Email to GenScript

MPV17 MpV17 mitochondrial inner membrane protein [Homo sapiens (human)]

Gene Symbol MPV17
Entrez Gene ID 4358
Full Name MpV17 mitochondrial inner membrane protein
Synonyms MTDPS6, SYM1
General protein information
Preferred Names
protein Mpv17
protein Mpv17
Mpv17, human homolog of glomerulosclerosis and nephrotic syndrome
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Mitochondrial DNA depletion syndrome 6 (hepatocerebral type), 256810

The following MPV17 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MPV17 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu18759 XM_005264326 PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu35417 XM_006712021 PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu35418 XM_005264327 PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99
OHu18759 NM_002437 Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu18759
Accession Version XM_005264326.2
Sequence Information ORF Nucleotide Sequence (Length: 531bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein Mpv17 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530367610. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)388..588(+)
Position Chain Variation Link
8 8 a, g dbSNP:746035554
38 38 a, c dbSNP:187681281
41 41 c, g dbSNP:573773662
42 42 c, t dbSNP:556045361
61 61 a, g dbSNP:200303357
64 64 a, g dbSNP:553716559
72 72 c, g dbSNP:749825582
83 83 a, g dbSNP:367838807
85 85 -, c dbSNP:267607266
85 85 -, c dbSNP:780204423
90 90 g, t dbSNP:35244252
91 91 a, g dbSNP:748232066
94 94 c, t dbSNP:540291444
95 95 c, t dbSNP:200445233
98 98 c, t dbSNP:573379897
100 100 -, g dbSNP:772418004
103 103 a, c dbSNP:750197174
108 108 a, g dbSNP:778886974
124 124 c, g dbSNP:200504529
133 133 g, t dbSNP:121909725
138 138 c, t dbSNP:779646719
141 141 a, g dbSNP:758012171
142 142 a, g dbSNP:750762447
159 159 -, tat dbSNP:753533146
165 165 a, t dbSNP:368254758
169 169 c, t dbSNP:754051090
170 170 a, c dbSNP:762327729
175 175 a, g dbSNP:754287189
179 179 -, agaggcggggtctgcaggaacaccag dbSNP:397507438
185 185 a, g dbSNP:140992482
188 188 g, t dbSNP:760807961
189 189 g, t dbSNP:775763471
193 193 c, t dbSNP:772370243
198 198 -, a dbSNP:777604559
202 202 c, t dbSNP:759706929
211 211 c, t dbSNP:121909723
212 212 a, g dbSNP:121909721
217 217 c, t dbSNP:769489459
219 219 a, g dbSNP:142493907
222 222 c, t dbSNP:781100178
223 223 a, g dbSNP:768617578
226 226 a, g dbSNP:746498319
227 227 c, t dbSNP:575558175
230 230 a, c dbSNP:563621997
243 243 a, c dbSNP:377148388
248 248 -, t dbSNP:755624411
254 254 c, g dbSNP:375401970
256 256 a, g dbSNP:753265816
257 257 c, t dbSNP:140888121
260 260 c, t dbSNP:755007721
263 263 a, g dbSNP:767864649
269 269 a, g dbSNP:267607261
274 274 a, g dbSNP:751699511
280 280 a, t dbSNP:766487119
282 282 c, g dbSNP:763182621
286 286 c, t dbSNP:370061168
287 287 a, g dbSNP:763891393
288 288 c, g dbSNP:760522781
297 297 -, tggcaccac dbSNP:267607262
298 298 c, g dbSNP:149893578
299 299 c, g dbSNP:772091735
302 302 c, g, t dbSNP:35759430
305 305 c, t dbSNP:539628243
312 312 a, g dbSNP:199952690
318 318 a, c dbSNP:778222745
325 325 a, g dbSNP:267607256
326 326 -, aga dbSNP:267607263
326 326 a, t dbSNP:756530281
328 328 a, t dbSNP:748590375
330 330 a, g dbSNP:781519360
331 331 a, t dbSNP:755557286
334 334 -, ttg dbSNP:267607264
334 334 c, t dbSNP:751542259
341 341 a, t dbSNP:200938111
343 343 c, g dbSNP:267607257
347 347 -, g dbSNP:766160589
353 353 c, t dbSNP:373571379
356 356 c, t dbSNP:267607258
357 357 a, g dbSNP:747567003
364 364 c, g dbSNP:369706595
368 368 c, g dbSNP:780485901
376 376 c, t dbSNP:758469630
392 392 c, t dbSNP:750541759
394 394 c, t dbSNP:55689147
400 400 a, g dbSNP:757495960
420 420 c, t dbSNP:137975836
422 422 a, g dbSNP:121909724
428 428 a, g dbSNP:767352327
436 436 c, t dbSNP:112170670
437 437 a, g, t dbSNP:766486395
453 453 c, g dbSNP:760281019
459 459 c, t dbSNP:775768004
461 461 c, g dbSNP:149309794
467 467 a, g dbSNP:199690638
468 468 c, t dbSNP:774833271
470 470 a, g dbSNP:374692755
474 474 a, g dbSNP:766859811
491 491 g, t dbSNP:763400903
497 497 a, c dbSNP:773274752
503 503 a, g dbSNP:769776397
504 504 c, t dbSNP:762053119
507 507 a, g dbSNP:776964645
510 510 c, t dbSNP:769048578
514 514 -, c dbSNP:267607267
514 514 c, t dbSNP:745609578
520 520 c, t dbSNP:778608060
531 531 c, t dbSNP:762630909
532 532 a, g dbSNP:773077701
540 540 a, g dbSNP:543675118
548 548 a, c dbSNP:267607259
561 561 a, c dbSNP:121909722
568 568 c, g dbSNP:748082349
570 570 c, g dbSNP:369282321
572 572 c, t dbSNP:267607260
579 579 a, g dbSNP:768140934
583 583 c, t dbSNP:746596000
584 584 a, g dbSNP:779551551
586 586 c, t dbSNP:374686068
587 587 a, g dbSNP:746180658
590 590 c, t dbSNP:779425887
591 591 c, g dbSNP:757784720
604 604 a, t dbSNP:575952120
606 606 g, t dbSNP:201202659
607 607 a, c dbSNP:756120491
611 611 c, t dbSNP:542401106
612 612 a, g dbSNP:201679811
625 625 a, g dbSNP:376716759
628 628 a, g dbSNP:147885371
641 641 a, c, t dbSNP:182018397
645 645 a, g dbSNP:765027589
648 648 c, t dbSNP:189632972
649 649 a, g dbSNP:371392423
666 666 a, c dbSNP:768630067
669 669 c, g dbSNP:571833094
674 674 c, t dbSNP:200529035
689 689 a, g dbSNP:183584895
702 702 a, c dbSNP:181227313
703 703 a, g dbSNP:781468403
709 709 a, t dbSNP:188354035
719 719 a, g dbSNP:781590414
749 749 c, t dbSNP:1049751
790 790 c, t dbSNP:1049772
797 797 c, t dbSNP:549349781
799 799 a, c dbSNP:1049790
823 823 c, t dbSNP:527826929
831 831 a, g dbSNP:757583837
889 889 a, c dbSNP:1049795
892 892 c, t dbSNP:1049796
923 923 c, t dbSNP:566603831
928 928 a, g dbSNP:761887014
932 932 c, t dbSNP:1049799
941 941 c, t dbSNP:144697795
942 942 c, t dbSNP:532199087
952 952 a, g dbSNP:1049801
960 960 c, t dbSNP:539574166
990 990 a, g dbSNP:564692529
1007 1007 a, c dbSNP:575276701

Target ORF information:

RefSeq Version XM_005264326
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu35417
Accession Version XM_006712021.2
Sequence Information ORF Nucleotide Sequence (Length: 483bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein Mpv17 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578802914. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)533..733(+)
Position Chain Variation Link
22 22 c, t dbSNP:537939605
49 49 a, g dbSNP:200303357
52 52 a, g dbSNP:553716559
60 60 c, g dbSNP:749825582
71 71 a, g dbSNP:367838807
73 73 -, c dbSNP:267607266
73 73 -, c dbSNP:780204423
78 78 g, t dbSNP:35244252
79 79 a, g dbSNP:748232066
82 82 c, t dbSNP:540291444
83 83 c, t dbSNP:200445233
86 86 c, t dbSNP:573379897
88 88 -, g dbSNP:772418004
91 91 a, c dbSNP:750197174
96 96 a, g dbSNP:778886974
112 112 c, g dbSNP:200504529
121 121 g, t dbSNP:121909725
150 150 a, g dbSNP:773752801
153 153 c, t dbSNP:572141468
156 156 c, t dbSNP:770268375
165 165 c, t dbSNP:748239567
172 172 a, t dbSNP:553602518
176 176 a, g, t dbSNP:538698009
182 182 a, g dbSNP:747243360
191 191 c, g dbSNP:778793106
203 203 c, t dbSNP:182612163
238 238 -, c dbSNP:375344391
242 242 -, c dbSNP:575046204
254 254 c, t dbSNP:532966259
255 255 a, g dbSNP:763071467
265 265 a, c dbSNP:79356266
283 283 c, t dbSNP:779646719
286 286 a, g dbSNP:758012171
287 287 a, g dbSNP:750762447
304 304 -, tat dbSNP:753533146
310 310 a, t dbSNP:368254758
314 314 c, t dbSNP:754051090
315 315 a, c dbSNP:762327729
320 320 a, g dbSNP:754287189
324 324 -, agaggcggggtctgcaggaacaccag dbSNP:397507438
330 330 a, g dbSNP:140992482
333 333 g, t dbSNP:760807961
334 334 g, t dbSNP:775763471
338 338 c, t dbSNP:772370243
343 343 -, a dbSNP:777604559
347 347 c, t dbSNP:759706929
356 356 c, t dbSNP:121909723
357 357 a, g dbSNP:121909721
362 362 c, t dbSNP:769489459
364 364 a, g dbSNP:142493907
367 367 c, t dbSNP:781100178
368 368 a, g dbSNP:768617578
371 371 a, g dbSNP:746498319
372 372 c, t dbSNP:575558175
375 375 a, c dbSNP:563621997
388 388 a, c dbSNP:377148388
393 393 -, t dbSNP:755624411
399 399 c, g dbSNP:375401970
401 401 a, g dbSNP:753265816
402 402 c, t dbSNP:140888121
405 405 c, t dbSNP:755007721
408 408 a, g dbSNP:767864649
414 414 a, g dbSNP:267607261
419 419 a, g dbSNP:751699511
425 425 a, t dbSNP:766487119
427 427 c, g dbSNP:763182621
431 431 c, t dbSNP:370061168
432 432 a, g dbSNP:763891393
433 433 c, g dbSNP:760522781
442 442 -, tggcaccac dbSNP:267607262
443 443 c, g dbSNP:149893578
444 444 c, g dbSNP:772091735
447 447 c, g, t dbSNP:35759430
450 450 c, t dbSNP:539628243
457 457 a, g dbSNP:199952690
463 463 a, c dbSNP:778222745
470 470 a, g dbSNP:267607256
471 471 -, aga dbSNP:267607263
471 471 a, t dbSNP:756530281
473 473 a, t dbSNP:748590375
475 475 a, g dbSNP:781519360
476 476 a, t dbSNP:755557286
479 479 -, ttg dbSNP:267607264
479 479 c, t dbSNP:751542259
486 486 a, t dbSNP:200938111
488 488 c, g dbSNP:267607257
492 492 -, g dbSNP:766160589
498 498 c, t dbSNP:373571379
501 501 c, t dbSNP:267607258
502 502 a, g dbSNP:747567003
509 509 c, g dbSNP:369706595
513 513 c, g dbSNP:780485901
521 521 c, t dbSNP:758469630
537 537 c, t dbSNP:750541759
539 539 c, t dbSNP:55689147
545 545 a, g dbSNP:757495960
565 565 c, t dbSNP:137975836
567 567 a, g dbSNP:121909724
573 573 a, g dbSNP:767352327
581 581 c, t dbSNP:112170670
582 582 a, g, t dbSNP:766486395
598 598 c, g dbSNP:760281019
604 604 c, t dbSNP:775768004
606 606 c, g dbSNP:149309794
612 612 a, g dbSNP:199690638
613 613 c, t dbSNP:774833271
615 615 a, g dbSNP:374692755
619 619 a, g dbSNP:766859811
636 636 g, t dbSNP:763400903
642 642 a, c dbSNP:773274752
648 648 a, g dbSNP:769776397
649 649 c, t dbSNP:762053119
652 652 a, g dbSNP:776964645
655 655 c, t dbSNP:769048578
659 659 -, c dbSNP:267607267
659 659 c, t dbSNP:745609578
665 665 c, t dbSNP:778608060
676 676 c, t dbSNP:762630909
677 677 a, g dbSNP:773077701
685 685 a, g dbSNP:543675118
693 693 a, c dbSNP:267607259
706 706 a, c dbSNP:121909722
713 713 c, g dbSNP:748082349
715 715 c, g dbSNP:369282321
717 717 c, t dbSNP:267607260
724 724 a, g dbSNP:768140934
728 728 c, t dbSNP:746596000
729 729 a, g dbSNP:779551551
731 731 c, t dbSNP:374686068
732 732 a, g dbSNP:746180658
735 735 c, t dbSNP:779425887
736 736 c, g dbSNP:757784720
749 749 a, t dbSNP:575952120
751 751 g, t dbSNP:201202659
752 752 a, c dbSNP:756120491
756 756 c, t dbSNP:542401106
757 757 a, g dbSNP:201679811
770 770 a, g dbSNP:376716759
773 773 a, g dbSNP:147885371
786 786 a, c, t dbSNP:182018397
790 790 a, g dbSNP:765027589
793 793 c, t dbSNP:189632972
794 794 a, g dbSNP:371392423
811 811 a, c dbSNP:768630067
814 814 c, g dbSNP:571833094
819 819 c, t dbSNP:200529035
834 834 a, g dbSNP:183584895
847 847 a, c dbSNP:181227313
848 848 a, g dbSNP:781468403
854 854 a, t dbSNP:188354035
864 864 a, g dbSNP:781590414
894 894 c, t dbSNP:1049751
935 935 c, t dbSNP:1049772
942 942 c, t dbSNP:549349781
944 944 a, c dbSNP:1049790
968 968 c, t dbSNP:527826929
976 976 a, g dbSNP:757583837
1034 1034 a, c dbSNP:1049795
1037 1037 c, t dbSNP:1049796
1068 1068 c, t dbSNP:566603831
1073 1073 a, g dbSNP:761887014
1077 1077 c, t dbSNP:1049799
1086 1086 c, t dbSNP:144697795
1087 1087 c, t dbSNP:532199087
1097 1097 a, g dbSNP:1049801
1105 1105 c, t dbSNP:539574166
1135 1135 a, g dbSNP:564692529
1152 1152 a, c dbSNP:575276701

Target ORF information:

RefSeq Version XM_006712021
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu35418
Accession Version XM_005264327.2
Sequence Information ORF Nucleotide Sequence (Length: 372bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein Mpv17 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530367612. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)2924..3124(+)
Position Chain Variation Link
30 30 a, g dbSNP:62130716
38 38 a, c dbSNP:143457655
41 41 c, t dbSNP:115610538
76 76 c, t dbSNP:759071022
88 88 c, t dbSNP:368175890
136 136 a, g dbSNP:534812122
143 143 a, g dbSNP:753562284
163 163 a, t dbSNP:560819849
177 177 c, t dbSNP:765883972
217 217 a, g dbSNP:760358048
221 221 a, g dbSNP:570680736
235 235 a, g dbSNP:552429660
268 268 a, g dbSNP:772942410
273 273 a, c dbSNP:771867072
276 276 c, t dbSNP:139996236
346 346 a, g dbSNP:569315988
347 347 a, g dbSNP:146299056
353 353 a, g dbSNP:529781823
409 409 a, g dbSNP:183215484
483 483 a, g dbSNP:761785823
509 509 a, g dbSNP:559022152
510 510 g, t dbSNP:4665378
529 529 c, t dbSNP:140025353
557 557 a, g dbSNP:144272051
563 563 a, g dbSNP:544118177
567 567 c, t dbSNP:576762228
596 596 a, c dbSNP:561275426
599 599 a, g dbSNP:543033278
619 619 c, g, t dbSNP:572617509
663 663 c, t dbSNP:761497611
700 700 c, t dbSNP:192897270
710 710 c, t dbSNP:149592923
747 747 c, t dbSNP:376909006
749 749 c, t dbSNP:576981191
771 771 a, g dbSNP:558424093
775 775 c, t dbSNP:79558076
782 782 c, t dbSNP:569607157
784 784 a, g dbSNP:754858108
786 786 c, t dbSNP:781491597
798 798 c, t dbSNP:554192467
828 828 c, t dbSNP:77198554
837 837 a, g dbSNP:565473569
887 887 a, g dbSNP:547485388
888 888 a, c dbSNP:532081810
898 898 c, g dbSNP:778040102
903 903 a, g dbSNP:766001947
918 918 c, t dbSNP:762605595
922 922 g, t dbSNP:551021705
937 937 c, t dbSNP:758816703
994 994 a, c dbSNP:571813738
1034 1034 c, t dbSNP:150885606
1055 1055 c, t dbSNP:751714126
1064 1064 c, g dbSNP:527301333
1091 1091 c, t dbSNP:532084083
1097 1097 a, t dbSNP:561563134
1127 1127 c, t dbSNP:543070261
1146 1146 a, g dbSNP:527668439
1155 1155 c, t dbSNP:560250568
1163 1163 -, c dbSNP:35733015
1211 1211 a, t dbSNP:777930313
1219 1219 g, t dbSNP:756247141
1228 1228 c, t dbSNP:752964355
1229 1229 c, g dbSNP:779652386
1233 1233 a, g dbSNP:754543266
1233 1233 -, g dbSNP:749902128
1237 1237 a, c dbSNP:545503618
1242 1242 c, g dbSNP:188416631
1244 1244 a, t dbSNP:373177380
1265 1265 -, tactt dbSNP:759553174
1267 1267 -, ctta dbSNP:764690704
1272 1272 -, tgataa dbSNP:770729561
1276 1276 -, aa dbSNP:368198052
1278 1278 -, aa dbSNP:762010868
1281 1281 -, ag dbSNP:560145508
1301 1301 c, g dbSNP:76164683
1319 1319 a, g dbSNP:558759684
1333 1333 c, t dbSNP:143316711
1357 1357 a, g dbSNP:139395202
1383 1383 a, t dbSNP:554429187
1408 1408 -, acatt dbSNP:777174352
1420 1420 a, g dbSNP:370729043
1428 1428 a, g dbSNP:111603818
1488 1488 a, c dbSNP:765903868
1515 1515 c, g dbSNP:536108170
1556 1556 c, t dbSNP:565358273
1565 1565 a, t dbSNP:146907553
1608 1608 c, g dbSNP:538735175
1616 1616 a, g dbSNP:76951300
1648 1648 c, t dbSNP:550394655
1677 1677 c, t dbSNP:183482037
1687 1687 g, t dbSNP:377215369
1691 1691 a, g dbSNP:372737857
1715 1715 a, g dbSNP:567991820
1748 1748 a, g dbSNP:549711288
1803 1803 c, t dbSNP:767320794
1846 1846 a, t dbSNP:527959050
1866 1866 a, t dbSNP:761553277
1900 1900 c, g dbSNP:560547632
1945 1945 a, g dbSNP:545067839
1983 1983 a, g dbSNP:533517575
1999 1999 a, c dbSNP:369197095
2005 2005 c, g dbSNP:562822355
2082 2082 a, t dbSNP:543248641
2095 2095 c, g dbSNP:375264722
2113 2113 g, t dbSNP:554315054
2116 2116 g, t dbSNP:184951472
2124 2124 a, g dbSNP:542516557
2141 2141 a, g dbSNP:572205546
2183 2183 c, g, t dbSNP:141916129
2279 2279 a, g dbSNP:776642761
2302 2302 c, g dbSNP:538251555
2304 2304 c, g dbSNP:771014608
2312 2312 a, t dbSNP:577694225
2320 2320 c, g dbSNP:556275678
2329 2329 a, g dbSNP:537904575
2338 2338 a, g dbSNP:563558312
2344 2344 c, t dbSNP:72817546
2368 2368 c, t dbSNP:534541657
2375 2375 a, c dbSNP:773437929
2390 2390 c, g dbSNP:4665968
2415 2415 -, g dbSNP:144877034
2417 2417 c, t dbSNP:565505634
2446 2446 a, g dbSNP:551782838
2457 2457 c, g dbSNP:190985336
2460 2460 -, tc dbSNP:3217473
2470 2470 a, g dbSNP:562868297
2473 2473 a, g dbSNP:143488606
2479 2479 a, g dbSNP:529301479
2480 2480 g, t dbSNP:576520006
2499 2499 c, t dbSNP:776008112
2503 2503 c, g dbSNP:542403860
2508 2508 c, g dbSNP:554773769
2519 2519 c, g dbSNP:572351759
2521 2521 c, t dbSNP:186133462
2522 2522 a, g dbSNP:536703797
2543 2543 c, t dbSNP:545021877
2547 2547 a, c dbSNP:577578752
2551 2551 a, g dbSNP:556165748
2553 2553 a, g dbSNP:373058214
2605 2605 c, t dbSNP:537939605
2632 2632 a, g dbSNP:200303357
2635 2635 a, g dbSNP:553716559
2643 2643 c, g dbSNP:749825582
2654 2654 a, g dbSNP:367838807
2656 2656 -, c dbSNP:267607266
2656 2656 -, c dbSNP:780204423
2661 2661 g, t dbSNP:35244252
2662 2662 a, g dbSNP:748232066
2665 2665 c, t dbSNP:540291444
2666 2666 c, t dbSNP:200445233
2669 2669 c, t dbSNP:573379897
2671 2671 -, g dbSNP:772418004
2674 2674 a, c dbSNP:750197174
2679 2679 a, g dbSNP:778886974
2695 2695 c, g dbSNP:200504529
2704 2704 g, t dbSNP:121909725
2705 2705 c, t dbSNP:754051090
2706 2706 a, c dbSNP:762327729
2711 2711 a, g dbSNP:754287189
2715 2715 -, agaggcggggtctgcaggaacaccag dbSNP:397507438
2721 2721 a, g dbSNP:140992482
2724 2724 g, t dbSNP:760807961
2725 2725 g, t dbSNP:775763471
2729 2729 c, t dbSNP:772370243
2734 2734 -, a dbSNP:777604559
2738 2738 c, t dbSNP:759706929
2747 2747 c, t dbSNP:121909723
2748 2748 a, g dbSNP:121909721
2753 2753 c, t dbSNP:769489459
2755 2755 a, g dbSNP:142493907
2758 2758 c, t dbSNP:781100178
2759 2759 a, g dbSNP:768617578
2762 2762 a, g dbSNP:746498319
2763 2763 c, t dbSNP:575558175
2766 2766 a, c dbSNP:563621997
2779 2779 a, c dbSNP:377148388
2784 2784 -, t dbSNP:755624411
2790 2790 c, g dbSNP:375401970
2792 2792 a, g dbSNP:753265816
2793 2793 c, t dbSNP:140888121
2796 2796 c, t dbSNP:755007721
2799 2799 a, g dbSNP:767864649
2805 2805 a, g dbSNP:267607261
2810 2810 a, g dbSNP:751699511
2816 2816 a, t dbSNP:766487119
2818 2818 c, g dbSNP:763182621
2822 2822 c, t dbSNP:370061168
2823 2823 a, g dbSNP:763891393
2824 2824 c, g dbSNP:760522781
2833 2833 -, tggcaccac dbSNP:267607262
2834 2834 c, g dbSNP:149893578
2835 2835 c, g dbSNP:772091735
2838 2838 c, g, t dbSNP:35759430
2841 2841 c, t dbSNP:539628243
2848 2848 a, g dbSNP:199952690
2854 2854 a, c dbSNP:778222745
2861 2861 a, g dbSNP:267607256
2862 2862 -, aga dbSNP:267607263
2862 2862 a, t dbSNP:756530281
2864 2864 a, t dbSNP:748590375
2866 2866 a, g dbSNP:781519360
2867 2867 a, t dbSNP:755557286
2870 2870 -, ttg dbSNP:267607264
2870 2870 c, t dbSNP:751542259
2877 2877 a, t dbSNP:200938111
2879 2879 c, g dbSNP:267607257
2883 2883 -, g dbSNP:766160589
2889 2889 c, t dbSNP:373571379
2892 2892 c, t dbSNP:267607258
2893 2893 a, g dbSNP:747567003
2900 2900 c, g dbSNP:369706595
2904 2904 c, g dbSNP:780485901
2912 2912 c, t dbSNP:758469630
2928 2928 c, t dbSNP:750541759
2930 2930 c, t dbSNP:55689147
2936 2936 a, g dbSNP:757495960
2956 2956 c, t dbSNP:137975836
2958 2958 a, g dbSNP:121909724
2964 2964 a, g dbSNP:767352327
2972 2972 c, t dbSNP:112170670
2973 2973 a, g, t dbSNP:766486395
2989 2989 c, g dbSNP:760281019
2995 2995 c, t dbSNP:775768004
2997 2997 c, g dbSNP:149309794
3003 3003 a, g dbSNP:199690638
3004 3004 c, t dbSNP:774833271
3006 3006 a, g dbSNP:374692755
3010 3010 a, g dbSNP:766859811
3027 3027 g, t dbSNP:763400903
3033 3033 a, c dbSNP:773274752
3039 3039 a, g dbSNP:769776397
3040 3040 c, t dbSNP:762053119
3043 3043 a, g dbSNP:776964645
3046 3046 c, t dbSNP:769048578
3050 3050 -, c dbSNP:267607267
3050 3050 c, t dbSNP:745609578
3056 3056 c, t dbSNP:778608060
3067 3067 c, t dbSNP:762630909
3068 3068 a, g dbSNP:773077701
3076 3076 a, g dbSNP:543675118
3084 3084 a, c dbSNP:267607259
3097 3097 a, c dbSNP:121909722
3104 3104 c, g dbSNP:748082349
3106 3106 c, g dbSNP:369282321
3108 3108 c, t dbSNP:267607260
3115 3115 a, g dbSNP:768140934
3119 3119 c, t dbSNP:746596000
3120 3120 a, g dbSNP:779551551
3122 3122 c, t dbSNP:374686068
3123 3123 a, g dbSNP:746180658
3126 3126 c, t dbSNP:779425887
3127 3127 c, g dbSNP:757784720
3140 3140 a, t dbSNP:575952120
3142 3142 g, t dbSNP:201202659
3143 3143 a, c dbSNP:756120491
3147 3147 c, t dbSNP:542401106
3148 3148 a, g dbSNP:201679811
3161 3161 a, g dbSNP:376716759
3164 3164 a, g dbSNP:147885371
3177 3177 a, c, t dbSNP:182018397
3181 3181 a, g dbSNP:765027589
3184 3184 c, t dbSNP:189632972
3185 3185 a, g dbSNP:371392423
3202 3202 a, c dbSNP:768630067
3205 3205 c, g dbSNP:571833094
3210 3210 c, t dbSNP:200529035
3225 3225 a, g dbSNP:183584895
3238 3238 a, c dbSNP:181227313
3239 3239 a, g dbSNP:781468403
3245 3245 a, t dbSNP:188354035
3255 3255 a, g dbSNP:781590414
3285 3285 c, t dbSNP:1049751
3326 3326 c, t dbSNP:1049772
3333 3333 c, t dbSNP:549349781
3335 3335 a, c dbSNP:1049790
3359 3359 c, t dbSNP:527826929
3367 3367 a, g dbSNP:757583837
3425 3425 a, c dbSNP:1049795
3428 3428 c, t dbSNP:1049796
3459 3459 c, t dbSNP:566603831
3464 3464 a, g dbSNP:761887014
3468 3468 c, t dbSNP:1049799
3477 3477 c, t dbSNP:144697795
3478 3478 c, t dbSNP:532199087
3488 3488 a, g dbSNP:1049801
3496 3496 c, t dbSNP:539574166
3526 3526 a, g dbSNP:564692529
3543 3543 a, c dbSNP:575276701

Target ORF information:

RefSeq Version XM_005264327
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18759
Accession Version NM_002437.4
Sequence Information ORF Nucleotide Sequence (Length: 531bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein Mpv17
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BI602840.1, X76538.1 and BC001115.2. This sequence is a reference standard in the RefSeqGene project. On May 19, 2006 this sequence version replaced gi:37059781. Summary: This gene encodes a mitochondrial inner membrane protein that is implicated in the metabolism of reactive oxygen species. Mutations in this gene have been associated with the hepatocerebral form of mitochondrial DNA depletion syndrome (MDDS). [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: BI458379.1, BQ057187.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2144335, SAMEA2146411 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)12..14(+)
Misc Feature(2)108..170(+)
Misc Feature(3)213..275(+)
Misc Feature(4)336..398(+)
Misc Feature(5)381..581(+)
Misc Feature(6)447..509(+)
Exon (1)1..51
Gene Synonym:
Exon (2)52..126
Gene Synonym:
Exon (3)127..242
Gene Synonym:
Exon (4)243..335
Gene Synonym:
Exon (5)336..431
Gene Synonym:
Exon (6)432..464
Gene Synonym:
Exon (7)465..517
Gene Synonym:
Exon (8)518..1007
Gene Synonym:
Position Chain Variation Link
27 27 c, t dbSNP:537939605
54 54 a, g dbSNP:200303357
57 57 a, g dbSNP:553716559
65 65 c, g dbSNP:749825582
76 76 a, g dbSNP:367838807
78 78 -, c dbSNP:267607266
78 78 -, c dbSNP:780204423
83 83 g, t dbSNP:35244252
84 84 a, g dbSNP:748232066
87 87 c, t dbSNP:540291444
88 88 c, t dbSNP:200445233
91 91 c, t dbSNP:573379897
93 93 -, g dbSNP:772418004
96 96 a, c dbSNP:750197174
101 101 a, g dbSNP:778886974
117 117 c, g dbSNP:200504529
126 126 g, t dbSNP:121909725
131 131 c, t dbSNP:779646719
134 134 a, g dbSNP:758012171
135 135 a, g dbSNP:750762447
152 152 -, tat dbSNP:753533146
158 158 a, t dbSNP:368254758
162 162 c, t dbSNP:754051090
163 163 a, c dbSNP:762327729
168 168 a, g dbSNP:754287189
172 172 -, agaggcggggtctgcaggaacaccag dbSNP:397507438
178 178 a, g dbSNP:140992482
181 181 g, t dbSNP:760807961
182 182 g, t dbSNP:775763471
186 186 c, t dbSNP:772370243
191 191 -, a dbSNP:777604559
195 195 c, t dbSNP:759706929
204 204 c, t dbSNP:121909723
205 205 a, g dbSNP:121909721
210 210 c, t dbSNP:769489459
212 212 a, g dbSNP:142493907
215 215 c, t dbSNP:781100178
216 216 a, g dbSNP:768617578
219 219 a, g dbSNP:746498319
220 220 c, t dbSNP:575558175
223 223 a, c dbSNP:563621997
236 236 a, c dbSNP:377148388
241 241 -, t dbSNP:755624411
247 247 c, g dbSNP:375401970
249 249 a, g dbSNP:753265816
250 250 c, t dbSNP:140888121
253 253 c, t dbSNP:755007721
256 256 a, g dbSNP:767864649
262 262 a, g dbSNP:267607261
267 267 a, g dbSNP:751699511
273 273 a, t dbSNP:766487119
275 275 c, g dbSNP:763182621
279 279 c, t dbSNP:370061168
280 280 a, g dbSNP:763891393
281 281 c, g dbSNP:760522781
290 290 -, tggcaccac dbSNP:267607262
291 291 c, g dbSNP:149893578
292 292 c, g dbSNP:772091735
295 295 c, g, t dbSNP:35759430
298 298 c, t dbSNP:539628243
305 305 a, g dbSNP:199952690
311 311 a, c dbSNP:778222745
318 318 a, g dbSNP:267607256
319 319 -, aga dbSNP:267607263
319 319 a, t dbSNP:756530281
321 321 a, t dbSNP:748590375
323 323 a, g dbSNP:781519360
324 324 a, t dbSNP:755557286
327 327 -, ttg dbSNP:267607264
327 327 c, t dbSNP:751542259
334 334 a, t dbSNP:200938111
336 336 c, g dbSNP:267607257
340 340 -, g dbSNP:766160589
346 346 c, t dbSNP:373571379
349 349 c, t dbSNP:267607258
350 350 a, g dbSNP:747567003
357 357 c, g dbSNP:369706595
361 361 c, g dbSNP:780485901
369 369 c, t dbSNP:758469630
385 385 c, t dbSNP:750541759
387 387 c, t dbSNP:55689147
393 393 a, g dbSNP:757495960
413 413 c, t dbSNP:137975836
415 415 a, g dbSNP:121909724
421 421 a, g dbSNP:767352327
429 429 c, t dbSNP:112170670
430 430 a, g, t dbSNP:766486395
446 446 c, g dbSNP:760281019
452 452 c, t dbSNP:775768004
454 454 c, g dbSNP:149309794
460 460 a, g dbSNP:199690638
461 461 c, t dbSNP:774833271
463 463 a, g dbSNP:374692755
467 467 a, g dbSNP:766859811
484 484 g, t dbSNP:763400903
490 490 a, c dbSNP:773274752
496 496 a, g dbSNP:769776397
497 497 c, t dbSNP:762053119
500 500 a, g dbSNP:776964645
503 503 c, t dbSNP:769048578
507 507 -, c dbSNP:267607267
507 507 c, t dbSNP:745609578
513 513 c, t dbSNP:778608060
524 524 c, t dbSNP:762630909
525 525 a, g dbSNP:773077701
533 533 a, g dbSNP:543675118
541 541 a, c dbSNP:267607259
554 554 a, c dbSNP:121909722
561 561 c, g dbSNP:748082349
563 563 c, g dbSNP:369282321
565 565 c, t dbSNP:267607260
572 572 a, g dbSNP:768140934
576 576 c, t dbSNP:746596000
577 577 a, g dbSNP:779551551
579 579 c, t dbSNP:374686068
580 580 a, g dbSNP:746180658
583 583 c, t dbSNP:779425887
584 584 c, g dbSNP:757784720
597 597 a, t dbSNP:575952120
599 599 g, t dbSNP:201202659
600 600 a, c dbSNP:756120491
604 604 c, t dbSNP:542401106
605 605 a, g dbSNP:201679811
618 618 a, g dbSNP:376716759
621 621 a, g dbSNP:147885371
634 634 a, c, t dbSNP:182018397
638 638 a, g dbSNP:765027589
641 641 c, t dbSNP:189632972
642 642 a, g dbSNP:371392423
659 659 a, c dbSNP:768630067
662 662 c, g dbSNP:571833094
667 667 c, t dbSNP:200529035
682 682 a, g dbSNP:183584895
695 695 a, c dbSNP:181227313
696 696 a, g dbSNP:781468403
702 702 a, t dbSNP:188354035
712 712 a, g dbSNP:781590414
742 742 c, t dbSNP:1049751
783 783 c, t dbSNP:1049772
790 790 c, t dbSNP:549349781
792 792 a, c dbSNP:1049790
816 816 c, t dbSNP:527826929
824 824 a, g dbSNP:757583837
882 882 a, c dbSNP:1049795
885 885 c, t dbSNP:1049796
916 916 c, t dbSNP:566603831
921 921 a, g dbSNP:761887014
925 925 c, t dbSNP:1049799
934 934 c, t dbSNP:144697795
935 935 c, t dbSNP:532199087
945 945 a, g dbSNP:1049801
953 953 c, t dbSNP:539574166
983 983 a, g dbSNP:564692529
1000 1000 a, c dbSNP:575276701

Target ORF information:

RefSeq Version NM_002437
Organism Homo sapiens (human)
Definition Homo sapiens MpV17 mitochondrial inner membrane protein (MPV17), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.