Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

MLH1 mutL homolog 1 [Homo sapiens (human)]

Gene Symbol MLH1
Entrez Gene ID 4292
Full Name mutL homolog 1
Synonyms COCA2, FCC2, HNPCC, HNPCC2, hMLH1
General protein information
Preferred Names
DNA mismatch repair protein Mlh1
DNA mismatch repair protein Mlh1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, hereditary nonpolyposis, type 2, 609310 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu37255 XM_005265161 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu20930 XM_005265163 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu20930 XM_005265164 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu37256 XM_005265166 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu58984 XM_011533727 PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu20930 NM_001258274 Homo sapiens mutL homolog 1 (MLH1), transcript variant 7, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu27476 NM_001258271 Homo sapiens mutL homolog 1 (MLH1), transcript variant 5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu20930 NM_001258273 Homo sapiens mutL homolog 1 (MLH1), transcript variant 6, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu26603 NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu27066 NM_001167617 Homo sapiens mutL homolog 1 (MLH1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu20930 NM_001167618 Homo sapiens mutL homolog 1 (MLH1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu20930 NM_001167619 Homo sapiens mutL homolog 1 (MLH1), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu37255D
Sequence Information ORF Nucleotide Sequence (Length: 2064bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Mlh1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)104..826(+)
Misc Feature(2)179..454(+)
Misc Feature(3)188..454(+)
Misc Feature(4)200..202(+)
Misc Feature(5)281..397(+)
Misc Feature(6)767..886(+)
Misc Feature(7)812..814(+)
Position Chain Variation Link
3 3 a, g dbSNP:558051715
8 8 a, t dbSNP:569951848
10 10 a, c dbSNP:753530414
25 25 g, t dbSNP:587779030
36 36 g, t dbSNP:587779020
42 42 a, c dbSNP:565334844
45 45 g, t dbSNP:753503730
46 46 c, t dbSNP:587781459
47 47 c, t dbSNP:41285097
48 48 a, g dbSNP:527826980
52 52 a, g dbSNP:749884419
53 53 a, g dbSNP:757995494
55 55 a, c, g dbSNP:780702356
56 56 g, t dbSNP:201247839
57 57 -, t dbSNP:747856324
59 59 a, c dbSNP:781364168
61 61 a, c, g, t dbSNP:56198082
62 62 a, c, t dbSNP:587779001
67 67 c, t dbSNP:771060933
68 68 c, t dbSNP:775371644
69 69 c, t dbSNP:760575557
74 74 c, t dbSNP:764112241
75 75 c, t dbSNP:730881744
77 77 c, t dbSNP:730881745
78 78 c, t dbSNP:776898290
81 81 g, t dbSNP:761672073
82 82 c, t dbSNP:104894994
89 89 a, g dbSNP:587778967
90 90 a, c, g, t dbSNP:111052004
91 91 a, g dbSNP:72481822
93 93 a, c, t dbSNP:587779029
94 94 c, g dbSNP:757950578
97 97 -, c dbSNP:63750745
97 97 c, g dbSNP:779759678
103 103 -, aggggttattcggc dbSNP:63751891
106 106 -, ggttattcggcggctgg dbSNP:63751892
106 106 a, g dbSNP:786202312
107 107 -, gttattcggcggctgga dbSNP:267607702
107 107 g, t dbSNP:730881746
108 108 g, t dbSNP:755402059
109 109 c, t dbSNP:781725830
110 110 -, a dbSNP:587778996
112 112 a, t dbSNP:748406142
113 113 c, t dbSNP:587779000
115 115 a, g, t dbSNP:759680369
117 117 a, g dbSNP:777971423
119 119 -, c dbSNP:63749816
122 122 a, g dbSNP:749548566
124 124 c, g dbSNP:587782181
125 125 a, g, t dbSNP:587779008
125 125 -, g dbSNP:63750081
126 126 -, ccca dbSNP:63750057
127 127 a, g dbSNP:1800143
128 128 -, ga dbSNP:587779013
129 129 c, t dbSNP:774363593
130 130 a, c dbSNP:369737664
132 132 -, t dbSNP:63751131
133 133 c, g dbSNP:768409958
134 134 c, g dbSNP:776643257
139 139 c, t dbSNP:761498953
140 140 -, c dbSNP:63749804
140 140 c, g, t dbSNP:367654552
143 143 a, t dbSNP:63750648
145 145 c, t dbSNP:762647509
149 149 -, g dbSNP:63750581
150 150 a, c, t dbSNP:63750706
153 153 c, g dbSNP:41295280
155 155 a, g, t dbSNP:63750823
155 155 -, g dbSNP:63750822
156 156 a, g dbSNP:750969880
157 157 a, g, t dbSNP:63750555
158 158 -, g dbSNP:63751396
159 159 g, t dbSNP:754533438
161 161 -, a dbSNP:63749839
161 161 a, t dbSNP:63749838
162 162 c, t dbSNP:63750514
163 163 c, t dbSNP:753317868
164 164 -, c dbSNP:63749828
164 164 c, t dbSNP:63749827
166 166 -, g dbSNP:587779040
167 167 c, t dbSNP:756398627
168 168 a, c, g dbSNP:138705565
171 171 c, t dbSNP:63750792
172 172 -, a dbSNP:587779045
173 173 g, t dbSNP:63750656
174 174 c, g dbSNP:63750216
179 179 gc, tg dbSNP:63749994
179 179 g, t dbSNP:749671520
180 180 c, g dbSNP:730882127
182 182 a, g dbSNP:2020872
189 189 a, c dbSNP:63750044
190 190 -, ga dbSNP:63749813
190 190 c, g dbSNP:745876152
192 192 -, aa dbSNP:587778882
192 192 ac, tg dbSNP:121912965
192 192 g, t dbSNP:63749906
194 194 -, aa dbSNP:63750371
194 194 a, g dbSNP:772251284
195 195 a, c, t dbSNP:267607707
196 196 c, g, t dbSNP:730881747
197 197 a, g, t dbSNP:63751012
200 200 a, c, g dbSNP:63750580
201 201 a, g dbSNP:587778888
202 202 c, g dbSNP:267607706
203 203 c, t dbSNP:587778890
204 204 a, g, t dbSNP:63751701
207 207 -, t dbSNP:587778896
209 209 c, g dbSNP:267607713
210 210 a, g dbSNP:63751094
213 213 c, g, t dbSNP:587778901
217 217 -, a dbSNP:63750867
218 218 g, t dbSNP:63750939
219 219 -, aatc dbSNP:63751431
219 219 c, t dbSNP:63751109
221 221 acaagta, tgtt dbSNP:587778904
222 222 c, g dbSNP:759287108
224 224 a, g dbSNP:771649701
225 225 g, t dbSNP:63749833
230 230 c, t dbSNP:587778913
231 231 a, c dbSNP:587778914
232 232 a, c dbSNP:147342421
233 233 a, g dbSNP:760185532
234 234 a, t dbSNP:63750098
238 238 -, t dbSNP:63749956
241 241 -, t dbSNP:587778922
242 242 -, aaag dbSNP:267607714
242 242 a, t dbSNP:63751401
243 243 -, aaga dbSNP:587778923
243 243 -, aa dbSNP:730881733
244 244 -, a dbSNP:63750028
244 244 -, a dbSNP:587778927
245 245 g, t dbSNP:63751199
246 246 a, c dbSNP:63750263
249 249 -, gagg dbSNP:587778932
249 249 a, g dbSNP:63751267
249 249 -, g dbSNP:63751266
256 256 g, t dbSNP:764529553
257 257 a, c, t dbSNP:63750877
258 258 a, c dbSNP:587779955
262 262 a, g dbSNP:762162504
263 263 -, a dbSNP:587778944
268 268 a, g dbSNP:63751398
272 272 a, c, t dbSNP:63751428
275 275 a, g dbSNP:63750850
277 277 a, c, t dbSNP:587778955
278 278 -, aa dbSNP:63750469
279 279 -, a dbSNP:63751255
279 279 a, g dbSNP:63750952
282 282 a, g dbSNP:63751465
283 283 -, c dbSNP:267607715
286 286 -, c dbSNP:587778966
286 286 c, t dbSNP:61751642
287 287 a, g, t dbSNP:63750206
288 288 a, g dbSNP:63749939
289 289 -, g dbSNP:587778968
290 290 a, g dbSNP:63750452
291 291 a, t dbSNP:63750281
292 292 c, g dbSNP:780141938
293 293 -, a dbSNP:63751704
293 293 a, g dbSNP:63750719
294 294 a, g dbSNP:63751661
297 297 -, aagaaga dbSNP:730881734
298 298 -, agaa dbSNP:267607723
298 298 a, c dbSNP:63751191
299 299 -, gaa dbSNP:267607724
299 299 c, g, t dbSNP:63749829
301 301 -, aga dbSNP:63751642
304 304 c, t dbSNP:63750621
305 305 c, g dbSNP:766608278
306 306 c, g, t dbSNP:397514684
307 307 a, g dbSNP:587778988
309 309 a, t dbSNP:751894165
310 310 c, t dbSNP:755073786
316 316 a, g dbSNP:767750489
317 317 c, t dbSNP:63749859
318 318 a, g dbSNP:63750437
319 319 -, tg dbSNP:63750052
319 319 a, t dbSNP:63750856
320 320 -, g dbSNP:587778997
323 323 a, c dbSNP:786203362
325 325 g, t dbSNP:752850761
326 326 g, t dbSNP:63749990
327 327 a, t dbSNP:753404814
329 329 a, g dbSNP:786203745
330 330 c, t dbSNP:63751069
331 331 g, t dbSNP:778724501
332 332 -, a dbSNP:267607729
332 332 a, g dbSNP:587778998
333 333 -, cta dbSNP:786202328
333 333 c, t dbSNP:63750005
336 336 g, t dbSNP:587778999
338 338 a, g dbSNP:63750641
341 341 c, t dbSNP:63750659
344 344 c, t dbSNP:63751421
349 349 -, c dbSNP:267607728
349 349 c, t dbSNP:63750923
352 352 g, t dbSNP:182963667
353 353 c, g, t dbSNP:11541859
354 354 a, g dbSNP:758110228
355 355 a, g dbSNP:746705035
360 360 a, t dbSNP:63751137
362 362 c, g dbSNP:63750133
363 363 c, t dbSNP:768132746
365 365 a, g dbSNP:41295282
371 371 g, t dbSNP:63751070
374 374 a, g dbSNP:770276731
378 378 a, g dbSNP:773647920
379 379 a, t dbSNP:63750651
380 380 a, c, g dbSNP:267607725
381 381 -, gctttcgaggtg dbSNP:63751691
385 385 a, t dbSNP:267607730
386 386 c, t dbSNP:63751221
387 387 a, c, g dbSNP:63750266
389 389 a, g dbSNP:267607726
390 390 a, g, t dbSNP:267607727
391 391 g, t dbSNP:4647220
392 392 a, g dbSNP:63750453
394 394 a, c, g, t dbSNP:63751665
395 395 c, g dbSNP:587779003
399 399 a, t dbSNP:63751397
405 405 a, g dbSNP:368208495
406 406 a, c, g dbSNP:63750297
407 407 a, g dbSNP:572906317
408 408 g, t dbSNP:63750507
414 414 a, c dbSNP:587779004
415 415 g, t dbSNP:63749803
419 419 c, g dbSNP:587779005
420 420 c, t dbSNP:63750539
423 423 a, g dbSNP:775914775
426 426 a, t dbSNP:63750559
429 429 -, c dbSNP:63750645
431 431 a, g dbSNP:371667663
432 432 c, t dbSNP:764120517
434 434 -, a dbSNP:267607739
434 434 -, a dbSNP:63750906
434 434 a, g dbSNP:750353040
435 435 a, c, g dbSNP:63750465
438 438 c, g, t dbSNP:63750781
439 439 a, g dbSNP:61751643
440 440 a, c dbSNP:766308335
443 443 -, aa dbSNP:63750658
444 444 -, aa dbSNP:63750841
447 447 c, t dbSNP:267607740
450 450 a, g dbSNP:730881735
455 455 a, t dbSNP:63750542
457 457 a, g dbSNP:754824181
458 458 c, t dbSNP:780816243
459 459 a, g dbSNP:730881736
460 460 -, tg dbSNP:587779006
463 463 a, g dbSNP:1800144
464 464 a, t dbSNP:200076893
465 465 a, g dbSNP:267607741
466 466 -, c dbSNP:63751607
466 466 c, g, t dbSNP:63751606
467 467 a, c dbSNP:587779007
468 468 a, g, t dbSNP:63751595
470 470 gcaagttactcagatggaaaa, t dbSNP:267607746
470 470 c, g dbSNP:63750866
470 470 -, g dbSNP:63750865
473 473 ag, gtt dbSNP:63751710
474 474 a, g dbSNP:755678310
476 476 c, t dbSNP:587779010
476 476 -, t dbSNP:587779009
477 477 -, a dbSNP:587779012
477 477 a, g dbSNP:587779011
480 480 a, c dbSNP:63749818
482 482 c, g dbSNP:28930073
485 485 g, t dbSNP:63751124
491 491 c, g dbSNP:63751052
492 492 -, tgaa dbSNP:587779014
492 492 g, t dbSNP:753233578
497 497 a, g dbSNP:756888142
498 498 c, t dbSNP:63750817
503 503 c, g dbSNP:779562531
508 508 -, a dbSNP:587779015
509 509 c, g dbSNP:63750977
510 510 c, g, t dbSNP:746419577
511 511 a, g dbSNP:201176051
512 512 c, t dbSNP:780232692
516 516 -, c dbSNP:63751045
524 524 c, t dbSNP:63749820
526 526 a, g dbSNP:377279035
527 527 c, g dbSNP:267607747
533 533 c, t dbSNP:63751302
535 535 c, g dbSNP:63750638
537 537 a, t dbSNP:786202495
539 539 -, acg dbSNP:587779016
540 540 c, t dbSNP:776969475
541 541 a, g dbSNP:369521379
542 542 a, g dbSNP:748417604
546 546 a, g dbSNP:770023778
550 550 c, t dbSNP:192938577
551 551 a, c dbSNP:749370894
552 552 g, t dbSNP:63750891
556 556 -, tt dbSNP:267607758
557 557 -, t dbSNP:63751101
559 559 a, c dbSNP:74396541
560 560 a, c dbSNP:63751242
562 562 c, t dbSNP:4647256
563 563 a, g dbSNP:370900909
564 564 c, t dbSNP:775560085
567 567 c, t dbSNP:63749924
570 570 c, t dbSNP:763992299
571 571 a, g dbSNP:776402672
574 574 -, gag dbSNP:587781788
575 575 a, c dbSNP:748500860
576 576 -, g dbSNP:267607754
580 580 a, c dbSNP:765014361
585 585 a, t dbSNP:267607755
585 585 -, t dbSNP:587779018
586 586 a, c dbSNP:267607757
590 590 -, aa dbSNP:267607756
591 591 -, a dbSNP:63749959
594 594 c, t dbSNP:63750834
601 601 -, a dbSNP:63749944
601 601 a, g dbSNP:779148982
604 604 a, g dbSNP:748128054
611 611 -, ag dbSNP:63749799
612 612 -, ga dbSNP:587779019
618 618 c, t dbSNP:758040210
619 619 at, ct, gg dbSNP:63750903
622 622 a, g dbSNP:786202121
623 623 g, t dbSNP:766791816
627 627 -, ttg dbSNP:786201988
627 627 c, g, t dbSNP:63750102
632 632 a, g dbSNP:63750211
633 633 a, g dbSNP:587779021
640 640 a, t dbSNP:35225190
641 641 c, g dbSNP:63750012
642 642 a, g, t dbSNP:63750515
644 644 c, t dbSNP:11541862
646 646 c, t dbSNP:63751050
651 651 c, t dbSNP:777971431
656 656 a, g dbSNP:786202038
660 660 g, t dbSNP:267607766
661 661 c, t dbSNP:754102133
665 665 c, t dbSNP:63751021
666 666 c, g dbSNP:63751480
667 667 a, g dbSNP:587781038
671 671 -, a dbSNP:35847123
674 674 a, t dbSNP:63750500
676 676 -, a dbSNP:63751653
683 683 c, g dbSNP:63749887
684 684 -, ag dbSNP:267607704
685 685 -, ga dbSNP:63751637
689 689 a, c, g dbSNP:534184145
695 695 a, g dbSNP:63750085
696 696 a, t dbSNP:749037674
709 709 a, g dbSNP:770554901
710 710 c, t dbSNP:587781509
714 714 a, c, g dbSNP:150478207
720 720 -, t dbSNP:63750908
722 722 a, g dbSNP:771612764
724 724 c, t dbSNP:138735345
725 725 a, g, t dbSNP:2308317
732 732 a, g dbSNP:267607775
735 735 g, t dbSNP:267607776
737 737 -, c dbSNP:63750380
737 737 c, t dbSNP:4986984
738 738 a, c, g dbSNP:762099920
740 740 c, t dbSNP:750650349
743 743 a, c, g dbSNP:1799977
753 753 -, a dbSNP:63750385
753 753 -, a dbSNP:63751286
753 753 a, g dbSNP:766517126
754 754 g, t dbSNP:751719069
756 756 c, t dbSNP:756045117
760 760 c, t dbSNP:786202912
760 760 -, t dbSNP:587779031
761 761 -, agtc dbSNP:267607774
761 761 a, g dbSNP:587781926
762 762 -, g dbSNP:63749842
764 764 c, t dbSNP:63751615
765 765 a, g, t dbSNP:63751711
768 768 -, t, tcctgacagttt dbSNP:63751620
768 768 c, g, t dbSNP:63750547
769 769 -, tcctgacagttt dbSNP:63751636
769 769 -, a dbSNP:267607809
770 770 a, g, t dbSNP:63750736
778 778 c, t dbSNP:767068637
779 779 a, c dbSNP:752430684
782 782 -, c dbSNP:587779052
782 782 c, t dbSNP:63750489
789 789 a, t dbSNP:267607813
792 792 a, g, t dbSNP:63750993
795 795 -, ttaatgtgcaccccacaaagcatg dbSNP:587779053
798 798 a, g dbSNP:755553895
799 799 a, t dbSNP:587779054
800 800 a, g dbSNP:786202196
803 803 -, gc dbSNP:63750962
806 806 c, t dbSNP:267607808
808 808 a, c, t dbSNP:63749896
809 809 -, a dbSNP:587779055
809 809 a, g dbSNP:779581111
810 810 a, c dbSNP:746206527
811 811 a, c dbSNP:587779056
816 816 -, a dbSNP:63750319
820 820 -, a dbSNP:63751259
824 824 c, t dbSNP:151119913
825 825 a, c dbSNP:786202114
826 826 c, g dbSNP:587779959
830 830 a, c dbSNP:267607814
835 835 a, c, t dbSNP:146777069
835 835 -, c dbSNP:63749926
836 836 a, g, t dbSNP:63750796
841 841 c, g dbSNP:267607811
843 843 a, g, t dbSNP:63750286
852 852 -, agcgggtgc dbSNP:63751404
852 852 -, a dbSNP:587781554
855 855 -, gggtgcagc dbSNP:587779057
855 855 a, g dbSNP:63750268
857 857 a, g dbSNP:730881739
857 857 -, g dbSNP:786204317
858 858 c, t dbSNP:63751049
860 860 c, g dbSNP:587782087
863 863 c, t dbSNP:587779058
865 865 -, gcacatcgagagca dbSNP:587782265
866 866 a, c, t dbSNP:267607810
867 867 a, c dbSNP:63750710
868 868 -, cat dbSNP:267607807
869 869 -, atc dbSNP:63751197
871 871 c, t dbSNP:372578171
872 872 a, g dbSNP:550914672
875 875 -, a dbSNP:63750533
877 877 c, t dbSNP:775167683
884 884 c, t dbSNP:267607812
888 888 a, g dbSNP:587781750
888 888 -, g dbSNP:63750434
891 891 c, g dbSNP:763847201
892 892 -, c dbSNP:63750677
892 892 -, c dbSNP:63750853
894 894 a, g dbSNP:63751467
898 898 -, c dbSNP:63750339
900 900 c, t dbSNP:191257018
901 901 c, g dbSNP:374770981
904 904 -, g dbSNP:63749837
907 907 -, g dbSNP:587778881
915 915 c, t dbSNP:750980386
916 916 c, t dbSNP:758668630
918 918 a, g dbSNP:63751609
919 919 a, c, g, t dbSNP:63751715
921 921 a, c dbSNP:201541505
924 924 c, t dbSNP:755401753
927 927 -, t dbSNP:267607822
931 931 -, a dbSNP:587778883
931 931 a, g dbSNP:137937003
937 937 a, t dbSNP:63750156
939 939 c, t dbSNP:63751265
941 941 a, g dbSNP:752962453
942 942 -, g dbSNP:63750472
943 943 c, t dbSNP:730881748
944 944 c, t dbSNP:756347993
945 945 c, t dbSNP:587782467
948 948 c, t dbSNP:749334262
949 949 -, tggggaga dbSNP:63750038
951 951 g, t dbSNP:730881740
952 952 -, ggagatgg dbSNP:587778884
953 953 -, g dbSNP:587778885
955 955 a, g dbSNP:587780533
957 957 c, t dbSNP:779917781
962 962 a, g dbSNP:786201875
971 971 a, g dbSNP:63749864
976 976 c, g, t dbSNP:746800098
981 981 a, c dbSNP:776402584
982 982 -, c dbSNP:63750715
984 984 c, t dbSNP:201673334
985 985 a, g dbSNP:769364808
988 988 c, t dbSNP:772718909
992 992 a, g dbSNP:762426947
998 998 a, g dbSNP:766904735
999 999 a, g dbSNP:774878513
1003 1003 g, t dbSNP:759868546
1009 1009 -, at dbSNP:730880011
1009 1009 c, t dbSNP:267607824
1010 1010 -, ta dbSNP:63750305
1013 1013 a, gtc dbSNP:587778887
1017 1017 a, c, g, t dbSNP:143009528
1021 1021 c, t dbSNP:786201611
1022 1022 c, t dbSNP:63750557
1025 1025 c, g dbSNP:778315874
1026 1026 -, a dbSNP:587778889
1029 1029 c, t dbSNP:141344760
1031 1031 a, g dbSNP:757350157
1031 1031 -, g dbSNP:63749965
1032 1032 a, t dbSNP:63750447
1034 1034 c, t dbSNP:63750760
1035 1035 a, c, g dbSNP:63750430
1040 1040 a, g dbSNP:781096630
1042 1042 c, t dbSNP:747967333
1044 1044 -, nnnn dbSNP:587778893
1046 1046 a, c, t dbSNP:61751644
1047 1047 a, g dbSNP:63750361
1048 1048 a, g dbSNP:772805767
1052 1052 c, t dbSNP:587778894
1053 1053 a, g dbSNP:587782884
1056 1056 a, g dbSNP:587780678
1059 1059 g, t dbSNP:786203413
1071 1071 -, t dbSNP:63750749
1072 1072 a, g, t dbSNP:35164771
1073 1073 c, g, t dbSNP:63750483
1079 1079 c, g dbSNP:63751485
1081 1081 a, g dbSNP:786203363
1083 1083 a, g dbSNP:587779951
1088 1088 c, t dbSNP:587778897
1091 1091 -, c dbSNP:587778898
1091 1091 -, ct dbSNP:63751015
1096 1096 c, t dbSNP:773869705
1098 1098 a, g dbSNP:41294980
1099 1099 -, t dbSNP:587778900
1104 1104 -, gtcagcc dbSNP:587778899
1106 1106 c, t dbSNP:63751153
1107 1107 a, c, g dbSNP:104895000
1108 1108 c, g dbSNP:775776362
1110 1110 c, t dbSNP:761006237
1111 1111 c, t dbSNP:764377126
1112 1112 a, g dbSNP:535470039
1113 1113 g, t dbSNP:786201951
1117 1117 c, t dbSNP:369576099
1119 1119 c, t dbSNP:63750766
1120 1120 a, g dbSNP:786203274
1124 1124 a, g dbSNP:373767220
1126 1126 g, t dbSNP:750563193
1127 1127 a, g dbSNP:267607823
1133 1133 -, ga dbSNP:63751118
1134 1134 a, g dbSNP:754898711
1135 1135 a, g, t dbSNP:63751440
1136 1136 a, g dbSNP:781335662
1137 1137 c, t dbSNP:377484262
1138 1138 -, ttctagtggcagggcta dbSNP:786203893
1140 1140 c, g dbSNP:63751179
1142 1142 -, a dbSNP:63750293
1142 1142 a, g dbSNP:755898663
1147 1147 c, t dbSNP:63750791
1149 1149 a, g dbSNP:370687064
1150 1150 a, g dbSNP:373076967
1151 1151 a, g dbSNP:377433038
1152 1152 c, g dbSNP:745393750
1157 1157 c, t dbSNP:63750316
1165 1165 c, t dbSNP:772555970
1174 1174 a, g dbSNP:776044212
1176 1176 a, t dbSNP:761070985
1178 1178 c, g dbSNP:63750443
1184 1184 a, c dbSNP:786202922
1185 1185 c, t dbSNP:63751414
1190 1190 c, g dbSNP:587782273
1191 1191 -, c dbSNP:63750748
1202 1202 a, g dbSNP:63750365
1205 1205 a, g dbSNP:761903819
1206 1206 ccaaaaatcagagcttggaggg, nnnnn dbSNP:587778903
1206 1206 c, g dbSNP:765563111
1208 1208 a, c dbSNP:34213726
1212 1212 a, g dbSNP:763189331
1215 1215 -, a dbSNP:63749845
1224 1224 -, a dbSNP:63749981
1225 1225 g, t dbSNP:587779952
1228 1228 ggatacaacaaaggggacttc, taaa dbSNP:587778905
1229 1229 -, g dbSNP:587778906
1229 1229 g, t dbSNP:752622244
1235 1235 -, a dbSNP:63750071
1235 1235 a, t dbSNP:34285587
1240 1240 c, g dbSNP:756099600
1241 1241 c, g dbSNP:63750527
1243 1243 -, g dbSNP:267607821
1243 1243 -, g dbSNP:587778907
1246 1246 a, t dbSNP:753671152
1249 1249 a, g dbSNP:786203279
1251 1251 a, t dbSNP:786203236
1254 1254 a, t dbSNP:63750390
1258 1258 -, a dbSNP:63750020
1258 1258 -, a dbSNP:587778908
1259 1259 a, g dbSNP:756843954
1260 1260 a, c dbSNP:202038499
1261 1261 -, ga dbSNP:587778909
1261 1261 -, t dbSNP:267607697
1262 1262 a, t dbSNP:63750540
1264 1264 c, g, t dbSNP:63751293
1273 1273 c, t dbSNP:63750201
1274 1274 a, g dbSNP:786202986
1279 1279 -, c dbSNP:63750713
1281 1281 a, c, g dbSNP:771610811
1282 1282 -, c dbSNP:587781892
1282 1282 c, t dbSNP:587778910
1283 1283 a, g dbSNP:267607820
1287 1287 c, t dbSNP:63750932
1291 1291 -, aaag dbSNP:267607828
1292 1292 -, aaga dbSNP:63751592
1293 1293 -, a dbSNP:63751677
1294 1294 -, gaga dbSNP:281864936
1294 1294 a, g dbSNP:63750616
1295 1295 -, a dbSNP:63751468
1296 1296 -, gacatcgggaaga dbSNP:587778912
1296 1296 -, ga dbSNP:281864937
1296 1296 a, g, t dbSNP:63750498
1301 1301 -, c dbSNP:63750482
1301 1301 c, g, t dbSNP:147939838
1302 1302 a, g dbSNP:63751083
1313 1313 g, t dbSNP:771282761
1322 1322 a, g dbSNP:559012648
1326 1326 c, t dbSNP:376642306
1328 1328 a, g dbSNP:774236450
1330 1330 -, a dbSNP:587778915
1331 1331 g, t dbSNP:730881741
1333 1333 c, t dbSNP:587778916
1334 1334 c, g dbSNP:63750314
1336 1336 a, t dbSNP:63750956
1338 1338 c, t dbSNP:532873141
1340 1340 c, t dbSNP:63749795
1341 1341 a, g dbSNP:587778917
1343 1343 a, t dbSNP:587778918
1344 1344 -, a dbSNP:63749876
1345 1345 -, ggaaa dbSNP:587778919
1349 1349 a, g dbSNP:776671941
1352 1352 -, a dbSNP:63751014
1355 1355 a, g dbSNP:63751145
1365 1365 -, c dbSNP:763560251
1366 1366 c, t dbSNP:764962961
1368 1368 a, c, g, t dbSNP:63750226
1370 1370 -, c dbSNP:63751031
1370 1370 -, c dbSNP:63750855
1370 1370 c, g, t dbSNP:200830026
1371 1371 a, g dbSNP:754554026
1372 1372 -, g dbSNP:63751435
1375 1375 a, g dbSNP:781525625
1378 1378 -, g dbSNP:63749793
1378 1378 g, t dbSNP:786202768
1379 1379 -, atc dbSNP:753409799
1380 1380 -, tca dbSNP:63751146
1381 1381 -, cat dbSNP:587778920
1382 1382 a, c dbSNP:748613173
1383 1383 c, g, t dbSNP:587780679
1388 1388 c, t dbSNP:145679961
1390 1390 c, t dbSNP:778216737
1393 1393 c, t dbSNP:749683911
1395 1395 a, g dbSNP:771044689
1396 1396 c, t dbSNP:774699212
1398 1398 c, t dbSNP:63749909
1401 1401 -, t dbSNP:63749916
1401 1401 -, t dbSNP:587778921
1406 1406 c, t dbSNP:267607829
1409 1409 c, t dbSNP:63749923
1414 1414 a, g dbSNP:745906843
1415 1415 g, t dbSNP:63751472
1422 1422 a, g dbSNP:772245091
1423 1423 -, t dbSNP:63750317
1423 1423 c, t dbSNP:775456144
1424 1424 a, g dbSNP:63750746
1430 1430 c, g, t dbSNP:63751705
1432 1432 a, g dbSNP:373322226
1433 1433 -, t dbSNP:587778924
1433 1433 -, c dbSNP:587778925
1435 1435 -, t dbSNP:63751689
1438 1438 -, t dbSNP:587778926
1442 1442 a, c dbSNP:63751688
1445 1445 c, t dbSNP:63751703
1446 1446 a, g, t dbSNP:63751630
1448 1448 a, g dbSNP:528463800
1450 1450 g, t dbSNP:63751680
1453 1453 -, gt dbSNP:587778928
1453 1453 c, g, t dbSNP:587779953
1454 1454 -, tt dbSNP:63751613
1454 1454 c, t dbSNP:63750137
1455 1455 a, t dbSNP:587778929
1457 1457 c, t dbSNP:63751281
1468 1468 c, t dbSNP:767089159
1469 1469 -, ttc dbSNP:587778930
1471 1471 c, g, t dbSNP:752241564
1472 1472 -, gt dbSNP:63750076
1472 1472 a, g dbSNP:764663152
1473 1473 -, tg dbSNP:587778931
1475 1475 a, g dbSNP:754447026
1477 1477 c, t dbSNP:63750000
1479 1479 a, g dbSNP:564240478
1490 1490 c, t dbSNP:63751277
1494 1494 a, g dbSNP:587778933
1495 1495 a, g dbSNP:267607842
1497 1497 a, c dbSNP:267607843
1501 1501 -, gg dbSNP:63750036
1501 1501 a, g dbSNP:786202409
1503 1503 -, c dbSNP:63750824
1503 1503 c, t dbSNP:757728402
1505 1505 c, t dbSNP:63750192
1506 1506 a, c, t dbSNP:63750511
1509 1509 a, g dbSNP:730881742
1511 1511 c, t dbSNP:63750413
1514 1514 a, g dbSNP:267607840
1518 1518 a, g dbSNP:587779954
1521 1521 a, t dbSNP:63750300
1523 1523 c, t dbSNP:780317287
1524 1524 -, ttata dbSNP:587778934
1525 1525 c, g dbSNP:63751087
1526 1526 c, t dbSNP:747090506
1527 1527 c, t dbSNP:63750289
1528 1528 c, t dbSNP:768770694
1530 1530 -, tct dbSNP:587778935
1530 1530 c, t dbSNP:63750193
1533 1533 a, c dbSNP:63750271
1534 1534 c, t dbSNP:587778936
1537 1537 -, cac dbSNP:267607841
1539 1539 -, cca dbSNP:63751641
1539 1539 c, t dbSNP:781270312
1545 1545 -, aagt dbSNP:267607699
1545 1545 c, t dbSNP:587778937
1546 1546 c, t dbSNP:749204990
1547 1547 a, g dbSNP:63751633
1548 1548 c, g, t dbSNP:63751596
1549 1549 -, t dbSNP:587778939
1550 1550 g, t dbSNP:63751244
1553 1553 g, t dbSNP:63751081
1556 1556 c, t dbSNP:780221881
1557 1557 g, t dbSNP:63750059
1558 1558 a, g dbSNP:786201538
1562 1562 c, t dbSNP:267607847
1564 1564 c, g dbSNP:63751393
1565 1565 c, t dbSNP:63751460
1570 1570 -, a dbSNP:63750464
1571 1571 -, ctca dbSNP:267607849
1571 1571 c, t dbSNP:786202693
1574 1574 a, t dbSNP:63750062
1577 1577 c, t dbSNP:730881743
1583 1583 a, t dbSNP:267607848
1590 1590 a, g dbSNP:375853155
1592 1592 c, t dbSNP:267607846
1595 1595 a, g dbSNP:587781796
1596 1596 a, g dbSNP:781178304
1598 1598 -, gt dbSNP:63751709
1602 1602 c, t dbSNP:63751608
1605 1605 c, g dbSNP:748185540
1606 1606 -, g dbSNP:63751685
1611 1611 c, g, t dbSNP:56185292
1612 1612 a, c, g dbSNP:63751657
1614 1614 a, g dbSNP:63751612
1623 1623 c, t dbSNP:63751684
1624 1624 a, c, g dbSNP:567838745
1625 1625 c, g, t dbSNP:63751713
1626 1626 c, t dbSNP:63751616
1626 1626 -, t dbSNP:587778942
1629 1629 -, tt dbSNP:587778943
1630 1630 -, t dbSNP:63750309
1635 1635 g, t dbSNP:267607865
1636 1636 c, t dbSNP:786202432
1637 1637 c, g dbSNP:63751176
1638 1638 -, t dbSNP:267607695
1638 1638 a, c dbSNP:63750587
1639 1639 -, c dbSNP:367543283
1639 1639 -, c dbSNP:63749863
1640 1640 a, c, g dbSNP:267607862
1641 1641 c, t dbSNP:587778945
1642 1642 a, g dbSNP:747665234
1644 1644 c, t dbSNP:63750575
1645 1645 -, t dbSNP:63751486
1647 1647 a, c dbSNP:63750016
1650 1650 -, taga dbSNP:63750147
1650 1650 -, t dbSNP:63749979
1651 1651 a, c dbSNP:769239969
1653 1653 -, atag dbSNP:63749868
1656 1656 a, c, g dbSNP:587782621
1659 1659 -, ca dbSNP:63750375
1660 1660 a, g dbSNP:786201766
1664 1664 -, ag dbSNP:63750035
1669 1669 c, t dbSNP:267607863
1671 1671 a, g dbSNP:63750604
1673 1673 a, g dbSNP:763381491
1680 1680 a, g dbSNP:267607861
1681 1681 -, agatggtcccaaagaagga dbSNP:587778946
1683 1683 a, g dbSNP:63750718
1689 1689 c, g, t dbSNP:63750876
1691 1691 a, t dbSNP:63750386
1693 1693 -, a dbSNP:63751240
1696 1696 a, g dbSNP:767748815
1701 1701 a, t dbSNP:41295284
1702 1702 -, t dbSNP:587778947
1703 1703 a, g dbSNP:147928948
1704 1704 a, c, t dbSNP:267607864
1712 1712 -, at dbSNP:63750150
1713 1713 -, acat dbSNP:587778948
1713 1713 c, t dbSNP:141688321
1715 1715 -, gtt dbSNP:267607859
1715 1715 a, g dbSNP:587779956
1716 1716 -, ttg dbSNP:63750486
1723 1723 g, t dbSNP:758353338
1726 1726 -, gaa dbSNP:587782285
1727 1727 -, aag dbSNP:121912962
1731 1731 a, c dbSNP:780199021
1732 1732 -, gaa dbSNP:267607858
1733 1733 -, aag dbSNP:63751247
1733 1733 aa, gc dbSNP:35502531
1733 1733 a, g, t dbSNP:35001569
1734 1734 a, c, g, t dbSNP:63750449
1734 1734 a, ttctt dbSNP:587778949
1735 1735 a, g dbSNP:786202638
1736 1736 c, g dbSNP:267607866
1736 1736 -, g dbSNP:63749986
1737 1737 a, c dbSNP:747708787
1739 1739 -, g dbSNP:786203456
1742 1742 a, g dbSNP:769488957
1746 1746 a, c, t dbSNP:63750693
1747 1747 -, t dbSNP:587778950
1748 1748 g, t dbSNP:587778951
1753 1753 c, t dbSNP:145535636
1755 1755 a, g dbSNP:748851107
1756 1756 g, t dbSNP:63751415
1757 1757 c, t dbSNP:377241633
1758 1758 -, tctcttt dbSNP:63751594
1758 1758 c, t dbSNP:587778952
1758 1758 -, t dbSNP:63750152
1759 1759 a, c, t dbSNP:63751214
1760 1760 -, tctt dbSNP:267607860
1760 1760 a, t dbSNP:63750846
1761 1761 -, cttt dbSNP:587778953
1765 1765 -, ggaaa dbSNP:63751639
1771 1771 -, t dbSNP:786201990
1771 1771 g, t dbSNP:774878438
1773 1773 a, c dbSNP:63750240
1774 1774 c, t dbSNP:786201289
1774 1774 -, t dbSNP:587778954
1777 1777 a, g dbSNP:63751632
1777 1777 -, g dbSNP:63751631
1778 1778 -, g dbSNP:63751643
1781 1781 a, g dbSNP:63750830
1782 1782 g, t dbSNP:786202396
1783 1783 a, g dbSNP:376866470
1783 1783 -, g dbSNP:587778956
1784 1784 -, a dbSNP:750300820
1785 1785 -, a dbSNP:587778957
1785 1785 a, g dbSNP:63751270
1786 1786 c, g dbSNP:63751047
1787 1787 -, tgat dbSNP:779795819
1788 1788 c, t dbSNP:63750825
1789 1789 a, g dbSNP:1800145
1793 1793 a, g, t dbSNP:63750549
1797 1797 -, t dbSNP:587778960
1797 1797 g, t dbSNP:63750079
1798 1798 a, g dbSNP:63750935
1799 1799 c, t dbSNP:63749792
1800 1800 c, t dbSNP:267607875
1801 1801 -, t dbSNP:587778961
1801 1801 c, t dbSNP:778417334
1805 1805 -, ct dbSNP:63750884
1805 1805 c, g dbSNP:577217817
1807 1807 -, gattaccccttctg dbSNP:587778958
1811 1811 -, g dbSNP:587778962
1815 1815 a, g dbSNP:587778963
1818 1818 a, g dbSNP:35045067
1819 1819 c, t dbSNP:786202774
1820 1820 a, g dbSNP:63750109
1823 1823 -, attaccccttctgattgacaactatgtgc dbSNP:587778959
1823 1823 c, t dbSNP:63750899
1824 1824 c, t dbSNP:63750610
1827 1827 -, ctt dbSNP:281864939
1827 1827 -, c dbSNP:281864938
1828 1828 c, t dbSNP:775658955
1834 1834 -, ggga dbSNP:63751301
1839 1839 g, t dbSNP:63751202
1840 1840 g, t dbSNP:1800146
1842 1842 c, t dbSNP:63750726
1844 1844 a, g, t dbSNP:55907433
1845 1845 c, t dbSNP:63751225
1848 1848 c, t dbSNP:267607876
1850 1850 a, t dbSNP:765363859
1852 1852 -, t dbSNP:63750115
1854 1854 c, t dbSNP:786202050
1856 1856 -, cg dbSNP:63750131
1856 1856 c, t dbSNP:63751310
1857 1857 -, ga dbSNP:63751200
1857 1857 a, c, g, t dbSNP:63749900
1858 1858 a, c, t dbSNP:759330601
1859 1859 c, t dbSNP:752427924
1865 1865 a, c dbSNP:587778964
1869 1869 -, a dbSNP:267607877
1869 1869 a, c, g dbSNP:63751682
1870 1870 a, g, t dbSNP:63751662
1872 1872 g, t dbSNP:786202938
1877 1877 c, t dbSNP:267607887
1879 1879 a, g dbSNP:63750639
1881 1881 -, a dbSNP:63750282
1881 1881 a, g dbSNP:63751162
1882 1882 c, t dbSNP:63750014
1883 1883 a, g dbSNP:63750292
1886 1886 c, g dbSNP:780406337
1887 1887 -, aaaag dbSNP:63750061
1890 1890 -, a dbSNP:63750740
1892 1892 g, t dbSNP:63750663
1894 1894 a, g dbSNP:747503723
1898 1898 c, t dbSNP:587780680
1901 1901 a, g dbSNP:755577490
1905 1905 a, c, g dbSNP:781637991
1906 1906 c, t dbSNP:770132213
1908 1908 c, g, t dbSNP:63750242
1909 1909 c, t dbSNP:587778969
1910 1910 a, t dbSNP:587780681
1911 1911 a, g dbSNP:587778970
1916 1916 g, t dbSNP:587778971
1917 1917 a, c dbSNP:749305196
1918 1918 a, g dbSNP:770992217
1919 1919 c, g, t dbSNP:63750809
1921 1921 a, c, t dbSNP:63749867
1922 1922 a, g dbSNP:63750217
1923 1923 c, t dbSNP:63750864
1924 1924 a, t dbSNP:768595157
1929 1929 c, t dbSNP:587778972
1932 1932 a, g dbSNP:267607886
1940 1940 c, t dbSNP:63751275
1941 1941 a, g dbSNP:587781310
1946 1946 a, c, t dbSNP:41542214
1947 1947 a, g dbSNP:63750702
1948 1948 -, gtacata dbSNP:63750420
1949 1949 g, t dbSNP:765877072
1951 1951 c, t dbSNP:550890395
1952 1952 -, t dbSNP:780956158
1952 1952 a, g dbSNP:201748079
1953 1953 a, t dbSNP:781780309
1955 1955 c, t dbSNP:587779957
1957 1957 -, tg dbSNP:63750769
1961 1961 g, t dbSNP:147542208
1962 1962 -, t dbSNP:267607698
1962 1962 a, c dbSNP:145565670
1965 1965 a, c, g dbSNP:63749995
1966 1966 a, g dbSNP:191505871
1972 1972 c, t dbSNP:536488280
1973 1973 -, tc dbSNP:63750859
1974 1974 c, g dbSNP:587778975
1975 1975 a, g dbSNP:786202433
1977 1977 a, g dbSNP:746007176
1980 1980 -, agca dbSNP:63751652
1982 1982 a, c, t dbSNP:63750114
1984 1984 a, c, g dbSNP:63750603
1985 1985 -, ag dbSNP:63751651
1986 1986 -, gtgaagtgcc dbSNP:587778979
1988 1988 a, c, g dbSNP:747727493
1991 1991 c, g dbSNP:587781811
1992 1992 -, tgcctgg dbSNP:587778980
1992 1992 g, t dbSNP:587780682
1999 1999 c, t dbSNP:1800147
2011 2011 c, g dbSNP:749100096
2012 2012 c, t dbSNP:587781342
2013 2013 c, g dbSNP:770583385
2015 2015 a, t dbSNP:267607909
2016 2016 a, g, t dbSNP:63750561
2017 2017 a, g, t dbSNP:63750499
2018 2018 a, t dbSNP:767094219
2022 2022 a, g dbSNP:63751022
2023 2023 a, g dbSNP:63750978
2027 2027 a, g, t dbSNP:35831931
2028 2028 -, tg dbSNP:587778981
2029 2029 ggaacacattgtctataaagc, nnnnn dbSNP:786202275
2033 2033 c, t dbSNP:2020873
2034 2034 a, c dbSNP:587778983
2035 2035 -, ca dbSNP:63750971
2035 2035 c, t dbSNP:1800148
2036 2036 -, atgtgttccaca, ca dbSNP:281864940
2036 2036 a, g dbSNP:754225520
2037 2037 c, t dbSNP:757603534
2038 2038 -, t dbSNP:587778984
2040 2040 g, t dbSNP:587778985
2043 2043 -, a dbSNP:786202767
2043 2043 a, c, g dbSNP:587778986
2044 2044 a, t dbSNP:63750484
2045 2045 a, g dbSNP:750596783
2047 2047 -, tataaa dbSNP:63751075
2050 2050 c, t dbSNP:758652752
2051 2051 a, t dbSNP:63749875
2053 2053 ag, gc dbSNP:786203433
2053 2053 a, g dbSNP:780045031
2054 2054 c, t dbSNP:138584384
2055 2055 a, g dbSNP:566928243
2060 2060 -, caca dbSNP:267607898
2060 2060 -, ca dbSNP:267607905
2061 2061 a, t dbSNP:104895002
2062 2062 -, ca dbSNP:587778987
2066 2066 c, g dbSNP:1800149
2071 2071 -, aaca dbSNP:267607902
2071 2071 -, t dbSNP:587780683
2074 2074 c, t dbSNP:749082864
2075 2075 a, t dbSNP:267607906
2076 2076 -, gaacacattgtctataaagccttgcgctcacacattctgcctcctaa dbSNP:587778982
2078 2078 -, aaac dbSNP:267607899
2079 2079 -, aaca dbSNP:267607903
2079 2079 a, g dbSNP:770579083
2086 2086 a, c dbSNP:371263535
2091 2091 a, t dbSNP:267607885
2094 2094 a, g dbSNP:148317871
2099 2099 -, a dbSNP:587778989
2102 2102 ctgc, nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:587778990
2102 2102 a, c dbSNP:786203583
2104 2104 -, gcagcttgcta dbSNP:267607897
2104 2104 a, g dbSNP:745444452
2105 2105 -, cagcttgct dbSNP:587778991
2105 2105 -, c dbSNP:267607896
2105 2105 c, t dbSNP:587778992
2107 2107 a, g dbSNP:771863612
2112 2112 c, t dbSNP:775127059
2120 2120 c, t dbSNP:587779958
2123 2123 a, c, g dbSNP:374380262
2127 2127 a, c, t dbSNP:267607894
2128 2128 a, c dbSNP:786202209
2129 2129 -, ta dbSNP:786202326
2129 2129 c, t dbSNP:777054430
2131 2131 a, c, g dbSNP:267607893
2132 2132 a, t dbSNP:786204318
2133 2133 -, aa dbSNP:267607907
2133 2133 a, g dbSNP:140195825
2134 2134 -, aa dbSNP:267607901
2139 2139 c, t dbSNP:587778993
2143 2143 -, g dbSNP:267607904
2144 2144 a, t dbSNP:267607900
2146 2146 c, g dbSNP:267607895
2147 2147 g, t dbSNP:765480781
2150 2150 -, t, tgtt dbSNP:267607892
2150 2150 a, t dbSNP:587778995
2152 2152 a, t dbSNP:267607908
2155 2155 a, g dbSNP:587778880
2156 2156 c, t dbSNP:750794400
2159 2159 -, ttat dbSNP:779336928
2162 2162 c, t dbSNP:758561792
2166 2166 c, t dbSNP:766650278
2167 2167 g, t dbSNP:75682204
2173 2173 g, t dbSNP:79406218
2182 2182 -, ttc dbSNP:200919928
2184 2184 -, ctt dbSNP:281875167
2184 2184 c, g, t dbSNP:200903126
2187 2187 -, ctt dbSNP:193922366
2191 2191 a, c dbSNP:781352547
2194 2194 c, g, t dbSNP:749138642
2197 2197 a, t dbSNP:778791265
2201 2201 c, t dbSNP:745713835
2210 2210 c, g dbSNP:771845260
2215 2215 a, g dbSNP:779892486
2223 2223 c, g dbSNP:746506283
2225 2225 a, g dbSNP:768003470
2247 2247 a, g dbSNP:776238530
2253 2253 a, g, t dbSNP:1803985
2257 2257 a, g dbSNP:770302355
2261 2261 c, g dbSNP:773556906
2270 2270 c, t dbSNP:763379368
2273 2273 a, g dbSNP:766562208
2274 2274 c, t dbSNP:751679614
2289 2289 a, t dbSNP:267607910
2296 2296 c, t dbSNP:570963416
2301 2301 c, t dbSNP:770660847
2310 2310 -, gatt dbSNP:201518804
2314 2314 -, gatt dbSNP:201866587
2317 2317 g, t dbSNP:538203686
2319 2319 a, t dbSNP:587778879
2325 2325 -, aata dbSNP:56329536
2342 2342 a, g dbSNP:556614001
2343 2343 c, t dbSNP:368443548

Target ORF information:

RefSeq Version XM_005265161
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu20930D
Sequence Information ORF Nucleotide Sequence (Length: 1548bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Mlh1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)722..1003(+)
Misc Feature(2)725..2059(+)
Misc Feature(3)929..931(+)
Position Chain Variation Link
13 13 a, g dbSNP:767391717
14 14 c, t dbSNP:750360439
21 21 a, g dbSNP:114683294
26 26 c, t dbSNP:760601810
39 39 c, g dbSNP:766270403
41 41 c, g dbSNP:576304627
54 54 a, t dbSNP:543749635
55 55 a, c dbSNP:561909643
56 56 c, g dbSNP:185841085
63 63 c, t dbSNP:747425626
64 64 -, gt dbSNP:747353952
80 80 c, g dbSNP:753623015
82 82 c, t dbSNP:547548108
84 84 c, g dbSNP:559815653
86 86 c, t dbSNP:561267247
89 89 a, g dbSNP:530086722
107 107 g, t dbSNP:4647205
117 117 -, t dbSNP:587778896
119 119 c, g dbSNP:267607713
120 120 a, g dbSNP:63751094
123 123 c, g, t dbSNP:587778901
127 127 -, a dbSNP:63750867
128 128 g, t dbSNP:63750939
129 129 -, aatc dbSNP:63751431
129 129 c, t dbSNP:63751109
131 131 acaagta, tgtt dbSNP:587778904
132 132 c, g dbSNP:759287108
134 134 a, g dbSNP:771649701
135 135 g, t dbSNP:63749833
140 140 c, t dbSNP:587778913
141 141 a, c dbSNP:587778914
142 142 a, c dbSNP:147342421
143 143 a, g dbSNP:760185532
144 144 a, t dbSNP:63750098
148 148 -, t dbSNP:63749956
151 151 -, t dbSNP:587778922
152 152 -, aaag dbSNP:267607714
152 152 a, t dbSNP:63751401
153 153 -, aaga dbSNP:587778923
153 153 -, aa dbSNP:730881733
154 154 -, a dbSNP:63750028
154 154 -, a dbSNP:587778927
155 155 g, t dbSNP:63751199
156 156 a, c dbSNP:63750263
159 159 -, gagg dbSNP:587778932
159 159 a, g dbSNP:63751267
159 159 -, g dbSNP:63751266
166 166 g, t dbSNP:764529553
167 167 a, c, t dbSNP:63750877
168 168 a, c dbSNP:587779955
172 172 a, g dbSNP:762162504
173 173 -, a dbSNP:587778944
178 178 a, g dbSNP:63751398
182 182 a, c, t dbSNP:63751428
185 185 a, g dbSNP:63750850
187 187 a, c, t dbSNP:587778955
188 188 -, aa dbSNP:63750469
189 189 -, a dbSNP:63751255
189 189 a, g dbSNP:63750952
192 192 a, g dbSNP:63751465
193 193 -, c dbSNP:267607715
196 196 -, c dbSNP:587778966
196 196 c, t dbSNP:61751642
197 197 a, g, t dbSNP:63750206
198 198 a, g dbSNP:63749939
199 199 -, g dbSNP:587778968
200 200 a, g dbSNP:63750452
201 201 a, t dbSNP:63750281
202 202 c, g dbSNP:780141938
203 203 -, a dbSNP:63751704
203 203 a, g dbSNP:63750719
204 204 a, g dbSNP:63751661
207 207 -, aagaaga dbSNP:730881734
208 208 -, agaa dbSNP:267607723
208 208 a, c dbSNP:63751191
209 209 -, gaa dbSNP:267607724
209 209 c, g, t dbSNP:63749829
211 211 -, aga dbSNP:63751642
214 214 c, t dbSNP:63750621
215 215 c, g dbSNP:766608278
216 216 c, g, t dbSNP:397514684
217 217 a, g dbSNP:587778988
219 219 a, t dbSNP:751894165
220 220 c, t dbSNP:755073786
226 226 a, g dbSNP:767750489
227 227 c, t dbSNP:63749859
228 228 a, g dbSNP:63750437
229 229 -, tg dbSNP:63750052
229 229 a, t dbSNP:63750856
230 230 -, g dbSNP:587778997
233 233 a, c dbSNP:786203362
235 235 g, t dbSNP:752850761
236 236 g, t dbSNP:63749990
237 237 a, t dbSNP:753404814
239 239 a, g dbSNP:786203745
240 240 c, t dbSNP:63751069
241 241 g, t dbSNP:778724501
242 242 -, a dbSNP:267607729
242 242 a, g dbSNP:587778998
243 243 -, cta dbSNP:786202328
243 243 c, t dbSNP:63750005
246 246 g, t dbSNP:587778999
248 248 a, g dbSNP:63750641
251 251 c, t dbSNP:63750659
254 254 c, t dbSNP:63751421
259 259 -, c dbSNP:267607728
259 259 c, t dbSNP:63750923
262 262 g, t dbSNP:182963667
263 263 c, g, t dbSNP:11541859
264 264 a, g dbSNP:758110228
265 265 a, g dbSNP:746705035
270 270 a, t dbSNP:63751137
272 272 c, g dbSNP:63750133
273 273 c, t dbSNP:768132746
275 275 a, g dbSNP:41295282
281 281 g, t dbSNP:63751070
284 284 a, g dbSNP:770276731
288 288 a, g dbSNP:773647920
289 289 a, t dbSNP:63750651
290 290 a, c, g dbSNP:267607725
291 291 -, gctttcgaggtg dbSNP:63751691
295 295 a, t dbSNP:267607730
296 296 c, t dbSNP:63751221
297 297 a, c, g dbSNP:63750266
299 299 a, g dbSNP:267607726
300 300 a, g, t dbSNP:267607727
301 301 g, t dbSNP:4647220
302 302 a, g dbSNP:63750453
304 304 a, c, g, t dbSNP:63751665
305 305 c, g dbSNP:587779003
309 309 a, t dbSNP:63751397
315 315 a, g dbSNP:368208495
316 316 a, c, g dbSNP:63750297
317 317 a, g dbSNP:572906317
318 318 g, t dbSNP:63750507
324 324 a, c dbSNP:587779004
325 325 g, t dbSNP:63749803
329 329 c, g dbSNP:587779005
330 330 c, t dbSNP:63750539
333 333 a, g dbSNP:775914775
336 336 a, t dbSNP:63750559
339 339 -, c dbSNP:63750645
341 341 a, g dbSNP:371667663
342 342 c, t dbSNP:764120517
344 344 -, a dbSNP:267607739
344 344 -, a dbSNP:63750906
344 344 a, g dbSNP:750353040
345 345 a, c, g dbSNP:63750465
348 348 c, g, t dbSNP:63750781
349 349 a, g dbSNP:61751643
350 350 a, c dbSNP:766308335
353 353 -, aa dbSNP:63750658
354 354 -, aa dbSNP:63750841
357 357 c, t dbSNP:267607740
360 360 a, g dbSNP:730881735
365 365 a, t dbSNP:63750542
367 367 a, g dbSNP:754824181
368 368 c, t dbSNP:780816243
369 369 a, g dbSNP:730881736
370 370 -, tg dbSNP:587779006
373 373 a, g dbSNP:1800144
374 374 a, t dbSNP:200076893
375 375 a, g dbSNP:267607741
376 376 -, c dbSNP:63751607
376 376 c, g, t dbSNP:63751606
377 377 a, c dbSNP:587779007
378 378 a, g, t dbSNP:63751595
380 380 gcaagttactcagatggaaaa, t dbSNP:267607746
380 380 c, g dbSNP:63750866
380 380 -, g dbSNP:63750865
383 383 ag, gtt dbSNP:63751710
384 384 a, g dbSNP:755678310
386 386 c, t dbSNP:587779010
386 386 -, t dbSNP:587779009
387 387 -, a dbSNP:587779012
387 387 a, g dbSNP:587779011
390 390 a, c dbSNP:63749818
392 392 c, g dbSNP:28930073
395 395 g, t dbSNP:63751124
401 401 c, g dbSNP:63751052
402 402 -, tgaa dbSNP:587779014
402 402 g, t dbSNP:753233578
407 407 a, g dbSNP:756888142
408 408 c, t dbSNP:63750817
413 413 c, g dbSNP:779562531
418 418 -, a dbSNP:587779015
419 419 c, g dbSNP:63750977
420 420 c, g, t dbSNP:746419577
421 421 a, g dbSNP:201176051
422 422 c, t dbSNP:780232692
426 426 -, c dbSNP:63751045
434 434 c, t dbSNP:63749820
436 436 a, g dbSNP:377279035
437 437 c, g dbSNP:267607747
443 443 c, t dbSNP:63751302
445 445 c, g dbSNP:63750638
447 447 a, t dbSNP:786202495
449 449 -, acg dbSNP:587779016
450 450 c, t dbSNP:776969475
451 451 a, g dbSNP:369521379
452 452 a, g dbSNP:748417604
456 456 a, g dbSNP:770023778
460 460 c, t dbSNP:192938577
461 461 a, c dbSNP:749370894
462 462 g, t dbSNP:63750891
466 466 -, tt dbSNP:267607758
467 467 -, t dbSNP:63751101
469 469 a, c dbSNP:74396541
470 470 a, c dbSNP:63751242
472 472 c, t dbSNP:4647256
473 473 a, g dbSNP:370900909
474 474 c, t dbSNP:775560085
477 477 c, t dbSNP:63749924
480 480 c, t dbSNP:763992299
481 481 a, g dbSNP:776402672
484 484 -, gag dbSNP:587781788
485 485 a, c dbSNP:748500860
486 486 -, g dbSNP:267607754
490 490 a, c dbSNP:765014361
495 495 a, t dbSNP:267607755
495 495 -, t dbSNP:587779018
496 496 a, c dbSNP:267607757
500 500 -, aa dbSNP:267607756
501 501 -, a dbSNP:63749959
504 504 c, t dbSNP:63750834
511 511 -, a dbSNP:63749944
511 511 a, g dbSNP:779148982
514 514 a, g dbSNP:748128054
521 521 -, ag dbSNP:63749799
522 522 -, ga dbSNP:587779019
528 528 c, t dbSNP:758040210
529 529 at, ct, gg dbSNP:63750903
532 532 a, g dbSNP:786202121
533 533 g, t dbSNP:766791816
537 537 -, ttg dbSNP:786201988
537 537 c, g, t dbSNP:63750102
542 542 a, g dbSNP:63750211
543 543 a, g dbSNP:587779021
550 550 a, t dbSNP:35225190
551 551 c, g dbSNP:63750012
552 552 a, g, t dbSNP:63750515
554 554 c, t dbSNP:11541862
556 556 c, t dbSNP:63751050
561 561 c, t dbSNP:777971431
566 566 a, g dbSNP:786202038
570 570 g, t dbSNP:267607766
571 571 c, t dbSNP:754102133
575 575 c, t dbSNP:63751021
576 576 c, g dbSNP:63751480
577 577 a, g dbSNP:587781038
581 581 -, a dbSNP:35847123
584 584 a, t dbSNP:63750500
586 586 -, a dbSNP:63751653
593 593 c, g dbSNP:63749887
594 594 -, ag dbSNP:267607704
595 595 -, ga dbSNP:63751637
599 599 a, c, g dbSNP:534184145
605 605 a, g dbSNP:63750085
606 606 a, t dbSNP:749037674
619 619 a, g dbSNP:770554901
620 620 c, t dbSNP:587781509
624 624 a, c, g dbSNP:150478207
630 630 -, t dbSNP:63750908
632 632 a, g dbSNP:771612764
634 634 c, t dbSNP:138735345
635 635 a, g, t dbSNP:2308317
642 642 a, g dbSNP:267607775
645 645 g, t dbSNP:267607776
647 647 -, c dbSNP:63750380
647 647 c, t dbSNP:4986984
648 648 a, c, g dbSNP:762099920
650 650 c, t dbSNP:750650349
653 653 a, c, g dbSNP:1799977
663 663 -, a dbSNP:63750385
663 663 -, a dbSNP:63751286
663 663 a, g dbSNP:766517126
664 664 g, t dbSNP:751719069
666 666 c, t dbSNP:756045117
670 670 c, t dbSNP:786202912
670 670 -, t dbSNP:587779031
671 671 -, agtc dbSNP:267607774
671 671 a, g dbSNP:587781926
672 672 -, g dbSNP:63749842
674 674 c, t dbSNP:63751615
675 675 a, g, t dbSNP:63751711
676 676 a, t dbSNP:786203360
680 680 a, c dbSNP:751628735
681 681 -, t dbSNP:63751659
691 691 c, t dbSNP:63750765
691 691 -, t dbSNP:63750764
693 693 a, g, t dbSNP:149302013
694 694 a, t dbSNP:786201226
695 695 c, t dbSNP:63751170
697 697 c, t dbSNP:764085979
698 698 ga, tt dbSNP:730881732
699 699 a, g dbSNP:63750696
700 700 a, g dbSNP:35908749
702 702 a, t dbSNP:587781505
708 708 c, t dbSNP:771606168
715 715 a, c dbSNP:63749901
719 719 a, g dbSNP:587778447
720 720 a, g dbSNP:778528329
725 725 -, aatg dbSNP:267607787
729 729 -, gtta dbSNP:587779037
729 729 a, g, t dbSNP:63750303
734 734 a, g dbSNP:750253749
737 737 c, g, t dbSNP:63750948
741 741 a, g dbSNP:587782800
743 743 -, g dbSNP:63750819
746 746 a, c dbSNP:786203107
751 751 c, t dbSNP:63750310
753 753 a, c dbSNP:63750198
759 759 a, g dbSNP:786202528
763 763 a, g dbSNP:63751276
767 767 -, a dbSNP:63750338
774 774 c, t dbSNP:56250509
776 776 c, t dbSNP:63750642
777 777 g, t dbSNP:63751283
778 778 c, g, t dbSNP:587779038
781 781 c, t dbSNP:768119795
782 782 -, atc dbSNP:63751623
783 783 -, tca dbSNP:587779039
783 783 c, t dbSNP:781707562
784 784 c, g dbSNP:748553134
786 786 a, c, g dbSNP:104894997
788 788 c, g, t dbSNP:63751597
789 789 -, atcg dbSNP:267607799
789 789 a, g, t dbSNP:63751664
791 791 a, c, t dbSNP:63751194
792 792 a, g dbSNP:63751448
795 795 c, t dbSNP:747697495
800 800 c, g dbSNP:748423430
801 801 a, g dbSNP:63750650
803 803 c, t dbSNP:786203623
804 804 c, g dbSNP:63750691
806 806 -, actt dbSNP:267607801
806 806 a, g dbSNP:371302926
809 809 -, tcctt dbSNP:587779043
812 812 g, t dbSNP:63751252
813 813 c, t dbSNP:63750584
819 819 a, g dbSNP:769958855
822 822 -, aagc dbSNP:63751439
836 836 g, t dbSNP:587779044
838 838 a, t dbSNP:63750938
840 840 c, t dbSNP:63749950
841 841 a, c dbSNP:146796765
842 842 a, g dbSNP:774689817
843 843 c, g dbSNP:63750360
846 846 a, g, t dbSNP:201931669
849 849 a, t dbSNP:63750889
851 851 c, g dbSNP:772374195
853 853 c, t dbSNP:63751154
854 854 -, t dbSNP:63750212
854 854 a, c dbSNP:63750395
855 855 a, g dbSNP:775368585
857 857 -, aa dbSNP:63750034
858 858 -, a dbSNP:63750814
858 858 -, a dbSNP:587779046
859 859 c, t dbSNP:63750421
860 860 a, g dbSNP:730881738
861 861 c, t dbSNP:786203878
864 864 -, ac dbSNP:587779047
865 865 -, ac dbSNP:587779048
870 870 -, t dbSNP:63750429
873 873 c, t dbSNP:63750517
874 874 a, g dbSNP:773452312
875 875 g, t dbSNP:587779049
880 880 c, g, t dbSNP:63751707
881 881 a, c, g dbSNP:63751598
882 882 a, c, g dbSNP:63750144
885 885 -, t, tcctgacagttt dbSNP:63751620
885 885 c, g, t dbSNP:63750547
886 886 -, tcctgacagttt dbSNP:63751636
886 886 -, a dbSNP:267607809
887 887 a, g, t dbSNP:63750736
895 895 c, t dbSNP:767068637
896 896 a, c dbSNP:752430684
899 899 -, c dbSNP:587779052
899 899 c, t dbSNP:63750489
906 906 a, t dbSNP:267607813
909 909 a, g, t dbSNP:63750993
912 912 -, ttaatgtgcaccccacaaagcatg dbSNP:587779053
915 915 a, g dbSNP:755553895
916 916 a, t dbSNP:587779054
917 917 a, g dbSNP:786202196
920 920 -, gc dbSNP:63750962
923 923 c, t dbSNP:267607808
925 925 a, c, t dbSNP:63749896
926 926 -, a dbSNP:587779055
926 926 a, g dbSNP:779581111
927 927 a, c dbSNP:746206527
928 928 a, c dbSNP:587779056
933 933 -, a dbSNP:63750319
937 937 -, a dbSNP:63751259
941 941 c, t dbSNP:151119913
942 942 a, c dbSNP:786202114
943 943 c, g dbSNP:587779959
947 947 a, c dbSNP:267607814
952 952 a, c, t dbSNP:146777069
952 952 -, c dbSNP:63749926
953 953 a, g, t dbSNP:63750796
958 958 c, g dbSNP:267607811
960 960 a, g, t dbSNP:63750286
969 969 -, agcgggtgc dbSNP:63751404
969 969 -, a dbSNP:587781554
972 972 -, gggtgcagc dbSNP:587779057
972 972 a, g dbSNP:63750268
974 974 a, g dbSNP:730881739
974 974 -, g dbSNP:786204317
975 975 c, t dbSNP:63751049
977 977 c, g dbSNP:587782087
980 980 c, t dbSNP:587779058
982 982 -, gcacatcgagagca dbSNP:587782265
983 983 a, c, t dbSNP:267607810
984 984 a, c dbSNP:63750710
985 985 -, cat dbSNP:267607807
986 986 -, atc dbSNP:63751197
988 988 c, t dbSNP:372578171
989 989 a, g dbSNP:550914672
992 992 -, a dbSNP:63750533
994 994 c, t dbSNP:775167683
1001 1001 c, t dbSNP:267607812
1005 1005 a, g dbSNP:587781750
1005 1005 -, g dbSNP:63750434
1008 1008 c, g dbSNP:763847201
1009 1009 -, c dbSNP:63750677
1009 1009 -, c dbSNP:63750853
1011 1011 a, g dbSNP:63751467
1015 1015 -, c dbSNP:63750339
1017 1017 c, t dbSNP:191257018
1018 1018 c, g dbSNP:374770981
1021 1021 -, g dbSNP:63749837
1024 1024 -, g dbSNP:587778881
1032 1032 c, t dbSNP:750980386
1033 1033 c, t dbSNP:758668630
1035 1035 a, g dbSNP:63751609
1036 1036 a, c, g, t dbSNP:63751715
1038 1038 a, c dbSNP:201541505
1041 1041 c, t dbSNP:755401753
1044 1044 -, t dbSNP:267607822
1048 1048 -, a dbSNP:587778883
1048 1048 a, g dbSNP:137937003
1054 1054 a, t dbSNP:63750156
1056 1056 c, t dbSNP:63751265
1058 1058 a, g dbSNP:752962453
1059 1059 -, g dbSNP:63750472
1060 1060 c, t dbSNP:730881748
1061 1061 c, t dbSNP:756347993
1062 1062 c, t dbSNP:587782467
1065 1065 c, t dbSNP:749334262
1066 1066 -, tggggaga dbSNP:63750038
1068 1068 g, t dbSNP:730881740
1069 1069 -, ggagatgg dbSNP:587778884
1070 1070 -, g dbSNP:587778885
1072 1072 a, g dbSNP:587780533
1074 1074 c, t dbSNP:779917781
1079 1079 a, g dbSNP:786201875
1088 1088 a, g dbSNP:63749864
1093 1093 c, g, t dbSNP:746800098
1098 1098 a, c dbSNP:776402584
1099 1099 -, c dbSNP:63750715
1101 1101 c, t dbSNP:201673334
1102 1102 a, g dbSNP:769364808
1105 1105 c, t dbSNP:772718909
1109 1109 a, g dbSNP:762426947
1115 1115 a, g dbSNP:766904735
1116 1116 a, g dbSNP:774878513
1120 1120 g, t dbSNP:759868546
1126 1126 -, at dbSNP:730880011
1126 1126 c, t dbSNP:267607824
1127 1127 -, ta dbSNP:63750305
1130 1130 a, gtc dbSNP:587778887
1134 1134 a, c, g, t dbSNP:143009528
1138 1138 c, t dbSNP:786201611
1139 1139 c, t dbSNP:63750557
1142 1142 c, g dbSNP:778315874
1143 1143 -, a dbSNP:587778889
1146 1146 c, t dbSNP:141344760
1148 1148 a, g dbSNP:757350157
1148 1148 -, g dbSNP:63749965
1149 1149 a, t dbSNP:63750447
1151 1151 c, t dbSNP:63750760
1152 1152 a, c, g dbSNP:63750430
1157 1157 a, g dbSNP:781096630
1159 1159 c, t dbSNP:747967333
1161 1161 -, nnnn dbSNP:587778893
1163 1163 a, c, t dbSNP:61751644
1164 1164 a, g dbSNP:63750361
1165 1165 a, g dbSNP:772805767
1169 1169 c, t dbSNP:587778894
1170 1170 a, g dbSNP:587782884
1173 1173 a, g dbSNP:587780678
1176 1176 g, t dbSNP:786203413
1188 1188 -, t dbSNP:63750749
1189 1189 a, g, t dbSNP:35164771
1190 1190 c, g, t dbSNP:63750483
1196 1196 c, g dbSNP:63751485
1198 1198 a, g dbSNP:786203363
1200 1200 a, g dbSNP:587779951
1205 1205 c, t dbSNP:587778897
1208 1208 -, c dbSNP:587778898
1208 1208 -, ct dbSNP:63751015
1213 1213 c, t dbSNP:773869705
1215 1215 a, g dbSNP:41294980
1216 1216 -, t dbSNP:587778900
1221 1221 -, gtcagcc dbSNP:587778899
1223 1223 c, t dbSNP:63751153
1224 1224 a, c, g dbSNP:104895000
1225 1225 c, g dbSNP:775776362
1227 1227 c, t dbSNP:761006237
1228 1228 c, t dbSNP:764377126
1229 1229 a, g dbSNP:535470039
1230 1230 g, t dbSNP:786201951
1234 1234 c, t dbSNP:369576099
1236 1236 c, t dbSNP:63750766
1237 1237 a, g dbSNP:786203274
1241 1241 a, g dbSNP:373767220
1243 1243 g, t dbSNP:750563193
1244 1244 a, g dbSNP:267607823
1250 1250 -, ga dbSNP:63751118
1251 1251 a, g dbSNP:754898711
1252 1252 a, g, t dbSNP:63751440
1253 1253 a, g dbSNP:781335662
1254 1254 c, t dbSNP:377484262
1255 1255 -, ttctagtggcagggcta dbSNP:786203893
1257 1257 c, g dbSNP:63751179
1259 1259 -, a dbSNP:63750293
1259 1259 a, g dbSNP:755898663
1264 1264 c, t dbSNP:63750791
1266 1266 a, g dbSNP:370687064
1267 1267 a, g dbSNP:373076967
1268 1268 a, g dbSNP:377433038
1269 1269 c, g dbSNP:745393750
1274 1274 c, t dbSNP:63750316
1282 1282 c, t dbSNP:772555970
1291 1291 a, g dbSNP:776044212
1293 1293 a, t dbSNP:761070985
1295 1295 c, g dbSNP:63750443
1301 1301 a, c dbSNP:786202922
1302 1302 c, t dbSNP:63751414
1307 1307 c, g dbSNP:587782273
1308 1308 -, c dbSNP:63750748
1319 1319 a, g dbSNP:63750365
1322 1322 a, g dbSNP:761903819
1323 1323 ccaaaaatcagagcttggaggg, nnnnn dbSNP:587778903
1323 1323 c, g dbSNP:765563111
1325 1325 a, c dbSNP:34213726
1329 1329 a, g dbSNP:763189331
1332 1332 -, a dbSNP:63749845
1341 1341 -, a dbSNP:63749981
1342 1342 g, t dbSNP:587779952
1345 1345 ggatacaacaaaggggacttc, taaa dbSNP:587778905
1346 1346 -, g dbSNP:587778906
1346 1346 g, t dbSNP:752622244
1352 1352 -, a dbSNP:63750071
1352 1352 a, t dbSNP:34285587
1357 1357 c, g dbSNP:756099600
1358 1358 c, g dbSNP:63750527
1360 1360 -, g dbSNP:267607821
1360 1360 -, g dbSNP:587778907
1363 1363 a, t dbSNP:753671152
1366 1366 a, g dbSNP:786203279
1368 1368 a, t dbSNP:786203236
1371 1371 a, t dbSNP:63750390
1375 1375 -, a dbSNP:63750020
1375 1375 -, a dbSNP:587778908
1376 1376 a, g dbSNP:756843954
1377 1377 a, c dbSNP:202038499
1378 1378 -, ga dbSNP:587778909
1378 1378 -, t dbSNP:267607697
1379 1379 a, t dbSNP:63750540
1381 1381 c, g, t dbSNP:63751293
1390 1390 c, t dbSNP:63750201
1391 1391 a, g dbSNP:786202986
1396 1396 -, c dbSNP:63750713
1398 1398 a, c, g dbSNP:771610811
1399 1399 -, c dbSNP:587781892
1399 1399 c, t dbSNP:587778910
1400 1400 a, g dbSNP:267607820
1404 1404 c, t dbSNP:63750932
1408 1408 -, aaag dbSNP:267607828
1409 1409 -, aaga dbSNP:63751592
1410 1410 -, a dbSNP:63751677
1411 1411 -, gaga dbSNP:281864936
1411 1411 a, g dbSNP:63750616
1412 1412 -, a dbSNP:63751468
1413 1413 -, gacatcgggaaga dbSNP:587778912
1413 1413 -, ga dbSNP:281864937
1413 1413 a, g, t dbSNP:63750498
1418 1418 -, c dbSNP:63750482
1418 1418 c, g, t dbSNP:147939838
1419 1419 a, g dbSNP:63751083
1430 1430 g, t dbSNP:771282761
1439 1439 a, g dbSNP:559012648
1443 1443 c, t dbSNP:376642306
1445 1445 a, g dbSNP:774236450
1447 1447 -, a dbSNP:587778915
1448 1448 g, t dbSNP:730881741
1450 1450 c, t dbSNP:587778916
1451 1451 c, g dbSNP:63750314
1453 1453 a, t dbSNP:63750956
1455 1455 c, t dbSNP:532873141
1457 1457 c, t dbSNP:63749795
1458 1458 a, g dbSNP:587778917
1460 1460 a, t dbSNP:587778918
1461 1461 -, a dbSNP:63749876
1462 1462 -, ggaaa dbSNP:587778919
1466 1466 a, g dbSNP:776671941
1469 1469 -, a dbSNP:63751014
1472 1472 a, g dbSNP:63751145
1482 1482 -, c dbSNP:763560251
1483 1483 c, t dbSNP:764962961
1485 1485 a, c, g, t dbSNP:63750226
1487 1487 -, c dbSNP:63751031
1487 1487 -, c dbSNP:63750855
1487 1487 c, g, t dbSNP:200830026
1488 1488 a, g dbSNP:754554026
1489 1489 -, g dbSNP:63751435
1492 1492 a, g dbSNP:781525625
1495 1495 -, g dbSNP:63749793
1495 1495 g, t dbSNP:786202768
1496 1496 -, atc dbSNP:753409799
1497 1497 -, tca dbSNP:63751146
1498 1498 -, cat dbSNP:587778920
1499 1499 a, c dbSNP:748613173
1500 1500 c, g, t dbSNP:587780679
1505 1505 c, t dbSNP:145679961
1507 1507 c, t dbSNP:778216737
1510 1510 c, t dbSNP:749683911
1512 1512 a, g dbSNP:771044689
1513 1513 c, t dbSNP:774699212
1515 1515 c, t dbSNP:63749909
1518 1518 -, t dbSNP:63749916
1518 1518 -, t dbSNP:587778921
1523 1523 c, t dbSNP:267607829
1526 1526 c, t dbSNP:63749923
1531 1531 a, g dbSNP:745906843
1532 1532 g, t dbSNP:63751472
1539 1539 a, g dbSNP:772245091
1540 1540 -, t dbSNP:63750317
1540 1540 c, t dbSNP:775456144
1541 1541 a, g dbSNP:63750746
1547 1547 c, g, t dbSNP:63751705
1549 1549 a, g dbSNP:373322226
1550 1550 -, t dbSNP:587778924
1550 1550 -, c dbSNP:587778925
1552 1552 -, t dbSNP:63751689
1555 1555 -, t dbSNP:587778926
1559 1559 a, c dbSNP:63751688
1562 1562 c, t dbSNP:63751703
1563 1563 a, g, t dbSNP:63751630
1565 1565 a, g dbSNP:528463800
1567 1567 g, t dbSNP:63751680
1570 1570 -, gt dbSNP:587778928
1570 1570 c, g, t dbSNP:587779953
1571 1571 -, tt dbSNP:63751613
1571 1571 c, t dbSNP:63750137
1572 1572 a, t dbSNP:587778929
1574 1574 c, t dbSNP:63751281
1585 1585 c, t dbSNP:767089159
1586 1586 -, ttc dbSNP:587778930
1588 1588 c, g, t dbSNP:752241564
1589 1589 -, gt dbSNP:63750076
1589 1589 a, g dbSNP:764663152
1590 1590 -, tg dbSNP:587778931
1592 1592 a, g dbSNP:754447026
1594 1594 c, t dbSNP:63750000
1596 1596 a, g dbSNP:564240478
1607 1607 c, t dbSNP:63751277
1611 1611 a, g dbSNP:587778933
1612 1612 a, g dbSNP:267607842
1614 1614 a, c dbSNP:267607843
1618 1618 -, gg dbSNP:63750036
1618 1618 a, g dbSNP:786202409
1620 1620 -, c dbSNP:63750824
1620 1620 c, t dbSNP:757728402
1622 1622 c, t dbSNP:63750192
1623 1623 a, c, t dbSNP:63750511
1626 1626 a, g dbSNP:730881742
1628 1628 c, t dbSNP:63750413
1631 1631 a, g dbSNP:267607840
1635 1635 a, g dbSNP:587779954
1638 1638 a, t dbSNP:63750300
1640 1640 c, t dbSNP:780317287
1641 1641 -, ttata dbSNP:587778934
1642 1642 c, g dbSNP:63751087
1643 1643 c, t dbSNP:747090506
1644 1644 c, t dbSNP:63750289
1645 1645 c, t dbSNP:768770694
1647 1647 -, tct dbSNP:587778935
1647 1647 c, t dbSNP:63750193
1650 1650 a, c dbSNP:63750271
1651 1651 c, t dbSNP:587778936
1654 1654 -, cac dbSNP:267607841
1656 1656 -, cca dbSNP:63751641
1656 1656 c, t dbSNP:781270312
1662 1662 -, aagt dbSNP:267607699
1662 1662 c, t dbSNP:587778937
1663 1663 c, t dbSNP:749204990
1664 1664 a, g dbSNP:63751633
1665 1665 c, g, t dbSNP:63751596
1666 1666 -, t dbSNP:587778939
1667 1667 g, t dbSNP:63751244
1670 1670 g, t dbSNP:63751081
1673 1673 c, t dbSNP:780221881
1674 1674 g, t dbSNP:63750059
1675 1675 a, g dbSNP:786201538
1679 1679 c, t dbSNP:267607847
1681 1681 c, g dbSNP:63751393
1682 1682 c, t dbSNP:63751460
1687 1687 -, a dbSNP:63750464
1688 1688 -, ctca dbSNP:267607849
1688 1688 c, t dbSNP:786202693
1691 1691 a, t dbSNP:63750062
1694 1694 c, t dbSNP:730881743
1700 1700 a, t dbSNP:267607848
1707 1707 a, g dbSNP:375853155
1709 1709 c, t dbSNP:267607846
1712 1712 a, g dbSNP:587781796
1713 1713 a, g dbSNP:781178304
1715 1715 -, gt dbSNP:63751709
1719 1719 c, t dbSNP:63751608
1722 1722 c, g dbSNP:748185540
1723 1723 -, g dbSNP:63751685
1728 1728 c, g, t dbSNP:56185292
1729 1729 a, c, g dbSNP:63751657
1731 1731 a, g dbSNP:63751612
1740 1740 c, t dbSNP:63751684
1741 1741 a, c, g dbSNP:567838745
1742 1742 c, g, t dbSNP:63751713
1743 1743 c, t dbSNP:63751616
1743 1743 -, t dbSNP:587778942
1746 1746 -, tt dbSNP:587778943
1747 1747 -, t dbSNP:63750309
1752 1752 g, t dbSNP:267607865
1753 1753 c, t dbSNP:786202432
1754 1754 c, g dbSNP:63751176
1755 1755 -, t dbSNP:267607695
1755 1755 a, c dbSNP:63750587
1756 1756 -, c dbSNP:367543283
1756 1756 -, c dbSNP:63749863
1757 1757 a, c, g dbSNP:267607862
1758 1758 c, t dbSNP:587778945
1759 1759 a, g dbSNP:747665234
1761 1761 c, t dbSNP:63750575
1762 1762 -, t dbSNP:63751486
1764 1764 a, c dbSNP:63750016
1767 1767 -, taga dbSNP:63750147
1767 1767 -, t dbSNP:63749979
1768 1768 a, c dbSNP:769239969
1770 1770 -, atag dbSNP:63749868
1773 1773 a, c, g dbSNP:587782621
1776 1776 -, ca dbSNP:63750375
1777 1777 a, g dbSNP:786201766
1781 1781 -, ag dbSNP:63750035
1786 1786 c, t dbSNP:267607863
1788 1788 a, g dbSNP:63750604
1790 1790 a, g dbSNP:763381491
1797 1797 a, g dbSNP:267607861
1798 1798 -, agatggtcccaaagaagga dbSNP:587778946
1800 1800 a, g dbSNP:63750718
1806 1806 c, g, t dbSNP:63750876
1808 1808 a, t dbSNP:63750386
1810 1810 -, a dbSNP:63751240
1813 1813 a, g dbSNP:767748815
1818 1818 a, t dbSNP:41295284
1819 1819 -, t dbSNP:587778947
1820 1820 a, g dbSNP:147928948
1821 1821 a, c, t dbSNP:267607864
1829 1829 -, at dbSNP:63750150
1830 1830 -, acat dbSNP:587778948
1830 1830 c, t dbSNP:141688321
1832 1832 -, gtt dbSNP:267607859
1832 1832 a, g dbSNP:587779956
1833 1833 -, ttg dbSNP:63750486
1840 1840 g, t dbSNP:758353338
1843 1843 -, gaa dbSNP:587782285
1844 1844 -, aag dbSNP:121912962
1848 1848 a, c dbSNP:780199021
1849 1849 -, gaa dbSNP:267607858
1850 1850 -, aag dbSNP:63751247
1850 1850 aa, gc dbSNP:35502531
1850 1850 a, g, t dbSNP:35001569
1851 1851 a, c, g, t dbSNP:63750449
1851 1851 a, ttctt dbSNP:587778949
1852 1852 a, g dbSNP:786202638
1853 1853 c, g dbSNP:267607866
1853 1853 -, g dbSNP:63749986
1854 1854 a, c dbSNP:747708787
1856 1856 -, g dbSNP:786203456
1859 1859 a, g dbSNP:769488957
1863 1863 a, c, t dbSNP:63750693
1864 1864 -, t dbSNP:587778950
1865 1865 g, t dbSNP:587778951
1870 1870 c, t dbSNP:145535636
1872 1872 a, g dbSNP:748851107
1873 1873 g, t dbSNP:63751415
1874 1874 c, t dbSNP:377241633
1875 1875 -, tctcttt dbSNP:63751594
1875 1875 c, t dbSNP:587778952
1875 1875 -, t dbSNP:63750152
1876 1876 a, c, t dbSNP:63751214
1877 1877 -, tctt dbSNP:267607860
1877 1877 a, t dbSNP:63750846
1878 1878 -, cttt dbSNP:587778953
1882 1882 -, ggaaa dbSNP:63751639
1888 1888 -, t dbSNP:786201990
1888 1888 g, t dbSNP:774878438
1890 1890 a, c dbSNP:63750240
1891 1891 c, t dbSNP:786201289
1891 1891 -, t dbSNP:587778954
1894 1894 a, g dbSNP:63751632
1894 1894 -, g dbSNP:63751631
1895 1895 -, g dbSNP:63751643
1898 1898 a, g dbSNP:63750830
1899 1899 g, t dbSNP:786202396
1900 1900 a, g dbSNP:376866470
1900 1900 -, g dbSNP:587778956
1901 1901 -, a dbSNP:750300820
1902 1902 -, a dbSNP:587778957
1902 1902 a, g dbSNP:63751270
1903 1903 c, g dbSNP:63751047
1904 1904 -, tgat dbSNP:779795819
1905 1905 c, t dbSNP:63750825
1906 1906 a, g dbSNP:1800145
1910 1910 a, g, t dbSNP:63750549
1914 1914 -, t dbSNP:587778960
1914 1914 g, t dbSNP:63750079
1915 1915 a, g dbSNP:63750935
1916 1916 c, t dbSNP:63749792
1917 1917 c, t dbSNP:267607875
1918 1918 -, t dbSNP:587778961
1918 1918 c, t dbSNP:778417334
1922 1922 -, ct dbSNP:63750884
1922 1922 c, g dbSNP:577217817
1924 1924 -, gattaccccttctg dbSNP:587778958
1928 1928 -, g dbSNP:587778962
1932 1932 a, g dbSNP:587778963
1935 1935 a, g dbSNP:35045067
1936 1936 c, t dbSNP:786202774
1937 1937 a, g dbSNP:63750109
1940 1940 -, attaccccttctgattgacaactatgtgc dbSNP:587778959
1940 1940 c, t dbSNP:63750899
1941 1941 c, t dbSNP:63750610
1944 1944 -, ctt dbSNP:281864939
1944 1944 -, c dbSNP:281864938
1945 1945 c, t dbSNP:775658955
1951 1951 -, ggga dbSNP:63751301
1956 1956 g, t dbSNP:63751202
1957 1957 g, t dbSNP:1800146
1959 1959 c, t dbSNP:63750726
1961 1961 a, g, t dbSNP:55907433
1962 1962 c, t dbSNP:63751225
1965 1965 c, t dbSNP:267607876
1967 1967 a, t dbSNP:765363859
1969 1969 -, t dbSNP:63750115
1971 1971 c, t dbSNP:786202050
1973 1973 -, cg dbSNP:63750131
1973 1973 c, t dbSNP:63751310
1974 1974 -, ga dbSNP:63751200
1974 1974 a, c, g, t dbSNP:63749900
1975 1975 a, c, t dbSNP:759330601
1976 1976 c, t dbSNP:752427924
1982 1982 a, c dbSNP:587778964
1986 1986 -, a dbSNP:267607877
1986 1986 a, c, g dbSNP:63751682
1987 1987 a, g, t dbSNP:63751662
1989 1989 g, t dbSNP:786202938
1994 1994 c, t dbSNP:267607887
1996 1996 a, g dbSNP:63750639
1998 1998 -, a dbSNP:63750282
1998 1998 a, g dbSNP:63751162
1999 1999 c, t dbSNP:63750014
2000 2000 a, g dbSNP:63750292
2003 2003 c, g dbSNP:780406337
2004 2004 -, aaaag dbSNP:63750061
2007 2007 -, a dbSNP:63750740
2009 2009 g, t dbSNP:63750663
2011 2011 a, g dbSNP:747503723
2015 2015 c, t dbSNP:587780680
2018 2018 a, g dbSNP:755577490
2022 2022 a, c, g dbSNP:781637991
2023 2023 c, t dbSNP:770132213
2025 2025 c, g, t dbSNP:63750242
2026 2026 c, t dbSNP:587778969
2027 2027 a, t dbSNP:587780681
2028 2028 a, g dbSNP:587778970
2033 2033 g, t dbSNP:587778971
2034 2034 a, c dbSNP:749305196
2035 2035 a, g dbSNP:770992217
2036 2036 c, g, t dbSNP:63750809
2038 2038 a, c, t dbSNP:63749867
2039 2039 a, g dbSNP:63750217
2040 2040 c, t dbSNP:63750864
2041 2041 a, t dbSNP:768595157
2046 2046 c, t dbSNP:587778972
2049 2049 a, g dbSNP:267607886
2057 2057 c, t dbSNP:63751275
2058 2058 a, g dbSNP:587781310
2063 2063 a, c, t dbSNP:41542214
2064 2064 a, g dbSNP:63750702
2065 2065 -, gtacata dbSNP:63750420
2066 2066 g, t dbSNP:765877072
2068 2068 c, t dbSNP:550890395
2069 2069 -, t dbSNP:780956158
2069 2069 a, g dbSNP:201748079
2070 2070 a, t dbSNP:781780309
2072 2072 c, t dbSNP:587779957
2074 2074 -, tg dbSNP:63750769
2078 2078 g, t dbSNP:147542208
2079 2079 -, t dbSNP:267607698
2079 2079 a, c dbSNP:145565670
2082 2082 a, c, g dbSNP:63749995
2083 2083 a, g dbSNP:191505871
2089 2089 c, t dbSNP:536488280
2090 2090 -, tc dbSNP:63750859
2091 2091 c, g dbSNP:587778975
2092 2092 a, g dbSNP:786202433
2094 2094 a, g dbSNP:746007176
2097 2097 -, agca dbSNP:63751652
2099 2099 a, c, t dbSNP:63750114
2101 2101 a, c, g dbSNP:63750603
2102 2102 -, ag dbSNP:63751651
2103 2103 -, gtgaagtgcc dbSNP:587778979
2105 2105 a, c, g dbSNP:747727493
2108 2108 c, g dbSNP:587781811
2109 2109 -, tgcctgg dbSNP:587778980
2109 2109 g, t dbSNP:587780682
2116 2116 c, t dbSNP:1800147
2128 2128 c, g dbSNP:749100096
2129 2129 c, t dbSNP:587781342
2130 2130 c, g dbSNP:770583385
2132 2132 a, t dbSNP:267607909
2133 2133 a, g, t dbSNP:63750561
2134 2134 a, g, t dbSNP:63750499
2135 2135 a, t dbSNP:767094219
2139 2139 a, g dbSNP:63751022
2140 2140 a, g dbSNP:63750978
2144 2144 a, g, t dbSNP:35831931
2145 2145 -, tg dbSNP:587778981
2146 2146 ggaacacattgtctataaagc, nnnnn dbSNP:786202275
2150 2150 c, t dbSNP:2020873
2151 2151 a, c dbSNP:587778983
2152 2152 -, ca dbSNP:63750971
2152 2152 c, t dbSNP:1800148
2153 2153 -, atgtgttccaca, ca dbSNP:281864940
2153 2153 a, g dbSNP:754225520
2154 2154 c, t dbSNP:757603534
2155 2155 -, t dbSNP:587778984
2157 2157 g, t dbSNP:587778985
2160 2160 -, a dbSNP:786202767
2160 2160 a, c, g dbSNP:587778986
2161 2161 a, t dbSNP:63750484
2162 2162 a, g dbSNP:750596783
2164 2164 -, tataaa dbSNP:63751075
2167 2167 c, t dbSNP:758652752
2168 2168 a, t dbSNP:63749875
2170 2170 ag, gc dbSNP:786203433
2170 2170 a, g dbSNP:780045031
2171 2171 c, t dbSNP:138584384
2172 2172 a, g dbSNP:566928243
2177 2177 -, caca dbSNP:267607898
2177 2177 -, ca dbSNP:267607905
2178 2178 a, t dbSNP:104895002
2179 2179 -, ca dbSNP:587778987
2183 2183 c, g dbSNP:1800149
2188 2188 -, aaca dbSNP:267607902
2188 2188 -, t dbSNP:587780683
2191 2191 c, t dbSNP:749082864
2192 2192 a, t dbSNP:267607906
2193 2193 -, gaacacattgtctataaagccttgcgctcacacattctgcctcctaa dbSNP:587778982
2195 2195 -, aaac dbSNP:267607899
2196 2196 -, aaca dbSNP:267607903
2196 2196 a, g dbSNP:770579083
2203 2203 a, c dbSNP:371263535
2208 2208 a, t dbSNP:267607885
2211 2211 a, g dbSNP:148317871
2216 2216 -, a dbSNP:587778989
2219 2219 ctgc, nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn dbSNP:587778990
2219 2219 a, c dbSNP:786203583
2221 2221 -, gcagcttgcta dbSNP:267607897
2221 2221 a, g dbSNP:745444452
2222 2222 -, cagcttgct dbSNP:587778991
2222 2222 -, c dbSNP:267607896
2222 2222 c, t dbSNP:587778992
2224 2224 a, g dbSNP:771863612
2229 2229 c, t dbSNP:775127059
2237 2237 c, t dbSNP:587779958
2240 2240 a, c, g dbSNP:374380262
2244 2244 a, c, t dbSNP:267607894
2245 2245 a, c dbSNP:786202209
2246 2246 -, ta dbSNP:786202326
2246 2246 c, t dbSNP:777054430
2248 2248 a, c, g dbSNP:267607893
2249 2249 a, t dbSNP:786204318
2250 2250 -, aa dbSNP:267607907
2250 2250 a, g dbSNP:140195825
2251 2251 -, aa dbSNP:267607901
2256 2256 c, t dbSNP:587778993
2260 2260 -, g dbSNP:267607904
2261 2261 a, t dbSNP:267607900
2263 2263 c, g dbSNP:267607895
2264 2264 g, t dbSNP:765480781
2267 2267 -, t, tgtt dbSNP:267607892
2267 2267 a, t dbSNP:587778995
2269 2269 a, t dbSNP:267607908
2272 2272 a, g dbSNP:587778880
2273 2273 c, t dbSNP:750794400
2276 2276 -, ttat dbSNP:779336928
2279 2279 c, t dbSNP:758561792
2283 2283 c, t dbSNP:766650278
2284 2284 g, t dbSNP:75682204
2290 2290 g, t dbSNP:79406218
2299 2299 -, ttc dbSNP:200919928
2301 2301 -, ctt dbSNP:281875167
2301 2301 c, g, t dbSNP:200903126
2304 2304 -, ctt dbSNP:193922366
2308 2308 a, c dbSNP:781352547
2311 2311 c, g, t dbSNP:749138642
2314 2314 a, t dbSNP:778791265
2318 2318 c, t dbSNP:745713835
2327 2327 c, g dbSNP:771845260
2332 2332 a, g dbSNP:779892486
2340 2340 c, g dbSNP:746506283
2342 2342 a, g dbSNP:768003470
2364 2364 a, g dbSNP:776238530
2370 2370 a, g, t dbSNP:1803985
2374 2374 a, g dbSNP:770302355
2378 2378 c, g dbSNP:773556906
2387 2387 c, t dbSNP:763379368
2390 2390 a, g dbSNP:766562208
2391 2391 c, t dbSNP:751679614
2406 2406 a, t dbSNP:267607910
2413 2413 c, t dbSNP:570963416
2418 2418 c, t dbSNP:770660847
2427 2427 -, gatt dbSNP:201518804
2431 2431 -, gatt dbSNP:201866587
2434 2434 g, t dbSNP:538203686
2436 2436 a, t dbSNP:587778879
2442 2442 -, aata dbSNP:56329536
2459 2459 a, g dbSNP:556614001
2460 2460 c, t dbSNP:368443548

Target ORF information:

RefSeq Version XM_005265163
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mutL homolog 1 (MLH1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu20930D
Sequence Information ORF Nucleotide Sequence (Length: 1548bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Mlh1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)775..1056(+)
Misc Feature(2)778..2112(+)
Misc Feature(3)982..984(+)
Position Chain Variation Link
4 4 g, t dbSNP:587779020
10 10 a, c dbSNP:565334844
13 13 g, t dbSNP:753503730
14 14 c, t dbSNP:587781459
15 15 c, t dbSNP:41285097
16 16 a, g dbSNP:527826980
20 20 a, g dbSNP:749884419
21 21 a, g dbSNP:757995494
23 23 a, c, g dbSNP:780702356
24 24 g, t dbSNP:201247839
25 25 -, t dbSNP:747856324
27 27 a, c dbSNP:781364168
29 29 a, c, g, t dbSNP:56198082
30 30 a, c, t dbSNP:587779001
35 35 c, t dbSNP:771060933
36 36 c, t dbSNP:775371644
37 37 c, t dbSNP:760575557
42 42 c, t dbSNP:764112241
43 43 c, t dbSNP:730881744
45 45 c, t dbSNP:730881745
46 46 c, t dbSNP:776898290
49 49 g, t dbSNP:761672073
50 50 c, t dbSNP:104894994
57 57 a, g dbSNP:587778967
58 58 a, c, g, t dbSNP:111052004
59 59 a, g dbSNP:72481822
61 61 a, c, t dbSNP:587779029
62 62 c, g dbSNP:757950578
65 65 -, c dbSNP:63750745
65 65 c, g dbSNP:779759678
71 71 -, aggggttattcggc dbSNP:63751891
74 74 -, ggttattcggcggctgg dbSNP:63751892
74 74 a, g dbSNP:786202312
75 75 -, gttattcggcggctgga dbSNP:267607702
75 75 g, t dbSNP:730881746
76 76 g, t dbSNP:755402059
77 77 c, t dbSNP:781725830
78 78 -, a dbSNP:587778996
80 80 a, t dbSNP:748406142
81 81 c, t dbSNP:587779000