Email to GenScript

ATXN3 ataxin 3 [Homo sapiens (human)]

Gene Symbol ATXN3
Entrez Gene ID 4287
Full Name ataxin 3
Synonyms AT3, ATX3, JOS, MJD, MJD1, SCA3
General protein information
Preferred Names
ataxin-3
Names
ataxin-3
josephin
ataxin 3 variant h
ataxin 3 variant m
ataxin 3 variant ref
olivopontocerebellar ataxia 3
Machado-Joseph disease protein 1
spinocerebellar ataxia type 3 protein
Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)
NP_001121168.1
NP_001121169.2
NP_001158246.1
NP_001158248.1
NP_001158249.1
NP_001158250.1
NP_001158251.1
NP_001158252.1
NP_001158253.1
NP_001158254.1
NP_004984.2
NP_109376.1
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

14

14q21

Summary Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. lac of sum
Disorder MIM:

607047

Disorder Html: Machado-Joseph disease, 109150 (3)





The following ATXN3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ATXN3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu27153 NM_001127696 Homo sapiens ataxin 3 (ATXN3), transcript variant ad, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $289
OHu21306 NM_001164778 Homo sapiens ataxin 3 (ATXN3), transcript variant o, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu26918 NM_004993 Homo sapiens ataxin 3 (ATXN3), transcript variant reference, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $289
OHu21437 NM_001164777 Homo sapiens ataxin 3 (ATXN3), transcript variant j, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu22357 NM_001164780 Homo sapiens ataxin 3 (ATXN3), transcript variant u, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu21248 NM_001164776 Homo sapiens ataxin 3 (ATXN3), transcript variant g, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu21077 NM_001164782 Homo sapiens ataxin 3 (ATXN3), transcript variant ae, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu20864 NM_001127697 Homo sapiens ataxin 3 (ATXN3), transcript variant e, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $309
OHu26675 NM_030660 Homo sapiens ataxin 3 (ATXN3), transcript variant h, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $309
OHu21583 NM_001164774 Homo sapiens ataxin 3 (ATXN3), transcript variant b, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu21582 NM_001164781 Homo sapiens ataxin 3 (ATXN3), transcript variant y, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $309
OHu21562 NM_001164779 Homo sapiens ataxin 3 (ATXN3), transcript variant r, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $269

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu27153
Accession Version NM_001127696.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1041bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product ataxin-3 isoform ad
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA827537.1, BU190081.1, AB050194.1 and AL049872.3. Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. Transcript Variant: This variant (ad, also known as variant 3) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform ad (also known as isoform 3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGG TTATAAGCAA TGCCTTGAAA GTTTGGGGTT TAGAACTAAT CCTGTTCAAC
AGTCCAGAGT ATCAGAGGCT CAGGATCGAT CCTATAAATG AAAGATCATT TATATGCAAT
TATAAGGAAC ACTGGTTTAC AGTTAGAAAA TTAGGAAAAC AGTGGTTTAA CTTGAATTCT
CTCTTGACGG GTCCAGAATT AATATCAGAT ACATATCTTG CACTTTTCTT GGCTCAATTA
CAACAGGAAG GTTATTCTAT ATTTGTCGTT AAGGGTGATC TGCCAGATTG CGAAGCTGAC
CAACTCCTGC AGATGATTAG GGTCCAACAG ATGCATCGAC CAAAACTTAT TGGAGAAGAA
TTAGCACAAC TAAAAGAGCA AAGAGTCCAT AAAACAGACC TGGAACGAGT GTTAGAAGCA
AATGATGGCT CAGGAATGTT AGACGAAGAT GAGGAGGATT TGCAGAGGGC TCTGGCACTA
AGTCGCCAAG AAATTGACAT GGAAGATGAG GAAGCAGATC TCCGCAGGGC TATTCAGCTA
AGTATGCAAG GTAGTTCCAG AAACATATCT CAAGATATGA CACAGACATC AGGTACAAAT
CTTACTTCAG AAGAGCTTCG GAAGAGACGA GAAGCCTACT TTGAAAAACA GCAGCAAAAG
CAGCAACAGC AGCAGCAGCA GCAGCAGCAG GGGGACCTAT CAGGACAGAG TTCACATCCA
TGTGAAAGGC CAGCCACCAG TTCAGGAGCA CTTGGGAGTG ATCTAGGTGA TGCTATGAGT
GAAGAAGACA TGCTTCAGGC AGCTGTGACC ATGTCTTTAG AAACTGTCAG AAATGATTTG
AAAACAGAAG GAAAAAAATA A
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001121168.1
CDS70..1110
Misc Feature(1)91..528(+)
Misc Feature(2)898..939(+)
Exon (1)1..93
Gene:ATXN3
Gene Synonym:
Exon (2)94..258
Gene:ATXN3
Gene Synonym:
Exon (3)259..344
Gene:ATXN3
Gene Synonym:
Exon (4)345..411
Gene:ATXN3
Gene Synonym:
Exon (5)412..499
Gene:ATXN3
Gene Synonym:
Exon (6)500..632
Gene:ATXN3
Gene Synonym:
Exon (7)633..799
Gene:ATXN3
Gene Synonym:
Exon (8)800..896
Gene:ATXN3
Gene Synonym:
Exon (9)897..1015
Gene:ATXN3
Gene Synonym:
Exon (10)1016..6878
Gene:ATXN3
Gene Synonym:
Translation
Position Chain Variation Link
15 15 -, g dbSNP:55970447
24 24 c, g dbSNP:773675927
27 27 a, g dbSNP:373384259
29 29 c, g dbSNP:747774933
30 30 g, t dbSNP:555614052
36 36 a, c, t dbSNP:56331048
39 39 c, t dbSNP:3814834
40 40 a, g, t dbSNP:374699412
41 41 g, t dbSNP:780973227
42 42 c, g, t dbSNP:751439402
43 43 c, g dbSNP:765348620
44 44 a, g dbSNP:755302582
47 47 c, t dbSNP:753922991
51 51 c, t dbSNP:368734521
52 52 a, g dbSNP:761201018
55 55 a, t dbSNP:773864210
56 56 a, c dbSNP:768123597
58 58 a, g dbSNP:762077144
62 62 a, t dbSNP:376741760
63 63 a, c, g dbSNP:768169130
64 64 a, g dbSNP:748959673
66 66 a, t dbSNP:774939813
87 87 c, t dbSNP:769298166
93 93 a, g dbSNP:745440781
95 95 a, g dbSNP:778221475
96 96 a, g dbSNP:758952886
114 114 c, t dbSNP:753009580
117 117 a, g dbSNP:201027114
126 126 a, g dbSNP:759040212
136 136 c, t dbSNP:753538537
149 149 a, g dbSNP:368260154
159 159 c, t dbSNP:17853195
160 160 a, g dbSNP:766001707
181 181 a, c dbSNP:760232954
182 182 a, g dbSNP:200872467
183 183 g, t dbSNP:772892274
186 186 a, g dbSNP:772116798
188 188 -, t dbSNP:760473560
199 199 a, g dbSNP:761867251
212 212 c, t dbSNP:774250246
225 225 a, g dbSNP:565014021
228 228 c, t dbSNP:746020592
229 229 a, g dbSNP:776899714
233 233 a, g dbSNP:771098090
234 234 g, t dbSNP:747089043
241 241 c, t dbSNP:375315995
244 244 c, t dbSNP:147833264
245 245 a, g dbSNP:531719156
246 246 a, c dbSNP:779188574
248 248 a, c, t dbSNP:144506566
249 249 a, g dbSNP:140562271
257 257 a, g dbSNP:377603133
262 262 a, t dbSNP:762049636
277 277 a, c, g dbSNP:761123692
283 283 -, tg dbSNP:35956988
299 299 c, t dbSNP:768626702
300 300 a, c dbSNP:763461497
311 311 a, g dbSNP:775850621
314 314 c, g dbSNP:545673644
337 337 a, g dbSNP:746205070
343 343 a, g dbSNP:781706817
344 344 c, t dbSNP:371630976
349 349 a, g dbSNP:772732276
350 350 a, g dbSNP:771793716
357 357 a, g dbSNP:747586178
371 371 a, t dbSNP:778421428
381 381 c, g dbSNP:754873504
383 383 g, t dbSNP:749230434
390 390 a, g dbSNP:200356462
391 391 a, g dbSNP:759456959
417 417 c, t dbSNP:781063243
421 421 a, t dbSNP:758482810
429 429 c, t dbSNP:752981470
430 430 c, t dbSNP:144152152
432 432 c, t dbSNP:755104001
437 437 c, t dbSNP:754007849
438 438 a, g dbSNP:780604497
439 439 g, t dbSNP:766771475
461 461 c, t dbSNP:761263261
464 464 a, g dbSNP:577858011
470 470 a, c dbSNP:750717644
472 472 c, t dbSNP:767933266
481 481 a, g dbSNP:761316840
486 486 a, g dbSNP:773982221
506 506 c, g dbSNP:200118135
508 508 a, g dbSNP:777729152
516 516 c, t dbSNP:16999141
532 532 c, t dbSNP:749523391
538 538 c, t dbSNP:779942460
540 540 c, t dbSNP:748191546
541 541 a, g dbSNP:750538982
553 553 c, t dbSNP:781702814
555 555 c, g dbSNP:139050721
563 563 a, t dbSNP:751874751
565 565 a, g dbSNP:374466872
567 567 a, t dbSNP:150738718
570 570 a, g dbSNP:562189056
576 576 -, a dbSNP:778230305
583 583 c, t dbSNP:752379583
584 584 a, g dbSNP:764865705
586 586 c, g dbSNP:759055604
587 587 a, g dbSNP:776051012
594 594 a, g dbSNP:202119840
607 607 a, g dbSNP:141672872
614 614 c, t dbSNP:560161051
621 621 a, g dbSNP:201241311
630 630 a, g dbSNP:748016235
656 656 a, g dbSNP:138404351
658 658 a, g dbSNP:1048755
660 660 a, g dbSNP:773271553
665 665 a, g dbSNP:752168522
666 666 a, g, t dbSNP:142148800
668 668 c, t dbSNP:774064667
669 669 a, g dbSNP:770009219
673 673 c, g dbSNP:746109327
674 674 a, t dbSNP:75188275
681 681 a, c dbSNP:770983214
683 683 a, g dbSNP:747156311
693 693 c, t dbSNP:371037244
694 694 a, g dbSNP:377574592
696 696 a, c dbSNP:148366775
704 704 a, g dbSNP:779172677
705 705 -, gga dbSNP:777522387
706 706 c, g dbSNP:754590483
717 717 -, ggctctggc dbSNP:755842617
726 726 a, g dbSNP:201012097
733 733 a, c, t dbSNP:548763388
734 734 a, g dbSNP:199876727
742 742 a, g dbSNP:199790369
746 746 a, g dbSNP:200483057
747 747 c, t dbSNP:143402326
748 748 a, g dbSNP:767543973
749 749 c, t dbSNP:761679000
753 753 a, g dbSNP:201553525
759 759 c, g dbSNP:751329134
771 771 c, t dbSNP:763802729
772 772 c, t dbSNP:759748483
773 773 a, g dbSNP:776828308
775 775 a, g dbSNP:149131253
777 777 a, g dbSNP:771181207
781 781 a, c dbSNP:760721207
795 795 a, g dbSNP:773301187
810 810 a, c dbSNP:764156853
813 813 c, g dbSNP:762622537
821 821 a, g dbSNP:752537367
824 824 a, t dbSNP:766538029
828 828 a, g dbSNP:760915098
836 836 c, g dbSNP:773204962
841 841 a, g dbSNP:772056412
850 850 c, g dbSNP:762007434
856 856 g, t dbSNP:774718180
868 868 c, t dbSNP:377031212
869 869 a, g dbSNP:145210459
878 878 a, g dbSNP:147058331
885 885 a, c dbSNP:3204346
890 890 c, t dbSNP:780591975
897 897 -, a dbSNP:748879218
906 906 -, aaa dbSNP:141993435
906 906 -, gc dbSNP:780906123
906 906 a, g dbSNP:12896589
907 907 -, gc dbSNP:754789530
907 907 a, c dbSNP:12896588
915 915 -, acagcagcagcagcagca dbSNP:750329097
915 915 -, acagcagcagca dbSNP:769306267
915 915 -, acagcagca dbSNP:762367488
915 915 -, acagca dbSNP:774699497
915 915 -, aca dbSNP:767957502
915 915 -, g dbSNP:775879957
915 915 a, g dbSNP:12896583
916 916 (cag(8_36)) dbSNP:193922928
921 921 -, tagcagcagcag dbSNP:771525981
921 921 g, t dbSNP:765913054
925 925 a, c dbSNP:759955623
926 926 -, ccagcagcagcagcagca dbSNP:772712821
928 928 c, t dbSNP:777075482
930 930 -, tag dbSNP:758426138
930 930 a, g dbSNP:538529483
932 932 -, agcagcagg dbSNP:767904273
934 934 a, c dbSNP:770449937
935 935 -, agcagg dbSNP:752940647
935 935 -, tcagcagcagcagcagca dbSNP:756295616
935 935 a, g dbSNP:569392621
937 937 c, t dbSNP:772535725
938 938 -, agg dbSNP:759967732
938 938 a, g dbSNP:771553430
939 939 -, cagcagcagcagcagcagcagcagcag dbSNP:763541221
940 940 -, a, c, t dbSNP:763461489
940 940 c, g dbSNP:12895357
941 941 a, g dbSNP:368058740
942 942 a, g dbSNP:747720294
943 943 c, g dbSNP:374646934
948 948 a, g dbSNP:778789395
952 952 a, g dbSNP:768632002
958 958 a, c dbSNP:748990614
961 961 g, t dbSNP:779933798
963 963 a, g dbSNP:757359624
967 967 c, t dbSNP:751821844
977 977 c, g dbSNP:778200373
986 986 c, g, t dbSNP:533268889
998 998 c, g dbSNP:765788785
999 999 a, c dbSNP:139577236
1005 1005 a, g dbSNP:754084606
1007 1007 a, g dbSNP:766775924
1012 1012 c, g dbSNP:151002328
1014 1014 a, g dbSNP:760999964
1024 1024 a, g dbSNP:542401270
1025 1025 c, t dbSNP:749363861
1036 1036 a, g, t dbSNP:142718363
1038 1038 c, t dbSNP:750747570
1041 1041 a, g dbSNP:199942851
1068 1068 a, g dbSNP:562671116
1069 1069 c, g dbSNP:751203850
1085 1085 a, c dbSNP:763724702
1088 1088 c, t dbSNP:762497293
1097 1097 a, g dbSNP:774914247
1107 1107 -, a dbSNP:776239444
1108 1108 -, t dbSNP:768351340
1123 1123 -, a dbSNP:746773032
1128 1128 a, t dbSNP:765179478
1132 1132 a, g dbSNP:759393936
1134 1134 a, t dbSNP:776508242
1140 1140 a, g dbSNP:770831500
1146 1146 -, c dbSNP:779829271
1148 1148 a, g dbSNP:746867371
1159 1159 g, t dbSNP:376064779
1160 1160 a, g dbSNP:371442064
1165 1165 g, t dbSNP:574166677
1173 1173 a, g dbSNP:748481683
1201 1201 c, g dbSNP:373813370
1223 1223 a, c, t dbSNP:10151135
1224 1224 a, g dbSNP:578194188
1243 1243 a, g dbSNP:376865350
1256 1256 a, g dbSNP:558382743
1261 1261 a, g dbSNP:709930
1263 1263 c, t dbSNP:116338117
1264 1264 g, t dbSNP:1804683
1315 1315 g, t dbSNP:756178320
1318 1318 a, g dbSNP:762685504
1387 1387 -, c dbSNP:34148613
1412 1412 c, t dbSNP:555522753
1430 1430 a, g dbSNP:535967073
1437 1437 c, t dbSNP:56277345
1440 1440 c, t dbSNP:567328244
1448 1448 -, g dbSNP:34431920
1469 1469 a, t dbSNP:745890873
1488 1488 a, g dbSNP:777583007
1492 1492 g, t dbSNP:910369
1505 1505 a, g dbSNP:140741824
1510 1510 a, t dbSNP:752468952
1596 1596 g, t dbSNP:17127901
1615 1615 c, t dbSNP:78530327
1629 1629 c, t dbSNP:377668917
1630 1630 -, g dbSNP:750893431
1736 1736 a, g dbSNP:17847274
1759 1759 a, g dbSNP:754727174
1761 1761 c, t dbSNP:180896627
1775 1775 c, t dbSNP:55644237
1783 1783 a, g dbSNP:529420712
1787 1787 a, g dbSNP:560592057
1795 1795 a, g dbSNP:529386181
1824 1824 a, g dbSNP:56396823
1939 1939 a, g dbSNP:538312555
1977 1977 a, g dbSNP:115345965
2028 2028 c, t dbSNP:373659686
2029 2029 a, g dbSNP:533409972
2047 2047 g, t dbSNP:772727244
2099 2099 c, t dbSNP:151107245
2216 2216 a, g dbSNP:55966267
2231 2231 c, t dbSNP:762350146
2273 2273 c, t dbSNP:774747355
2279 2279 a, g dbSNP:575509086
2283 2283 a, g dbSNP:755952813
2312 2312 a, g dbSNP:74731246
2315 2315 c, t dbSNP:546260267
2317 2317 a, t dbSNP:529742601
2326 2326 a, g dbSNP:768991623
2334 2334 c, t dbSNP:555559894
2335 2335 a, c dbSNP:375844803
2356 2356 c, t dbSNP:541987773
2371 2371 a, g dbSNP:749575271
2391 2391 a, g dbSNP:573665148
2435 2435 c, t dbSNP:553786504
2448 2448 a, g dbSNP:531956768
2507 2507 a, c dbSNP:74071835
2524 2524 c, g dbSNP:775690573
2544 2544 c, t dbSNP:557771242
2545 2545 a, g dbSNP:538172199
2562 2562 a, g, t dbSNP:142986250
2572 2572 c, t dbSNP:529036679
2581 2581 c, t dbSNP:745959046
2587 2587 c, t dbSNP:61988394
2589 2589 c, t dbSNP:547111329
2666 2666 g, t dbSNP:533250394
2695 2695 a, g dbSNP:564165980
2727 2727 c, t dbSNP:750309656
2734 2734 g, t dbSNP:544170451
2750 2750 c, t dbSNP:531128594
2839 2839 c, t dbSNP:781295503
2848 2848 c, t dbSNP:562006347
2864 2864 a, c dbSNP:542024827
2905 2905 a, g dbSNP:758310971
2933 2933 a, g dbSNP:748079715
2936 2936 a, g dbSNP:148968790
2945 2945 a, g dbSNP:147932464
3010 3010 c, g dbSNP:544031301
3107 3107 c, t dbSNP:55692120
3128 3128 a, c dbSNP:187186734
3165 3165 g, t dbSNP:577644529
3173 3173 -, t dbSNP:145019811
3178 3178 c, t dbSNP:182587249
3179 3179 a, g dbSNP:12433948
3190 3190 a, g dbSNP:569174897
3233 3233 a, g dbSNP:766144891
3248 3248 c, t dbSNP:140811598
3249 3249 a, g dbSNP:535376586
3287 3287 c, t dbSNP:374968114
3337 3337 g, t dbSNP:566690448
3345 3345 a, g dbSNP:8019545
3346 3346 c, t dbSNP:55921125
3356 3356 a, g dbSNP:570576217
3414 3414 c, t dbSNP:550573299
3423 3423 c, t dbSNP:530768711
3424 3424 g, t dbSNP:35041243
3448 3448 c, t dbSNP:149978731
3449 3449 a, g dbSNP:528765879
3459 3459 c, t dbSNP:113070671
3495 3495 g, t dbSNP:762283961
3526 3526 g, t dbSNP:764037942
3536 3536 a, t dbSNP:559924763
3547 3547 a, g dbSNP:752749801
3582 3582 g, t dbSNP:56196346
3626 3626 c, t dbSNP:577684465
3632 3632 -, attg dbSNP:768003087
3658 3658 a, g dbSNP:764515154
3765 3765 a, g dbSNP:763317999
3782 3782 a, c dbSNP:190326858
3797 3797 a, g dbSNP:11628764
3822 3822 c, t dbSNP:769942768
3829 3829 a, g dbSNP:186208016
3936 3936 c, t dbSNP:111461096
3962 3962 c, t dbSNP:375246638
3989 3989 c, t dbSNP:188739788
4021 4021 c, g dbSNP:371606868
4040 4040 a, g dbSNP:546433513
4050 4050 c, t dbSNP:573022747
4051 4051 a, g dbSNP:532483134
4099 4099 c, t dbSNP:560663525
4111 4111 c, t dbSNP:553145415
4150 4150 a, c dbSNP:759893441
4151 4151 -, a dbSNP:776918783
4182 4182 -, t dbSNP:201936460
4254 4254 a, g dbSNP:563148297
4261 4261 a, g dbSNP:771030906
4283 4283 a, g dbSNP:540263466
4334 4334 c, t dbSNP:570617215
4372 4372 a, t dbSNP:574815764
4374 4374 c, t dbSNP:550712214
4375 4375 c, t dbSNP:1055996
4389 4389 c, t dbSNP:184013158
4416 4416 c, t dbSNP:538059127
4424 4424 c, t dbSNP:548266802
4446 4446 c, t dbSNP:150577313
4447 4447 a, g dbSNP:192345523
4463 4463 g, t dbSNP:111357714
4465 4465 g, t dbSNP:552740772
4468 4468 c, t dbSNP:189650643
4469 4469 a, g dbSNP:374782928
4477 4477 a, g dbSNP:112586446
4506 4506 a, c dbSNP:768019941
4543 4543 a, g dbSNP:138165116
4560 4560 a, g dbSNP:3178662
4593 4593 c, t dbSNP:575386049
4596 4596 c, t dbSNP:779866271
4610 4610 acagaggatgcagtgagcca, gcagaggatgcagtgagccg dbSNP:386779980
4610 4610 a, g dbSNP:1134377
4629 4629 a, g dbSNP:1134378
4671 4671 a, c dbSNP:184319601
4695 4695 -, aa dbSNP:35141835
4722 4722 c, t dbSNP:193285351
4785 4785 c, t dbSNP:552947804
4789 4789 a, g dbSNP:745527516
4795 4795 a, t dbSNP:539718709
4839 4839 c, t dbSNP:146242536
4864 4864 -, gat dbSNP:554238799
4867 4867 c, g dbSNP:556725165
4901 4901 c, t dbSNP:188681362
4911 4911 a, c dbSNP:182949932
4925 4925 a, g dbSNP:554966272
4983 4983 a, g dbSNP:141777702
5014 5014 c, t dbSNP:191933456
5015 5015 a, g dbSNP:552633402
5051 5051 a, g dbSNP:75002598
5090 5090 a, g dbSNP:78681557
5120 5120 a, c, t dbSNP:377639670
5124 5124 c, g, t dbSNP:374276626
5144 5144 c, t dbSNP:8008405
5148 5148 -, aa dbSNP:11451253
5158 5158 -, atat dbSNP:397970086
5158 5158 a, t dbSNP:775080758
5159 5159 -, a, aaaa, at dbSNP:61461391
5160 5160 -, tatat dbSNP:770619918
5160 5160 -, tat dbSNP:371762976
5160 5160 a, t dbSNP:11621770
5160 5160 -, t dbSNP:386419521
5162 5162 -, tat dbSNP:777952246
5162 5162 a, t dbSNP:34351382
5162 5162 -, t dbSNP:757192263
5164 5164 -, t dbSNP:367664867
5177 5177 -, atat dbSNP:376316878
5177 5177 -, at dbSNP:753004854
5177 5177 a, g dbSNP:138868478
5179 5179 -, at dbSNP:751303682
5179 5179 a, g dbSNP:149006887
5185 5185 a, g dbSNP:199894637
5186 5186 -, gt dbSNP:200238931
5196 5196 -, at dbSNP:201691672
5320 5320 a, c dbSNP:528123223
5345 5345 a, c dbSNP:8009456
5361 5361 c, g dbSNP:182375232
5370 5370 a, g dbSNP:576705676
5447 5447 a, g dbSNP:556760089
5485 5485 c, t dbSNP:543180973
5522 5522 a, g dbSNP:574887239
5525 5525 g, t dbSNP:554810577
5531 5531 g, t dbSNP:535108713
5534 5534 g, t dbSNP:67089639
5596 5596 -, cttt dbSNP:760008124
5597 5597 -, cttt dbSNP:367993031
5597 5597 -, ctt dbSNP:748105188
5597 5597 c, t dbSNP:200134701
5601 5601 c, t dbSNP:558890121
5607 5607 -, tttt dbSNP:779811232
5610 5610 c, t dbSNP:191168297
5617 5617 c, t dbSNP:112733683
5659 5659 a, g dbSNP:550405473
5663 5663 -, t dbSNP:112537858
5690 5690 a, g dbSNP:141847020
5697 5697 c, t dbSNP:186244206
5698 5698 a, g, t dbSNP:569604127
5711 5711 c, t dbSNP:147968987
5714 5714 c, t dbSNP:531937444
5767 5767 -, t dbSNP:398118522
5774 5774 -, t dbSNP:145205040
5775 5775 -, t, tt dbSNP:552780970
5827 5827 a, g dbSNP:765615691
5855 5855 c, g dbSNP:759738968
5887 5887 c, t dbSNP:182487175
5888 5888 a, g dbSNP:776908103
5893 5893 g, t dbSNP:770993613
5941 5941 c, t dbSNP:760852869
6018 6018 c, t dbSNP:773379500
6031 6031 a, g dbSNP:116994678
6059 6059 c, t dbSNP:749214501
6097 6097 a, t dbSNP:532290325
6107 6107 c, t dbSNP:769626047
6115 6115 c, g dbSNP:192385527
6127 6127 -, ataaaaata dbSNP:781437447
6157 6157 -, atga dbSNP:369630957
6157 6157 a, g dbSNP:9652396
6161 6161 a, g dbSNP:10151945
6178 6178 c, t dbSNP:751097712
6192 6192 a, g dbSNP:554732515
6212 6212 c, t dbSNP:74244591
6251 6251 c, g dbSNP:541880574
6293 6293 g, t dbSNP:758956940
6303 6303 a, g dbSNP:8022758
6323 6323 c, t dbSNP:144799309
6355 6355 a, g dbSNP:765591204
6472 6472 -, t dbSNP:58982263
6484 6484 -, t dbSNP:762458117
6498 6498 a, g dbSNP:73323741
6519 6519 -, tcta dbSNP:552042048
6538 6538 g, t dbSNP:151053179
6600 6600 c, g dbSNP:537593516
6629 6629 c, t dbSNP:1047795
6644 6644 a, g dbSNP:142874189
6663 6663 a, g dbSNP:567800167
6670 6670 c, t dbSNP:766647421
6686 6686 a, g dbSNP:760946854
6687 6687 a, g dbSNP:773473590
6688 6688 c, t dbSNP:74071833
6706 6706 c, g dbSNP:534442386
6732 6732 c, t dbSNP:565734430
6736 6736 -, caca dbSNP:549867277
6737 6737 a, c dbSNP:767691121
6746 6746 a, c dbSNP:763050363
6757 6757 a, g dbSNP:775498557
6792 6792 a, t dbSNP:769557211
6809 6809 g, t dbSNP:564884511
6810 6810 c, t dbSNP:148498078
6814 6814 c, g dbSNP:186327684
6815 6815 a, t dbSNP:562933608

Target ORF information:

RefSeq Version NM_001127696
Organism Homo sapiens (human)
Definition Homo sapiens ataxin 3 (ATXN3), transcript variant ad, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001127696

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGG TTATAAGCAA TGCCTTGAAA GTTTGGGGTT TAGAACTAAT CCTGTTCAAC
AGTCCAGAGT ATCAGAGGCT CAGGATCGAT CCTATAAATG AAAGATCATT TATATGCAAT
TATAAGGAAC ACTGGTTTAC AGTTAGAAAA TTAGGAAAAC AGTGGTTTAA CTTGAATTCT
CTCTTGACGG GTCCAGAATT AATATCAGAT ACATATCTTG CACTTTTCTT GGCTCAATTA
CAACAGGAAG GTTATTCTAT ATTTGTCGTT AAGGGTGATC TGCCAGATTG CGAAGCTGAC
CAACTCCTGC AGATGATTAG GGTCCAACAG ATGCATCGAC CAAAACTTAT TGGAGAAGAA
TTAGCACAAC TAAAAGAGCA AAGAGTCCAT AAAACAGACC TGGAACGAGT GTTAGAAGCA
AATGATGGCT CAGGAATGTT AGACGAAGAT GAGGAGGATT TGCAGAGGGC TCTGGCACTA
AGTCGCCAAG AAATTGACAT GGAAGATGAG GAAGCAGATC TCCGCAGGGC TATTCAGCTA
AGTATGCAAG GTAGTTCCAG AAACATATCT CAAGATATGA CACAGACATC AGGTACAAAT
CTTACTTCAG AAGAGCTTCG GAAGAGACGA GAAGCCTACT TTGAAAAACA GCAGCAAAAG
CAGCAACAGC AGCAGCAGCA GCAGCAGCAG GGGGACCTAT CAGGACAGAG TTCACATCCA
TGTGAAAGGC CAGCCACCAG TTCAGGAGCA CTTGGGAGTG ATCTAGGTGA TGCTATGAGT
GAAGAAGACA TGCTTCAGGC AGCTGTGACC ATGTCTTTAG AAACTGTCAG AAATGATTTG
AAAACAGAAG GAAAAAAATA A

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21306
Accession Version NM_001164778.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 465bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product ataxin-3 isoform o
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL121773.5 and AL049872.3. Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. Transcript Variant: This variant (o) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform o. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGC AGCCTTCTGG AAATATGGAT GACAGTGGTT TTTTCTCTAT TCAGGTTATA
AGCAATGCCT TGAAAGTTTG GGGTTTAGAA CTAATCCTGT TCAACAGTCC AGAGTATCAG
AGGCTCAGGA TCGATCCTAT AAATGAAAGA TCATTTATAT GCAATTATAA GGAACACTGG
TTTACAGTTA GAAAATTAGG AAAACAGACA GCAGCAAAAG CAGCAACAGC AGCAGCAGCA
GCAGCAGCAG GGGGACCTAT CAGGACAGAG TTCACATCCA TGTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001158250.1
CDS70..534
Misc Feature(1)91..>456(+)
Exon (1)1..93
Gene:ATXN3
Gene Synonym:
Exon (2)94..258
Gene:ATXN3
Gene Synonym:
Exon (3)259..303
Gene:ATXN3
Gene Synonym:
Exon (4)304..389
Gene:ATXN3
Gene Synonym:
Exon (5)390..456
Gene:ATXN3
Gene Synonym:
Exon (6)457..575
Gene:ATXN3
Gene Synonym:
Exon (7)576..6438
Gene:ATXN3
Gene Synonym:
Translation
Position Chain Variation Link
15 15 -, g dbSNP:55970447
24 24 c, g dbSNP:773675927
27 27 a, g dbSNP:373384259
29 29 c, g dbSNP:747774933
30 30 g, t dbSNP:555614052
36 36 a, c, t dbSNP:56331048
39 39 c, t dbSNP:3814834
40 40 a, g, t dbSNP:374699412
41 41 g, t dbSNP:780973227
42 42 c, g, t dbSNP:751439402
43 43 c, g dbSNP:765348620
44 44 a, g dbSNP:755302582
47 47 c, t dbSNP:753922991
51 51 c, t dbSNP:368734521
52 52 a, g dbSNP:761201018
55 55 a, t dbSNP:773864210
56 56 a, c dbSNP:768123597
58 58 a, g dbSNP:762077144
62 62 a, t dbSNP:376741760
63 63 a, c, g dbSNP:768169130
64 64 a, g dbSNP:748959673
66 66 a, t dbSNP:774939813
87 87 c, t dbSNP:769298166
93 93 a, g dbSNP:745440781
95 95 a, g dbSNP:778221475
96 96 a, g dbSNP:758952886
114 114 c, t dbSNP:753009580
117 117 a, g dbSNP:201027114
126 126 a, g dbSNP:759040212
136 136 c, t dbSNP:753538537
149 149 a, g dbSNP:368260154
159 159 c, t dbSNP:17853195
160 160 a, g dbSNP:766001707
181 181 a, c dbSNP:760232954
182 182 a, g dbSNP:200872467
183 183 g, t dbSNP:772892274
186 186 a, g dbSNP:772116798
188 188 -, t dbSNP:760473560
199 199 a, g dbSNP:761867251
212 212 c, t dbSNP:774250246
225 225 a, g dbSNP:565014021
228 228 c, t dbSNP:746020592
229 229 a, g dbSNP:776899714
233 233 a, g dbSNP:771098090
234 234 g, t dbSNP:747089043
241 241 c, t dbSNP:375315995
244 244 c, t dbSNP:147833264
245 245 a, g dbSNP:531719156
246 246 a, c dbSNP:779188574
248 248 a, c, t dbSNP:144506566
249 249 a, g dbSNP:140562271
257 257 a, g dbSNP:377603133
261 261 a, g dbSNP:373205243
263 263 c, t dbSNP:200230139
269 269 g, t dbSNP:773405950
293 293 -, t dbSNP:763008544
307 307 a, t dbSNP:762049636
322 322 a, c, g dbSNP:761123692
328 328 -, tg dbSNP:35956988
344 344 c, t dbSNP:768626702
345 345 a, c dbSNP:763461497
356 356 a, g dbSNP:775850621
359 359 c, g dbSNP:545673644
382 382 a, g dbSNP:746205070
388 388 a, g dbSNP:781706817
389 389 c, t dbSNP:371630976
394 394 a, g dbSNP:772732276
395 395 a, g dbSNP:771793716
402 402 a, g dbSNP:747586178
416 416 a, t dbSNP:778421428
426 426 c, g dbSNP:754873504
428 428 g, t dbSNP:749230434
435 435 a, g dbSNP:200356462
436 436 a, g dbSNP:759456959
457 457 -, a dbSNP:748879218
466 466 -, aaa dbSNP:141993435
466 466 -, gc dbSNP:780906123
466 466 a, g dbSNP:12896589
467 467 -, gc dbSNP:754789530
467 467 a, c dbSNP:12896588
475 475 -, acagcagcagcagcagca dbSNP:750329097
475 475 -, acagcagcagca dbSNP:769306267
475 475 -, acagcagca dbSNP:762367488
475 475 -, acagca dbSNP:774699497
475 475 -, aca dbSNP:767957502
475 475 -, g dbSNP:775879957
475 475 a, g dbSNP:12896583
476 476 (cag(8_36)) dbSNP:193922928
481 481 -, tagcagcagcag dbSNP:771525981
481 481 g, t dbSNP:765913054
485 485 a, c dbSNP:759955623
486 486 -, ccagcagcagcagcagca dbSNP:772712821
488 488 c, t dbSNP:777075482
490 490 -, tag dbSNP:758426138
490 490 a, g dbSNP:538529483
492 492 -, agcagcagg dbSNP:767904273
494 494 a, c dbSNP:770449937
495 495 -, agcagg dbSNP:752940647
495 495 -, tcagcagcagcagcagca dbSNP:756295616
495 495 a, g dbSNP:569392621
497 497 c, t dbSNP:772535725
498 498 -, agg dbSNP:759967732
498 498 a, g dbSNP:771553430
499 499 -, cagcagcagcagcagcagcagcagcag dbSNP:763541221
500 500 -, a, c, t dbSNP:763461489
500 500 c, g dbSNP:12895357
501 501 a, g dbSNP:368058740
502 502 a, g dbSNP:747720294
503 503 c, g dbSNP:374646934
508 508 a, g dbSNP:778789395
512 512 a, g dbSNP:768632002
518 518 a, c dbSNP:748990614
521 521 g, t dbSNP:779933798
523 523 a, g dbSNP:757359624
527 527 c, t dbSNP:751821844
537 537 c, g dbSNP:778200373
546 546 c, g, t dbSNP:533268889
558 558 c, g dbSNP:765788785
559 559 a, c dbSNP:139577236
565 565 a, g dbSNP:754084606
567 567 a, g dbSNP:766775924
572 572 c, g dbSNP:151002328
574 574 a, g dbSNP:760999964
584 584 a, g dbSNP:542401270
585 585 c, t dbSNP:749363861
596 596 a, g, t dbSNP:142718363
598 598 c, t dbSNP:750747570
601 601 a, g dbSNP:199942851
628 628 a, g dbSNP:562671116
629 629 c, g dbSNP:751203850
645 645 a, c dbSNP:763724702
648 648 c, t dbSNP:762497293
657 657 a, g dbSNP:774914247
667 667 -, a dbSNP:776239444
668 668 -, t dbSNP:768351340
683 683 -, a dbSNP:746773032
688 688 a, t dbSNP:765179478
692 692 a, g dbSNP:759393936
694 694 a, t dbSNP:776508242
700 700 a, g dbSNP:770831500
706 706 -, c dbSNP:779829271
708 708 a, g dbSNP:746867371
719 719 g, t dbSNP:376064779
720 720 a, g dbSNP:371442064
725 725 g, t dbSNP:574166677
733 733 a, g dbSNP:748481683
761 761 c, g dbSNP:373813370
783 783 a, c, t dbSNP:10151135
784 784 a, g dbSNP:578194188
803 803 a, g dbSNP:376865350
816 816 a, g dbSNP:558382743
821 821 a, g dbSNP:709930
823 823 c, t dbSNP:116338117
824 824 g, t dbSNP:1804683
875 875 g, t dbSNP:756178320
878 878 a, g dbSNP:762685504
947 947 -, c dbSNP:34148613
972 972 c, t dbSNP:555522753
990 990 a, g dbSNP:535967073
997 997 c, t dbSNP:56277345
1000 1000 c, t dbSNP:567328244
1008 1008 -, g dbSNP:34431920
1029 1029 a, t dbSNP:745890873
1048 1048 a, g dbSNP:777583007
1052 1052 g, t dbSNP:910369
1065 1065 a, g dbSNP:140741824
1070 1070 a, t dbSNP:752468952
1156 1156 g, t dbSNP:17127901
1175 1175 c, t dbSNP:78530327
1189 1189 c, t dbSNP:377668917
1190 1190 -, g dbSNP:750893431
1296 1296 a, g dbSNP:17847274
1319 1319 a, g dbSNP:754727174
1321 1321 c, t dbSNP:180896627
1335 1335 c, t dbSNP:55644237
1343 1343 a, g dbSNP:529420712
1347 1347 a, g dbSNP:560592057
1355 1355 a, g dbSNP:529386181
1384 1384 a, g dbSNP:56396823
1499 1499 a, g dbSNP:538312555
1537 1537 a, g dbSNP:115345965
1588 1588 c, t dbSNP:373659686
1589 1589 a, g dbSNP:533409972
1607 1607 g, t dbSNP:772727244
1659 1659 c, t dbSNP:151107245
1776 1776 a, g dbSNP:55966267
1791 1791 c, t dbSNP:762350146
1833 1833 c, t dbSNP:774747355
1839 1839 a, g dbSNP:575509086
1843 1843 a, g dbSNP:755952813
1872 1872 a, g dbSNP:74731246
1875 1875 c, t dbSNP:546260267
1877 1877 a, t dbSNP:529742601
1886 1886 a, g dbSNP:768991623
1894 1894 c, t dbSNP:555559894
1895 1895 a, c dbSNP:375844803
1916 1916 c, t dbSNP:541987773
1931 1931 a, g dbSNP:749575271
1951 1951 a, g dbSNP:573665148
1995 1995 c, t dbSNP:553786504
2008 2008 a, g dbSNP:531956768
2067 2067 a, c dbSNP:74071835
2084 2084 c, g dbSNP:775690573
2104 2104 c, t dbSNP:557771242
2105 2105 a, g dbSNP:538172199
2122 2122 a, g, t dbSNP:142986250
2132 2132 c, t dbSNP:529036679
2141 2141 c, t dbSNP:745959046
2147 2147 c, t dbSNP:61988394
2149 2149 c, t dbSNP:547111329
2226 2226 g, t dbSNP:533250394
2255 2255 a, g dbSNP:564165980
2287 2287 c, t dbSNP:750309656
2294 2294 g, t dbSNP:544170451
2310 2310 c, t dbSNP:531128594
2399 2399 c, t dbSNP:781295503
2408 2408 c, t dbSNP:562006347
2424 2424 a, c dbSNP:542024827
2465 2465 a, g dbSNP:758310971
2493 2493 a, g dbSNP:748079715
2496 2496 a, g dbSNP:148968790
2505 2505 a, g dbSNP:147932464
2570 2570 c, g dbSNP:544031301
2667 2667 c, t dbSNP:55692120
2688 2688 a, c dbSNP:187186734
2725 2725 g, t dbSNP:577644529
2733 2733 -, t dbSNP:145019811
2738 2738 c, t dbSNP:182587249
2739 2739 a, g dbSNP:12433948
2750 2750 a, g dbSNP:569174897
2793 2793 a, g dbSNP:766144891
2808 2808 c, t dbSNP:140811598
2809 2809 a, g dbSNP:535376586
2847 2847 c, t dbSNP:374968114
2897 2897 g, t dbSNP:566690448
2905 2905 a, g dbSNP:8019545
2906 2906 c, t dbSNP:55921125
2916 2916 a, g dbSNP:570576217
2974 2974 c, t dbSNP:550573299
2983 2983 c, t dbSNP:530768711
2984 2984 g, t dbSNP:35041243
3008 3008 c, t dbSNP:149978731
3009 3009 a, g dbSNP:528765879
3019 3019 c, t dbSNP:113070671
3055 3055 g, t dbSNP:762283961
3086 3086 g, t dbSNP:764037942
3096 3096 a, t dbSNP:559924763
3107 3107 a, g dbSNP:752749801
3142 3142 g, t dbSNP:56196346
3186 3186 c, t dbSNP:577684465
3192 3192 -, attg dbSNP:768003087
3218 3218 a, g dbSNP:764515154
3325 3325 a, g dbSNP:763317999
3342 3342 a, c dbSNP:190326858
3357 3357 a, g dbSNP:11628764
3382 3382 c, t dbSNP:769942768
3389 3389 a, g dbSNP:186208016
3496 3496 c, t dbSNP:111461096
3522 3522 c, t dbSNP:375246638
3549 3549 c, t dbSNP:188739788
3581 3581 c, g dbSNP:371606868
3600 3600 a, g dbSNP:546433513
3610 3610 c, t dbSNP:573022747
3611 3611 a, g dbSNP:532483134
3659 3659 c, t dbSNP:560663525
3671 3671 c, t dbSNP:553145415
3710 3710 a, c dbSNP:759893441
3711 3711 -, a dbSNP:776918783
3742 3742 -, t dbSNP:201936460
3814 3814 a, g dbSNP:563148297
3821 3821 a, g dbSNP:771030906
3843 3843 a, g dbSNP:540263466
3894 3894 c, t dbSNP:570617215
3932 3932 a, t dbSNP:574815764
3934 3934 c, t dbSNP:550712214
3935 3935 c, t dbSNP:1055996
3949 3949 c, t dbSNP:184013158
3976 3976 c, t dbSNP:538059127
3984 3984 c, t dbSNP:548266802
4006 4006 c, t dbSNP:150577313
4007 4007 a, g dbSNP:192345523
4023 4023 g, t dbSNP:111357714
4025 4025 g, t dbSNP:552740772
4028 4028 c, t dbSNP:189650643
4029 4029 a, g dbSNP:374782928
4037 4037 a, g dbSNP:112586446
4066 4066 a, c dbSNP:768019941
4103 4103 a, g dbSNP:138165116
4120 4120 a, g dbSNP:3178662
4153 4153 c, t dbSNP:575386049
4156 4156 c, t dbSNP:779866271
4170 4170 acagaggatgcagtgagcca, gcagaggatgcagtgagccg dbSNP:386779980
4170 4170 a, g dbSNP:1134377
4189 4189 a, g dbSNP:1134378
4231 4231 a, c dbSNP:184319601
4255 4255 -, aa dbSNP:35141835
4282 4282 c, t dbSNP:193285351
4345 4345 c, t dbSNP:552947804
4349 4349 a, g dbSNP:745527516
4355 4355 a, t dbSNP:539718709
4399 4399 c, t dbSNP:146242536
4424 4424 -, gat dbSNP:554238799
4427 4427 c, g dbSNP:556725165
4461 4461 c, t dbSNP:188681362
4471 4471 a, c dbSNP:182949932
4485 4485 a, g dbSNP:554966272
4543 4543 a, g dbSNP:141777702
4574 4574 c, t dbSNP:191933456
4575 4575 a, g dbSNP:552633402
4611 4611 a, g dbSNP:75002598
4650 4650 a, g dbSNP:78681557
4680 4680 a, c, t dbSNP:377639670
4684 4684 c, g, t dbSNP:374276626
4704 4704 c, t dbSNP:8008405
4708 4708 -, aa dbSNP:11451253
4718 4718 -, atat dbSNP:397970086
4718 4718 a, t dbSNP:775080758
4719 4719 -, a, aaaa, at dbSNP:61461391
4720 4720 -, tatat dbSNP:770619918
4720 4720 -, tat dbSNP:371762976
4720 4720 a, t dbSNP:11621770
4720 4720 -, t dbSNP:386419521
4722 4722 -, tat dbSNP:777952246
4722 4722 a, t dbSNP:34351382
4722 4722 -, t dbSNP:757192263
4724 4724 -, t dbSNP:367664867
4737 4737 -, atat dbSNP:376316878
4737 4737 -, at dbSNP:753004854
4737 4737 a, g dbSNP:138868478
4739 4739 -, at dbSNP:751303682
4739 4739 a, g dbSNP:149006887
4745 4745 a, g dbSNP:199894637
4746 4746 -, gt dbSNP:200238931
4756 4756 -, at dbSNP:201691672
4880 4880 a, c dbSNP:528123223
4905 4905 a, c dbSNP:8009456
4921 4921 c, g dbSNP:182375232
4930 4930 a, g dbSNP:576705676
5007 5007 a, g dbSNP:556760089
5045 5045 c, t dbSNP:543180973
5082 5082 a, g dbSNP:574887239
5085 5085 g, t dbSNP:554810577
5091 5091 g, t dbSNP:535108713
5094 5094 g, t dbSNP:67089639
5156 5156 -, cttt dbSNP:760008124
5157 5157 -, cttt dbSNP:367993031
5157 5157 -, ctt dbSNP:748105188
5157 5157 c, t dbSNP:200134701
5161 5161 c, t dbSNP:558890121
5167 5167 -, tttt dbSNP:779811232
5170 5170 c, t dbSNP:191168297
5177 5177 c, t dbSNP:112733683
5219 5219 a, g dbSNP:550405473
5223 5223 -, t dbSNP:112537858
5250 5250 a, g dbSNP:141847020
5257 5257 c, t dbSNP:186244206
5258 5258 a, g, t dbSNP:569604127
5271 5271 c, t dbSNP:147968987
5274 5274 c, t dbSNP:531937444
5327 5327 -, t dbSNP:398118522
5334 5334 -, t dbSNP:145205040
5335 5335 -, t, tt dbSNP:552780970
5387 5387 a, g dbSNP:765615691
5415 5415 c, g dbSNP:759738968
5447 5447 c, t dbSNP:182487175
5448 5448 a, g dbSNP:776908103
5453 5453 g, t dbSNP:770993613
5501 5501 c, t dbSNP:760852869
5578 5578 c, t dbSNP:773379500
5591 5591 a, g dbSNP:116994678
5619 5619 c, t dbSNP:749214501
5657 5657 a, t dbSNP:532290325
5667 5667 c, t dbSNP:769626047
5675 5675 c, g dbSNP:192385527
5687 5687 -, ataaaaata dbSNP:781437447
5717 5717 -, atga dbSNP:369630957
5717 5717 a, g dbSNP:9652396
5721 5721 a, g dbSNP:10151945
5738 5738 c, t dbSNP:751097712
5752 5752 a, g dbSNP:554732515
5772 5772 c, t dbSNP:74244591
5811 5811 c, g dbSNP:541880574
5853 5853 g, t dbSNP:758956940
5863 5863 a, g dbSNP:8022758
5883 5883 c, t dbSNP:144799309
5915 5915 a, g dbSNP:765591204
6032 6032 -, t dbSNP:58982263
6044 6044 -, t dbSNP:762458117
6058 6058 a, g dbSNP:73323741
6079 6079 -, tcta dbSNP:552042048
6098 6098 g, t dbSNP:151053179
6160 6160 c, g dbSNP:537593516
6189 6189 c, t dbSNP:1047795
6204 6204 a, g dbSNP:142874189
6223 6223 a, g dbSNP:567800167
6230 6230 c, t dbSNP:766647421
6246 6246 a, g dbSNP:760946854
6247 6247 a, g dbSNP:773473590
6248 6248 c, t dbSNP:74071833
6266 6266 c, g dbSNP:534442386
6292 6292 c, t dbSNP:565734430
6296 6296 -, caca dbSNP:549867277
6297 6297 a, c dbSNP:767691121
6306 6306 a, c dbSNP:763050363
6317 6317 a, g dbSNP:775498557
6352 6352 a, t dbSNP:769557211
6369 6369 g, t dbSNP:564884511
6370 6370 c, t dbSNP:148498078
6374 6374 c, g dbSNP:186327684
6375 6375 a, t dbSNP:562933608

Target ORF information:

RefSeq Version NM_001164778
Organism Homo sapiens (human)
Definition Homo sapiens ataxin 3 (ATXN3), transcript variant o, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001164778

ORF Insert Sequence:

1
61
121
181
241
301
361
421
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGC AGCCTTCTGG AAATATGGAT GACAGTGGTT TTTTCTCTAT TCAGGTTATA
AGCAATGCCT TGAAAGTTTG GGGTTTAGAA CTAATCCTGT TCAACAGTCC AGAGTATCAG
AGGCTCAGGA TCGATCCTAT AAATGAAAGA TCATTTATAT GCAATTATAA GGAACACTGG
TTTACAGTTA GAAAATTAGG AAAACAGACA GCAGCAAAAG CAGCAACAGC AGCAGCAGCA
GCAGCAGCAG GGGGACCTAT CAGGACAGAG TTCACATCCA TGTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26918
Accession Version NM_004993.5 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1086bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product ataxin-3 reference isoform
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA827537.1, AB050194.1 and AL049872.3. This sequence is a reference standard in the RefSeqGene project. On May 29, 2008 this sequence version replaced gi:130979651. Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. Transcript Variant: This variant (reference, also known as variant 1) encodes the longest isoform (reference isoform, also known as isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U64820.1, AK225884.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGC AGCCTTCTGG AAATATGGAT GACAGTGGTT TTTTCTCTAT TCAGGTTATA
AGCAATGCCT TGAAAGTTTG GGGTTTAGAA CTAATCCTGT TCAACAGTCC AGAGTATCAG
AGGCTCAGGA TCGATCCTAT AAATGAAAGA TCATTTATAT GCAATTATAA GGAACACTGG
TTTACAGTTA GAAAATTAGG AAAACAGTGG TTTAACTTGA ATTCTCTCTT GACGGGTCCA
GAATTAATAT CAGATACATA TCTTGCACTT TTCTTGGCTC AATTACAACA GGAAGGTTAT
TCTATATTTG TCGTTAAGGG TGATCTGCCA GATTGCGAAG CTGACCAACT CCTGCAGATG
ATTAGGGTCC AACAGATGCA TCGACCAAAA CTTATTGGAG AAGAATTAGC ACAACTAAAA
GAGCAAAGAG TCCATAAAAC AGACCTGGAA CGAGTGTTAG AAGCAAATGA TGGCTCAGGA
ATGTTAGACG AAGATGAGGA GGATTTGCAG AGGGCTCTGG CACTAAGTCG CCAAGAAATT
GACATGGAAG ATGAGGAAGC AGATCTCCGC AGGGCTATTC AGCTAAGTAT GCAAGGTAGT
TCCAGAAACA TATCTCAAGA TATGACACAG ACATCAGGTA CAAATCTTAC TTCAGAAGAG
CTTCGGAAGA GACGAGAAGC CTACTTTGAA AAACAGCAGC AAAAGCAGCA ACAGCAGCAG
CAGCAGCAGC AGCAGGGGGA CCTATCAGGA CAGAGTTCAC ATCCATGTGA AAGGCCAGCC
ACCAGTTCAG GAGCACTTGG GAGTGATCTA GGTGATGCTA TGAGTGAAGA AGACATGCTT
CAGGCAGCTG TGACCATGTC TTTAGAAACT GTCAGAAATG ATTTGAAAAC AGAAGGAAAA
AAATAA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_004984.2
CDS70..1155
Misc Feature(1)91..573(+)
Misc Feature(2)943..984(+)
Exon (1)1..93
Gene:ATXN3
Gene Synonym:
Exon (2)94..258
Gene:ATXN3
Gene Synonym:
Exon (3)259..303
Gene:ATXN3
Gene Synonym:
Exon (4)304..389
Gene:ATXN3
Gene Synonym:
Exon (5)390..456
Gene:ATXN3
Gene Synonym:
Exon (6)457..544
Gene:ATXN3
Gene Synonym:
Exon (7)545..677
Gene:ATXN3
Gene Synonym:
Exon (8)678..844
Gene:ATXN3
Gene Synonym:
Exon (9)845..941
Gene:ATXN3
Gene Synonym:
Exon (10)942..1060
Gene:ATXN3
Gene Synonym:
Exon (11)1061..6923
Gene:ATXN3
Gene Synonym:
Translation
Position Chain Variation Link
15 15 -, g dbSNP:55970447
24 24 c, g dbSNP:773675927
27 27 a, g dbSNP:373384259
29 29 c, g dbSNP:747774933
30 30 g, t dbSNP:555614052
36 36 a, c, t dbSNP:56331048
39 39 c, t dbSNP:3814834
40 40 a, g, t dbSNP:374699412
41 41 g, t dbSNP:780973227
42 42 c, g, t dbSNP:751439402
43 43 c, g dbSNP:765348620
44 44 a, g dbSNP:755302582
47 47 c, t dbSNP:753922991
51 51 c, t dbSNP:368734521
52 52 a, g dbSNP:761201018
55 55 a, t dbSNP:773864210
56 56 a, c dbSNP:768123597
58 58 a, g dbSNP:762077144
62 62 a, t dbSNP:376741760
63 63 a, c, g dbSNP:768169130
64 64 a, g dbSNP:748959673
66 66 a, t dbSNP:774939813
87 87 c, t dbSNP:769298166
93 93 a, g dbSNP:745440781
95 95 a, g dbSNP:778221475
96 96 a, g dbSNP:758952886
114 114 c, t dbSNP:753009580
117 117 a, g dbSNP:201027114
126 126 a, g dbSNP:759040212
136 136 c, t dbSNP:753538537
149 149 a, g dbSNP:368260154
159 159 c, t dbSNP:17853195
160 160 a, g dbSNP:766001707
181 181 a, c dbSNP:760232954
182 182 a, g dbSNP:200872467
183 183 g, t dbSNP:772892274
186 186 a, g dbSNP:772116798
188 188 -, t dbSNP:760473560
199 199 a, g dbSNP:761867251
212 212 c, t dbSNP:774250246
225 225 a, g dbSNP:565014021
228 228 c, t dbSNP:746020592
229 229 a, g dbSNP:776899714
233 233 a, g dbSNP:771098090
234 234 g, t dbSNP:747089043
241 241 c, t dbSNP:375315995
244 244 c, t dbSNP:147833264
245 245 a, g dbSNP:531719156
246 246 a, c dbSNP:779188574
248 248 a, c, t dbSNP:144506566
249 249 a, g dbSNP:140562271
257 257 a, g dbSNP:377603133
261 261 a, g dbSNP:373205243
263 263 c, t dbSNP:200230139
269 269 g, t dbSNP:773405950
293 293 -, t dbSNP:763008544
307 307 a, t dbSNP:762049636
322 322 a, c, g dbSNP:761123692
328 328 -, tg dbSNP:35956988
344 344 c, t dbSNP:768626702
345 345 a, c dbSNP:763461497
356 356 a, g dbSNP:775850621
359 359 c, g dbSNP:545673644
382 382 a, g dbSNP:746205070
388 388 a, g dbSNP:781706817
389 389 c, t dbSNP:371630976
394 394 a, g dbSNP:772732276
395 395 a, g dbSNP:771793716
402 402 a, g dbSNP:747586178
416 416 a, t dbSNP:778421428
426 426 c, g dbSNP:754873504
428 428 g, t dbSNP:749230434
435 435 a, g dbSNP:200356462
436 436 a, g dbSNP:759456959
462 462 c, t dbSNP:781063243
466 466 a, t dbSNP:758482810
474 474 c, t dbSNP:752981470
475 475 c, t dbSNP:144152152
477 477 c, t dbSNP:755104001
482 482 c, t dbSNP:754007849
483 483 a, g dbSNP:780604497
484 484 g, t dbSNP:766771475
506 506 c, t dbSNP:761263261
509 509 a, g dbSNP:577858011
515 515 a, c dbSNP:750717644
517 517 c, t dbSNP:767933266
526 526 a, g dbSNP:761316840
531 531 a, g dbSNP:773982221
551 551 c, g dbSNP:200118135
553 553 a, g dbSNP:777729152
561 561 c, t dbSNP:16999141
577 577 c, t dbSNP:749523391
583 583 c, t dbSNP:779942460
585 585 c, t dbSNP:748191546
586 586 a, g dbSNP:750538982
598 598 c, t dbSNP:781702814
600 600 c, g dbSNP:139050721
608 608 a, t dbSNP:751874751
610 610 a, g dbSNP:374466872
612 612 a, t dbSNP:150738718
615 615 a, g dbSNP:562189056
621 621 -, a dbSNP:778230305
628 628 c, t dbSNP:752379583
629 629 a, g dbSNP:764865705
631 631 c, g dbSNP:759055604
632 632 a, g dbSNP:776051012
639 639 a, g dbSNP:202119840
652 652 a, g dbSNP:141672872
659 659 c, t dbSNP:560161051
666 666 a, g dbSNP:201241311
675 675 a, g dbSNP:748016235
701 701 a, g dbSNP:138404351
703 703 a, g dbSNP:1048755
705 705 a, g dbSNP:773271553
710 710 a, g dbSNP:752168522
711 711 a, g, t dbSNP:142148800
713 713 c, t dbSNP:774064667
714 714 a, g dbSNP:770009219
718 718 c, g dbSNP:746109327
719 719 a, t dbSNP:75188275
726 726 a, c dbSNP:770983214
728 728 a, g dbSNP:747156311
738 738 c, t dbSNP:371037244
739 739 a, g dbSNP:377574592
741 741 a, c dbSNP:148366775
749 749 a, g dbSNP:779172677
750 750 -, gga dbSNP:777522387
751 751 c, g dbSNP:754590483
762 762 -, ggctctggc dbSNP:755842617
771 771 a, g dbSNP:201012097
778 778 a, c, t dbSNP:548763388
779 779 a, g dbSNP:199876727
787 787 a, g dbSNP:199790369
791 791 a, g dbSNP:200483057
792 792 c, t dbSNP:143402326
793 793 a, g dbSNP:767543973
794 794 c, t dbSNP:761679000
798 798 a, g dbSNP:201553525
804 804 c, g dbSNP:751329134
816 816 c, t dbSNP:763802729
817 817 c, t dbSNP:759748483
818 818 a, g dbSNP:776828308
820 820 a, g dbSNP:149131253
822 822 a, g dbSNP:771181207
826 826 a, c dbSNP:760721207
840 840 a, g dbSNP:773301187
855 855 a, c dbSNP:764156853
858 858 c, g dbSNP:762622537
866 866 a, g dbSNP:752537367
869 869 a, t dbSNP:766538029
873 873 a, g dbSNP:760915098
881 881 c, g dbSNP:773204962
886 886 a, g dbSNP:772056412
895 895 c, g dbSNP:762007434
901 901 g, t dbSNP:774718180
913 913 c, t dbSNP:377031212
914 914 a, g dbSNP:145210459
923 923 a, g dbSNP:147058331
930 930 a, c dbSNP:3204346
935 935 c, t dbSNP:780591975
942 942 -, a dbSNP:748879218
951 951 -, aaa dbSNP:141993435
951 951 -, gc dbSNP:780906123
951 951 a, g dbSNP:12896589
952 952 -, gc dbSNP:754789530
952 952 a, c dbSNP:12896588
960 960 -, acagcagcagcagcagca dbSNP:750329097
960 960 -, acagcagcagca dbSNP:769306267
960 960 -, acagcagca dbSNP:762367488
960 960 -, acagca dbSNP:774699497
960 960 -, aca dbSNP:767957502
960 960 -, g dbSNP:775879957
960 960 a, g dbSNP:12896583
961 961 (cag(8_36)) dbSNP:193922928
966 966 -, tagcagcagcag dbSNP:771525981
966 966 g, t dbSNP:765913054
970 970 a, c dbSNP:759955623
971 971 -, ccagcagcagcagcagca dbSNP:772712821
973 973 c, t dbSNP:777075482
975 975 -, tag dbSNP:758426138
975 975 a, g dbSNP:538529483
977 977 -, agcagcagg dbSNP:767904273
979 979 a, c dbSNP:770449937
980 980 -, agcagg dbSNP:752940647
980 980 -, tcagcagcagcagcagca dbSNP:756295616
980 980 a, g dbSNP:569392621
982 982 c, t dbSNP:772535725
983 983 -, agg dbSNP:759967732
983 983 a, g dbSNP:771553430
984 984 -, cagcagcagcagcagcagcagcagcag dbSNP:763541221
985 985 -, a, c, t dbSNP:763461489
985 985 c, g dbSNP:12895357
986 986 a, g dbSNP:368058740
987 987 a, g dbSNP:747720294
988 988 c, g dbSNP:374646934
993 993 a, g dbSNP:778789395
997 997 a, g dbSNP:768632002
1003 1003 a, c dbSNP:748990614
1006 1006 g, t dbSNP:779933798
1008 1008 a, g dbSNP:757359624
1012 1012 c, t dbSNP:751821844
1022 1022 c, g dbSNP:778200373
1031 1031 c, g, t dbSNP:533268889
1043 1043 c, g dbSNP:765788785
1044 1044 a, c dbSNP:139577236
1050 1050 a, g dbSNP:754084606
1052 1052 a, g dbSNP:766775924
1057 1057 c, g dbSNP:151002328
1059 1059 a, g dbSNP:760999964
1069 1069 a, g dbSNP:542401270
1070 1070 c, t dbSNP:749363861
1081 1081 a, g, t dbSNP:142718363
1083 1083 c, t dbSNP:750747570
1086 1086 a, g dbSNP:199942851
1113 1113 a, g dbSNP:562671116
1114 1114 c, g dbSNP:751203850
1130 1130 a, c dbSNP:763724702
1133 1133 c, t dbSNP:762497293
1142 1142 a, g dbSNP:774914247
1152 1152 -, a dbSNP:776239444
1153 1153 -, t dbSNP:768351340
1168 1168 -, a dbSNP:746773032
1173 1173 a, t dbSNP:765179478
1177 1177 a, g dbSNP:759393936
1179 1179 a, t dbSNP:776508242
1185 1185 a, g dbSNP:770831500
1191 1191 -, c dbSNP:779829271
1193 1193 a, g dbSNP:746867371
1204 1204 g, t dbSNP:376064779
1205 1205 a, g dbSNP:371442064
1210 1210 g, t dbSNP:574166677
1218 1218 a, g dbSNP:748481683
1246 1246 c, g dbSNP:373813370
1268 1268 a, c, t dbSNP:10151135
1269 1269 a, g dbSNP:578194188
1288 1288 a, g dbSNP:376865350
1301 1301 a, g dbSNP:558382743
1306 1306 a, g dbSNP:709930
1308 1308 c, t dbSNP:116338117
1309 1309 g, t dbSNP:1804683
1360 1360 g, t dbSNP:756178320
1363 1363 a, g dbSNP:762685504
1432 1432 -, c dbSNP:34148613
1457 1457 c, t dbSNP:555522753
1475 1475 a, g dbSNP:535967073
1482 1482 c, t dbSNP:56277345
1485 1485 c, t dbSNP:567328244
1493 1493 -, g dbSNP:34431920
1514 1514 a, t dbSNP:745890873
1533 1533 a, g dbSNP:777583007
1537 1537 g, t dbSNP:910369
1550 1550 a, g dbSNP:140741824
1555 1555 a, t dbSNP:752468952
1641 1641 g, t dbSNP:17127901
1660 1660 c, t dbSNP:78530327
1674 1674 c, t dbSNP:377668917
1675 1675 -, g dbSNP:750893431
1781 1781 a, g dbSNP:17847274
1804 1804 a, g dbSNP:754727174
1806 1806 c, t dbSNP:180896627
1820 1820 c, t dbSNP:55644237
1828 1828 a, g dbSNP:529420712
1832 1832 a, g dbSNP:560592057
1840 1840 a, g dbSNP:529386181
1869 1869 a, g dbSNP:56396823
1984 1984 a, g dbSNP:538312555
2022 2022 a, g dbSNP:115345965
2073 2073 c, t dbSNP:373659686
2074 2074 a, g dbSNP:533409972
2092 2092 g, t dbSNP:772727244
2144 2144 c, t dbSNP:151107245
2261 2261 a, g dbSNP:55966267
2276 2276 c, t dbSNP:762350146
2318 2318 c, t dbSNP:774747355
2324 2324 a, g dbSNP:575509086
2328 2328 a, g dbSNP:755952813
2357 2357 a, g dbSNP:74731246
2360 2360 c, t dbSNP:546260267
2362 2362 a, t dbSNP:529742601
2371 2371 a, g dbSNP:768991623
2379 2379 c, t dbSNP:555559894
2380 2380 a, c dbSNP:375844803
2401 2401 c, t dbSNP:541987773
2416 2416 a, g dbSNP:749575271
2436 2436 a, g dbSNP:573665148
2480 2480 c, t dbSNP:553786504
2493 2493 a, g dbSNP:531956768
2552 2552 a, c dbSNP:74071835
2569 2569 c, g dbSNP:775690573
2589 2589 c, t dbSNP:557771242
2590 2590 a, g dbSNP:538172199
2607 2607 a, g, t dbSNP:142986250
2617 2617 c, t dbSNP:529036679
2626 2626 c, t dbSNP:745959046
2632 2632 c, t dbSNP:61988394
2634 2634 c, t dbSNP:547111329
2711 2711 g, t dbSNP:533250394
2740 2740 a, g dbSNP:564165980
2772 2772 c, t dbSNP:750309656
2779 2779 g, t dbSNP:544170451
2795 2795 c, t dbSNP:531128594
2884 2884 c, t dbSNP:781295503
2893 2893 c, t dbSNP:562006347
2909 2909 a, c dbSNP:542024827
2950 2950 a, g dbSNP:758310971
2978 2978 a, g dbSNP:748079715
2981 2981 a, g dbSNP:148968790
2990 2990 a, g dbSNP:147932464
3055 3055 c, g dbSNP:544031301
3152 3152 c, t dbSNP:55692120
3173 3173 a, c dbSNP:187186734
3210 3210 g, t dbSNP:577644529
3218 3218 -, t dbSNP:145019811
3223 3223 c, t dbSNP:182587249
3224 3224 a, g dbSNP:12433948
3235 3235 a, g dbSNP:569174897
3278 3278 a, g dbSNP:766144891
3293 3293 c, t dbSNP:140811598
3294 3294 a, g dbSNP:535376586
3332 3332 c, t dbSNP:374968114
3382 3382 g, t dbSNP:566690448
3390 3390 a, g dbSNP:8019545
3391 3391 c, t dbSNP:55921125
3401 3401 a, g dbSNP:570576217
3459 3459 c, t dbSNP:550573299
3468 3468 c, t dbSNP:530768711
3469 3469 g, t dbSNP:35041243
3493 3493 c, t dbSNP:149978731
3494 3494 a, g dbSNP:528765879
3504 3504 c, t dbSNP:113070671
3540 3540 g, t dbSNP:762283961
3571 3571 g, t dbSNP:764037942
3581 3581 a, t dbSNP:559924763
3592 3592 a, g dbSNP:752749801
3627 3627 g, t dbSNP:56196346
3671 3671 c, t dbSNP:577684465
3677 3677 -, attg dbSNP:768003087
3703 3703 a, g dbSNP:764515154
3810 3810 a, g dbSNP:763317999
3827 3827 a, c dbSNP:190326858
3842 3842 a, g dbSNP:11628764
3867 3867 c, t dbSNP:769942768
3874 3874 a, g dbSNP:186208016
3981 3981 c, t dbSNP:111461096
4007 4007 c, t dbSNP:375246638
4034 4034 c, t dbSNP:188739788
4066 4066 c, g dbSNP:371606868
4085 4085 a, g dbSNP:546433513
4095 4095 c, t dbSNP:573022747
4096 4096 a, g dbSNP:532483134
4144 4144 c, t dbSNP:560663525
4156 4156 c, t dbSNP:553145415
4195 4195 a, c dbSNP:759893441
4196 4196 -, a dbSNP:776918783
4227 4227 -, t dbSNP:201936460
4299 4299 a, g dbSNP:563148297
4306 4306 a, g dbSNP:771030906
4328 4328 a, g dbSNP:540263466
4379 4379 c, t dbSNP:570617215
4417 4417 a, t dbSNP:574815764
4419 4419 c, t dbSNP:550712214
4420 4420 c, t dbSNP:1055996
4434 4434 c, t dbSNP:184013158
4461 4461 c, t dbSNP:538059127
4469 4469 c, t dbSNP:548266802
4491 4491 c, t dbSNP:150577313
4492 4492 a, g dbSNP:192345523
4508 4508 g, t dbSNP:111357714
4510 4510 g, t dbSNP:552740772
4513 4513 c, t dbSNP:189650643
4514 4514 a, g dbSNP:374782928
4522 4522 a, g dbSNP:112586446
4551 4551 a, c dbSNP:768019941
4588 4588 a, g dbSNP:138165116
4605 4605 a, g dbSNP:3178662
4638 4638 c, t dbSNP:575386049
4641 4641 c, t dbSNP:779866271
4655 4655 acagaggatgcagtgagcca, gcagaggatgcagtgagccg dbSNP:386779980
4655 4655 a, g dbSNP:1134377
4674 4674 a, g dbSNP:1134378
4716 4716 a, c dbSNP:184319601
4740 4740 -, aa dbSNP:35141835
4767 4767 c, t dbSNP:193285351
4830 4830 c, t dbSNP:552947804
4834 4834 a, g dbSNP:745527516
4840 4840 a, t dbSNP:539718709
4884 4884 c, t dbSNP:146242536
4909 4909 -, gat dbSNP:554238799
4912 4912 c, g dbSNP:556725165
4946 4946 c, t dbSNP:188681362
4956 4956 a, c dbSNP:182949932
4970 4970 a, g dbSNP:554966272
5028 5028 a, g dbSNP:141777702
5059 5059 c, t dbSNP:191933456
5060 5060 a, g dbSNP:552633402
5096 5096 a, g dbSNP:75002598
5135 5135 a, g dbSNP:78681557
5165 5165 a, c, t dbSNP:377639670
5169 5169 c, g, t dbSNP:374276626
5189 5189 c, t dbSNP:8008405
5193 5193 -, aa dbSNP:11451253
5203 5203 -, atat dbSNP:397970086
5203 5203 a, t dbSNP:775080758
5204 5204 -, a, aaaa, at dbSNP:61461391
5205 5205 -, tatat dbSNP:770619918
5205 5205 -, tat dbSNP:371762976
5205 5205 a, t dbSNP:11621770
5205 5205 -, t dbSNP:386419521
5207 5207 -, tat dbSNP:777952246
5207 5207 a, t dbSNP:34351382
5207 5207 -, t dbSNP:757192263
5209 5209 -, t dbSNP:367664867
5222 5222 -, atat dbSNP:376316878
5222 5222 -, at dbSNP:753004854
5222 5222 a, g dbSNP:138868478
5224 5224 -, at dbSNP:751303682
5224 5224 a, g dbSNP:149006887
5230 5230 a, g dbSNP:199894637
5231 5231 -, gt dbSNP:200238931
5241 5241 -, at dbSNP:201691672
5365 5365 a, c dbSNP:528123223
5390 5390 a, c dbSNP:8009456
5406 5406 c, g dbSNP:182375232
5415 5415 a, g dbSNP:576705676
5492 5492 a, g dbSNP:556760089
5530 5530 c, t dbSNP:543180973
5567 5567 a, g dbSNP:574887239
5570 5570 g, t dbSNP:554810577
5576 5576 g, t dbSNP:535108713
5579 5579 g, t dbSNP:67089639
5641 5641 -, cttt dbSNP:760008124
5642 5642 -, cttt dbSNP:367993031
5642 5642 -, ctt dbSNP:748105188
5642 5642 c, t dbSNP:200134701
5646 5646 c, t dbSNP:558890121
5652 5652 -, tttt dbSNP:779811232
5655 5655 c, t dbSNP:191168297
5662 5662 c, t dbSNP:112733683
5704 5704 a, g dbSNP:550405473
5708 5708 -, t dbSNP:112537858
5735 5735 a, g dbSNP:141847020
5742 5742 c, t dbSNP:186244206
5743 5743 a, g, t dbSNP:569604127
5756 5756 c, t dbSNP:147968987
5759 5759 c, t dbSNP:531937444
5812 5812 -, t dbSNP:398118522
5819 5819 -, t dbSNP:145205040
5820 5820 -, t, tt dbSNP:552780970
5872 5872 a, g dbSNP:765615691
5900 5900 c, g dbSNP:759738968
5932 5932 c, t dbSNP:182487175
5933 5933 a, g dbSNP:776908103
5938 5938 g, t dbSNP:770993613
5986 5986 c, t dbSNP:760852869
6063 6063 c, t dbSNP:773379500
6076 6076 a, g dbSNP:116994678
6104 6104 c, t dbSNP:749214501
6142 6142 a, t dbSNP:532290325
6152 6152 c, t dbSNP:769626047
6160 6160 c, g dbSNP:192385527
6172 6172 -, ataaaaata dbSNP:781437447
6202 6202 -, atga dbSNP:369630957
6202 6202 a, g dbSNP:9652396
6206 6206 a, g dbSNP:10151945
6223 6223 c, t dbSNP:751097712
6237 6237 a, g dbSNP:554732515
6257 6257 c, t dbSNP:74244591
6296 6296 c, g dbSNP:541880574
6338 6338 g, t dbSNP:758956940
6348 6348 a, g dbSNP:8022758
6368 6368 c, t dbSNP:144799309
6400 6400 a, g dbSNP:765591204
6517 6517 -, t dbSNP:58982263
6529 6529 -, t dbSNP:762458117
6543 6543 a, g dbSNP:73323741
6564 6564 -, tcta dbSNP:552042048
6583 6583 g, t dbSNP:151053179
6645 6645 c, g dbSNP:537593516
6674 6674 c, t dbSNP:1047795
6689 6689 a, g dbSNP:142874189
6708 6708 a, g dbSNP:567800167
6715 6715 c, t dbSNP:766647421
6731 6731 a, g dbSNP:760946854
6732 6732 a, g dbSNP:773473590
6733 6733 c, t dbSNP:74071833
6751 6751 c, g dbSNP:534442386
6777 6777 c, t dbSNP:565734430
6781 6781 -, caca dbSNP:549867277
6782 6782 a, c dbSNP:767691121
6791 6791 a, c dbSNP:763050363
6802 6802 a, g dbSNP:775498557
6837 6837 a, t dbSNP:769557211
6854 6854 g, t dbSNP:564884511
6855 6855 c, t dbSNP:148498078
6859 6859 c, g dbSNP:186327684
6860 6860 a, t dbSNP:562933608

Target ORF information:

RefSeq Version NM_004993
Organism Homo sapiens (human)
Definition Homo sapiens ataxin 3 (ATXN3), transcript variant reference, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_004993

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
ATGGAGTCCA TCTTCCACGA GAAACAAGAA GGCTCACTTT GTGCTCAACA TTGCCTGAAT 
AACTTATTGC AAGGAGAATA TTTTAGCCCT GTGGAATTAT CCTCAATTGC ACATCAGCTG
GATGAGGAGG AGAGGATGAG AATGGCAGAA GGAGGAGTTA CTAGTGAAGA TTATCGCACG
TTTTTACAGC AGCCTTCTGG AAATATGGAT GACAGTGGTT TTTTCTCTAT TCAGGTTATA
AGCAATGCCT TGAAAGTTTG GGGTTTAGAA CTAATCCTGT TCAACAGTCC AGAGTATCAG
AGGCTCAGGA TCGATCCTAT AAATGAAAGA TCATTTATAT GCAATTATAA GGAACACTGG
TTTACAGTTA GAAAATTAGG AAAACAGTGG TTTAACTTGA ATTCTCTCTT GACGGGTCCA
GAATTAATAT CAGATACATA TCTTGCACTT TTCTTGGCTC AATTACAACA GGAAGGTTAT
TCTATATTTG TCGTTAAGGG TGATCTGCCA GATTGCGAAG CTGACCAACT CCTGCAGATG
ATTAGGGTCC AACAGATGCA TCGACCAAAA CTTATTGGAG AAGAATTAGC ACAACTAAAA
GAGCAAAGAG TCCATAAAAC AGACCTGGAA CGAGTGTTAG AAGCAAATGA TGGCTCAGGA
ATGTTAGACG AAGATGAGGA GGATTTGCAG AGGGCTCTGG CACTAAGTCG CCAAGAAATT
GACATGGAAG ATGAGGAAGC AGATCTCCGC AGGGCTATTC AGCTAAGTAT GCAAGGTAGT
TCCAGAAACA TATCTCAAGA TATGACACAG ACATCAGGTA CAAATCTTAC TTCAGAAGAG
CTTCGGAAGA GACGAGAAGC CTACTTTGAA AAACAGCAGC AAAAGCAGCA ACAGCAGCAG
CAGCAGCAGC AGCAGGGGGA CCTATCAGGA CAGAGTTCAC ATCCATGTGA AAGGCCAGCC
ACCAGTTCAG GAGCACTTGG GAGTGATCTA GGTGATGCTA TGAGTGAAGA AGACATGCTT
CAGGCAGCTG TGACCATGTC TTTAGAAACT GTCAGAAATG ATTTGAAAAC AGAAGGAAAA
AAATAA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21437
Accession Version NM_001164777.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 147bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product ataxin-3 isoform j
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL121773.5 and AL049872.3. Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. Transcript Variant: This variant (j) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform j. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
ATGGAGTCCA TCTTCCACGA GAAACAGCCT TCTGGAAATA TGGATGACAG TGGTTTTTTC 
TCTATTCAGA CAGCAGCAAA AGCAGCAACA GCAGCAGCAG CAGCAGCAGC AGGGGGACCT
ATCAGGACAG AGTTCACATC CATGTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001158249.1
CDS70..216
Misc Feature(1)94..>138(+)
Exon (1)1..93
Gene:ATXN3
Gene Synonym:
Exon (2)94..138
Gene:ATXN3
Gene Synonym:
Exon (3)139..257
Gene:ATXN3
Gene Synonym:
Exon (4)258..6120
Gene:ATXN3
Gene Synonym:
Translation
Position Chain Variation Link
15 15 -, g dbSNP:55970447
24 24 c, g dbSNP:773675927
27 27 a, g dbSNP:373384259
29 29 c, g dbSNP:747774933
30 30 g, t dbSNP:555614052
36 36 a, c, t dbSNP:56331048
39 39 c, t dbSNP:3814834
40 40 a, g, t dbSNP:374699412
41 41 g, t dbSNP:780973227
42 42 c, g, t dbSNP:751439402
43 43 c, g dbSNP:765348620
44 44 a, g dbSNP:755302582
47 47 c, t dbSNP:753922991
51 51 c, t dbSNP:368734521
52 52 a, g dbSNP:761201018
55 55 a, t dbSNP:773864210
56 56 a, c dbSNP:768123597
58 58 a, g dbSNP:762077144
62 62 a, t dbSNP:376741760
63 63 a, c, g dbSNP:768169130
64 64 a, g dbSNP:748959673
66 66 a, t dbSNP:774939813
87 87 c, t dbSNP:769298166
93 93 a, g dbSNP:745440781
96 96 a, g dbSNP:373205243
98 98 c, t dbSNP:200230139
104 104 g, t dbSNP:773405950
128 128 -, t dbSNP:763008544
139 139 -, a dbSNP:748879218
148 148 -, aaa dbSNP:141993435
148 148 -, gc dbSNP:780906123
148 148 a, g dbSNP:12896589
149 149 -, gc dbSNP:754789530
149 149 a, c dbSNP:12896588
157 157 -, acagcagcagcagcagca dbSNP:750329097
157 157 -, acagcagcagca dbSNP:769306267
157 157 -, acagcagca dbSNP:762367488
157 157 -, acagca dbSNP:774699497
157 157 -, aca dbSNP:767957502
157 157 -, g dbSNP:775879957
157 157 a, g dbSNP:12896583
158 158 (cag(8_36)) dbSNP:193922928
163 163 -, tagcagcagcag dbSNP:771525981
163 163 g, t dbSNP:765913054
167 167 a, c dbSNP:759955623
168 168 -, ccagcagcagcagcagca dbSNP:772712821
170 170 c, t dbSNP:777075482
172 172 -, tag dbSNP:758426138
172 172 a, g dbSNP:538529483
174 174 -, agcagcagg dbSNP:767904273
176 176 a, c dbSNP:770449937
177 177 -, agcagg dbSNP:752940647
177 177 -, tcagcagcagcagcagca dbSNP:756295616
177 177 a, g dbSNP:569392621
179 179 c, t dbSNP:772535725
180 180 -, agg dbSNP:759967732
180 180 a, g dbSNP:771553430
181 181 -, cagcagcagcagcagcagcagcagcag dbSNP:763541221
182 182 -, a, c, t dbSNP:763461489
182 182 c, g dbSNP:12895357
183 183 a, g dbSNP:368058740
184 184 a, g dbSNP:747720294
185 185 c, g dbSNP:374646934
190 190 a, g dbSNP:778789395
194 194 a, g dbSNP:768632002
200 200 a, c dbSNP:748990614
203 203 g, t dbSNP:779933798
205 205 a, g dbSNP:757359624
209 209 c, t dbSNP:751821844
219 219 c, g dbSNP:778200373
228 228 c, g, t dbSNP:533268889
240 240 c, g dbSNP:765788785
241 241 a, c dbSNP:139577236
247 247 a, g dbSNP:754084606
249 249 a, g dbSNP:766775924
254 254 c, g dbSNP:151002328
256 256 a, g dbSNP:760999964
266 266 a, g dbSNP:542401270
267 267 c, t dbSNP:749363861
278 278 a, g, t dbSNP:142718363
280 280 c, t dbSNP:750747570
283 283 a, g dbSNP:199942851
310 310 a, g dbSNP:562671116
311 311 c, g dbSNP:751203850
327 327 a, c dbSNP:763724702
330 330 c, t dbSNP:762497293
339 339 a, g dbSNP:774914247
349 349 -, a dbSNP:776239444
350 350 -, t dbSNP:768351340
365 365 -, a dbSNP:746773032
370 370 a, t dbSNP:765179478
374 374 a, g dbSNP:759393936
376 376 a, t dbSNP:776508242
382 382 a, g dbSNP:770831500
388 388 -, c dbSNP:779829271
390 390 a, g dbSNP:746867371
401 401 g, t dbSNP:376064779
402 402 a, g dbSNP:371442064
407 407 g, t dbSNP:574166677
415 415 a, g dbSNP:748481683
443 443 c, g dbSNP:373813370
465 465 a, c, t dbSNP:10151135
466 466 a, g dbSNP:578194188
485 485 a, g dbSNP:376865350
498 498 a, g dbSNP:558382743
503 503 a, g dbSNP:709930
505 505 c, t dbSNP:116338117
506 506 g, t dbSNP:1804683
557 557 g, t dbSNP:756178320
560 560 a, g dbSNP:762685504
629 629 -, c dbSNP:34148613
654 654 c, t dbSNP:555522753
672 672 a, g dbSNP:535967073
679 679 c, t dbSNP:56277345
682 682 c, t dbSNP:567328244
690 690 -, g dbSNP:34431920
711 711 a, t dbSNP:745890873
730 730 a, g dbSNP:777583007
734 734 g, t dbSNP:910369
747 747 a, g dbSNP:140741824
752 752 a, t dbSNP:752468952
838 838 g, t dbSNP:17127901
857 857 c, t dbSNP:78530327
871 871 c, t dbSNP:377668917
872 872 -, g dbSNP:750893431
978 978 a, g dbSNP:17847274
1001 1001 a, g dbSNP:754727174
1003 1003 c, t dbSNP:180896627
1017 1017 c, t dbSNP:55644237
1025 1025 a, g dbSNP:529420712
1029 1029 a, g dbSNP:560592057
1037 1037 a, g dbSNP:529386181
1066 1066 a, g dbSNP:56396823
1181 1181 a, g dbSNP:538312555
1219 1219 a, g dbSNP:115345965
1270 1270 c, t dbSNP:373659686
1271 1271 a, g dbSNP:533409972
1289 1289 g, t dbSNP:772727244
1341 1341 c, t dbSNP:151107245
1458 1458 a, g dbSNP:55966267
1473 1473 c, t dbSNP:762350146
1515 1515 c, t dbSNP:774747355
1521 1521 a, g dbSNP:575509086
1525 1525 a, g dbSNP:755952813
1554 1554 a, g dbSNP:74731246
1557 1557 c, t dbSNP:546260267
1559 1559 a, t dbSNP:529742601
1568 1568 a, g dbSNP:768991623
1576 1576 c, t dbSNP:555559894
1577 1577 a, c dbSNP:375844803
1598 1598 c, t dbSNP:541987773
1613 1613 a, g dbSNP:749575271
1633 1633 a, g dbSNP:573665148
1677 1677 c, t dbSNP:553786504
1690 1690 a, g dbSNP:531956768
1749 1749 a, c dbSNP:74071835
1766 1766 c, g dbSNP:775690573
1786 1786 c, t dbSNP:557771242
1787 1787 a, g dbSNP:538172199
1804 1804 a, g, t dbSNP:142986250
1814 1814 c, t dbSNP:529036679
1823 1823 c, t dbSNP:745959046
1829 1829 c, t dbSNP:61988394
1831 1831 c, t dbSNP:547111329
1908 1908 g, t dbSNP:533250394
1937 1937 a, g dbSNP:564165980
1969 1969 c, t dbSNP:750309656
1976 1976 g, t dbSNP:544170451
1992 1992 c, t dbSNP:531128594
2081 2081 c, t dbSNP:781295503
2090 2090 c, t dbSNP:562006347
2106 2106 a, c dbSNP:542024827
2147 2147 a, g dbSNP:758310971
2175 2175 a, g dbSNP:748079715
2178 2178 a, g dbSNP:148968790
2187 2187 a, g dbSNP:147932464
2252 2252 c, g dbSNP:544031301
2349 2349 c, t dbSNP:55692120
2370 2370 a, c dbSNP:187186734
2407 2407 g, t dbSNP:577644529
2415 2415 -, t dbSNP:145019811
2420 2420 c, t dbSNP:182587249
2421 2421 a, g dbSNP:12433948
2432 2432 a, g dbSNP:569174897
2475 2475 a, g dbSNP:766144891
2490 2490 c, t dbSNP:140811598
2491 2491 a, g dbSNP:535376586
2529 2529 c, t dbSNP:374968114
2579 2579 g, t dbSNP:566690448
2587 2587 a, g dbSNP:8019545
2588 2588 c, t dbSNP:55921125
2598 2598 a, g dbSNP:570576217
2656 2656 c, t dbSNP:550573299
2665 2665 c, t dbSNP:530768711
2666 2666 g, t dbSNP:35041243
2690 2690 c, t dbSNP:149978731
2691 2691 a, g dbSNP:528765879
2701 2701 c, t dbSNP:113070671
2737 2737 g, t dbSNP:762283961
2768 2768 g, t dbSNP:764037942
2778 2778 a, t dbSNP:559924763
2789 2789 a, g dbSNP:752749801
2824 2824 g, t dbSNP:56196346
2868 2868 c, t dbSNP:577684465
2874 2874 -, attg dbSNP:768003087
2900 2900 a, g dbSNP:764515154
3007 3007 a, g dbSNP:763317999
3024 3024 a, c dbSNP:190326858
3039 3039 a, g dbSNP:11628764
3064 3064 c, t dbSNP:769942768
3071 3071 a, g dbSNP:186208016
3178 3178 c, t dbSNP:111461096
3204 3204 c, t dbSNP:375246638
3231 3231 c, t dbSNP:188739788
3263 3263 c, g dbSNP:371606868
3282 3282 a, g dbSNP:546433513
3292 3292 c, t dbSNP:573022747
3293 3293 a, g dbSNP:532483134
3341 3341 c, t dbSNP:560663525
3353 3353 c, t dbSNP:553145415
3392 3392 a, c dbSNP:759893441
3393 3393 -, a dbSNP:776918783
3424 3424 -, t dbSNP:201936460
3496 3496 a, g dbSNP:563148297
3503 3503 a, g dbSNP:771030906
3525 3525 a, g dbSNP:540263466
3576 3576 c, t dbSNP:570617215
3614 3614 a, t dbSNP:574815764
3616 3616 c, t dbSNP:550712214
3617 3617 c, t dbSNP:1055996
3631 3631 c, t dbSNP:184013158
3658 3658 c, t dbSNP:538059127
3666 3666 c, t dbSNP:548266802
3688 3688 c, t dbSNP:150577313
3689 3689 a, g dbSNP:192345523
3705 3705 g, t dbSNP:111357714
3707 3707 g, t dbSNP:552740772
3710 3710 c, t dbSNP:189650643
3711 3711 a, g dbSNP:374782928
3719 3719 a, g dbSNP:112586446
3748 3748 a, c dbSNP:768019941
3785 3785 a, g dbSNP:138165116
3802 3802 a, g dbSNP:3178662
3835 3835 c, t dbSNP:575386049
3838 3838 c, t dbSNP:779866271
3852 3852 acagaggatgcagtgagcca, gcagaggatgcagtgagccg dbSNP:386779980
3852 3852 a, g dbSNP:1134377
3871 3871 a, g dbSNP:1134378
3913 3913 a, c dbSNP:184319601
3937 3937 -, aa dbSNP:35141835
3964 3964 c, t dbSNP:193285351
4027 4027 c, t dbSNP:552947804
4031 4031 a, g dbSNP:745527516
4037 4037 a, t dbSNP:539718709
4081 4081 c, t dbSNP:146242536
4106 4106 -, gat dbSNP:554238799
4109 4109 c, g dbSNP:556725165
4143 4143 c, t dbSNP:188681362
4153 4153 a, c dbSNP:182949932
4167 4167 a, g dbSNP:554966272
4225 4225 a, g dbSNP:141777702
4256 4256 c, t dbSNP:191933456
4257 4257 a, g dbSNP:552633402
4293 4293 a, g dbSNP:75002598
4332 4332 a, g dbSNP:78681557
4362 4362 a, c, t dbSNP:377639670
4366 4366 c, g, t dbSNP:374276626
4386 4386 c, t dbSNP:8008405
4390 4390 -, aa dbSNP:11451253
4400 4400 -, atat dbSNP:397970086
4400 4400 a, t dbSNP:775080758
4401 4401 -, a, aaaa, at dbSNP:61461391
4402 4402 -, tatat dbSNP:770619918
4402 4402 -, tat dbSNP:371762976
4402 4402 a, t dbSNP:11621770
4402 4402 -, t dbSNP:386419521
4404 4404 -, tat dbSNP:777952246
4404 4404 a, t dbSNP:34351382
4404 4404 -, t dbSNP:757192263
4406 4406 -, t dbSNP:367664867
4419 4419 -, atat dbSNP:376316878
4419 4419 -, at dbSNP:753004854
4419 4419 a, g dbSNP:138868478
4421 4421 -, at dbSNP:751303682
4421 4421 a, g dbSNP:149006887
4427 4427 a, g dbSNP:199894637
4428 4428 -, gt dbSNP:200238931
4438 4438 -, at dbSNP:201691672
4562 4562 a, c dbSNP:528123223
4587 4587 a, c dbSNP:8009456
4603 4603 c, g dbSNP:182375232
4612 4612 a, g dbSNP:576705676
4689 4689 a, g dbSNP:556760089
4727 4727 c, t dbSNP:543180973
4764 4764 a, g dbSNP:574887239
4767 4767 g, t dbSNP:554810577
4773 4773 g, t dbSNP:535108713
4776 4776 g, t dbSNP:67089639
4838 4838 -, cttt dbSNP:760008124
4839 4839 -, cttt dbSNP:367993031
4839 4839 -, ctt dbSNP:748105188
4839 4839 c, t dbSNP:200134701
4843 4843 c, t dbSNP:558890121
4849 4849 -, tttt dbSNP:779811232
4852 4852 c, t dbSNP:191168297
4859 4859 c, t dbSNP:112733683
4901 4901 a, g dbSNP:550405473
4905 4905 -, t dbSNP:112537858
4932 4932 a, g dbSNP:141847020
4939 4939 c, t dbSNP:186244206
4940 4940 a, g, t dbSNP:569604127
4953 4953 c, t dbSNP:147968987
4956 4956 c, t dbSNP:531937444
5009 5009 -, t dbSNP:398118522
5016 5016 -, t dbSNP:145205040
5017 5017 -, t, tt dbSNP:552780970
5069 5069 a, g dbSNP:765615691
5097 5097 c, g dbSNP:759738968
5129 5129 c, t dbSNP:182487175
5130 5130 a, g dbSNP:776908103
5135 5135 g, t dbSNP:770993613
5183 5183 c, t dbSNP:760852869
5260 5260 c, t dbSNP:773379500
5273 5273 a, g dbSNP:116994678
5301 5301 c, t dbSNP:749214501
5339 5339 a, t dbSNP:532290325
5349 5349 c, t dbSNP:769626047
5357 5357 c, g dbSNP:192385527
5369 5369 -, ataaaaata dbSNP:781437447
5399 5399 -, atga dbSNP:369630957
5399 5399 a, g dbSNP:9652396
5403 5403 a, g dbSNP:10151945
5420 5420 c, t dbSNP:751097712
5434 5434 a, g dbSNP:554732515
5454 5454 c, t dbSNP:74244591
5493 5493 c, g dbSNP:541880574
5535 5535 g, t dbSNP:758956940
5545 5545 a, g dbSNP:8022758
5565 5565 c, t dbSNP:144799309
5597 5597 a, g dbSNP:765591204
5714 5714 -, t dbSNP:58982263
5726 5726 -, t dbSNP:762458117
5740 5740 a, g dbSNP:73323741
5761 5761 -, tcta dbSNP:552042048
5780 5780 g, t dbSNP:151053179
5842 5842 c, g dbSNP:537593516
5871 5871 c, t dbSNP:1047795
5886 5886 a, g dbSNP:142874189
5905 5905 a, g dbSNP:567800167
5912 5912 c, t dbSNP:766647421
5928 5928 a, g dbSNP:760946854
5929 5929 a, g dbSNP:773473590
5930 5930 c, t dbSNP:74071833
5948 5948 c, g dbSNP:534442386
5974 5974 c, t dbSNP:565734430
5978 5978 -, caca dbSNP:549867277
5979 5979 a, c dbSNP:767691121
5988 5988 a, c dbSNP:763050363
5999 5999 a, g dbSNP:775498557
6034 6034 a, t dbSNP:769557211
6051 6051 g, t dbSNP:564884511
6052 6052 c, t dbSNP:148498078
6056 6056 c, g dbSNP:186327684
6057 6057 a, t dbSNP:562933608

Target ORF information:

RefSeq Version NM_001164777
Organism Homo sapiens (human)
Definition Homo sapiens ataxin 3 (ATXN3), transcript variant j, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001164777

ORF Insert Sequence:

1
61
121
ATGGAGTCCA TCTTCCACGA GAAACAGCCT TCTGGAAATA TGGATGACAG TGGTTTTTTC 
TCTATTCAGA CAGCAGCAAA AGCAGCAACA GCAGCAGCAG CAGCAGCAGC AGGGGGACCT
ATCAGGACAG AGTTCACATC CATGTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu22357
Accession Version NM_001164780.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 549bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product ataxin-3 isoform u
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL121773.5 and AL049872.3. Summary: Machado-Joseph disease, also known as spinocerebellar ataxia-3, is an autosomal dominant neurologic disorder. The protein encoded by this gene contains (CAG)n repeats in the coding region, and the expansion of these repeats from the normal 13-36 to 68-79 is one cause of Machado-Joseph disease. There is a negative correlation between the age of onset and CAG repeat numbers. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2009]. Transcript Variant: This variant (u) is one of several transcript variants described in figure 2 of Bettencourt et al. (PMID: 19714377). This variant encodes isoform u. PMID:19714377 predicts that this is a noncoding transcript, but there is a downstream orf that may encode a protein identical to the C-terminus of the reference isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC022245.1, AK225884.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
ATGATTAGGG TCCAACAGAT GCATCGACCA AAACTTATTG GAGAAGAATT AGCACAACTA 
AAAGAGCAAA GAGTCCATAA AACAGACCTG GAACGAGTGT TAGAAGCAAA TGATGGCTCA
GGAATGTTAG ACGAAGATGA GGAGGATTTG CAGAGGGCTC TGGCACTAAG TCGCCAAGAA
ATTGACATGG AAGATGAGGA AGCAGATCTC CGCAGGGCTA TTCAGCTAAG TATGCAAGGT
AGTTCCAGAA ACATATCTCA AGATATGACA CAGACATCAG GTACAAATCT TACTTCAGAA
GAGCTTCGGA AGAGACGAGA AGCCTACTTT GAAAAACAGC AGCAAAAGCA GCAACAGCAG
CAGCAGCAGC AGCAGCAGGG GGACCTATCA GGACAGAGTT CACATCCATG TGAAAGGCCA
GCCACCAGTT CAGGAGCACT TGGGAGTGAT CTAGGTGATG CTATGAGTGA AGAAGACATG
CTTCAGGCAG CTGTGACCAT GTCTTTAGAA ACTGTCAGAA ATGATTTGAA AACAGAAGGA
AAAAAATAA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001158252.1
CDS311..859
Misc Feature(1)65..67(+)
Misc Feature(2)647..688(+)
Exon (1)1..93
Gene:ATXN3
Gene Synonym:
Exon (2)94..160
Gene:ATXN3
Gene Synonym:
Exon (3)161..248
Gene:ATXN3
Gene Synonym:
Exon (4)249..381
Gene:ATXN3
Gene Synonym:
Exon (5)382..548
Gene:ATXN3
Gene Synonym:
Exon (6)549..645
Gene:ATXN3
Gene Synonym:
Exon (7)646..764
Gene:ATXN3
Gene Synonym:
Exon (8)765..6627
Gene:ATXN3
Gene Synonym:
Translation
Position Chain Variation Link
15 15 -, g dbSNP:55970447
24 24 c, g dbSNP:773675927
27 27 a, g dbSNP:373384259
29 29 c, g dbSNP:747774933
30 30 g, t dbSNP:555614052
36 36 a, c, t dbSNP:56331048
39 39 c, t dbSNP:3814834
40 40 a, g, t dbSNP:374699412
41 41 g, t dbSNP:780973227
42 42 c, g, t dbSNP:751439402
43 43 c, g dbSNP:765348620
44 44 a, g dbSNP:755302582
47 47 c, t dbSNP:753922991
51 51 c, t dbSNP:368734521
52 52 a, g dbSNP:761201018
55 55 a, t dbSNP:773864210
56 56 a, c dbSNP:768123597
58 58 a, g dbSNP:762077144
62 62 a, t dbSNP:376741760
63 63 a, c, g dbSNP:768169130
64 64 a, g dbSNP:748959673
66 66 a, t dbSNP:774939813
87 87 c, t dbSNP:769298166
93 93 a, g dbSNP:745440781
98 98 a, g dbSNP:772732276
99 99 a, g dbSNP:771793716
106 106 a, g dbSNP:747586178
120 120 a, t dbSNP:778421428
130 130 c, g dbSNP:754873504
132 132 g, t dbSNP:749230434
139 139 a, g dbSNP:200356462
140 140 a, g dbSNP:759456959
166 166 c, t dbSNP:781063243
170 170 a, t dbSNP:758482810
178 178 c, t dbSNP:752981470
179 179 c, t dbSNP:144152152
181 181 c, t dbSNP:755104001
186 186 c, t dbSNP:754007849
187 187 a, g dbSNP:780604497
188 188 g, t dbSNP:766771475
210 210 c, t dbSNP:761263261
213 213 a, g dbSNP:577858011
219 219 a, c dbSNP:750717644
221 221 c, t dbSNP:767933266
230 230 a, g dbSNP:761316840
235 235 a, g dbSNP:773982221
255 255 c, g dbSNP:200118135
257 257 a, g dbSNP:777729152
265 265 c, t dbSNP:16999141
281 281 c, t dbSNP:749523391
287 287 c, t dbSNP:779942460
289 289 c, t dbSNP:748191546
290 290 a, g dbSNP:750538982
302 302 c, t dbSNP:781702814
304 304 c, g dbSNP:139050721
312 312 a, t dbSNP:751874751
314 314 a, g dbSNP:374466872
316 316 a, t dbSNP:150738718
319 319 a, g dbSNP:562189056
325 325 -, a dbSNP:778230305
332 332 c, t dbSNP:752379583
333 333 a, g dbSNP:764865705
335 335 c, g dbSNP:759055604
336 336 a, g dbSNP:776051012
343 343 a, g dbSNP:202119840
356 356 a, g dbSNP:141672872
363 363 c, t dbSNP:560161051
370 370 a, g dbSNP:201241311
379 379 a, g dbSNP:748016235
405 405 a, g dbSNP:138404351
407 407 a, g dbSNP:1048755
409 409 a, g dbSNP:773271553
414 414 a, g dbSNP:752168522
415 415 a, g, t dbSNP:142148800
417 417 c, t dbSNP:774064667
418 418 a, g dbSNP:770009219
422 422 c, g dbSNP:746109327
423 423 a, t dbSNP:75188275
430 430 a, c dbSNP:770983214
432 432 a, g dbSNP:747156311
442 442 c, t dbSNP:371037244
443 443 a, g dbSNP:377574592
445 445 a, c dbSNP:148366775
453 453 a, g dbSNP:779172677
454 454 -, gga dbSNP:777522387
455 455 c, g dbSNP:754590483
466 466 -, ggctctggc dbSNP:755842617
475 475 a, g dbSNP:201012097
482 482 a, c, t dbSNP:548763388
483 483 a, g dbSNP:199876727
491 491 a, g dbSNP:199790369
495 495 a, g dbSNP:200483057
496 496 c, t dbSNP:143402326
497 497 a, g dbSNP:767543973
498 498 c, t dbSNP:761679000
502 502 a, g dbSNP:201553525
508 508 c, g dbSNP:751329134
520 520 c, t dbSNP:763802729
521 521 c, t dbSNP:759748483
522 522 a, g dbSNP:776828308
524 524 a, g dbSNP:149131253
526 526 a, g dbSNP:771181207
530 530 a, c dbSNP:760721207
544 544 a, g dbSNP:773301187
559 559 a, c dbSNP:764156853
562 562 c, g dbSNP:762622537
570 570 a, g dbSNP:752537367
573 573 a, t dbSNP:766538029
577 577 a, g dbSNP:760915098
585 585 c, g dbSNP:773204962
590 590 a, g dbSNP:772056412
599 599 c, g dbSNP:762007434
605 605 g, t dbSNP:774718180
617 617 c, t dbSNP:377031212
618 618 a, g dbSNP:145210459
627 627 a, g dbSNP:147058331
634 634 a, c dbSNP:3204346
639 639 c, t dbSNP:780591975
646 646 -, a dbSNP:748879218
655 655 -, aaa dbSNP:141993435
655 655 -, gc dbSNP:780906123
655 655 a, g dbSNP:12896589
656 656 -, gc dbSNP:754789530
656 656 a, c dbSNP:12896588
664 664 -, acagcagcagcagcagca dbSNP:750329097
664 664 -, acagcagcagca dbSNP:769306267
664 664 -, acagcagca dbSNP:762367488
664 664 -, acagca dbSNP:774699497
664 664 -, aca dbSNP:767957502
664 664 -, g dbSNP:775879957
664 664 a, g dbSNP:12896583
665 665 (cag(8_36)) dbSNP:193922928
670 670 -, tagcagcagcag dbSNP:771525981
670 670 g, t dbSNP:765913054
674 674 a, c dbSNP:759955623
675 675 -, ccagcagcagcagcagca dbSNP:772712821
677 677 c, t dbSNP:777075482
679 679 -, tag dbSNP:758426138
679 679 a, g dbSNP:538529483
681 681 -, agcagcagg dbSNP:767904273
683 683 a, c dbSNP:770449937
684 684 -, agcagg dbSNP:752940647
684 684 -, tcagcagcagcagcagca dbSNP:756295616
684 684 a, g dbSNP:569392621
686 686 c, t dbSNP:772535725
687 687 -, agg dbSNP:759967732
687 687 a, g dbSNP:771553430
688 688 -, cagcagcagcagcagcagcagcagcag dbSNP:763541221
689 689 -, a, c, t dbSNP:763461489
689 689 c, g dbSNP:12895357
690 690 a, g dbSNP:368058740
691 691 a, g dbSNP:747720294
692 692 c, g dbSNP:374646934
697 697 a, g dbSNP:778789395
701 701 a, g dbSNP:768632002
707 707 a, c dbSNP:748990614
710 710 g, t dbSNP:779933798
712 712 a, g dbSNP:757359624
716 716 c, t dbSNP:751821844
726 726 c, g dbSNP:778200373
735 735 c, g, t dbSNP:533268889
747 747 c, g dbSNP:765788785
748 748 a, c dbSNP:139577236
754 754 a, g dbSNP:754084606
756 756 a, g dbSNP:766775924
761 761 c, g dbSNP:151002328
763 763 a, g dbSNP:760999964
773 773 a, g dbSNP:542401270
774 774 c, t dbSNP:749363861
785 785 a, g, t dbSNP:142718363
787 787 c, t dbSNP:750747570
790 790 a, g dbSNP:199942851
817 817 a, g dbSNP:562671116
818 818 c, g dbSNP:751203850
834 834 a, c dbSNP:763724702
837 837 c, t dbSNP:762497293
846 846 a, g dbSNP:774914247
856 856 -, a dbSNP:776239444
857 857 -, t dbSNP:768351340
872 872