g dbSNP:61754420
823 823 a, g, t dbSNP:61749702
825 825 -, a dbSNP:61749703
832 832 a, t dbSNP:267608495
836 836 c, t dbSNP:61749705
837 837 -, tc dbSNP:267608496
841 841 c, g dbSNP:61749706
847 847 a, g dbSNP:587783135
848 848 -, g dbSNP:61749707
850 850 a, t dbSNP:587783136
860 860 -, g dbSNP:267608499
860 860 -, g dbSNP:61749708
861 861 -, a dbSNP:61749709
862 862 c, t dbSNP:587783137
867 867 -, c dbSNP:786204307
867 867 c, g, t dbSNP:61749710
868 868 a, t dbSNP:193922679
876 876 c, t dbSNP:61749711
877 877 a, g dbSNP:786204308
879 879 c, t dbSNP:61749712
881 881 a, c, g dbSNP:61749713
884 884 c, t dbSNP:61749714
885 885 a, c, g dbSNP:61749716
886 886 a, c, t dbSNP:61749717
890 890 a, c, g dbSNP:267608502
892 892 a, t dbSNP:61749718
895 895 -, g dbSNP:267608503
896 896 c, t dbSNP:61748381
897 897 a, g dbSNP:267608504
899 899 c, t dbSNP:587783138
902 902 -, a dbSNP:267608506
902 902 c, t dbSNP:61749720
903 903 a, g dbSNP:61749722
905 905 ag, ca dbSNP:267608507
905 905 c, g dbSNP:61749724
907 907 c, g, t dbSNP:61749726
911 911 a, c, g dbSNP:63485860
911 911 -, g dbSNP:61749727
914 914 -, t dbSNP:61749728
916 916 c, t dbSNP:61749729
921 921 a, g dbSNP:786205017
923 923 a, t dbSNP:61749730
925 925 -, agggtcctggagaaaagtcctgggaag dbSNP:267608508
927 927 c, g dbSNP:61749731
929 929 -, tcctggagaaaagtcctggga dbSNP:267608509
935 935 -, agaaaagtcctgg dbSNP:267608386
943 943 c, t dbSNP:786205894
945 945 -, tg dbSNP:267608510
948 948 -, gaag dbSNP:61749734
954 954 c, g, t dbSNP:267608512
960 960 c, g, t dbSNP:61749735
967 967 a, c, g dbSNP:267608513
968 968 c, g, t dbSNP:61749715
970 970 -, a dbSNP:267608514
971 971 -, a dbSNP:61749736
973 973 c, g dbSNP:61749737
977 977 c, g dbSNP:61749738
980 980 a, c, t dbSNP:61749739
984 984 a, c dbSNP:61749740
985 985 a, g dbSNP:587783139
989 989 -, g dbSNP:267608516
989 989 c, g dbSNP:61748422
989 989 -, g dbSNP:63260260
990 990 -, c dbSNP:61749741
995 995 c, g dbSNP:138211345
996 996 -, tgaggggggtggggc dbSNP:786204309
1004 1004 -, g dbSNP:267608517
1004 1004 -, g dbSNP:61749743
1004 1004 g, t dbSNP:62846063
1009 1009 -, g dbSNP:61749744
1014 1014 -, c dbSNP:267608518
1014 1014 c, g, t dbSNP:61749746
1024 1024 c, t dbSNP:61749747
1028 1028 -, tcatggtgatcaaacgccccggcagg dbSNP:267608519
1030 1030 atggtgat, gtg dbSNP:267608520
1030 1030 -, at dbSNP:61749749
1033 1033 -, g dbSNP:61749750
1042 1042 cgcccc, ggccg dbSNP:61750225
1042 1042 -, c, t dbSNP:61749752
1043 1043 a, g dbSNP:61750227
1044 1044 a, c, t dbSNP:61748424
1044 1044 c, tcaggaagctt dbSNP:267608521
1045 1045 -, acgcc, c dbSNP:61749751
1046 1046 c, t dbSNP:61750229
1047 1047 -, c, cc dbSNP:267608522
1047 1047 -, c dbSNP:61750231
1047 1047 c, t dbSNP:63582063
1048 1048 -, ggcaggaagcgaaaagctgaggccgaccc dbSNP:786204310
1049 1049 -, g dbSNP:61750232
1049 1049 -, g dbSNP:61750233
1050 1050 -, cagg dbSNP:267608523
1054 1054 a, t dbSNP:63259763
1057 1057 -, caggaagc dbSNP:61750235
1057 1057 c, t dbSNP:61749721
1058 1058 -, nnnnnnnn dbSNP:786205026
1060 1060 a, t dbSNP:786205027
1071 1071 c, t dbSNP:1042870
1073 1073 -, aaagctgaggccga dbSNP:267608524
1078 1078 c, t dbSNP:267608525
1079 1079 -, aggccattcccaagaaacggggccgaaagccggg dbSNP:786205028
1086 1086 -, tc dbSNP:267608526
1089 1089 c, g dbSNP:267608527
1093 1093 a, t dbSNP:61750238
1096 1096 c, t dbSNP:61750239
1100 1100 -, g dbSNP:61750241
1102 1102 -, c dbSNP:62931162
1102 1102 c, g, t dbSNP:61750240
1104 1104 -, aaag dbSNP:267608529
1106 1106 -, agccggg dbSNP:61750242
1109 1109 c, t dbSNP:61750243
1110 1110 -, ggggagtgtggtggcag dbSNP:63749012
1110 1110 a, g dbSNP:587783746
1113 1113 -, ccgaaagccgggg dbSNP:587783091
1113 1113 a, g, t dbSNP:61750245
1113 1113 -, g dbSNP:267608530
1124 1124 -, nnnnnnnnnnnnnnnnnnnnnnn dbSNP:786205029
1124 1124 -, c dbSNP:61750247
1126 1126 a, g dbSNP:786205018
1128 1128 c, t dbSNP:61750248
1129 1129 -, gggagtgtggtggcagccg dbSNP:786204311
1130 1130 c, t dbSNP:61750249
1134 1134 c, t dbSNP:61750251
1137 1137 c, g, t dbSNP:61750252
1143 1143 c, g dbSNP:61750253
1144 1144 a, g dbSNP:61750255
1148 1148 -, a dbSNP:267608531
1149 1149 aaaaaaaagact, gaaag dbSNP:786205030
1150 1150 -, aaag dbSNP:61750256
1151 1151 a, g dbSNP:267608533
1153 1153 c, g dbSNP:61750257
1158 1158 -, g dbSNP:267608535
1159 1159 -, aa dbSNP:267608536
1159 1159 a, t dbSNP:61750259
1163 1163 agtcttctatcc, caca dbSNP:786205031
1163 1163 -, a dbSNP:267608538
1164 1164 a, g dbSNP:587781032
1165 1165 g, t dbSNP:61751360
1168 1168 -, a dbSNP:61751361
1173 1173 c, g dbSNP:587783140
1174 1174 -, cgatc dbSNP:61751364
1174 1174 c, g, t dbSNP:61751362
1175 1175 -, gatctgtgcaggagaccgtact dbSNP:267608540
1175 1175 a, c, g dbSNP:61751366
1177 1177 -, t dbSNP:267608541
1183 1183 c, t dbSNP:61751367
1191 1191 c, g, t dbSNP:61748423
1192 1192 -, gtactcc dbSNP:267608543
1192 1192 -, gtac dbSNP:62701461
1192 1192 a, g dbSNP:61751370
1192 1192 -, g dbSNP:267608544
1194 1194 -, actccccat dbSNP:267608545
1197 1197 c, g, t dbSNP:61751372
1198 1198 a, c, g, t dbSNP:61751373
1199 1199 a, c, g, t dbSNP:61749723
1200 1200 -, c dbSNP:267608548
1200 1200 c, g dbSNP:61751438
1202 1202 g, t dbSNP:267608549
1203 1203 c, g dbSNP:61751439
1204 1204 a, g dbSNP:61751440
1205 1205 a, c, g dbSNP:267608550
1207 1207 a, g dbSNP:267608551
1208 1208 a, g dbSNP:61751441
1210 1210 a, c, g, t dbSNP:28935468
1211 1211 a, g, t dbSNP:61751443
1219 1219 c, t dbSNP:61751444
1226 1226 c, t dbSNP:61751445
1230 1230 c, t dbSNP:398124188
1236 1236 c, t dbSNP:61751446
1242 1242 c, g, t dbSNP:61751447
1247 1247 a, c dbSNP:61751448
1258 1258 c, g, t dbSNP:61751449
1259 1259 -, ccctgc dbSNP:61751452
1259 1259 c, t dbSNP:61751450
1276 1276 c, g dbSNP:267608556
1278 1278 a, c, t dbSNP:61751442
1279 1279 a, g dbSNP:201871183
1281 1281 nnnnnnnnnnnnn, tgagaag dbSNP:786204312
1283 1283 agaagagc, nnnnnnnnnnnnnnnnnn dbSNP:672601302
1286 1286 -, aga dbSNP:61751456
1286 1286 a, g dbSNP:267608557
1288 1288 -, agcgg dbSNP:267608558
1290 1290 c, t dbSNP:148744894
1293 1293 g, t dbSNP:61751451
1298 1298 -, gactgaagacctgtaagagccctgggcggaaaag dbSNP:267608376
1300 1300 c, g dbSNP:587783104
1303 1303 -, aagacctgtaagagccctg dbSNP:267608559
1307 1307 c, g dbSNP:786204313
1308 1308 c, t dbSNP:267608400
1309 1309 c, t dbSNP:267608560
1323 1323 -, g dbSNP:267608331
1323 1323 -, g dbSNP:61751457
1324 1324 c, g, t dbSNP:61752361
1329 1329 a, g dbSNP:61752362
1332 1332 c, g dbSNP:61752365
1337 1337 -, agagcagccccaag dbSNP:267608380
1342 1342 -, agccccaaggggcgcagcagcagcgcctcctcaccccccaagaaggag dbSNP:267608562
1345 1345 -, cccaaggggcgcagc dbSNP:267608384
1345 1345 -, ccca dbSNP:267608377
1347 1347 c, g dbSNP:786205013
1353 1353 -, gcgcagcagcagcg dbSNP:267608378
1354 1354 c, t dbSNP:143876280
1355 1355 -, gcagcagcagcgcc dbSNP:267608381
1355 1355 a, g, t dbSNP:61748387
1359 1359 a, c, t dbSNP:267608563
1363 1363 -, agc dbSNP:267608564
1365 1365 c, t dbSNP:61750236
1366 1366 a, g dbSNP:147017239
1369 1369 c, t dbSNP:61752371
1373 1373 a, c dbSNP:61752372
1375 1375 a, c, g dbSNP:61752373
1379 1379 a, c, t dbSNP:587783105
1380 1380 -, c dbSNP:587783092
1381 1381 a, t dbSNP:61752375
1382 1382 -, agaaggagcaccaccaccatcaccacca dbSNP:267608385
1387 1387 -, gag dbSNP:786205032
1393 1393 -, caccaccatcaccaccactc dbSNP:267608567
1395 1395 -, ccacca dbSNP:587783093
1398 1398 -, cca dbSNP:61752381
1398 1398 c, g, t dbSNP:61752382
1399 1399 -, catcaccaccac dbSNP:267608371
1399 1399 -, c dbSNP:267608568
1412 1412 a, c, g dbSNP:267608569
1419 1419 -, cccaaaggccccc dbSNP:267608340
1420 1420 c, t dbSNP:61752387
1421 1421 -, caaaggccccc dbSNP:267608570
1421 1421 c, g dbSNP:61752976
1423 1423 aaggc, gagt dbSNP:267608379
1423 1423 a, c, g, t dbSNP:368461080
1426 1426 -, gcccccgtgccactgctcccacccctgc dbSNP:267608348
1426 1426 g, t dbSNP:587783106
1427 1427 a, c, g, t dbSNP:201314910
1429 1429 -, cccgtgcc dbSNP:267608571
1430 1430 -, ccgtgcc dbSNP:267608389
1431 1431 c, t dbSNP:61752980
1432 1432 -, gtgccactgctcccacccctgccccc dbSNP:267608382
1432 1432 a, g dbSNP:267608572
1434 1434 a, g dbSNP:201711454
1435 1435 c, g, t dbSNP:61752981
1439 1439 -, tgctcccacccctgcccccacctccacctgagcccgagagctccgagg ac dbSNP:267608573
1439 1439 -, tgctcccacccctgcccccacctccac dbSNP:587783094
1441 1441 -, ctcccacccctgcccccacctccacctgag dbSNP:267608350
1444 1444 -, ccacccctgcccccacctccacctgagcccgagagctccgagg dbSNP:63749023
1445 1445 -, cacccctgcccccacctccacctgagcccgagagctccgag dbSNP:63749024
1445 1445 -, cacccctgcccccacctccacctgagcccgagagctcc dbSNP:267608574
1445 1445 -, cacccctgcccccacctccacctgagcccgaga dbSNP:267608575
1445 1445 c, t dbSNP:193922676
1446 1446 -, acccctgcccccacctccacctgagcccgagagctccgaggacc dbSNP:267608372
1446 1446 -, accc dbSNP:267608576
1447 1447 -, cccctgcccccacctccacctgagcccgagagctccga dbSNP:267608577
1447 1447 -, cccctgcccccacctccacctgagcccgagagctcc dbSNP:786205033
1448 1448 -, ccctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608579
1448 1448 -, ccctgcccccacctccacctgagcccgagagc dbSNP:267608578
1448 1448 a, c, t dbSNP:111302745
1449 1449 -, cctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608329
1449 1449 -, cctgcccccacctccacctgagcccgaga dbSNP:267608580
1449 1449 -, cctgcccccacctccacc dbSNP:267608392
1449 1449 -, cctgcccccacc dbSNP:786205034
1450 1450 -, ctgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608581
1450 1450 -, ctgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608583
1450 1450 -, ctgcccccacctccacc dbSNP:267608582
1451 1451 -, tgcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63749748
1451 1451 -, tgcccccacctccacctgagcccgagagctccgaggaccccac dbSNP:267608587
1451 1451 -, tgcccccacctccacctgagcccgagagctccgaggacccc dbSNP:267608327
1451 1451 -, tgcccccacctccacctgagcccgagagctccgagg dbSNP:63749028
1451 1451 -, tgcccccacctccacctgagcccgagagctccgag dbSNP:267608586
1451 1451 -, tgcccccacctccacctgagcccgagagctcc dbSNP:267608585
1451 1451 -, tgcccccacctccacctgagcccgagagctc dbSNP:61754419
1451 1451 -, ct dbSNP:267608584
1452 1452 -, gcccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:61752992
1452 1452 -, gcccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:63009262
1452 1452 -, gcccccacctccacctgagcccgagagctccgaggacccca dbSNP:267608588
1452 1452 cca, gcccccacctccacctgagcccgagagct dbSNP:386134271
1452 1452 -, gcccccacctccacctgagcccgagagct dbSNP:63749029
1452 1452 -, gcccccacct dbSNP:63583161
1453 1453 -, cccccacctccacctgagcccgagagctccgaggaccccacca dbSNP:63749030
1453 1453 -, cccccacctccacctgagcccgagagctccgagga dbSNP:267608589
1453 1453 -, cccccacctccacctg dbSNP:267608373
1453 1453 cc, t dbSNP:267608590
1454 1454 aggggtgg, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:786205035
1454 1454 -, ccccacctccacctgagcccgagagctccgaggaccccacc dbSNP:267608592
1454 1454 -, ccccacctccacctgagcccgagagctcc dbSNP:267608593
1454 1454 -, ccccacctccacctgagcccgagagc dbSNP:267608591
1454 1454 -, ccccacctccacctgagcccg dbSNP:267608594
1454 1454 -, ccccacc dbSNP:267608595
1454 1454 c, t dbSNP:63390262
1455 1455 a, cccacctccacctgagcccgagagctccgaggaccccaccagccc dbSNP:267608596
1455 1455 -, cccacctccacctgagcccgagagctcc dbSNP:786204314
1455 1455 -, cccacctcc dbSNP:267608401
1455 1455 -, cccacc dbSNP:267608332
1455 1455 -, ccc dbSNP:267608339
1455 1455 c, t dbSNP:61750246
1456 1456 -, ccacctccacctgagcccgagagctccgag dbSNP:63749034
1456 1456 -, ccacctccacctgagccc dbSNP:267608406
1456 1456 -, cc dbSNP:267608598
1456 1456 cc, ta dbSNP:267608597
1456 1456 c, g, t dbSNP:61753000
1457 1457 -, cacctccacctgagcccgagagctccgaggaccccacca dbSNP:267608602
1457 1457 -, cacctccacctgagcccgagagctccgaggacccc dbSNP:267608599
1457 1457 -, cacctccacctgagcccgagagctcc dbSNP:267608600
1457 1457 -, cacctccacctgagccc dbSNP:267608601
1457 1457 -, cacctccacct dbSNP:267608334
1457 1457 c, t dbSNP:61753006
1458 1458 -, acctccacctgagcccgagagctccgaggaccccaccagcccccc dbSNP:267608605
1458 1458 -, acctccacctgagcccgagagctccgaggaccccaccagccccc dbSNP:63749749
1458 1458 -, acctccacctgagcccgagagctccgaggaccccaccagcccc dbSNP:267608603
1458 1458 -, acctccacctgagcccgagagctccgaggac dbSNP:786205020
1458 1458 acctccacctgagcccgagag, ctgagccccaggacttgagca dbSNP:786205019
1458 1458 -, acctccacc dbSNP:267608604
1458 1458 -, a dbSNP:267608606
1459 1459 -, cctccacctgagcccgagagctccga dbSNP:267608607
1461 1461 -, tccacctgagcccgagagctccgaggaccccacc dbSNP:267608343
1461 1461 -, tccacctgag dbSNP:267608349
1462 1462 -, ccacct dbSNP:61753008
1463 1463 -, ca dbSNP:267608608
1464 1464 -, acctgagcccgagagctccgaggaccccaccagccccc dbSNP:267608609
1467 1467 -, tgagcccgagagctcc dbSNP:267608369
1470 1470 -, gcccgagagctccgagga dbSNP:267608335
1470 1470 a, g dbSNP:61753009
1472 1472 -, ccgagagc dbSNP:267608383
1472 1472 c, t dbSNP:267608402
1474 1474 -, gagagctccgaggaccccaccagccc dbSNP:267608333
1474 1474 -, t dbSNP:786205021
1474 1474 a, g, t dbSNP:63094662
1475 1475 -, agagctccgag dbSNP:267608403
1479 1479 -, ctccgag dbSNP:63749018
1483 1483 -, gaggaccc dbSNP:267608338
1483 1483 a, g, t dbSNP:56268439
1484 1484 -, a dbSNP:267608610
1488 1488 -, t dbSNP:61753011
1490 1490 c, t dbSNP:62915962
1491 1491 -, c dbSNP:267608612
1491 1491 c, t dbSNP:61753012
1494 1494 -, c dbSNP:267608613
1496 1496 -, g dbSNP:267608614
1496 1496 a, c, g dbSNP:62707562
1499 1499 a, c, t dbSNP:61753014
1500 1500 c, t dbSNP:63586860
1502 1502 a, c, t dbSNP:587783107
1508 1508 -, cccaggacttgagcagc dbSNP:267608615
1508 1508 c, t dbSNP:61753016
1509 1509 c, t dbSNP:61753964
1510 1510 c, t dbSNP:61753965
1517 1517 -, tgagcagcagcgtctgcaaagaggagaagatgcccagaggagg dbSNP:63749038
1518 1518 c, g dbSNP:786204315
1523 1523 a, g dbSNP:267608616
1526 1526 -, gcgtctgca dbSNP:63749027
1526 1526 -, gcgtc dbSNP:267608351
1527 1527 -, cgtctgcaaag dbSNP:786205036
1527 1527 c, t dbSNP:3027928
1528 1528 a, g dbSNP:61753966
1529 1529 -, tctgcaaagaggagaagatgcccaga dbSNP:267608617
1532 1532 -, gcaaagaggagaagatgcccagaggaggc dbSNP:267608374
1533 1533 c, t dbSNP:61753967
1544 1544 a, t dbSNP:61753968
1549 1549 c, t dbSNP:140258520
1559 1559 agcggccg, gctcactggagagcgacggctgccc dbSNP:63749064
1560 1560 c, g, t dbSNP:61753970
1572 1572 c, t dbSNP:267608619
1576 1576 a, g dbSNP:61753971
1578 1578 c, t dbSNP:267608621
1582 1582 c, t dbSNP:267608622
1584 1584 -, c dbSNP:587783095
1602 1602 -, tc dbSNP:61753972
1609 1609 a, g, t dbSNP:61753973
1614 1614 -, t dbSNP:267608624
1616 1616 -, ccaccgccg dbSNP:267608404
1618 1618 -, accgccgccacggccgcagaaaagtacaaacaccgagggga dbSNP:267608625
1618 1618 a, g dbSNP:61753974
1620 1620 c, t dbSNP:61751363
1621 1621 a, g dbSNP:193922677
1624 1624 -, gccacggccgcag dbSNP:63749065
1624 1624 a, g dbSNP:61753975
1629 1629 a, g dbSNP:3027927
1632 1632 -, cgcaga dbSNP:786205022
1633 1633 a, g dbSNP:267608626
1634 1634 c, t dbSNP:61753978
1651 1651 c, t dbSNP:61753979
1652 1652 a, g dbSNP:61753980
1657 1657 g, t dbSNP:104894864
1658 1658 -, c dbSNP:267608627
1666 1666 c, t dbSNP:267608628
1667 1667 a, g dbSNP:185957513
1690 1690 -, at dbSNP:267608630
1697 1697 -, ggccaa dbSNP:267608632
1698 1698 a, g dbSNP:267608633
1702 1702 aaca, tg dbSNP:786205023
1704 1704 -, ca dbSNP:786204316
1709 1709 -, ag dbSNP:267608634
1714 1714 c, t dbSNP:587783108
1724 1724 c, g dbSNP:267608328
1727 1727 a, g dbSNP:145790362
1730 1730 c, t dbSNP:267608635
1731 1731 a, g dbSNP:587781033
1732 1732 c, t dbSNP:267608636
1735 1735 a, g dbSNP:193922678
1740 1740 c, t dbSNP:76895094
1741 1741 g, t dbSNP:587777421
1742 1742 -, agagagttagctgactttacacggagcggattgcaaagcaaac dbSNP:267608393
1743 1743 c, g dbSNP:267608336
1744 1744 -, agagttagctgactttacacggag dbSNP:267608637
1744 1744 -, agag dbSNP:267608638
1745 1745 c, g dbSNP:267608370
1747 1747 -, ag dbSNP:267608639
1748 1748 -, ttag dbSNP:267608640
1750 1750 -, ta dbSNP:267608641
1753 1753 c, t dbSNP:267608337
1754 1754 g, t dbSNP:267608399
1755 1755 a, c, g dbSNP:267608642
1763 1763 c, t dbSNP:267608330
1764 1764 a, g dbSNP:144008995
1769 1769 a, g dbSNP:199963992
1791 1791 c, g dbSNP:267608347
1810 1810 c, g dbSNP:267608344
1847 1847 c, g, t dbSNP:62621672
1848 1848 a, g dbSNP:267608326
1853 1853 -, a dbSNP:267608341
1877 1877 -, t dbSNP:267608342
1911 1911 g, t dbSNP:73627291
1932 1932 c, g dbSNP:267608345
1959 1959 a, g dbSNP:267608352
2083 2083 a, g dbSNP:62621673
2114 2114 c, g dbSNP:62621674
2118 2118 c, g dbSNP:62621675
2122 2122 a, g dbSNP:62620967
2126 2126 c, g dbSNP:187851059
2148 2148 a, g dbSNP:267608361
2242 2242 c, g dbSNP:267608325
2244 2244 c, g dbSNP:111565519
2284 2284 g, t dbSNP:267608362
2299 2299 a, g dbSNP:183349022
2309 2309 a, g dbSNP:267608353
2522 2522 g, t dbSNP:267608354
2551 2551 -, acaaggtgcaggcaggctggcctgggg dbSNP:267608375
2561 2561 a, g dbSNP:267608363
2586 2586 c, g dbSNP:190920575
2616 2616 g, t dbSNP:187614438
2630 2630 -, a dbSNP:267608364
2633 2633 c, g dbSNP:3027924
2889 2889 a, g dbSNP:267608390
2992 2992 c, t dbSNP:267608365
3031 3031 a, g dbSNP:2853337
3123 3123 a, c dbSNP:267608355
3155 3155 c, g dbSNP:3027923
3265 3265 c, t dbSNP:112674002

Target ORF information:

RefSeq Version XM_005274682
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methyl CpG binding protein 2 (MECP2), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54402
Accession Version XM_011531165.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1182bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methyl-CpG-binding protein 2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)630..854(+)
Misc Feature(2)669..761(+)
Position Chain Variation Link
23 23 a, g, t dbSNP:587783132
27 27 c, t dbSNP:179363901
40 40 -, cgccgc dbSNP:587783129
45 45 -, cgc, cgccgc, cgccgccgc dbSNP:398123566
49 49 -, cgccg dbSNP:786205038
52 52 c, ga dbSNP:786205040
69 69 -, gcgaggaggag dbSNP:786205042
69 69 -, agg, aggagg dbSNP:587783744
70 70 -, cgaggagg dbSNP:786205043
70 70 c, t dbSNP:786205045
71 71 a, g dbSNP:786205046
77 77 -, cgaggagg dbSNP:786205044
79 79 c, g dbSNP:587783133
81 81 -, ga dbSNP:786205047
168 168 c, t dbSNP:267608324
173 173 a, g dbSNP:202057538
183 183 -, atggtagctgggatgttagggctcag dbSNP:267608407
183 183 -, a dbSNP:267608408
183 183 a, t dbSNP:786205892
378 378 c, g, t dbSNP:61754421
386 386 a, c, g, t dbSNP:61754422
392 392 -, agtcagaa dbSNP:63749008
396 396 c, t dbSNP:61754424
400 400 -, a dbSNP:267608416
405 405 c, t dbSNP:61754425
406 406 -, a dbSNP:267608417
414 414 a, t dbSNP:62641234
426 426 -, c dbSNP:61754426
440 440 a, g dbSNP:398124187
441 441 -, g dbSNP:61754427
450 450 -, gata dbSNP:61754428
457 457 -, aagaaga dbSNP:267608424
457 457 -, aa dbSNP:267608425
458 458 -, agaa dbSNP:267608426
467 467 -, a dbSNP:267608427
469 469 -, ag dbSNP:267608428
476 476 -, g dbSNP:61754430
486 486 a, c, g dbSNP:587783134
490 490 -, a dbSNP:61754431
496 496 a, c, g dbSNP:61754432
503 503 c, g, t dbSNP:267608432
505 505 a, g dbSNP:61754433
517 517 -, cc dbSNP:267608434
518 518 c, t dbSNP:61754435
539 539 -, ga dbSNP:61754436
544 544 c, g dbSNP:61754437
551 551 -, g dbSNP:61754438
553 553 c, g dbSNP:267608438
560 560 c, t dbSNP:61754439
565 565 -, c, t dbSNP:61754441
565 565 c, t dbSNP:61754440
574 574 c, t dbSNP:267608440
575 575 a, g dbSNP:61754442
579 579 -, gcttctgcct dbSNP:63749009
583 583 -, c dbSNP:267608442
593 593 -, c dbSNP:267608443
595 595 a, g dbSNP:61754444
599 599 -, nnnnnnn dbSNP:786205024
607 607 c, g dbSNP:61754445
608 608 -, ca dbSNP:267608444
623 623 a, g dbSNP:200629699
624 624 g, t dbSNP:267608445
625 625 -, g dbSNP:267608446
625 625 -, g dbSNP:587783090
626 626 -, g dbSNP:267608405
627 627 c, t dbSNP:61754447
629 629 c, t dbSNP:267608447
639 639 g, t dbSNP:61754448
641 641 a, c dbSNP:61754449
645 645 -, acc dbSNP:267608449
647 647 c, g dbSNP:61754450
648 648 c, g dbSNP:28935168
649 649 g, t dbSNP:61754451
651 651 c, t dbSNP:61754452
652 652 a, c, g, t dbSNP:61754453
658 658 a, g dbSNP:267608450
660 660 c, t dbSNP:267608451
661 661 -, ggacacggaagct dbSNP:63749010
661 661 a, g dbSNP:61754455
665 665 -, a dbSNP:61754456
666 666 c, g, t dbSNP:28934907
667 667 a, g, t dbSNP:61754457
671 671 -, gaag dbSNP:786205025
673 673 a, c, t dbSNP:61754458
676 676 -, a dbSNP:267608452
681 681 a, g dbSNP:61754459
684 684 a, t dbSNP:267608398
691 691 c, g dbSNP:61755760
693 693 c, t dbSNP:267608388
695 695 -, c dbSNP:61755761
708 708 g, t dbSNP:267608454
712 712 a, g dbSNP:61755762
714 714 a, g dbSNP:267608455
715 715 c, t dbSNP:267608456
722 722 c, g, t dbSNP:61755763
725 725 a, c dbSNP:146107517
725 725 -, c dbSNP:267608457
727 727 a, g dbSNP:786205037
730 730 c, t dbSNP:267608387
732 732 c, g, t dbSNP:267608469
733 733 a, c dbSNP:61748383
736 736 g, t dbSNP:61748384
740 740 -, a dbSNP:786205895
742 742 a, c dbSNP:267608470
743 743 c, g, t dbSNP:61748385
747 747 c, g, t dbSNP:28934904
748 748 a, g, t dbSNP:61748389
750 750 c, t dbSNP:267608471
751 751 c, g, t dbSNP:61748390
753 753 a, g dbSNP:61748391
760 760 a, g dbSNP:61748392