Home » Species Summary » Homo sapiens » MLH1 cDNA ORF clone
Email to GenScript

MLH1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MLH1
Entrez Gene ID 4292
Full Name mutL homolog 1
Synonyms COCA2, FCC2, HNPCC, HNPCC2, hMLH1
General protein information
Preferred Names
DNA mismatch repair protein Mlh1
DNA mismatch repair protein Mlh1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, hereditary nonpolyposis, type 2, 609310 (3);

mRNA and Protein(s)

mRNA Protein Name
XM_005265161 XP_005265218 DNA mismatch repair protein Mlh1 isoform X2
XM_005265163 XP_005265220 DNA mismatch repair protein Mlh1 isoform X1
XM_005265164 XP_005265221 DNA mismatch repair protein Mlh1 isoform X1
XM_005265166 XP_005265223 DNA mismatch repair protein Mlh1 isoform X3
XM_011533727 XP_011532029 DNA mismatch repair protein Mlh1 isoform X4
NM_001258274 NP_001245203 DNA mismatch repair protein Mlh1 isoform 3
NM_001258271 NP_001245200 DNA mismatch repair protein Mlh1 isoform 4
NM_001258273 NP_001245202 DNA mismatch repair protein Mlh1 isoform 3
NM_000249 NP_000240 DNA mismatch repair protein Mlh1 isoform 1
NM_001167617 NP_001161089 DNA mismatch repair protein Mlh1 isoform 2
NM_001167618 NP_001161090 DNA mismatch repair protein Mlh1 isoform 3
NM_001167619 NP_001161091 DNA mismatch repair protein Mlh1 isoform 3

hsa03430 Mismatch repair
hsa05213 Endometrial cancer
hsa05210 Colorectal cancer
hsa05200 Pathways in cancer
hsa03460 Fanconi anemia pathway
hsa_M00295 BRCA1-associated genome surveillance complex (BASC)
R-HSA-1640170 Cell Cycle
R-HSA-1500620 Meiosis
R-HSA-912446 Meiotic recombination
R-HSA-5358565 Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha)
R-HSA-73894 DNA Repair
R-HSA-5358508 Mismatch Repair
R-HSA-5358606 Mismatch repair (MMR) directed by MSH2:MSH3 (MutSbeta)
Pathway Interaction Database
p53downstreampathway Direct p53 effectors
WP34 Ovarian Infertility Genes
WP531 Mismatch repair

Homo sapiens (human) MLH1 NP_000240.1
Pan troglodytes (chimpanzee) MLH1 XP_001170433.1
Canis lupus familiaris (dog) MLH1 XP_534219.2
Bos taurus (cattle) MLH1 NP_001069462.2
Mus musculus (house mouse) Mlh1 NP_081086.2
Rattus norvegicus (Norway rat) Mlh1 NP_112315.1
Gallus gallus (chicken) MLH1 XP_418828.1
Danio rerio (zebrafish) mlh1 NP_956953.1
Drosophila melanogaster (fruit fly) Mlh1 NP_477022.1
Arabidopsis thaliana (thale cress) MLH1 NP_567345.2
Xenopus (Silurana) tropicalis (western clawed frog) mlh1 XP_002933455.2


ID Name Evidence
GO:0000795 synaptonemal complex ISS
GO:0001673 male germ cell nucleus IEA
GO:0005634 nucleus IC
GO:0005712 chiasma ISS
GO:0032389 MutLalpha complex ISS
GO:0032390 MutLbeta complex ISS


ID Name Evidence
GO:0003697 single-stranded DNA binding IDA
GO:0005515 protein binding IPI
GO:0005515 protein binding IPI
GO:0005524 ATP binding IEA
GO:0016887 ATPase activity ISS
GO:0030983 mismatched DNA binding ISS
GO:0032137 guanine/thymine mispair binding IEA
GO:0032407 MutSalpha complex binding IDA


ID Name Evidence
GO:0000239 pachytene IEA
GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening IEA
GO:0000712 resolution of meiotic recombination intermediates IEA
GO:0006200 ATP catabolic process ISS
GO:0006298 mismatch repair ISS
GO:0006303 double-strand break repair via nonhomologous end joining IEA
GO:0007049 cell cycle IEA
GO:0007060 male meiosis chromosome segregation IEA
GO:0007131 reciprocal meiotic recombination ISS
GO:0007283 spermatogenesis IEA
GO:0008630 DNA damage response, signal transduction resulting in induction of apoptosis IEA
GO:0016446 somatic hypermutation of immunoglobulin genes ISS
GO:0043060 meiotic metaphase I plate congression IEA
GO:0045190 isotype switching IEA
GO:0045950 negative regulation of mitotic recombination IEA
GO:0048477 oogenesis IEA
GO:0051257 spindle midzone assembly involved in meiosis IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following MLH1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MLH1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu37255 XM_005265161 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
XM_005265163 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
XM_005265164 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu37256 XM_005265166 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
OHu58984 XM_011533727 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319.00
NM_001258274 Homo sapiens mutL homolog 1 (MLH1), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu27476 NM_001258271 Homo sapiens mutL homolog 1 (MLH1), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
NM_001258273 Homo sapiens mutL homolog 1 (MLH1), transcript variant 6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Quote Price
OHu27066 NM_001167617 Homo sapiens mutL homolog 1 (MLH1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379.00
NM_001167618 Homo sapiens mutL homolog 1 (MLH1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_001167619 Homo sapiens mutL homolog 1 (MLH1), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu37255
Accession Version XM_005265161.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2064bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Mlh1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)104..826(+)
Misc Feature(2)179..454(+)
Misc Feature(3)188..454(+)
Misc Feature(4)200..202(+)
Misc Feature(5)281..397(+)
Misc Feature(6)767..886(+)
Misc Feature(7)812..814(+)
Position Chain Variation Link
3 3 a, g dbSNP:558051715
8 8 a, t dbSNP:569951848
10 10 a, c dbSNP:753530414
25 25 g, t dbSNP:587779030
36 36 g, t dbSNP:587779020
42 42 a, c dbSNP:565334844
45 45 g, t dbSNP:753503730
46 46 c, t dbSNP:587781459
47 47 c, t dbSNP:41285097
48 48 a, g dbSNP:527826980
52 52 a, g dbSNP:749884419
53 53 a, g dbSNP:757995494
55 55 a, c, g dbSNP:780702356
56 56 g, t dbSNP:201247839
57 57 -, t dbSNP:747856324
59 59 a, c dbSNP:781364168
61 61 a, c, g, t dbSNP:56198082
62 62 a, c, t dbSNP:587779001
67 67 c, t dbSNP:771060933
68 68 c, t dbSNP:775371644
69 69 c, t dbSNP:760575557
74 74 c, t dbSNP:764112241
75 75 c, t dbSNP:730881744
77 77 c, t dbSNP:730881745
78 78 c, t dbSNP:776898290
81 81 g, t dbSNP:761672073
82 82 c, t dbSNP:104894994
89 89 a, g dbSNP:587778967
90 90 a, c, g, t dbSNP:111052004
91 91 a, g dbSNP:72481822
93 93 a, c, t dbSNP:587779029
94 94 c, g dbSNP:757950578
97 97 -, c dbSNP:63750745
97 97 c, g dbSNP:779759678
103 103 -, aggggttattcggc dbSNP:63751891
106 106 -, ggttattcggcggctgg dbSNP:63751892
106 106 a, g dbSNP:786202312
107 107 -, gttattcggcggctgga dbSNP:267607702
107 107 g, t dbSNP:730881746
108 108 g, t dbSNP:755402059
109 109 c, t dbSNP:781725830
110 110 -, a dbSNP:587778996
112 112 a, t dbSNP:748406142
113 113 c, t dbSNP:587779000
115 115 a, g, t dbSNP:759680369
117 117 a, g dbSNP:777971423
119 119 -, c dbSNP:63749816
122 122 a, g dbSNP:749548566
124 124 c, g dbSNP:587782181
125 125 a, g, t dbSNP:587779008
125 125 -, g dbSNP:63750081
126 126 -, ccca dbSNP:63750057
127 127 a, g dbSNP:1800143
128 128 -, ga dbSNP:587779013
129 129 c, t dbSNP:774363593
130 130 a, c dbSNP:369737664
132 132 -, t dbSNP:63751131
133 133 c, g dbSNP:768409958
134 134 c, g dbSNP:776643257
139 139 c, t dbSNP:761498953
140 140 -, c dbSNP:63749804
140 140 c, g, t dbSNP:367654552
143 143 a, t dbSNP:63750648
145 145 c, t dbSNP:762647509
149 149 -, g dbSNP:63750581
150 150 a, c, t dbSNP:63750706
153 153 c, g dbSNP:41295280
155 155 a, g, t dbSNP:63750823
155 155 -, g dbSNP:63750822
156 156 a, g dbSNP:750969880
157 157 a, g, t dbSNP:63750555
158 158 -, g dbSNP:63751396
159 159 g, t dbSNP:754533438
161 161 -, a dbSNP:63749839
161 161 a, t dbSNP:63749838
162 162 c, t dbSNP:63750514
163 163 c, t dbSNP:753317868
164 164 -, c dbSNP:63749828
164 164 c, t dbSNP:63749827
166 166 -, g dbSNP:587779040
167 167 c, t dbSNP:756398627
168 168 a, c, g dbSNP:138705565
171 171 c, t dbSNP:63750792
172 172 -, a dbSNP:587779045
173 173 g, t dbSNP:63750656
174 174 c, g dbSNP:63750216
179 179 gc, tg dbSNP:63749994
179 179 g, t dbSNP:749671520
180 180 c, g dbSNP:730882127
182 182 a, g dbSNP:2020872
189 189 a, c dbSNP:63750044
190 190 -, ga dbSNP:63749813
190 190 c, g dbSNP:745876152
192 192 -, aa dbSNP:587778882
192 192 ac, tg dbSNP:121912965
192 192 g, t dbSNP:63749906
194 194 -, aa dbSNP:63750371
194 194 a, g dbSNP:772251284
195 195 a, c, t dbSNP:267607707
196 196 c, g, t dbSNP:730881747
197 197 a, g, t dbSNP:63751012
200 200 a, c, g dbSNP:63750580
201 201 a, g dbSNP:587778888
202 202 c, g dbSNP:267607706
203 203 c, t dbSNP:587778890
204 204 a, g, t dbSNP:63751701
207 207 -, t dbSNP:587778896
209 209 c, g dbSNP:267607713
210 210 a, g dbSNP:63751094
213 213 c, g, t dbSNP:587778901
217 217 -, a dbSNP:63750867
218 218 g, t dbSNP:63750939
219 219 -, aatc dbSNP:63751431
219 219 c, t dbSNP:63751109
221 221 acaagta, tgtt dbSNP:587778904
222 222 c, g dbSNP:759287108
224 224 a, g dbSNP:771649701
225 225 g, t dbSNP:63749833
230 230 c, t dbSNP:587778913
231 231 a, c dbSNP:587778914
232 232 a, c dbSNP:147342421
233 233 a, g dbSNP:760185532
234 234 a, t dbSNP:63750098
238 238 -, t dbSNP:63749956
241 241 -, t dbSNP:587778922
242 242 -, aaag dbSNP:267607714
242 242 a, t dbSNP:63751401
243 243 -, aaga dbSNP:587778923
243 243 -, aa dbSNP:730881733
244 244 -, a dbSNP:63750028
244 244 -, a dbSNP:587778927
245 245 g, t dbSNP:63751199
246 246 a, c dbSNP:63750263
249 249 -, gagg dbSNP:587778932
249 249 a, g dbSNP:63751267
249 249 -, g dbSNP:63751266
256 256 g, t dbSNP:764529553
257 257 a, c, t dbSNP:63750877
258 258 a, c dbSNP:587779955
262 262 a, g dbSNP:762162504
263 263 -, a dbSNP:587778944
268 268 a, g dbSNP:63751398
272 272 a, c, t dbSNP:63751428
275 275 a, g dbSNP:63750850
277 277 a, c, t dbSNP:587778955
278 278 -, aa dbSNP:63750469
279 279 -, a dbSNP:63751255
279 279 a, g dbSNP:63750952
282 282 a, g dbSNP:63751465
283 283 -, c dbSNP:267607715
286 286 -, c dbSNP:587778966
286 286 c, t dbSNP:61751642
287 287 a, g, t dbSNP:63750206
288 288 a, g dbSNP:63749939
289 289 -, g dbSNP:587778968
290 290 a, g dbSNP:63750452
291 291 a, t dbSNP:63750281
292 292 c, g dbSNP:780141938
293 293 -, a dbSNP:63751704
293 293 a, g dbSNP:63750719
294 294 a, g dbSNP:63751661
297 297 -, aagaaga dbSNP:730881734
298 298 -, agaa dbSNP:267607723
298 298 a, c dbSNP:63751191
299 299 -, gaa dbSNP:267607724
299 299 c, g, t dbSNP:63749829
301 301 -, aga dbSNP:63751642
304 304 c, t dbSNP:63750621
305 305 c, g dbSNP:766608278
306 306 c, g, t dbSNP:397514684
307 307 a, g dbSNP:587778988
309 309 a, t dbSNP:751894165
310 310 c, t dbSNP:755073786
316 316 a, g dbSNP:767750489
317 317 c, t dbSNP:63749859
318 318 a, g dbSNP:63750437
319 319 -, tg dbSNP:63750052
319 319 a, t dbSNP:63750856
320 320 -, g dbSNP:587778997
323 323 a, c dbSNP:786203362
325 325 g, t dbSNP:752850761
326 326 g, t dbSNP:63749990
327 327 a, t dbSNP:753404814
329 329 a, g dbSNP:786203745
330 330 c, t dbSNP:63751069
331 331 g, t dbSNP:778724501
332 332 -, a dbSNP:267607729
332 332 a, g dbSNP:587778998
333 333 -, cta dbSNP:786202328
333 333 c, t dbSNP:63750005
336 336 g, t dbSNP:587778999
338 338 a, g dbSNP:63750641
341 341 c, t dbSNP:63750659
344 344 c, t dbSNP:63751421
349 349 -, c dbSNP:267607728
349 349 c, t dbSNP:63750923
352 352 g, t dbSNP:182963667
353 353 c, g, t dbSNP:11541859
354 354 a, g dbSNP:758110228
355 355 a, g dbSNP:746705035
360 360 a, t dbSNP:63751137
362 362 c, g dbSNP:63750133
363 363 c, t dbSNP:768132746
365 365 a, g dbSNP:41295282
371 371 g, t dbSNP:63751070
374 374 a, g dbSNP:770276731
378 378 a, g dbSNP:773647920
379 379 a, t dbSNP:63750651
380 380 a, c, g dbSNP:267607725
381 381 -, gctttcgaggtg dbSNP:63751691
385 385 a, t dbSNP:267607730
386 386 c, t dbSNP:63751221
387 387 a, c, g dbSNP:63750266
389 389 a, g dbSNP:267607726
390 390 a, g, t dbSNP:267607727
391 391 g, t dbSNP:4647220
392 392 a, g dbSNP:63750453
394 394 a, c, g, t dbSNP:63751665
395 395 c, g dbSNP:587779003
399 399 a, t dbSNP:63751397
405 405 a, g dbSNP:368208495
406 406 a, c, g dbSNP:63750297
407 407 a, g dbSNP:572906317
408 408 g, t dbSNP:63750507
414 414 a, c dbSNP:587779004
415 415 g, t dbSNP:63749803
419 419 c, g dbSNP:587779005
420 420 c, t dbSNP:63750539
423 423 a, g dbSNP:775914775
426 426 a, t dbSNP:63750559
429 429 -, c dbSNP:63750645
431 431 a, g dbSNP:371667663
432 432 c, t dbSNP:764120517
434 434 -, a dbSNP:267607739
434 434 -, a dbSNP:63750906
434 434 a, g dbSNP:750353040
435 435 a, c, g dbSNP:63750465
438 438 c, g, t dbSNP:63750781
439 439 a, g dbSNP:61751643
440 440 a, c dbSNP:766308335
443 443 -, aa dbSNP:63750658
444 444 -, aa dbSNP:63750841
447 447 c, t dbSNP:267607740
450 450 a, g dbSNP:730881735
455 455 a, t dbSNP:63750542
457 457 a, g dbSNP:754824181
458 458 c, t dbSNP:780816243
459 459 a, g dbSNP:730881736
460 460 -, tg dbSNP:587779006
463 463 a, g dbSNP:1800144
464 464 a, t dbSNP:200076893
465 465 a, g dbSNP:267607741
466 466 -, c dbSNP:63751607
466 466 c, g, t dbSNP:63751606
467 467 a, c dbSNP:587779007
468 468 a, g, t dbSNP:63751595
470 470 gcaagttactcagatggaaaa, t dbSNP:267607746
470 470 c, g dbSNP:63750866
470 470 -, g dbSNP:63750865
473 473 ag, gtt dbSNP:63751710
474 474 a, g dbSNP:755678310
476 476 c, t dbSNP:587779010
476 476 -, t dbSNP:587779009
477 477 -, a dbSNP:587779012
477 477 a, g dbSNP:587779011
480 480 a, c dbSNP:63749818
482 482 c, g dbSNP:28930073
485 485 g, t dbSNP:63751124
491 491 c, g dbSNP:63751052
492 492 -, tgaa dbSNP:587779014
492 492 g, t dbSNP:753233578
497 497 a, g dbSNP:756888142
498 498 c, t dbSNP:63750817
503 503 c, g dbSNP:779562531
508 508 -, a dbSNP:587779015
509 509 c, g dbSNP:63750977
510 510 c, g, t dbSNP:746419577
511 511 a, g dbSNP:201176051
512 512 c, t dbSNP:780232692
516 516 -, c dbSNP:63751045
524 524 c, t dbSNP:63749820
526 526 a, g dbSNP:377279035
527 527 c, g dbSNP:267607747
533 533 c, t dbSNP:63751302
535 535 c, g dbSNP:63750638
537 537 a, t dbSNP:786202495
539 539 -, acg dbSNP:587779016
540 540 c, t dbSNP:776969475
541 541 a, g dbSNP:369521379
542 542 a, g dbSNP:748417604
546 546 a, g dbSNP:770023778
550 550 c, t dbSNP:192938577
551 551 a, c dbSNP:749370894
552 552 g, t dbSNP:63750891
556 556 -, tt dbSNP:267607758
557 557 -, t dbSNP:63751101
559 559 a, c dbSNP:74396541
560 560 a, c dbSNP:63751242
562 562 c, t dbSNP:4647256
563 563 a, g dbSNP:370900909
564 564 c, t dbSNP:775560085
567 567 c, t dbSNP:63749924
570 570 c, t dbSNP:763992299
571 571 a, g dbSNP:776402672
574 574 -, gag dbSNP:587781788
575 575 a, c dbSNP:748500860
576 576 -, g dbSNP:267607754
580 580 a, c dbSNP:765014361
585 585 a, t dbSNP:267607755
585 585 -, t dbSNP:587779018
586 586 a, c dbSNP:267607757
590 590 -, aa dbSNP:267607756
591 591 -, a dbSNP:63749959
594 594 c, t dbSNP:63750834
601 601 -, a dbSNP:63749944
601 601 a, g dbSNP:779148982
604 604 a, g dbSNP:748128054
611 611 -, ag dbSNP:63749799
612 612 -, ga dbSNP:587779019
618 618 c, t dbSNP:758040210
619 619 at, ct, gg dbSNP:63750903
622 622 a, g dbSNP:786202121
623 623 g, t dbSNP:766791816
627 627 -, ttg dbSNP:786201988
627 627 c, g, t dbSNP:63750102
632 632 a, g dbSNP:63750211
633 633 a, g dbSNP:587779021
640 640 a, t dbSNP:35225190
641 641 c, g dbSNP:63750012
642 642 a, g, t dbSNP:63750515
644 644 c, t dbSNP:11541862
646 646 c, t dbSNP:63751050
651 651 c, t dbSNP:777971431
656 656 a, g dbSNP:786202038
660 660 g, t dbSNP:267607766
661 661 c, t dbSNP:754102133
665 665 c, t dbSNP:63751021
666 666 c, g dbSNP:63751480
667 667 a, g dbSNP:587781038
671 671 -, a dbSNP:35847123
674 674 a, t dbSNP:63750500
676 676 -, a dbSNP:63751653
683 683 c, g dbSNP:63749887
684 684 -, ag dbSNP:267607704
685 685 -, ga dbSNP:63751637
689 689 a, c, g dbSNP:534184145
695 695 a, g dbSNP:63750085
696 696 a, t dbSNP:749037674
709 709 a, g dbSNP:770554901
710 710 c, t dbSNP:587781509
714 714 a, c, g dbSNP:150478207
720 720 -, t dbSNP:63750908
722 722 a, g dbSNP:771612764
724 724 c, t dbSNP:138735345
725 725 a, g, t dbSNP:2308317
732 732 a, g dbSNP:267607775
735 735 g, t dbSNP:267607776
737 737 -, c dbSNP:63750380
737 737 c, t dbSNP:4986984
738 738 a, c, g dbSNP:762099920
740 740 c, t dbSNP:750650349
743 743 a, c, g dbSNP:1799977
753 753 -, a dbSNP:63750385
753 753 -, a dbSNP:63751286
753 753 a, g dbSNP:766517126
754 754 g, t dbSNP:751719069
756 756 c, t dbSNP:756045117
760 760 c, t dbSNP:786202912
760 760 -, t dbSNP:587779031
761 761 -, agtc dbSNP:267607774
761 761 a, g dbSNP:587781926
762 762 -, g dbSNP:63749842
764 764 c, t dbSNP:63751615
765 765 a, g, t dbSNP:63751711
768 768 -, t, tcctgacagttt dbSNP:63751620
768 768 c, g, t dbSNP:63750547
769 769 -, tcctgacagttt dbSNP:63751636
769 769 -, a dbSNP:267607809
770 770 a, g, t dbSNP:63750736
778 778 c, t dbSNP:767068637
779 779 a, c dbSNP:752430684
782 782 -, c dbSNP:587779052
782 782 c, t dbSNP:63750489
789 789 a, t dbSNP:267607813
792 792 a, g, t dbSNP:63750993
795 795 -, ttaatgtgcaccccacaaagcatg dbSNP:587779053
798 798 a, g dbSNP:755553895
799 799 a, t dbSNP:587779054
800 800 a, g dbSNP:786202196
803 803 -, gc dbSNP:63750962
806 806 c, t dbSNP:267607808
808 808 a, c, t dbSNP:63749896
809 809 -, a dbSNP:587779055
809 809 a, g dbSNP:779581111
810 810 a, c dbSNP:746206527
811 811 a, c dbSNP:587779056
816 816 -, a dbSNP:63750319
820 820 -, a dbSNP:63751259
824 824 c, t dbSNP:151119913
825 825 a, c dbSNP:786202114
826 826 c, g dbSNP:587779959
830 830 a, c dbSNP:267607814
835 835 a, c, t dbSNP:146777069
835 835 -, c dbSNP:63749926
836 836 a, g, t dbSNP:63750796
841 841 c, g dbSNP:267607811
843 843 a, g, t dbSNP:63750286
852 852 -, agcgggtgc dbSNP:63751404
852 852 -, a dbSNP:587781554
855 855 -, gggtgcagc dbSNP:587779057
855 855 a, g dbSNP:63750268
857 857 a, g dbSNP:730881739
857 857 -, g dbSNP:786204317
858 858 c, t dbSNP:63751049
860 860 c, g dbSNP:587782087
863 863 c, t dbSNP:587779058
865 865 -, gcacatcgagagca dbSNP:587782265
866 866 a, c, t dbSNP:267607810
867 867 a, c dbSNP:63750710
868 868 -, cat dbSNP:267607807
869 869 -, atc dbSNP:63751197
871 871 c, t dbSNP:372578171
872 872 a, g dbSNP:550914672
875 875 -, a dbSNP:63750533
877 877 c, t dbSNP:775167683
884 884 c, t dbSNP:267607812
888 888 a, g dbSNP:587781750
888 888 -, g dbSNP:63750434
891 891 c, g dbSNP:763847201
892 892 -, c dbSNP:63750677
892 892 -, c dbSNP:63750853
894 894 a, g dbSNP:63751467
898 898 -, c dbSNP:63750339
900 900 c, t dbSNP:191257018
901 901 c, g dbSNP:374770981
904 904 -, g dbSNP:63749837
907 907 -, g dbSNP:587778881
915 915 c, t dbSNP:750980386
916 916 c, t dbSNP:758668630
918 918 a, g dbSNP:63751609
919 919 a, c, g, t dbSNP:63751715
921 921 a, c dbSNP:201541505
924 924 c, t dbSNP:755401753
927 927 -, t dbSNP:267607822
931 931 -, a dbSNP:587778883
931 931 a, g dbSNP:137937003
937 937 a, t dbSNP:63750156
939 939 c, t dbSNP:63751265
941 941 a, g dbSNP:752962453
942 942 -, g dbSNP:63750472
943 943 c, t dbSNP:730881748
944 944 c, t dbSNP:756347993
945 945 c, t dbSNP:587782467
948 948 c, t dbSNP:749334262
949 949 -, tggggaga dbSNP:63750038
951 951 g, t dbSNP:730881740
952 952 -, ggagatgg dbSNP:587778884
953 953 -, g dbSNP:587778885
955 955 a, g dbSNP:587780533
957 957 c, t dbSNP:779917781
962 962 a, g dbSNP:786201875
971 971 a, g dbSNP:63749864
976 976 c, g, t dbSNP:746800098
981 981 a, c dbSNP:776402584
982 982 -, c dbSNP:63750715
984 984 c, t dbSNP:201673334
985 985 a, g dbSNP:769364808
988 988 c, t dbSNP:772718909
992 992 a, g dbSNP:762426947
998 998 a, g dbSNP:766904735
999 999 a, g dbSNP:774878513
1003 1003 g, t dbSNP:759868546
1009 1009 -, at dbSNP:730880011
1009 1009 c, t dbSNP:267607824
1010 1010 -, ta dbSNP:63750305
1013 1013 a, gtc dbSNP:587778887
1017 1017 a, c, g, t dbSNP:143009528
1021 1021 c, t dbSNP:786201611
1022 1022 c, t dbSNP:63750557
1025 1025 c, g dbSNP:778315874
1026 1026 -, a dbSNP:587778889
1029 1029 c, t dbSNP:141344760
1031 1031 a, g dbSNP:757350157
1031 1031 -, g dbSNP:63749965
1032 1032 a, t dbSNP:63750447
1034 1034 c, t dbSNP:63750760
1035 1035 a, c, g dbSNP:63750430
1040 1040 a, g dbSNP:781096630
1042 1042 c, t dbSNP:747967333
1044 1044 -, nnnn dbSNP:587778893
1046 1046 a, c, t dbSNP:61751644
1047 1047 a, g dbSNP:63750361
1048 1048 a, g dbSNP:772805767
1052 1052 c, t dbSNP:587778894
1053 1053 a, g dbSNP:587782884
1056 1056 a, g dbSNP:587780678
1059 1059 g, t dbSNP:786203413
1071 1071 -, t dbSNP:63750749
1072 1072 a, g, t dbSNP:35164771
1073 1073 c, g, t dbSNP:63750483
1079 1079 c, g dbSNP:63751485
1081 1081 a, g dbSNP:786203363
1083 1083 a, g dbSNP:587779951
1088 1088 c, t dbSNP:587778897
1091 1091 -, c dbSNP:587778898
1091 1091 -, ct dbSNP:63751015
1096 1096 c, t dbSNP:773869705
1098 1098 a, g dbSNP:41294980
1099 1099 -, t dbSNP:587778900
1104 1104 -, gtcagcc dbSNP:587778899
1106 1106 c, t dbSNP:63751153
1107 1107 a, c, g dbSNP:104895000
1108 1108 c, g dbSNP:775776362
1110 1110 c, t dbSNP:761006237
1111 1111 c, t dbSNP:764377126
1112 1112 a, g dbSNP:535470039
1113 1113 g, t dbSNP:786201951
1117 1117 c, t dbSNP:369576099
1119 1119 c, t dbSNP:63750766
1120 1120 a, g dbSNP:786203274
1124 1124 a, g dbSNP:373767220
1126 1126 g, t dbSNP:750563193
1127 1127 a, g dbSNP:267607823
1133 1133 -, ga dbSNP:63751118
1134 1134 a, g dbSNP:754898711
1135 1135 a, g, t dbSNP:63751440
1136 1136 a, g dbSNP:781335662
1137 1137 c, t dbSNP:377484262
1138 1138 -, ttctagtggcagggcta dbSNP:786203893
1140 1140 c, g dbSNP:63751179
1142 1142 -, a dbSNP:63750293
1142 1142 a, g dbSNP:755898663
1147 1147 c, t dbSNP:63750791
1149 1149 a, g dbSNP:370687064
1150 1150 a, g dbSNP:373076967
1151 1151 a, g dbSNP:377433038
1152 1152 c, g dbSNP:745393750
1157 1157 c, t dbSNP:63750316
1165 1165 c, t dbSNP:772555970
1174 1174 a, g dbSNP:776044212
1176 1176 a, t dbSNP:761070985
1178 1178 c, g dbSNP:63750443
1184 1184 a, c dbSNP:786202922
1185 1185 c, t dbSNP:63751414
1190 1190 c, g dbSNP:587782273
1191 1191 -, c dbSNP:63750748
1202 1202 a, g dbSNP:63750365
1205 1205 a, g dbSNP:761903819
1206 1206 ccaaaaatcagagcttggaggg, nnnnn dbSNP:587778903
1206 1206 c, g dbSNP:765563111
1208 1208 a, c dbSNP:34213726
1212 1212 a, g dbSNP:763189331
1215 1215 -, a dbSNP:63749845
1224 1224 -, a dbSNP:63749981
1225 1225 g, t dbSNP:587779952
1228 1228 ggatacaacaaaggggacttc, taaa dbSNP:587778905
1229 1229 -, g dbSNP:587778906
1229 1229 g, t dbSNP:752622244
1235 1235 -, a dbSNP:63750071
1235 1235 a, t dbSNP:34285587
1240 1240 c, g dbSNP:756099600
1241 1241 c, g dbSNP:63750527
1243 1243 -, g dbSNP:267607821
1243 1243 -, g dbSNP:587778907
1246 1246 a, t dbSNP:753671152
1249 1249 a, g dbSNP:786203279
1251 1251 a, t dbSNP:786203236
1254 1254 a, t dbSNP:63750390
1258 1258 -, a dbSNP:63750020
1258 1258 -, a dbSNP:587778908
1259 1259 a, g dbSNP:756843954
1260 1260 a, c dbSNP:202038499
1261 1261 -, ga dbSNP:587778909
1261 1261 -, t dbSNP:267607697
1262 1262 a, t dbSNP:63750540
1264 1264 c, g, t dbSNP:63751293
1273 1273 c, t dbSNP:63750201
1274 1274 a, g dbSNP:786202986
1279 1279 -, c dbSNP:63750713
1281 1281 a, c, g dbSNP:771610811
1282 1282 -, c dbSNP:587781892
1282 1282 c, t dbSNP:587778910
1283 1283 a, g dbSNP:267607820
1287 1287 c, t dbSNP:63750932
1291 1291 -, aaag dbSNP:267607828
1292 1292 -, aaga dbSNP:63751592
1293 1293 -, a dbSNP:63751677
1294 1294 -, gaga dbSNP:281864936
1294 1294 a, g dbSNP:63750616
1295 1295 -, a dbSNP:63751468
1296 1296 -, gacatcgggaaga dbSNP:587778912
1296 1296 -, ga dbSNP:281864937
1296 1296 a, g, t dbSNP:63750498
1301 1301 -, c dbSNP:63750482
1301 1301 c, g, t dbSNP:147939838
1302 1302 a, g dbSNP:63751083
1313 1313 g, t dbSNP:771282761
1322 1322 a, g dbSNP:559012648
1326 1326 c, t dbSNP:376642306
1328 1328 a, g dbSNP:774236450
1330 1330 -, a dbSNP:587778915
1331 1331 g, t dbSNP:730881741
1333 1333 c, t dbSNP:587778916
1334 1334 c, g dbSNP:63750314
1336 1336 a, t dbSNP:63750956
1338 1338 c, t dbSNP:532873141
1340 1340 c, t dbSNP:63749795
1341 1341 a, g dbSNP:587778917
1343 1343 a, t dbSNP:587778918
1344 1344 -, a dbSNP:63749876
1345 1345 -, ggaaa dbSNP:587778919
1349 1349 a, g dbSNP:776671941
1352 1352 -, a dbSNP:63751014
1355 1355 a, g dbSNP:63751145
1365 1365 -, c dbSNP:763560251
1366 1366 c, t dbSNP:764962961
1368 1368 a, c, g, t dbSNP:63750226
1370 1370 -, c dbSNP:63751031
1370 1370 -, c dbSNP:63750855
1370 1370 c, g, t dbSNP:200830026
1371 1371 a, g dbSNP:754554026
1372 1372 -, g dbSNP:63751435
1375 1375 a, g dbSNP:781525625
1378 1378 -, g dbSNP:63749793
1378 1378 g, t dbSNP:786202768
1379 1379 -, atc dbSNP:753409799
1380 1380 -, tca dbSNP:63751146
1381 1381 -, cat dbSNP:587778920
1382 1382 a, c dbSNP:748613173
1383 1383 c, g, t dbSNP:587780679
1388 1388 c, t dbSNP:145679961
1390 1390 c, t dbSNP:778216737
1393 1393 c, t dbSNP:749683911
1395 1395 a, g dbSNP:771044689
1396 1396 c, t dbSNP:774699212
1398 1398 c, t dbSNP:63749909
1401 1401 -, t dbSNP:63749916
1401 1401 -, t dbSNP:587778921
1406 1406 c, t dbSNP:267607829
1409 1409 c, t dbSNP:63749923
1414 1414 a, g dbSNP:745906843
1415 1415 g, t dbSNP:63751472
1422 1422 a, g dbSNP:772245091
1423 1423 -, t dbSNP:63750317
1423 1423 c, t dbSNP:775456144
1424 1424 a, g dbSNP:63750746
1430 1430 c, g, t dbSNP:63751705
1432 1432 a, g dbSNP:373322226
1433 1433 -, t dbSNP:587778924
1433 1433 -, c dbSNP:587778925
1435 1435 -, t dbSNP:63751689
1438 1438 -, t dbSNP:587778926
1442 1442 a, c dbSNP:63751688
1445 1445 c, t dbSNP:63751703
1446 1446 a, g, t dbSNP:63751630
1448 1448 a, g dbSNP:528463800
1450 1450 g, t dbSNP:63751680
1453 1453 -, gt dbSNP:587778928
1453 1453 c, g, t dbSNP:587779953
1454 1454 -, tt dbSNP:63751613
1454 1454 c, t dbSNP:63750137
1455 1455 a, t dbSNP:587778929
1457 1457 c, t dbSNP:63751281
1468 1468 c, t dbSNP:767089159
1469 1469 -, ttc dbSNP:587778930
1471 1471 c, g, t dbSNP:752241564
1472 1472 -, gt dbSNP:63750076
1472 1472 a, g dbSNP:764663152
1473 1473 -, tg dbSNP:587778931
1475 1475 a, g dbSNP:754447026
1477 1477 c, t dbSNP:63750000
1479 1479 a, g dbSNP:564240478
1490 1490 c, t dbSNP:63751277
1494 1494 a, g dbSNP:587778933
1495 1495 a, g dbSNP:267607842
1497 1497 a, c dbSNP:267607843
1501 1501 -, gg dbSNP:63750036
1501 1501 a, g dbSNP:786202409
1503 1503 -, c dbSNP:63750824
1503 1503 c, t dbSNP:757728402
1505 1505 c, t dbSNP:63750192
1506 1506 a, c, t dbSNP:63750511
1509 1509 a, g dbSNP:730881742
1511 1511 c, t dbSNP:63750413
1514 1514 a, g dbSNP:267607840
1518 1518 a, g dbSNP:587779954
1521 1521 a, t dbSNP:63750300
1523 1523 c, t dbSNP:780317287
1524 1524 -, ttata dbSNP:587778934
1525 1525 c, g dbSNP:63751087
1526 1526 c, t dbSNP:747090506
1527 1527 c, t dbSNP:63750289
1528 1528 c, t dbSNP:768770694
1530 1530 -, tct dbSNP:587778935
1530 1530 c, t dbSNP:63750193
1533 1533 a, c dbSNP:63750271
1534 1534 c, t dbSNP:587778936
1537 1537 -, cac dbSNP:267607841
1539 1539 -, cca dbSNP:63751641
1539 1539 c, t dbSNP:781270312
1545 1545 -, aagt dbSNP:267607699
1545 1545 c, t dbSNP:587778937
1546 1546 c, t dbSNP:749204990
1547 1547 a, g dbSNP:63751633
1548 1548 c, g, t dbSNP:63751596
1549 1549 -, t dbSNP:587778939
1550 1550 g, t dbSNP:63751244
1553 1553 g, t dbSNP:63751081
1556 1556 c, t dbSNP:780221881
1557 1557 g, t dbSNP:63750059
1558 1558 a, g dbSNP:786201538
1562 1562 c, t dbSNP:267607847
1564 1564 c, g dbSNP:63751393
1565 1565 c, t dbSNP:63751460
1570 1570 -, a dbSNP:63750464
1571 1571 -, ctca dbSNP:267607849
1571 1571 c, t dbSNP:786202693
1574 1574 a, t dbSNP:63750062
1577 1577 c, t dbSNP:730881743
1583 1583 a, t dbSNP:267607848
1590 1590 a, g dbSNP:375853155
1592 1592 c, t dbSNP:267607846
1595 1595 a, g dbSNP:587781796
1596 1596 a, g dbSNP:781178304
1598 1598 -, gt dbSNP:63751709
1602 1602 c, t dbSNP:63751608
1605 1605 c, g dbSNP:748185540
1606 1606 -, g dbSNP:63751685
1611 1611 c, g, t dbSNP:56185292
1612 1612 a, c, g dbSNP:63751657
1614 1614 a, g dbSNP:63751612
1623 1623 c, t dbSNP:63751684
1624 1624 a, c, g dbSNP:567838745
1625 1625 c, g, t dbSNP:63751713
1626 1626 c, t dbSNP:63751616
1626 1626 -, t dbSNP:587778942
1629 1629 -, tt dbSNP:587778943
1630 1630 -, t dbSNP:63750309
1635 1635 g, t dbSNP:267607865
1636 1636 c, t dbSNP:786202432
1637 1637 c, g dbSNP:63751176
1638 1638 -, t dbSNP:267607695
1638 1638 a, c dbSNP:63750587
1639 1639 -, c dbSNP:367543283
1639 1639 -, c dbSNP:63749863
1640 1640 a, c, g dbSNP:267607862
1641 1641 c, t dbSNP:587778945
1642 1642 a, g dbSNP:747665234
1644 1644 c, t dbSNP:63750575
1645 1645 -, t dbSNP:63751486
1647 1647 a, c dbSNP:63750016
1650 1650 -, taga dbSNP:63750147
1650 1650 -, t dbSNP:63749979
1651 1651 a, c dbSNP:769239969
1653 1653 -, atag dbSNP:63749868
1656 1656 a, c, g dbSNP:587782621
1659 1659 -, ca dbSNP:63750375
1660 1660 a, g dbSNP:786201766
1664 1664 -, ag dbSNP:63750035
1669 1669 c, t dbSNP:267607863
1671 1671 a, g dbSNP:63750604
1673 1673 a, g dbSNP:763381491
1680 1680 a, g dbSNP:267607861
1681 1681 -, agatggtcccaaagaagga dbSNP:587778946
1683 1683 a, g dbSNP:63750718
1689 1689 c, g, t dbSNP:63750876
1691 1691 a, t dbSNP:63750386
1693 1693 -, a dbSNP:63751240
1696 1696 a, g dbSNP:767748815
1701 1701 a, t dbSNP:41295284
1702 1702 -, t dbSNP:587778947
1703 1703 a, g dbSNP:147928948
1704 1704 a, c, t dbSNP:267607864
1712 1712 -, at dbSNP:63750150
1713 1713 -, acat dbSNP:587778948
1713 1713 c, t dbSNP:141688321
1715 1715 -, gtt dbSNP:267607859
1715 1715 a, g dbSNP:587779956
1716 1716 -, ttg dbSNP:63750486
1723 1723 g, t dbSNP:758353338
1726 1726 -, gaa dbSNP:587782285
1727 1727 -, aag dbSNP:121912962
1731 1731 a, c dbSNP:780199021
1732 1732 -, gaa dbSNP:267607858
1733 1733 -, aag dbSNP:63751247
1733 1733 aa, gc dbSNP:35502531
1733 1733 a, g, t dbSNP:35001569
1734 1734 a, c, g, t dbSNP:63750449
1734 1734 a, ttctt dbSNP:587778949
1735 1735 a, g dbSNP:786202638
1736 1736 c, g dbSNP:267607866
1736 1736 -, g dbSNP:63749986
1737 1737 a, c dbSNP:747708787
1739 1739 -, g dbSNP:786203456
1742 1742 a, g dbSNP:769488957
1746 1746 a, c, t dbSNP:63750693
1747 1747 -, t dbSNP:587778950
1748 1748 g, t dbSNP:587778951
1753 1753 c, t dbSNP:145535636
1755 1755 a, g dbSNP:748851107
1756 1756 g, t dbSNP:63751415
1757 1757 c, t dbSNP:377241633
1758 1758 -, tctcttt dbSNP:63751594
1758 1758 c, t dbSNP:587778952
1758 1758 -, t dbSNP:63750152
1759 1759 a, c, t dbSNP:63751214
1760 1760 -, tctt dbSNP:267607860
1760 1760 a, t dbSNP:63750846
1761 1761 -, cttt dbSNP:587778953
1765 1765 -, ggaaa dbSNP:63751639
1771 1771 -, t dbSNP:786201990
1771 1771 g, t dbSNP:774878438
1773 1773 a, c dbSNP:63750240
1774 1774 c, t dbSNP:786201289
1774 1774 -, t dbSNP:587778954
1777 1777 a, g dbSNP:63751632
1777 1777 -, g dbSNP:63751631
1778 1778 -, g dbSNP:63751643
1781 1781 a, g dbSNP:63750830
1782 1782 g, t dbSNP:786202396
1783 1783 a, g dbSNP:376866470
1783 1783 -, g dbSNP:587778956
1784 1784 -, a dbSNP:750300820
1785 1785 -, a dbSNP:587778957
1785 1785 a, g dbSNP:63751270
1786 1786 c, g dbSNP:63751047
1787 1787 -, tgat dbSNP:779795819
1788 1788 c, t dbSNP:63750825
1789 1789 a, g dbSNP:1800145
1793 1793 a, g, t dbSNP:63750549
1797 1797 -, t dbSNP:587778960
1797 1797 g, t dbSNP:63750079
1798 1798 a, g dbSNP:63750935
1799 1799 c, t dbSNP:63749792
1800 1800 c, t dbSNP:267607875
1801 1801 -, t dbSNP:587778961
1801 1801 c, t dbSNP:778417334
1805 1805 -, ct dbSNP:63750884
1805 1805 c, g dbSNP:577217817
1807 1807 -, gattaccccttctg dbSNP:587778958
1811 1811 -, g dbSNP:587778962
1815 1815 a, g dbSNP:587778963
1818 1818 a, g dbSNP:35045067
1819 1819 c, t dbSNP:786202774
1820 1820 a, g dbSNP:63750109
1823 1823 -, attaccccttctgattgacaactatgtgc dbSNP:587778959
1823 1823 c, t dbSNP:63750899
1824 1824 c, t dbSNP:63750610
1827 1827 -, ctt dbSNP:281864939
1827 1827 -, c dbSNP:281864938
1828 1828 c, t dbSNP:775658955
1834 1834 -, ggga dbSNP:63751301
1839 1839 g, t dbSNP:63751202
1840 1840 g, t dbSNP:1800146
1842 1842 c, t dbSNP:63750726
1844 1844 a, g, t dbSNP:55907433
1845 1845 c, t dbSNP:63751225
1848 1848 c, t dbSNP:267607876
1850 1850 a, t dbSNP:765363859
1852 1852 -, t dbSNP:63750115
1854 1854 c, t dbSNP:786202050
1856 1856 -, cg dbSNP:63750131
1856 1856 c, t dbSNP:63751310
1857 1857 -, ga dbSNP:63751200
1857 1857 a, c, g, t dbSNP:63749900
1858 1858 a, c, t dbSNP:759330601
1859 1859 c, t dbSNP:752427924
1865 1865 a, c dbSNP:587778964
1869 1869 -, a dbSNP:267607877
1869 1869 a, c, g dbSNP:63751682
1870 1870 a, g, t dbSNP:63751662
1872 1872 g, t dbSNP:786202938
1877 1877 c, t dbSNP:267607887
1879 1879 a, g dbSNP:63750639
1881 1881 -, a dbSNP:63750282
1881 1881 a, g dbSNP:63751162
1882 1882 c, t dbSNP:63750014
1883 1883 a, g dbSNP:63750292
1886 1886 c, g dbSNP:780406337
1887 1887 -, aaaag dbSNP:63750061
1890 1890 -, a dbSNP:63750740
1892 1892 g, t dbSNP:63750663
1894 1894 a, g dbSNP:747503723
1898 1898 c, t dbSNP:587780680
1901 1901 a, g dbSNP:755577490
1905 1905 a, c, g dbSNP:781637991
1906 1906 c, t dbSNP:770132213
1908 1908 c, g, t dbSNP:63750242
1909 1909 c, t dbSNP:587778969
1910 1910 a, t dbSNP:587780681
1911 1911 a, g dbSNP:587778970
1916 1916 g, t dbSNP:587778971
1917 1917 a, c dbSNP:749305196
1918 1918 a, g dbSNP:770992217
1919 1919 c, g, t dbSNP:63750809
1921 1921 a, c, t dbSNP:63749867
1922 1922 a, g dbSNP:63750217
1923 1923 c, t dbSNP:63750864
1924 1924 a, t dbSNP:768595157
1929 1929 c, t dbSNP:587778972
1932 1932 a, g dbSNP:267607886
1940 1940 c, t dbSNP:63751275
1941 1941 a, g dbSNP:587781310
1946 1946 a, c, t dbSNP:41542214
1947 1947 a, g dbSNP:63750702
1948 1948 -, gtacata dbSNP:63750420
1949 1949 g, t dbSNP:765877072
1951 1951 c, t dbSNP:550890395
1952 1952 -, t dbSNP:780956158
1952 1952 a, g dbSNP:201748079
1953 1953 a, t dbSNP:781780309
1955 1955 c, t dbSNP:587779957
1957 1957 -, tg dbSNP:63750769
1961 1961 g, t dbSNP:147542208
1962 1962 -, t dbSNP:267607698
1962 1962 a, c dbSNP:145565670
1965 1965 a, c, g dbSNP:63749995
1966 1966 a, g dbSNP:191505871
1972 1972 c, t dbSNP:536488280
1973 1973 -, tc dbSNP:63750859
1974 1974 c, g dbSNP:587778975
1975 1975 a, g dbSNP:786202433
1977 1977 a, g dbSNP:746007176
1980 1980 -, agca dbSNP:63751652
1982 1982 a, c, t dbSNP:63750114
1984 1984 a, c, g dbSNP:63750603
1985 1985 -, ag dbSNP:63751651
1986 1986 -, gtgaagtgcc dbSNP:587778979
1988 1988 a, c, g dbSNP:747727493
1991 1991 c, g dbSNP:587781811
1992 1992 -, tgcctgg dbSNP:587778980
1992 1992 g, t dbSNP:587780682
1999 1999 c, t dbSNP:1800147
2011 2011 c, g dbSNP:749100096
2012 2012 c, t dbSNP:587781342
2013 2013 c, g dbSNP:770583385
2015 2015 a, t dbSNP:267607909
2016 2016 a, g, t dbSNP:63750561
2017 2017 a, g, t dbSNP:63750499
2018 2018 a, t dbSNP:767094219
2022 2022 a, g dbSNP:63751022
2023 2023 a, g dbSNP:63750978
2027 2027 a, g, t dbSNP:35831931
2028 2028 -, tg dbSNP:587778981
2029 2029 ggaacacattgtctataaagc, nnnnn dbSNP:786202275
2033 2033 c, t dbSNP:2020873
2034 2034 a, c dbSNP:587778983
2035 2035 -, ca dbSNP:63750971
2035 2035 c, t dbSNP:1800148
2036 2036 -, atgtgttccaca, ca dbSNP:281864940
2036 2036 a, g dbSNP:754225520
2037 2037 c, t dbSNP:757603534
2038 2038 -, t dbSNP:587778984
2040 2040 g, t dbSNP:587778985
2043 2043 -, a dbSNP:786202767
2043 2043 a, c, g dbSNP:587778986
2044 2044 a, t dbSNP:63750484
2045 2045 a, g dbSNP:750596783
2047 2047 -, tataaa dbSNP:63751075
2050 2050 c, t dbSNP:758652752
2051 2051 a, t dbSNP:63749875
2053 2053 ag, gc dbSNP:786203433
2053 2053 a, g dbSNP:780045031
2054 2054 c, t dbSNP:138584384
2055 2055 a, g dbSNP:566928243
2060 2060 -, caca dbSNP:267607898
2060 2060 -, ca dbSNP:267607905
2061 2061 a, t dbSNP:104895002
2062 2062 -, ca dbSNP:587778987
2066 2066 c, g dbSNP:1800149
2071 2071 -, aaca dbSNP:267607902
2071 2071 -, t dbSNP:587780683
2074 2074 c, t dbSNP:749082864
2075 2075 a, t dbSNP:267607906
2076 2076 -, gaacacattgtctataaagccttgcgctcacacattctgcctcctaa dbSNP:587778982
2078 2078 -, aaac dbSNP:267607899
2079 2079 -, aaca dbSNP:267607903
2079 2079 a, g dbSNP:770579083
2086 2086 a, c dbSNP:371263535
2091 2091 a, t dbSNP:267607885
2094 2094 a, g dbSNP:148317871
2099 2099 -, a dbSNP:587778989
2102 2102 ctgc, nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:587778990
2102 2102 a, c dbSNP:786203583
2104 2104 -, gcagcttgcta dbSNP:267607897
2104 2104 a, g dbSNP:745444452
2105 2105 -, cagcttgct dbSNP:587778991
2105 2105 -, c dbSNP:267607896
2105 2105 c, t dbSNP:587778992
2107 2107 a, g dbSNP:771863612
2112 2112 c, t dbSNP:775127059
2120 2120 c, t dbSNP:587779958
2123 2123 a, c, g dbSNP:374380262
2127 2127 a, c, t dbSNP:267607894
2128 2128 a, c dbSNP:786202209
2129 2129 -, ta dbSNP:786202326
2129 2129 c, t dbSNP:777054430
2131 2131 a, c, g dbSNP:267607893
2132 2132 a, t dbSNP:786204318
2133 2133 -, aa dbSNP:267607907
2133 2133 a, g dbSNP:140195825
2134 2134 -, aa dbSNP:267607901
2139 2139 c, t dbSNP:587778993
2143 2143 -, g dbSNP:267607904
2144 2144 a, t dbSNP:267607900
2146 2146 c, g dbSNP:267607895
2147 2147 g, t dbSNP:765480781
2150 2150 -, t, tgtt dbSNP:267607892
2150 2150 a, t dbSNP:587778995
2152 2152 a, t dbSNP:267607908
2155 2155 a, g dbSNP:587778880
2156 2156 c, t dbSNP:750794400
2159 2159 -, ttat dbSNP:779336928
2162 2162 c, t dbSNP:758561792
2166 2166 c, t dbSNP:766650278
2167 2167 g, t dbSNP:75682204
2173 2173 g, t dbSNP:79406218
2182 2182 -, ttc dbSNP:200919928
2184 2184 -, ctt dbSNP:281875167
2184 2184 c, g, t dbSNP:200903126
2187 2187 -, ctt dbSNP:193922366
2191 2191 a, c dbSNP:781352547
2194 2194 c, g, t dbSNP:749138642
2197 2197 a, t dbSNP:778791265
2201 2201 c, t dbSNP:745713835
2210 2210 c, g dbSNP:771845260
2215 2215 a, g dbSNP:779892486
2223 2223 c, g dbSNP:746506283
2225 2225 a, g dbSNP:768003470
2247 2247 a, g dbSNP:776238530
2253 2253 a, g, t dbSNP:1803985
2257 2257 a, g dbSNP:770302355
2261 2261 c, g dbSNP:773556906
2270 2270 c, t dbSNP:763379368
2273 2273 a, g dbSNP:766562208
2274 2274 c, t dbSNP:751679614
2289 2289 a, t dbSNP:267607910
2296 2296 c, t dbSNP:570963416
2301 2301 c, t dbSNP:770660847
2310 2310 -, gatt dbSNP:201518804
2314 2314 -, gatt dbSNP:201866587
2317 2317 g, t dbSNP:538203686
2319 2319 a, t dbSNP:587778879
2325 2325 -, aata dbSNP:56329536
2342 2342 a, g dbSNP:556614001
2343 2343 c, t dbSNP:368443548

Target ORF information:

RefSeq Version XM_005265161
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20930
Accession Version XM_005265163.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1548bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Mlh1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)722..1003(+)
Misc Feature(2)725..2059(+)
Misc Feature(3)929..931(+)
Position Chain Variation Link
13 13 a, g dbSNP:767391717
14 14 c, t dbSNP:750360439
21 21 a, g dbSNP:114683294
26 26 c, t dbSNP:760601810
39 39 c, g dbSNP:766270403
41 41 c, g dbSNP:576304627
54 54 a, t dbSNP:543749635
55 55 a, c dbSNP:561909643
56 56 c, g dbSNP:185841085
63 63 c, t dbSNP:747425626
64 64 -, gt dbSNP:747353952
80 80 c, g dbSNP:753623015
82 82 c, t dbSNP:547548108
84 84 c, g dbSNP:559815653
86 86 c, t dbSNP:561267247
89 89 a, g dbSNP:530086722
107 107 g, t dbSNP:4647205
117 117 -, t dbSNP:587778896
119 119 c, g dbSNP:267607713
120 120 a, g dbSNP:63751094
123 123 c, g, t dbSNP:587778901
127 127 -, a dbSNP:63750867
128 128 g, t dbSNP:63750939
129 129 -, aatc dbSNP:63751431
129 129 c, t dbSNP:63751109
131 131 acaagta, tgtt dbSNP:587778904
132 132 c, g dbSNP:759287108
134 134 a, g dbSNP:771649701
135 135 g, t dbSNP:63749833
140 140 c, t dbSNP:587778913
141 141 a, c dbSNP:587778914
142 142 a, c dbSNP:147342421
143 143 a, g dbSNP:760185532
144 144 a, t dbSNP:63750098
148 148 -, t dbSNP:63749956
151 151 -, t dbSNP:587778922
152 152 -, aaag dbSNP:267607714
152 152 a, t dbSNP:63751401
153 153 -, aaga dbSNP:587778923
153 153 -, aa dbSNP:730881733
154 154 -, a dbSNP:63750028
154 154 -, a dbSNP:587778927
155 155 g, t dbSNP:63751199
156 156 a, c dbSNP:63750263
159 159 -, gagg dbSNP:587778932
159 159 a, g dbSNP:63751267
159 159 -, g dbSNP:63751266
166 166 g, t dbSNP:764529553
167 167 a, c, t dbSNP:63750877
168 168 a, c dbSNP:587779955
172 172 a, g dbSNP:762162504
173 173 -, a dbSNP:587778944
178 178 a, g dbSNP:63751398
182 182 a, c, t dbSNP:63751428
185 185 a, g dbSNP:63750850
187 187 a, c, t dbSNP:587778955
188 188 -, aa dbSNP:63750469
189 189 -, a dbSNP:63751255
189 189 a, g dbSNP:63750952
192 192 a, g dbSNP:63751465
193 193 -, c dbSNP:267607715
196 196 -, c dbSNP:587778966
196 196 c, t dbSNP:61751642
197 197 a, g, t dbSNP:63750206
198 198 a, g dbSNP:63749939
199 199 -, g dbSNP:587778968
200 200 a, g dbSNP:63750452
201 201 a, t dbSNP:63750281
202 202 c, g dbSNP:780141938
203 203 -, a dbSNP:63751704
203 203 a, g dbSNP:63750719
204 204 a, g dbSNP:63751661
207 207 -, aagaaga dbSNP:730881734
208 208 -, agaa dbSNP:267607723
208 208 a, c dbSNP:63751191
209 209 -, gaa dbSNP:267607724
209 209 c, g, t dbSNP:63749829
211 211 -, aga dbSNP:63751642
214 214 c, t dbSNP:63750621
215 215 c, g dbSNP:766608278
216 216 c, g, t dbSNP:397514684
217 217 a, g dbSNP:587778988
219 219 a, t dbSNP:751894165
220 220 c, t dbSNP:755073786
226 226 a, g dbSNP:767750489
227 227 c, t dbSNP:63749859
228 228 a, g dbSNP:63750437
229 229 -, tg dbSNP:63750052
229 229 a, t dbSNP:63750856
230 230 -, g dbSNP:587778997
233 233 a, c dbSNP:786203362
235 235 g, t dbSNP:752850761
236 236 g, t dbSNP:63749990
237 237 a, t dbSNP:753404814
239 239 a, g dbSNP:786203745
240 240 c, t dbSNP:63751069
241 241 g, t dbSNP:778724501
242 242 -, a dbSNP:267607729
242 242 a, g dbSNP:587778998
243 243 -, cta dbSNP:786202328
243 243 c, t dbSNP:63750005
246 246 g, t dbSNP:587778999
248 248 a, g dbSNP:63750641
251 251 c, t dbSNP:63750659
254 254 c, t dbSNP:63751421
259 259 -, c dbSNP:267607728
259 259 c, t dbSNP:63750923
262 262 g, t dbSNP:182963667
263 263 c, g, t dbSNP:11541859
264 264 a, g dbSNP:758110228
265 265 a, g dbSNP:746705035
270 270 a, t dbSNP:63751137
272 272 c, g dbSNP:63750133
273 273 c, t dbSNP:768132746
275 275 a, g dbSNP:41295282
281 281 g, t dbSNP:63751070
284 284 a, g dbSNP:770276731
288 288 a, g dbSNP:773647920
289 289 a, t dbSNP:63750651
290 290 a, c, g dbSNP:267607725
291 291 -, gctttcgaggtg dbSNP:63751691
295 295 a, t dbSNP:267607730
296 296 c, t dbSNP:63751221
297 297 a, c, g dbSNP:63750266
299 299 a, g dbSNP:267607726
300 300 a, g, t dbSNP:267607727
301 301 g, t dbSNP:4647220
302 302 a, g dbSNP:63750453
304 304 a, c, g, t dbSNP:63751665
305 305 c, g dbSNP:587779003
309 309 a, t dbSNP:63751397
315 315 a, g dbSNP:368208495
316 316 a, c, g dbSNP:63750297
317 317 a, g dbSNP:572906317
318 318 g, t dbSNP:63750507
324 324 a, c dbSNP:587779004
325 325 g, t dbSNP:63749803
329 329 c, g dbSNP:587779005
330 330 c, t dbSNP:63750539
333 333 a, g dbSNP:775914775
336 336 a, t dbSNP:63750559
339 339 -, c dbSNP:63750645
341 341 a, g dbSNP:371667663
342 342 c, t dbSNP:764120517
344 344 -, a dbSNP:267607739
344 344 -, a dbSNP:63750906
344 344 a, g dbSNP:750353040
345 345 a, c, g dbSNP:63750465
348 348 c, g, t dbSNP:63750781
349 349 a, g dbSNP:61751643
350 350 a, c dbSNP:766308335
353 353 -, aa dbSNP:63750658
354 354 -, aa dbSNP:63750841
357 357 c, t dbSNP:267607740
360 360 a, g dbSNP:730881735
365 365 a, t dbSNP:63750542
367 367 a, g dbSNP:754824181
368 368 c, t dbSNP:780816243
369 369 a, g dbSNP:730881736
370 370 -, tg dbSNP:587779006
373 373 a, g dbSNP:1800144
374 374 a, t dbSNP:200076893
375 375 a, g dbSNP:267607741
376 376 -, c dbSNP:63751607
376 376 c, g, t dbSNP:63751606
377 377 a, c dbSNP:587779007
378 378 a, g, t dbSNP:63751595
380 380 gcaagttactcagatggaaaa, t dbSNP:267607746
380 380 c, g dbSNP:63750866
380 380 -, g dbSNP:63750865
383 383 ag, gtt dbSNP:63751710
384 384 a, g dbSNP:755678310
386 386 c, t dbSNP:587779010
386 386 -, t dbSNP:587779009
387 387 -, a dbSNP:587779012
387 387 a, g dbSNP:587779011
390 390 a, c dbSNP:63749818
392 392 c, g dbSNP:28930073
395 395 g, t dbSNP:63751124
401 401 c, g dbSNP:63751052
402 402 -, tgaa dbSNP:587779014
402 402 g, t dbSNP:753233578
407 407 a, g dbSNP:756888142
408 408 c, t dbSNP:63750817
413 413 c, g dbSNP:779562531
418 418 -, a dbSNP:587779015
419 419 c, g dbSNP:63750977
420 420 c, g, t dbSNP:746419577
421 421 a, g dbSNP:201176051
422 422 c, t dbSNP:780232692
426 426 -, c dbSNP:63751045
434 434 c, t dbSNP:63749820
436 436 a, g dbSNP:377279035
437 437 c, g dbSNP:267607747
443 443 c, t dbSNP:63751302
445 445 c, g dbSNP:63750638
447 447 a, t dbSNP:786202495
449 449 -, acg dbSNP:587779016
450 450 c, t dbSNP:776969475
451 451 a, g dbSNP:369521379
452 452 a, g dbSNP:748417604
456 456 a, g dbSNP:770023778
460 460 c, t dbSNP:192938577
461 461 a, c dbSNP:749370894
462 462 g, t dbSNP:63750891
466 466 -, tt dbSNP:267607758
467 467 -, t dbSNP:63751101
469 469 a, c dbSNP:74396541
470 470 a, c dbSNP:63751242
472 472 c, t dbSNP:4647256
473 473 a, g dbSNP:370900909
474 474 c, t dbSNP:775560085
477 477 c, t dbSNP:63749924
480 480 c, t dbSNP:763992299
481 481 a, g dbSNP:776402672
484 484 -, gag dbSNP:587781788
485 485 a, c dbSNP:748500860
486 486 -, g dbSNP:267607754
490 490 a, c dbSNP:765014361
495 495 a, t dbSNP:267607755
495 495 -, t dbSNP:587779018
496 496 a, c dbSNP:267607757
500 500 -, aa dbSNP:267607756
501 501 -, a dbSNP:63749959
504 504 c, t dbSNP:63750834
511 511 -, a dbSNP:63749944
511 511 a, g dbSNP:779148982
514 514 a, g dbSNP:748128054
521 521 -, ag dbSNP:63749799
522 522 -, ga dbSNP:587779019
528 528 c, t dbSNP:758040210
529 529 at, ct, gg dbSNP:63750903
532 532 a, g dbSNP:786202121
533 533 g, t dbSNP:766791816
537 537 -, ttg dbSNP:786201988
537 537 c, g, t dbSNP:63750102
542 542 a, g dbSNP:63750211
543 543 a, g dbSNP:587779021
550 550 a, t dbSNP:35225190
551 551 c, g dbSNP:63750012
552 552 a, g, t dbSNP:63750515
554 554 c, t dbSNP:11541862
556 556 c, t dbSNP:63751050
561 561 c, t dbSNP:777971431
566 566 a, g dbSNP:786202038
570 570 g, t dbSNP:267607766
571 571 c, t dbSNP:754102133
575 575 c, t dbSNP:63751021
576 576 c, g dbSNP:63751480
577 577 a, g dbSNP:587781038
581 581 -, a dbSNP:35847123
584 584 a, t dbSNP:63750500
586 586 -, a dbSNP:63751653
593 593 c, g dbSNP:63749887
594 594 -, ag dbSNP:267607704
595 595 -, ga dbSNP:63751637
599 599 a, c, g dbSNP:534184145
605 605 a, g dbSNP:63750085
606 606 a, t dbSNP:749037674
619 619 a, g dbSNP:770554901
620 620 c, t dbSNP:587781509
624 624 a, c, g dbSNP:150478207
630 630 -, t dbSNP:63750908
632 632 a, g dbSNP:771612764
634 634 c, t dbSNP:138735345
635 635 a, g, t dbSNP:2308317
642 642 a, g dbSNP:267607775
645 645 g, t dbSNP:267607776
647 647 -, c dbSNP:63750380
647 647 c, t dbSNP:4986984
648 648 a, c, g dbSNP:762099920
650 650 c, t dbSNP:750650349
653 653 a, c, g dbSNP:1799977
663 663 -, a dbSNP:63750385
663 663 -, a dbSNP:63751286
663 663 a, g dbSNP:766517126
664 664 g, t dbSNP:751719069
666 666 c, t dbSNP:756045117
670 670 c, t dbSNP:786202912
670 670 -, t dbSNP:587779031
671 671 -, agtc dbSNP:267607774
671 671 a, g dbSNP:587781926
672 672 -, g dbSNP:63749842
674 674 c, t dbSNP:63751615
675 675 a, g, t dbSNP:63751711
676 676 a, t dbSNP:786203360
680 680 a, c dbSNP:751628735
681 681 -, t dbSNP:63751659
691 691 c, t dbSNP:63750765
691 691 -, t dbSNP:63750764
693 693 a, g, t dbSNP:149302013
694 694 a, t dbSNP:786201226
695 695 c, t dbSNP:63751170
697 697 c, t dbSNP:764085979
698 698 ga, tt dbSNP:730881732
699 699 a, g dbSNP:63750696
700 700 a, g dbSNP:35908749
702 702 a, t dbSNP:587781505
708 708 c, t dbSNP:771606168
715 715 a, c dbSNP:63749901
719 719 a, g dbSNP:587778447
720 720 a, g dbSNP:778528329
725 725 -, aatg dbSNP:267607787
729 729 -, gtta dbSNP:587779037
729 729 a, g, t dbSNP:63750303
734 734 a, g dbSNP:750253749
737 737 c, g, t dbSNP:63750948
741 741 a, g dbSNP:587782800
743 743 -, g dbSNP:63750819
746 746 a, c dbSNP:786203107
751 751 c, t dbSNP:63750310
753 753 a, c dbSNP:63750198
759 759 a, g dbSNP:786202528
763 763 a, g dbSNP:63751276
767 767 -, a dbSNP:63750338
774 774 c, t dbSNP:56250509
776 776 c, t dbSNP:63750642
777 777 g, t dbSNP:63751283
778 778 c, g, t dbSNP:587779038
781 781 c, t dbSNP:768119795
782 782 -, atc dbSNP:63751623
783 783 -, tca dbSNP:587779039
783 783 c, t dbSNP:781707562
784 784 c, g dbSNP:748553134
786 786 a, c, g dbSNP:104894997
788 788 c, g, t dbSNP:63751597
789 789 -, atcg dbSNP:267607799
789 789 a, g, t dbSNP:63751664
791 791 a, c, t dbSNP:63751194
792 792 a, g dbSNP:63751448
795 795 c, t dbSNP:747697495
800 800 c, g dbSNP:748423430
801 801 a, g dbSNP:63750650
803 803 c, t dbSNP:786203623
804 804 c, g dbSNP:63750691
806 806 -, actt dbSNP:267607801
806 806 a, g dbSNP:371302926
809 809 -, tcctt dbSNP:587779043
812 812 g, t dbSNP:63751252
813 813 c, t dbSNP:63750584
819 819 a, g dbSNP:769958855
822 822 -, aagc dbSNP:63751439
836 836 g, t dbSNP:587779044
838 838 a, t dbSNP:63750938
840 840 c, t dbSNP:63749950
841 841 a, c dbSNP:146796765
842 842 a, g dbSNP:774689817
843 843 c, g dbSNP:63750360
846 846 a, g, t dbSNP:201931669
849 849 a, t dbSNP:63750889
851 851 c, g dbSNP:772374195
853 853 c, t dbSNP:63751154
854 854 -, t dbSNP:63750212
854 854 a, c dbSNP:63750395
855 855 a, g dbSNP:775368585
857 857 -, aa dbSNP:63750034
858 858 -, a dbSNP:63750814
858 858 -, a dbSNP:587779046
859 859 c, t dbSNP:63750421
860 860 a, g dbSNP:730881738
861 861 c, t dbSNP:786203878
864 864 -, ac dbSNP:587779047
865 865 -, ac dbSNP:587779048
870 870 -, t dbSNP:63750429
873 873 c, t dbSNP:63750517
874 874 a, g dbSNP:773452312
875 875 g, t dbSNP:587779049
880 880 c, g, t dbSNP:63751707
881 881 a, c, g dbSNP:63751598
882 882 a, c, g dbSNP:63750144
885 885 -, t, tcctgacagttt dbSNP:63751620
885 885 c, g, t dbSNP:63750547
886 886 -, tcctgacagttt dbSNP:63751636
886 886 -, a dbSNP:267607809
887 887 a, g, t dbSNP:63750736
895 895 c, t dbSNP:767068637
896 896 a, c dbSNP:752430684
899 899 -, c dbSNP:587779052
899 899 c, t dbSNP:63750489
906 906 a, t dbSNP:267607813
909 909 a, g, t dbSNP:63750993
912 912 -, ttaatgtgcaccccacaaagcatg dbSNP:587779053
915 915 a, g dbSNP:755553895
916 916 a, t dbSNP:587779054
917 917 a, g dbSNP:786202196
920 920 -, gc dbSNP:63750962
923 923 c, t dbSNP:267607808
925 925 a, c, t dbSNP:63749896
926 926 -, a dbSNP:587779055
926 926 a, g dbSNP:779581111
927 927 a, c dbSNP:746206527
928 928 a, c dbSNP:587779056
933 933 -, a dbSNP:63750319
937 937 -, a dbSNP:63751259
941 941 c, t dbSNP:151119913
942 942 a, c dbSNP:786202114
943 943 c, g dbSNP:587779959
947 947 a, c dbSNP:267607814
952 952 a, c, t dbSNP:146777069
952 952 -, c dbSNP:63749926
953 953 a, g, t dbSNP:63750796
958 958 c, g dbSNP:267607811
960 960 a, g, t dbSNP:63750286
969 969 -, agcgggtgc dbSNP:63751404
969 969 -, a dbSNP:587781554
972 972 -, gggtgcagc dbSNP:587779057
972 972 a, g dbSNP:63750268
974 974 a, g dbSNP:730881739
974 974 -, g dbSNP:786204317
975 975 c, t dbSNP:63751049
977 977 c, g dbSNP:587782087
980 980 c, t dbSNP:587779058
982 982 -, gcacatcgagagca dbSNP:587782265
983 983 a, c, t dbSNP:267607810
984 984 a, c dbSNP:63750710
985 985 -, cat dbSNP:267607807
986 986 -, atc dbSNP:63751197
988 988 c, t dbSNP:372578171
989 989 a, g dbSNP:550914672
992 992 -, a dbSNP:63750533
994 994 c, t dbSNP:775167683
1001 1001 c, t dbSNP:267607812
1005 1005 a, g dbSNP:587781750
1005 1005 -, g dbSNP:63750434
1008 1008 c, g dbSNP:763847201
1009 1009 -, c dbSNP:63750677
1009 1009 -, c dbSNP:63750853
1011 1011 a, g dbSNP:63751467
1015 1015 -, c dbSNP:63750339
1017 1017 c, t dbSNP:191257018
1018 1018 c, g dbSNP:374770981
1021 1021 -, g dbSNP:63749837
1024 1024 -, g dbSNP:587778881
1032 1032 c, t dbSNP:750980386
1033 1033 c, t dbSNP:758668630
1035 1035 a, g dbSNP:63751609
1036 1036 a, c, g, t dbSNP:63751715
1038 1038 a, c dbSNP:201541505
1041 1041 c, t dbSNP:755401753
1044 1044 -, t dbSNP:267607822
1048 1048 -, a dbSNP:587778883
1048 1048 a, g dbSNP:137937003
1054 1054 a, t dbSNP:63750156
1056 1056 c, t dbSNP:63751265
1058 1058 a, g dbSNP:752962453
1059 1059 -, g dbSNP:63750472
1060 1060 c, t dbSNP:730881748
1061 1061 c, t dbSNP:756347993
1062 1062 c, t dbSNP:587782467
1065 1065 c, t dbSNP:749334262
1066 1066 -, tggggaga dbSNP:63750038
1068 1068 g, t dbSNP:730881740
1069 1069 -, ggagatgg dbSNP:587778884
1070 1070 -, g dbSNP:587778885
1072 1072 a, g dbSNP:587780533
1074 1074 c, t dbSNP:779917781
1079 1079 a, g dbSNP:786201875
1088 1088 a, g dbSNP:63749864
1093 1093 c, g, t dbSNP:746800098
1098 1098 a, c dbSNP:776402584
1099 1099 -, c dbSNP:63750715
1101 1101 c, t dbSNP:201673334
1102 1102 a, g dbSNP:769364808
1105 1105 c, t dbSNP:772718909
1109 1109 a, g dbSNP:762426947
1115 1115 a, g dbSNP:766904735
1116 1116 a, g dbSNP:774878513
1120 1120 g, t dbSNP:759868546
1126 1126 -, at dbSNP:730880011
1126 1126 c, t dbSNP:267607824
1127 1127 -, ta dbSNP:63750305
1130 1130 a, gtc dbSNP:587778887
1134 1134 a, c, g, t dbSNP:143009528
1138 1138 c, t dbSNP:786201611
1139 1139 c, t dbSNP:63750557
1142 1142 c, g dbSNP:778315874
1143 1143 -, a dbSNP:587778889
1146 1146 c, t dbSNP:141344760
1148 1148 a, g dbSNP:757350157
1148 1148 -, g dbSNP:63749965
1149 1149 a, t dbSNP:63750447
1151 1151 c, t dbSNP:63750760
1152 1152 a, c, g dbSNP:63750430
1157 1157 a, g dbSNP:781096630
1159 1159 c, t dbSNP:747967333
1161 1161 -, nnnn dbSNP:587778893
1163 1163 a, c, t dbSNP:61751644
1164 1164 a, g dbSNP:63750361
1165 1165 a, g dbSNP:772805767
1169 1169 c, t dbSNP:587778894
1170 1170 a, g dbSNP:587782884
1173 1173 a, g dbSNP:587780678
1176 1176 g, t dbSNP:786203413
1188 1188 -, t dbSNP:63750749
1189 1189 a, g, t dbSNP:35164771
1190 1190 c, g, t dbSNP:63750483
1196 1196 c, g dbSNP:63751485
1198 1198 a, g dbSNP:786203363
1200 1200 a, g dbSNP:587779951
1205 1205 c, t dbSNP:587778897
1208 1208 -, c dbSNP:587778898
1208 1208 -, ct dbSNP:63751015
1213 1213 c, t dbSNP:773869705
1215 1215 a, g dbSNP:41294980
1216 1216 -, t dbSNP:587778900
1221 1221 -, gtcagcc dbSNP:587778899
1223 1223 c, t dbSNP:63751153
1224 1224 a, c, g dbSNP:104895000
1225 1225 c, g dbSNP:775776362
1227 1227 c, t dbSNP:761006237
1228 1228 c, t dbSNP:764377126
1229 1229 a, g dbSNP:535470039
1230 1230 g, t dbSNP:786201951
1234 1234 c, t dbSNP:369576099
1236 1236 c, t dbSNP:63750766
1237 1237 a, g dbSNP:786203274
1241 1241 a, g dbSNP:373767220
1243 1243 g, t dbSNP:750563193
1244 1244 a, g dbSNP:267607823
1250 1250 -, ga dbSNP:63751118
1251 1251 a, g dbSNP:754898711
1252 1252 a, g, t dbSNP:63751440
1253 1253 a, g dbSNP:781335662
1254 1254 c, t dbSNP:377484262
1255 1255 -, ttctagtggcagggcta dbSNP:786203893
1257 1257 c, g dbSNP:63751179
1259 1259 -, a dbSNP:63750293
1259 1259 a, g dbSNP:755898663
1264 1264 c, t dbSNP:63750791
1266 1266 a, g dbSNP:370687064
1267 1267 a, g dbSNP:373076967
1268 1268 a, g dbSNP:377433038
1269 1269 c, g dbSNP:745393750
1274 1274 c, t dbSNP:63750316
1282 1282 c, t dbSNP:772555970
1291 1291 a, g dbSNP:776044212
1293 1293 a, t dbSNP:761070985
1295 1295 c, g dbSNP:63750443
1301 1301 a, c dbSNP:786202922
1302 1302 c, t dbSNP:63751414
1307 1307 c, g dbSNP:587782273
1308 1308 -, c dbSNP:63750748
1319 1319 a, g dbSNP:63750365
1322 1322 a, g dbSNP:761903819
1323 1323 ccaaaaatcagagcttggaggg, nnnnn dbSNP:587778903
1323 1323 c, g dbSNP:765563111
1325 1325 a, c dbSNP:34213726
1329 1329 a, g dbSNP:763189331
1332 1332 -, a dbSNP:63749845
1341 1341 -, a dbSNP:63749981
1342 1342 g, t dbSNP:587779952
1345 1345 ggatacaacaaaggggacttc, taaa dbSNP:587778905
1346 1346 -, g dbSNP:587778906
1346 1346 g, t dbSNP:752622244
1352 1352 -, a dbSNP:63750071
1352 1352 a, t dbSNP:34285587
1357 1357 c, g dbSNP:756099600
1358 1358 c, g dbSNP:63750527
1360 1360 -, g dbSNP:267607821
1360 1360 -, g dbSNP:587778907
1363 1363 a, t dbSNP:753671152
1366 1366 a, g dbSNP:786203279
1368 1368 a, t dbSNP:786203236
1371 1371 a, t dbSNP:63750390
1375 1375 -, a dbSNP:63750020
1375 1375 -, a dbSNP:587778908
1376 1376 a, g dbSNP:756843954
1377 1377 a, c dbSNP:202038499
1378 1378 -, ga dbSNP:587778909
1378 1378 -, t dbSNP:267607697
1379 1379 a, t dbSNP:63750540
1381 1381 c, g, t dbSNP:63751293
1390 1390 c, t dbSNP:63750201
1391 1391 a, g dbSNP:786202986
1396 1396 -, c dbSNP:63750713
1398 1398 a, c, g dbSNP:771610811
1399 1399 -, c dbSNP:587781892
1399 1399 c, t dbSNP:587778910
1400 1400 a, g dbSNP:267607820
1404 1404 c, t dbSNP:63750932
1408 1408 -, aaag dbSNP:267607828
1409 1409 -, aaga dbSNP:63751592
1410 1410 -, a dbSNP:63751677
1411 1411 -, gaga dbSNP:281864936
1411 1411 a, g dbSNP:63750616
1412 1412 -, a dbSNP:63751468
1413 1413 -, gacatcgggaaga dbSNP:587778912
1413 1413 -, ga dbSNP:281864937
1413 1413 a, g, t dbSNP:63750498
1418 1418 -, c dbSNP:63750482
1418 1418 c, g, t dbSNP:147939838
1419 1419 a, g dbSNP:63751083
1430 1430 g, t dbSNP:771282761
1439 1439 a, g dbSNP:559012648
1443 1443 c, t dbSNP:376642306
1445 1445 a, g dbSNP:774236450
1447 1447 -, a dbSNP:587778915
1448 1448 g, t dbSNP:730881741
1450 1450 c, t dbSNP:587778916
1451 1451 c, g dbSNP:63750314
1453 1453 a, t dbSNP:63750956
1455 1455 c, t dbSNP:532873141
1457 1457 c, t dbSNP:63749795
1458 1458 a, g dbSNP:587778917
1460 1460 a, t dbSNP:587778918
1461 1461 -, a dbSNP:63749876
1462 1462 -, ggaaa dbSNP:587778919
1466 1466 a, g dbSNP:776671941
1469 1469 -, a dbSNP:63751014
1472 1472 a, g dbSNP:63751145
1482 1482 -, c dbSNP:763560251
1483 1483 c, t dbSNP:764962961
1485 1485 a, c, g, t dbSNP:63750226
1487 1487 -, c dbSNP:63751031
1487 1487 -, c dbSNP:63750855
1487 1487 c, g, t dbSNP:200830026
1488 1488 a, g dbSNP:754554026
1489 1489 -, g dbSNP:63751435
1492 1492 a, g dbSNP:781525625
1495 1495 -, g dbSNP:63749793
1495 1495 g, t dbSNP:786202768
1496 1496 -, atc dbSNP:753409799
1497 1497 -, tca dbSNP:63751146
1498 1498 -, cat dbSNP:587778920
1499 1499 a, c dbSNP:748613173
1500 1500 c, g, t dbSNP:587780679
1505 1505 c, t dbSNP:145679961
1507 1507 c, t dbSNP:778216737
1510 1510 c, t dbSNP:749683911
1512 1512 a, g dbSNP:771044689
1513 1513 c, t dbSNP:774699212
1515 1515 c, t dbSNP:63749909
1518 1518 -, t dbSNP:63749916
1518 1518 -, t dbSNP:587778921
1523 1523 c, t dbSNP:267607829
1526 1526 c, t dbSNP:63749923
1531 1531 a, g dbSNP:745906843
1532 1532 g, t dbSNP:63751472
1539 1539 a, g dbSNP:772245091
1540 1540 -, t dbSNP:63750317
1540 1540 c, t dbSNP:775456144
1541 1541 a, g dbSNP:63750746
1547 1547 c, g, t dbSNP:63751705
1549 1549 a, g dbSNP:373322226
1550 1550 -, t dbSNP:587778924
1550 1550 -, c dbSNP:587778925
1552 1552 -, t dbSNP:63751689
1555 1555 -, t dbSNP:587778926
1559 1559 a, c dbSNP:63751688
1562 1562 c, t dbSNP:63751703
1563 1563 a, g, t dbSNP:63751630
1565 1565 a, g dbSNP:528463800
1567 1567 g, t dbSNP:63751680
1570 1570 -, gt dbSNP:587778928
1570 1570 c, g, t dbSNP:587779953
1571 1571 -, tt dbSNP:63751613
1571 1571 c, t dbSNP:63750137
1572 1572 a, t dbSNP:587778929
1574 1574 c, t dbSNP:63751281
1585 1585 c, t dbSNP:767089159
1586 1586 -, ttc dbSNP:587778930
1588 1588 c, g, t dbSNP:752241564
1589 1589 -, gt dbSNP:63750076
1589 1589 a, g dbSNP:764663152
1590 1590 -, tg dbSNP:587778931
1592 1592 a, g dbSNP:754447026
1594 1594 c, t dbSNP:63750000
1596 1596 a, g dbSNP:564240478
1607 1607 c, t dbSNP:63751277
1611 1611 a, g dbSNP:587778933
1612 1612 a, g dbSNP:267607842
1614 1614 a, c dbSNP:267607843
1618 1618 -, gg dbSNP:63750036
1618 1618 a, g dbSNP:786202409
1620 1620 -, c dbSNP:63750824
1620 1620 c, t dbSNP:757728402
1622 1622 c, t dbSNP:63750192
1623 1623 a, c, t dbSNP:63750511
1626 1626 a, g dbSNP:730881742
1628 1628 c, t dbSNP:63750413
1631 1631 a, g dbSNP:267607840
1635 1635 a, g dbSNP:587779954
1638 1638 a, t dbSNP:63750300
1640 1640 c, t dbSNP:780317287
1641 1641 -, ttata dbSNP:587778934
1642 1642 c, g dbSNP:63751087
1643 1643 c, t dbSNP:747090506
1644 1644 c, t dbSNP:63750289
1645 1645 c, t dbSNP:768770694
1647 1647 -, tct dbSNP:587778935
1647 1647 c, t dbSNP:63750193
1650 1650 a, c dbSNP:63750271
1651 1651 c, t dbSNP:587778936
1654 1654 -, cac dbSNP:267607841
1656 1656 -, cca dbSNP:63751641
1656 1656 c, t dbSNP:781270312
1662 1662 -, aagt dbSNP:267607699
1662 1662 c, t dbSNP:587778937
1663 1663 c, t dbSNP:749204990
1664 1664 a, g dbSNP:63751633
1665 1665 c, g, t dbSNP:63751596
1666 1666 -, t dbSNP:587778939
1667 1667 g, t dbSNP:63751244
1670 1670 g, t dbSNP:63751081
1673 1673 c, t dbSNP:780221881
1674 1674 g, t dbSNP:63750059
1675 1675 a, g dbSNP:786201538
1679 1679 c, t dbSNP:267607847
1681 1681 c, g dbSNP:63751393
1682 1682 c, t dbSNP:63751460
1687 1687 -, a dbSNP:63750464
1688 1688 -, ctca dbSNP:267607849
1688 1688 c, t dbSNP:786202693
1691 1691 a, t dbSNP:63750062
1694 1694 c, t dbSNP:730881743
1700 1700 a, t dbSNP:267607848
1707 1707 a, g dbSNP:375853155
1709 1709 c, t dbSNP:267607846
1712 1712 a, g dbSNP:587781796
1713 1713 a, g dbSNP:781178304
1715 1715 -, gt dbSNP:63751709
1719 1719 c, t dbSNP:63751608
1722 1722 c, g dbSNP:748185540
1723 1723 -, g dbSNP:63751685
1728 1728 c, g, t dbSNP:56185292
1729 1729 a, c, g dbSNP:63751657
1731 1731 a, g dbSNP:63751612
1740 1740 c, t dbSNP:63751684
1741 1741 a, c, g dbSNP:567838745
1742 1742 c, g, t dbSNP:63751713
1743 1743 c, t dbSNP:63751616
1743 1743 -, t dbSNP:587778942
1746 1746 -, tt dbSNP:587778943
1747 1747 -, t dbSNP:63750309
1752 1752 g, t dbSNP:267607865
1753 1753 c, t dbSNP:786202432
1754 1754 c, g dbSNP:63751176
1755 1755 -, t dbSNP:267607695
1755 1755 a, c dbSNP:63750587
1756 1756 -, c dbSNP:367543283
1756 1756 -, c dbSNP:63749863
1757 1757 a, c, g dbSNP:267607862
1758 1758 c, t dbSNP:587778945
1759 1759 a, g dbSNP:747665234
1761 1761 c, t dbSNP:63750575
1762 1762 -, t dbSNP:63751486
1764 1764 a, c dbSNP:63750016
1767 1767 -, taga dbSNP:63750147
1767 1767 -, t dbSNP:63749979
1768 1768 a, c dbSNP:769239969
1770 1770 -, atag dbSNP:63749868
1773 1773 a, c, g dbSNP:587782621
1776 1776 -, ca dbSNP:63750375
1777 1777 a, g dbSNP:786201766
1781 1781 -, ag dbSNP:63750035
1786 1786 c, t dbSNP:267607863
1788 1788 a, g dbSNP:63750604
1790 1790 a, g dbSNP:763381491
1797 1797 a, g dbSNP:267607861
1798 1798 -, agatggtcccaaagaagga dbSNP:587778946
1800 1800 a, g dbSNP:63750718
1806 1806 c, g, t dbSNP:63750876
1808 1808 a, t dbSNP:63750386
1810 1810 -, a dbSNP:63751240
1813 1813 a, g dbSNP:767748815
1818 1818 a, t dbSNP:41295284
1819 1819 -, t dbSNP:587778947
1820 1820 a, g dbSNP:147928948
1821 1821 a, c, t dbSNP:267607864
1829 1829 -, at dbSNP:63750150
1830 1830 -, acat dbSNP:587778948
1830 1830 c, t dbSNP:141688321
1832 1832 -, gtt dbSNP:267607859
1832 1832 a, g dbSNP:587779956
1833 1833 -, ttg dbSNP:63750486
1840 1840 g, t dbSNP:758353338
1843 1843 -, gaa dbSNP:587782285
1844 1844 -, aag dbSNP:121912962
1848 1848 a, c dbSNP:780199021
1849 1849 -, gaa dbSNP:267607858
1850 1850 -, aag dbSNP:63751247
1850 1850 aa, gc dbSNP:35502531
1850 1850 a, g, t dbSNP:35001569
1851 1851 a, c, g, t dbSNP:63750449
1851 1851 a, ttctt dbSNP:587778949
1852 1852 a, g dbSNP:786202638
1853 1853 c, g dbSNP:267607866
1853 1853 -, g dbSNP:63749986
1854 1854 a, c dbSNP:747708787
1856 1856 -, g dbSNP:786203456
1859 1859 a, g dbSNP:769488957
1863 1863 a, c, t dbSNP:63750693
1864 1864 -, t dbSNP:587778950
1865 1865 g, t dbSNP:587778951
1870 1870 c, t dbSNP:145535636
1872 1872 a, g dbSNP:748851107
1873 1873 g, t dbSNP:63751415
1874 1874 c, t dbSNP:377241633
1875 1875 -, tctcttt dbSNP:63751594
1875 1875 c, t dbSNP:587778952
1875 1875 -, t dbSNP:63750152
1876 1876 a, c, t dbSNP:63751214
1877 1877 -, tctt dbSNP:267607860
1877 1877 a, t dbSNP:63750846
1878 1878 -, cttt dbSNP:587778953
1882 1882 -, ggaaa dbSNP:63751639
1888 1888 -, t dbSNP:786201990
1888 1888 g, t dbSNP:774878438
1890 1890 a, c dbSNP:63750240
1891 1891 c, t dbSNP:786201289
1891 1891 -, t dbSNP:587778954
1894 1894 a, g dbSNP:63751632
1894 1894 -, g dbSNP:63751631
1895 1895 -, g dbSNP:63751643
1898 1898 a, g dbSNP:63750830
1899 1899 g, t dbSNP:786202396
1900 1900 a, g dbSNP:376866470
1900 1900 -, g dbSNP:587778956
1901 1901 -, a dbSNP:750300820
1902 1902 -, a dbSNP:587778957
1902 1902 a, g dbSNP:63751270
1903 1903 c, g dbSNP:63751047
1904 1904 -, tgat dbSNP:779795819
1905 1905 c, t dbSNP:63750825
1906 1906 a, g dbSNP:1800145
1910 1910 a, g, t dbSNP:63750549
1914 1914 -, t dbSNP:587778960
1914 1914 g, t dbSNP:63750079
1915 1915 a, g dbSNP:63750935