
MSH2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MSH2
Entrez Gene ID 4436
Full Name mutS homolog 2
General protein information
Preferred Names
DNA mismatch repair protein Msh2
DNA mismatch repair protein Msh2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, hereditary nonpolyposis, type 1, 120435 (3);

mRNA and Protein(s)

mRNA Protein Name
NM_001258281 NP_001245210 DNA mismatch repair protein Msh2 isoform 2
XM_005264332 XP_005264389 DNA mismatch repair protein Msh2 isoform X1
XM_011532867 XP_011531169 DNA mismatch repair protein Msh2 isoform X2
NM_000251 NP_000242 DNA mismatch repair protein Msh2 isoform 1

hsa03430 Mismatch repair
hsa05210 Colorectal cancer
hsa05200 Pathways in cancer
hsa_M00295 BRCA1-associated genome surveillance complex (BASC)
R-HSA-5358565 Mismatch repair (MMR) directed by MSH2:MSH6 (MutSalpha)
R-HSA-73894 DNA Repair
R-HSA-5358508 Mismatch Repair
R-HSA-5358606 Mismatch repair (MMR) directed by MSH2:MSH3 (MutSbeta)
Pathway Interaction Database
p53downstreampathway Direct p53 effectors
WP531 Mismatch repair
WP1984 Integrated Breast Cancer Pathway
WP2263 Prostate Cancer
WP1971 Integrated Cancer pathway

Homo sapiens (human) MSH2 NP_000242.1
Canis lupus familiaris (dog) MSH2 XP_538482.2
Bos taurus (cattle) MSH2 NP_001029756.1
Mus musculus (house mouse) Msh2 NP_032654.1
Rattus norvegicus (Norway rat) Msh2 NP_112320.1
Gallus gallus (chicken) MSH2 XP_426110.4
Danio rerio (zebrafish) msh2 NP_998689.1
Drosophila melanogaster (fruit fly) spel1 NP_001246031.1
Arabidopsis thaliana (thale cress) MSH2 NP_566804.3
Xenopus (Silurana) tropicalis (western clawed frog) msh2 XP_002935427.2


ID Name Evidence
GO:0000228 nuclear chromosome ISS
GO:0005634 nucleus IEA
GO:0032301 MutSalpha complex IDA
GO:0032302 MutSbeta complex IDA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0000287 magnesium ion binding IDA
GO:0000400 four-way junction DNA binding IDA
GO:0000403 Y-form DNA binding ISS
GO:0000404 loop DNA binding ISS
GO:0000406 double-strand/single-strand DNA junction binding ISS
GO:0003677 DNA binding IDA
GO:0003684 damaged DNA binding IEA
GO:0003690 double-stranded DNA binding IDA
GO:0003697 single-stranded DNA binding IDA
GO:0005515 protein binding IPI
GO:0005515 protein binding IPI
GO:0005524 ATP binding IDA
GO:0008022 protein C-terminus binding IPI
GO:0008094 DNA-dependent ATPase activity ISS
GO:0016887 ATPase activity IDA
GO:0019237 centromeric DNA binding IEA
GO:0019899 enzyme binding IPI
GO:0019901 protein kinase binding IPI
GO:0030983 mismatched DNA binding IDA
GO:0032137 guanine/thymine mispair binding IDA
GO:0032137 guanine/thymine mispair binding IMP
GO:0032139 dinucleotide insertion or deletion binding IDA
GO:0032142 single guanine insertion binding IDA
GO:0032143 single thymine insertion binding IDA
GO:0032181 dinucleotide repeat insertion binding IDA
GO:0032357 oxidized purine DNA binding IDA
GO:0032405 MutLalpha complex binding IDA
GO:0042802 identical protein binding IPI
GO:0042803 protein homodimerization activity IDA
GO:0043531 ADP binding IDA


ID Name Evidence
GO:0000710 meiotic mismatch repair ISS
GO:0001701 in utero embryonic development IEA
GO:0006119 oxidative phosphorylation IEA
GO:0006200 ATP catabolic process IDA
GO:0006281 DNA repair IDA
GO:0006298 mismatch repair IDA
GO:0006301 postreplication repair IDA
GO:0006302 double-strand break repair ISS
GO:0006311 meiotic gene conversion ISS
GO:0007050 cell cycle arrest IEA
GO:0007281 germ cell development IEA
GO:0007283 spermatogenesis IEA
GO:0008340 determination of adult lifespan IEA
GO:0008584 male gonad development ISS
GO:0010165 response to X-ray ISS
GO:0010224 response to UV-B ISS
GO:0014070 response to organic cyclic compound IEA
GO:0016446 somatic hypermutation of immunoglobulin genes ISS
GO:0016447 somatic recombination of immunoglobulin gene segments ISS
GO:0019724 B cell mediated immunity ISS
GO:0030183 B cell differentiation ISS
GO:0031573 intra-S DNA damage checkpoint ISS
GO:0042493 response to drug IEA
GO:0042771 DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis ISS
GO:0043200 response to amino acid stimulus IEA
GO:0043524 negative regulation of neuron apoptosis ISS
GO:0043570 maintenance of DNA repeat elements IMP
GO:0045128 negative regulation of reciprocal meiotic recombination ISS
GO:0045190 isotype switching ISS
GO:0045910 negative regulation of DNA recombination IDA
GO:0045910 negative regulation of DNA recombination ISS
GO:0051096 positive regulation of helicase activity IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following MSH2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MSH2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_001258281 Homo sapiens mutS homolog 2 (MSH2), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu59053 XM_005264332 PREDICTED: Homo sapiens mutS homolog 2 (MSH2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu59054 XM_011532867 PREDICTED: Homo sapiens mutS homolog 2 (MSH2), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
NM_000251 Homo sapiens mutS homolog 2 (MSH2), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu16740
Accession Version NM_001258281.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2607bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 20-APR-2014
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh2 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC342099.1, AK304496.1 and CB250419.1. Summary: This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (2) lacks an alternate segment of the first exon, including the translation start site, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK304496.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)5..7(+)
Misc Feature(2)152..337(+)
Misc Feature(3)413..793(+)
Misc Feature(4)854..1771(+)
Misc Feature(5)908..1876(+)
Misc Feature(6)1838..2497(+)
Misc Feature(7)1946..1969(+)
Misc Feature(8)1955..2290(+)
Misc Feature(9)2069..2080(+)
Misc Feature(10)2093..2134(+)
Misc Feature(11)2171..2188(+)
Misc Feature(12)2195..2206(+)
Misc Feature(13)2276..2296(+)
Exon (1)1..109
Gene Synonym:
Exon (2)110..152
Gene Synonym:
Exon (3)153..307
Gene Synonym:
Exon (4)308..586
Gene Synonym:
Exon (5)587..733
Gene Synonym:
Exon (6)734..883
Gene Synonym:
Exon (7)884..1017
Gene Synonym:
Exon (8)1018..1217
Gene Synonym:
Exon (9)1218..1327
Gene Synonym:
Exon (10)1328..1451
Gene Synonym:
Exon (11)1452..1602
Gene Synonym:
Exon (12)1603..1700
Gene Synonym:
Exon (13)1701..1946
Gene Synonym:
Exon (14)1947..2151
Gene Synonym:
Exon (15)2152..2399
Gene Synonym:
Exon (16)2400..2575
Gene Synonym:
Exon (17)2576..3025
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:2303425
10 10 g, t dbSNP:587782786
12 12 a, g dbSNP:786203146
14 14 a, g dbSNP:553751848
19 19 a, c dbSNP:587782649
20 20 c, g dbSNP:786202882
24 24 c, t dbSNP:17217709
28 28 c, t dbSNP:777285149
30 30 a, g dbSNP:56062561
32 32 c, t dbSNP:786202841
36 36 c, g dbSNP:372200074
43 43 a, g, t dbSNP:571975131
44 44 -, a dbSNP:560991330
45 45 -, a dbSNP:587779187
45 45 a, t dbSNP:542893403
48 48 -, tg dbSNP:587779182
50 50 a, g dbSNP:34355730
52 52 a, g dbSNP:786201938
53 53 a, g dbSNP:552303079
56 56 a, g dbSNP:746702986
58 58 a, g dbSNP:576303132
70 70 c, t dbSNP:543647908
76 76 a, g dbSNP:778304645
78 78 a, g dbSNP:751932753
81 81 g, t dbSNP:757842312
83 83 c, g dbSNP:781492698
84 84 c, g dbSNP:748885234
87 87 c, t dbSNP:768044277
90 90 g, t dbSNP:771263105
93 93 -, t dbSNP:766903439
97 97 c, t dbSNP:199841800
100 100 a, c dbSNP:771667817
102 102 a, g dbSNP:183204578
103 103 a, c, g, t dbSNP:368949534
104 104 c, g, t dbSNP:770870694
105 105 a, t dbSNP:776559145
108 108 a, t dbSNP:759730085
110 110 a, g dbSNP:267607913
115 115 a, c, g, t dbSNP:372189599
116 116 a, g dbSNP:771255106
117 117 a, g dbSNP:777174093
121 121 c, t dbSNP:760058815
122 122 c, t dbSNP:63750951
123 123 a, c dbSNP:587779113
124 124 c, g, t dbSNP:751082926
125 125 a, g dbSNP:767140240
127 127 a, g dbSNP:750058876
128 128 -, g, gg dbSNP:281864942
128 128 -, g dbSNP:63750160
139 139 c, t dbSNP:730881784
140 140 a, g dbSNP:768824654
145 145 -, g dbSNP:63750199
145 145 g, t dbSNP:753643218
149 149 a, g dbSNP:587778522
150 150 c, t dbSNP:587782481
152 152 c, g dbSNP:587782659
157 157 a, g dbSNP:746298214
158 158 a, g dbSNP:770110491
160 160 a, g dbSNP:1800150
161 161 a, c dbSNP:150548839
164 164 -, ct dbSNP:63750712
167 167 c, g, t dbSNP:63750042
169 169 g, t dbSNP:587782857
170 170 -, ag dbSNP:63749848
173 173 a, g dbSNP:772779997
175 175 g, t dbSNP:786202437
178 178 g, t dbSNP:786202203
184 184 c, t dbSNP:760201111
185 185 a, t dbSNP:587779145
188 188 -, a dbSNP:63749912
188 188 a, c dbSNP:766196837
192 192 -, a dbSNP:786202037
196 196 -, t dbSNP:63751158
196 196 -, tg dbSNP:267607921
197 197 c, g dbSNP:776423120
201 201 c, g dbSNP:587781447
202 202 -, t dbSNP:786204257
204 204 -, tt dbSNP:267607920
206 206 c, g dbSNP:587782586
214 214 -, tct dbSNP:528263777
215 215 c, g dbSNP:587779154
218 218 -, ctt dbSNP:267607918
218 218 c, t dbSNP:63751429
219 219 -, tt dbSNP:63749872
219 219 c, t dbSNP:63751456
220 220 -, tct dbSNP:267607919
223 223 a, g dbSNP:752387348
228 228 a, g dbSNP:63750002
230 230 -, aaagatcttcttctggttcgtc dbSNP:63751295
230 230 c, t dbSNP:63750970
231 231 -, aagatcttcttctggttcgtca dbSNP:587776529
234 234 a, g dbSNP:63750887
235 235 c, t dbSNP:763872353
236 236 a, c dbSNP:63750230
237 237 -, g dbSNP:63749861
238 238 -, agttga dbSNP:63750506
238 238 a, t dbSNP:587782283
242 242 -, gaagtt dbSNP:587779157
242 242 g, t dbSNP:63750318
245 245 a, g dbSNP:193922373
248 248 c, t dbSNP:587780688
249 249 a, g dbSNP:63751173
253 253 c, g dbSNP:372972328
256 256 c, t dbSNP:746066632
258 258 a, g dbSNP:41295286
260 260 c, g dbSNP:587779158
266 266 a, g dbSNP:780496649
267 267 a, g dbSNP:749545338
268 268 c, t dbSNP:63751437
269 269 a, c dbSNP:587779970
270 270 a, g dbSNP:63751040
276 276 c, g dbSNP:769215192
277 277 a, c dbSNP:34312619
280 280 a, g dbSNP:35898375
285 285 -, a dbSNP:63751195
286 286 g, t dbSNP:770536851
288 288 -, attg dbSNP:63750501
289 289 c, t dbSNP:548225893
291 291 c, g dbSNP:786202083
293 293 -, t dbSNP:587779159
303 303 a, g dbSNP:587779971
304 304 g, t dbSNP:63750458
305 305 a, c dbSNP:374127044
308 308 a, g dbSNP:768313992
309 309 -, c dbSNP:63750210
309 309 c, g, t dbSNP:730881767
314 314 c, t dbSNP:761767467
317 317 a, g dbSNP:767371843
321 321 -, at dbSNP:63751227
321 321 a, g, t dbSNP:17217772
323 323 c, g dbSNP:145649774
324 324 g, t dbSNP:730881768
325 325 c, g dbSNP:766694099
327 327 c, g, t dbSNP:587779972
328 328 -, tc dbSNP:63750924
329 329 -, ca dbSNP:63750704
332 332 g, t dbSNP:755423698
340 340 -, c dbSNP:63751290
340 340 c, t dbSNP:61756462
344 344 c, g, t dbSNP:193096019
346 346 c, g dbSNP:778368203
347 347 -, t dbSNP:776948651
349 349 -, t dbSNP:63750408
350 350 c, g dbSNP:587781795
354 354 a, g dbSNP:769154205
357 357 -, a dbSNP:63750401
359 359 g, t dbSNP:779803074
362 362 a, g dbSNP:193922374
363 363 c, t dbSNP:768313658
366 366 c, g dbSNP:63750910
375 375 c, t dbSNP:774132884
376 376 g, t dbSNP:63750124
378 378 g, t dbSNP:772052262
379 379 c, g, t dbSNP:587779161
380 380 a, g dbSNP:773125415
381 381 g, t dbSNP:760851623
387 387 a, g dbSNP:587779162
388 388 c, t dbSNP:786203142
395 395 -, a dbSNP:63751449
399 399 c, g dbSNP:766349734
400 400 c, t dbSNP:63751065
401 401 a, g dbSNP:759712763
410 410 -, ggc dbSNP:762825105
411 411 c, g dbSNP:765489269
412 412 a, c dbSNP:61756463
413 413 c, t dbSNP:63751226
416 416 -, a dbSNP:786204319
417 417 g, t dbSNP:786202921
419 419 c, t dbSNP:63751426
422 422 a, g dbSNP:149511545
423 423 a, t dbSNP:63750126
424 424 g, t dbSNP:375202935
425 425 a, g dbSNP:63750624
426 426 c, g dbSNP:63750773
429 429 a, g, t dbSNP:63750214
431 431 a, g, t dbSNP:63750582
432 432 a, g dbSNP:786204082
434 434 g, t dbSNP:587779163
436 436 g, t dbSNP:63749949
440 440 c, g dbSNP:63750255
442 442 g, t dbSNP:757733033
446 446 a, g dbSNP:63750716
447 447 -, taca dbSNP:63751013
448 448 a, g dbSNP:748762580
449 449 c, g, t dbSNP:63750843
453 453 a, g dbSNP:63750902
454 454 -, g dbSNP:63750933
458 458 a, ctaggactgtgt dbSNP:63751067
459 459 c, g, t dbSNP:63750070
459 459 -, t dbSNP:63750069
462 462 a, g dbSNP:147346837
464 464 -, ctgtgtgaattccctgataatgatcagttctccaatcttgag dbSNP:63750705
465 465 c, t dbSNP:63751291
466 466 a, g dbSNP:771827041
469 469 -, tg dbSNP:587779164
470 470 a, g, t dbSNP:63750382
471 471 -, aa dbSNP:63750551
471 471 a, t dbSNP:786203795
484 484 c, t dbSNP:528114416
485 485 g, t dbSNP:730881770
488 488 c, t dbSNP:63750037
492 492 -, t dbSNP:267607928
493 493 c, t dbSNP:786202238
497 497 a, g dbSNP:766497093
498 498 a, g dbSNP:151129360
500 500 c, g dbSNP:759603999
501 501 c, g, t dbSNP:63751444
502 502 -, tgaggctct dbSNP:63750088
505 505 -, tcagttctccaatcttgag dbSNP:63750080
506 506 a, g, t dbSNP:63750821
507 507 c, g dbSNP:141021599
509 509 c, g dbSNP:763459034
510 510 ct, tc dbSNP:267607927
511 511 c, g dbSNP:764573221
512 512 -, ctc dbSNP:587779165
514 514 c, g, t dbSNP:1800151
515 515 a, t dbSNP:768006988
518 518 c, t dbSNP:63751326
522 522 c, t dbSNP:730881778
527 527 c, t dbSNP:587782804
528 528 -, c dbSNP:63750682
528 528 c, t dbSNP:754478179
530 530 a, c dbSNP:778573140
533 533 -, g dbSNP:63750786
533 533 a, g, t dbSNP:587779166
534 534 a, g dbSNP:63750327
535 535 a, g dbSNP:369685768
536 536 c, t dbSNP:63751110
537 537 a, g dbSNP:63751136
540 540 a, t dbSNP:587779167
547 547 c, g, t dbSNP:63750600
548 548 a, g dbSNP:587779973
551 551 a, g, t dbSNP:63750574
552 552 a, g dbSNP:770787472
554 554 c, g, t dbSNP:63749984
557 557 -, a dbSNP:63750995
560 560 a, g, t dbSNP:63750913
561 561 c, t dbSNP:781178004
564 564 -, g dbSNP:63750121
565 565 a, c dbSNP:786202651
566 566 g, t dbSNP:746013810
571 571 a, g dbSNP:769971586
572 572 a, g dbSNP:587780689
579 579 -, tg dbSNP:63751622
580 580 a, c, g dbSNP:751250018
582 582 g, t dbSNP:763298811
583 583 -, acag dbSNP:63751695
583 583 a, g dbSNP:768931909
584 584 c, t dbSNP:63751274
587 587 a, c, g dbSNP:63749936
588 588 c, t dbSNP:786203108
590 590 a, g dbSNP:762436663
591 591 -, ttcaa dbSNP:63751602
593 593 c, t dbSNP:587779170
605 605 a, t dbSNP:763720908
610 610 a, g dbSNP:751195930
613 613 c, g dbSNP:587779171
616 616 agaaa, taat dbSNP:587779172
616 616 -, agaa dbSNP:587782537
620 620 a, g dbSNP:756809051
623 623 a, g dbSNP:200313142
626 626 a, t dbSNP:587779173
627 627 -, aa dbSNP:587779975
628 628 -, a dbSNP:63750364
628 628 -, a dbSNP:63749897
632 632 -, g dbSNP:587779174
634 634 c, t dbSNP:541325199
637 637 -, tt dbSNP:63750426
639 639 c, g dbSNP:587781724
642 642 c, t dbSNP:730881773
643 643 a, g dbSNP:780121922
644 644 a, g dbSNP:749442037
645 645 -, aa dbSNP:281864944
646 646 -, a dbSNP:281864945
650 650 a, g dbSNP:63751307
652 652 -, ttat dbSNP:63751288
655 655 c, t dbSNP:369670665
656 656 c, t dbSNP:63750488
657 657 a, g dbSNP:199676483
658 658 ggacc, tta dbSNP:63750690
666 666 -, a dbSNP:587779176
666 666 a, g dbSNP:779051492
667 667 c, t dbSNP:748427458
668 668 c, t dbSNP:138857091
669 669 a, g dbSNP:63751455
676 676 -, g dbSNP:63750107
677 677 a, c, t dbSNP:63750881
682 682 c, g dbSNP:747321505
683 683 a, g dbSNP:587779178
687 687 -, a dbSNP:63749832
687 687 a, c dbSNP:61756464
688 688 a, g dbSNP:786201568
690 690 a, g, t dbSNP:730881779
692 692 a, g dbSNP:147389443
695 695 c, t dbSNP:63750347
696 696 a, g dbSNP:370906735
697 697 -, c dbSNP:35170366
697 697 c, g dbSNP:763639520
700 700 -, gaat dbSNP:267607931
700 700 -, g dbSNP:63751160
702 702 -, a dbSNP:587779179
703 703 c, t dbSNP:587779180
704 704 agtg, tt dbSNP:63750329
704 704 a, g dbSNP:761529282
705 705 a, c, g dbSNP:763184168
707 707 a, g dbSNP:377403073
709 709 -, ct dbSNP:587779181
715 715 a, g, t dbSNP:755965129
716 716 c, t dbSNP:587781294
718 718 a, g dbSNP:544212322
722 722 a, t dbSNP:786201941
723 723 -, a dbSNP:786204144
723 723 c, t dbSNP:63749969
723 723 -, t dbSNP:63749968
727 727 c, g dbSNP:754820584
729 729 -, at dbSNP:63751614
732 732 a, g dbSNP:730881780
733 733 c, g dbSNP:587779183
736 736 c, g, t dbSNP:63749903
736 736 -, t dbSNP:63749902
738 738 c, t dbSNP:587781745
744 744 c, t dbSNP:563410947
747 747 c, t dbSNP:63750058
748 748 -, a dbSNP:63750225
749 749 -, ctgt dbSNP:63750326
749 749 c, g dbSNP:758403441
751 751 -, gtct dbSNP:63749978
751 751 -, gt dbSNP:63751133
752 752 -, tctg dbSNP:587779185
753 753 c, t dbSNP:139891783
755 755 at, gc dbSNP:587779186
756 756 c, t dbSNP:34136999
757 757 a, g dbSNP:368912987
758 758 aa, gt dbSNP:63749840
758 758 a, g dbSNP:530814648
759 759 c, t dbSNP:144288433
760 760 a, g dbSNP:146577635
761 761 a, g dbSNP:371944271
763 763 c, g dbSNP:781569442
771 771 g, t dbSNP:786203424
776 776 c, g dbSNP:375351205
777 777 -, tct dbSNP:267607936
777 777 -, t dbSNP:63751159
778 778 c, g dbSNP:747730026
780 780 -, t dbSNP:63750091
781 781 -, a dbSNP:63750154
782 782 c, t dbSNP:587779977
783 783 a, c, g dbSNP:63749991
784 784 a, t dbSNP:150197753
785 785 c, g dbSNP:760432160
786 786 a, g dbSNP:587779978
788 788 g, t dbSNP:63750381
789 789 a, t dbSNP:770643326
792 792 a, c dbSNP:776501892
795 795 -, a dbSNP:63750701
796 796 c, t dbSNP:759242666
799 799 -, g dbSNP:34198889
800 800 g, t dbSNP:63750276
801 801 -, g dbSNP:193922375
801 801 c, g dbSNP:587782567
803 803 c, t dbSNP:63750097
804 804 -, a dbSNP:587779189
809 809 g, t dbSNP:587779190
814 814 -, gact dbSNP:587779191
815 815 a, t dbSNP:104895022
822 822 -, tt dbSNP:63751115
826 826 c, g dbSNP:201334592
829 829 -, c dbSNP:587779192
832 832 c, g dbSNP:551236465
833 833 c, t dbSNP:63750934
834 834 a, c dbSNP:267607998
835 835 c, g dbSNP:587781397
839 839 a, g dbSNP:730881753
840 840 -, at dbSNP:63750885
841 841 a, g dbSNP:587782530
842 842 a, t dbSNP:63749915
846 846 a, t dbSNP:63749914
847 847 a, g dbSNP:786202947
853 853 c, t dbSNP:786202261
854 854 -, g dbSNP:786203604
854 854 a, g dbSNP:63751454
855 855 a, c dbSNP:751600874
856 856 a, c dbSNP:757483245
863 863 -, agcagtca dbSNP:63750046
866 866 a, g dbSNP:781257094
869 869 c, g dbSNP:750866402
870 870 c, g, t dbSNP:63750640
873 873 -, a dbSNP:587779979
875 875 -, c dbSNP:267607937
875 875 c, g dbSNP:756398636
879 879 c, t dbSNP:780656204
883 883 a, g dbSNP:587779197
885 885 a, g, t dbSNP:202026056
897 897 a, t dbSNP:786204185
899 899 -, a dbSNP:63749852
899 899 a, g dbSNP:368982417
902 902 a, c dbSNP:587781550
905 905 a, g dbSNP:773301485
906 906 a, g, t dbSNP:4987188
909 909 a, c, g, t dbSNP:63750732
911 911 -, ca dbSNP:63751044
911 911 -, nnnn dbSNP:587779199
911 911 c, t dbSNP:63750502
913 913 a, g dbSNP:63750505
914 914 -, t dbSNP:63749945
915 915 c, t dbSNP:765886157
923 923 c, g, t dbSNP:753237286
924 924 c, t dbSNP:780602406
925 925 c, t dbSNP:4987189
930 930 c, t dbSNP:63750630
932 932 a, g dbSNP:267607938
933 933 a, g dbSNP:779673318
938 938 c, t dbSNP:63750468
939 939 a, g dbSNP:63750828
941 941 a, t dbSNP:587779063
945 945 -, cccc dbSNP:63751289
945 945 c, t dbSNP:63750602
946 946 c, g dbSNP:749117915
947 947 c, g, t dbSNP:63751062
948 948 -, c dbSNP:587779064
950 950 c, t dbSNP:63750778
953 953 a, g dbSNP:63751004
954 954 a, g dbSNP:587779065
955 955 a, c dbSNP:774083607
958 958 -, aa dbSNP:63750703
959 959 -, a dbSNP:587779066
962 962 c, g dbSNP:748115066
963 963 c, t dbSNP:63751147
965 965 a, g dbSNP:63749879
968 968 a, g dbSNP:587779961
971 971 a, c, t dbSNP:63750245
973 973 c, g dbSNP:375799148
974 974 -, tat dbSNP:587782374
975 975 a, g dbSNP:63751027
976 976 a, g dbSNP:63750396
979 979 -, tt dbSNP:63751483
984 984 a, g dbSNP:773177076
986 986 c, g dbSNP:267607939
987 987 c, g, t dbSNP:587779067
989 989 c, t dbSNP:771126636
992 992 a, g dbSNP:138026880
994 994 c, g, t dbSNP:373122667
1000 1000 -, g dbSNP:587779068
1005 1005 g, t dbSNP:730881754
1008 1008 c, t dbSNP:753075410
1010 1010 c, g dbSNP:587779069
1011 1011 a, c dbSNP:150503781
1012 1012 c, g dbSNP:587781617
1014 1014 a, c dbSNP:587781775
1016 1016 a, t dbSNP:587779070
1017 1017 a, c, g, t dbSNP:63751604
1018 1018 a, t dbSNP:63751617
1023 1023 a, g dbSNP:587779072
1027 1027 a, t dbSNP:63751699
1028 1028 g, t dbSNP:377345366
1036 1036 c, t dbSNP:746989189
1038 1038 -, a dbSNP:267607693
1040 1040 a, g, t dbSNP:80285180
1040 1040 -, g dbSNP:587779073
1041 1041 c, t dbSNP:770956016
1049 1049 -, g dbSNP:63749814
1050 1050 c, t dbSNP:139652783
1053 1053 a, g dbSNP:745889191
1055 1055 g, t dbSNP:770201760
1058 1058 a, c dbSNP:781061998
1060 1060 -, g dbSNP:63750516
1061 1061 c, t dbSNP:63750558
1062 1062 a, g dbSNP:749660228
1063 1063 c, g dbSNP:370378607
1065 1065 c, t dbSNP:774539871
1066 1066 -, at dbSNP:786203350
1068 1068 c, t dbSNP:762385137
1069 1069 -, ta dbSNP:63751219
1070 1070 c, g, t dbSNP:63750267
1071 1071 a, g dbSNP:776174711
1072 1072 a, g dbSNP:181852377
1076 1076 g, t dbSNP:764911657
1080 1080 c, t dbSNP:730881755
1080 1080 -, t dbSNP:63750039
1085 1085 -, c dbSNP:63750496
1085 1085 c, t dbSNP:752373431
1086 1086 a, g dbSNP:267607947
1088 1088 c, t dbSNP:63749849
1089 1089 a, c, g dbSNP:376934727
1094 1094 c, t dbSNP:763985746
1095 1095 c, t dbSNP:564736113
1098 1098 -, a dbSNP:730881774
1100 1100 c, t dbSNP:751249745
1101 1101 c, t dbSNP:63750485
1106 1106 c, t dbSNP:587779075
1107 1107 a, g dbSNP:757276241
1109 1109 c, t dbSNP:17224367
1116 1116 a, t dbSNP:61756465
1123 1123 -, t dbSNP:63750901
1123 1123 g, t dbSNP:374135434
1124 1124 c, t dbSNP:63750302
1125 1125 a, g dbSNP:779944676
1130 1130 c, g, t dbSNP:63750611
1132 1132 a, g dbSNP:768694189
1133 1133 -, g dbSNP:63751169
1138 1138 -, ca dbSNP:63749850
1144 1144 -, a dbSNP:63750586
1145 1145 a, c, t dbSNP:63751412
1145 1145 -, c dbSNP:63751413
1151 1151 -, t dbSNP:587782777
1156 1156 a, c dbSNP:63751271
1157 1157 c, t dbSNP:63751108
1158 1158 a, g dbSNP:146567853
1159 1159 -, ccga dbSNP:267607946
1160 1160 -, cgac dbSNP:63751192
1161 1161 -, c dbSNP:760228651
1162 1162 -, ct dbSNP:587779076
1162 1162 c, g, t dbSNP:63750813
1163 1163 -, t dbSNP:63751142
1164 1164 a, g, t dbSNP:63750379
1165 1165 c, t dbSNP:63750132
1166 1166 a, c, g dbSNP:151244108
1167 1167 -, ag dbSNP:63750086
1168 1168 a, g dbSNP:759098126
1169 1169 g, t dbSNP:587782242
1172 1172 a, t dbSNP:764825558
1176 1176 -, atcaactacctaatgttatacaggctctggaaa dbSNP:63751644
1177 1177 -, tcaactacctaatgttatacaggctctggaaaa dbSNP:587779077
1179 1179 a, c dbSNP:587779962
1182 1182 c, t dbSNP:587779078
1183 1183 a, t dbSNP:757250110
1184 1184 -, ccta dbSNP:63751206
1184 1184 c, g, t dbSNP:35717997
1189 1189 c, t dbSNP:786201156
1190 1190 -, gttat dbSNP:587779079
1190 1190 -, g dbSNP:63751059
1193 1193 a, t dbSNP:763600083
1194 1194 c, t dbSNP:786202303
1195 1195 a, g dbSNP:751431238
1196 1196 a, c, t dbSNP:63750006
1199 1199 c, g dbSNP:767609290
1202 1202 a, c dbSNP:63750228
1203 1203 c, t dbSNP:587779080
1205 1205 g, t dbSNP:63751712
1208 1208 a, g dbSNP:201059765
1209 1209 a, g dbSNP:756071499
1210 1210 -, a dbSNP:63751667
1211 1211 c, t dbSNP:587782278
1212 1212 -, a dbSNP:587783055
1212 1212 a, g dbSNP:200429136
1216 1216 a, g dbSNP:63751650
1225 1225 c, g dbSNP:776034412
1226 1226 c, t dbSNP:63751693
1228 1228 -, g dbSNP:63751626
1229 1229 a, t dbSNP:63751646
1233 1233 a, t dbSNP:63751315
1234 1234 a, g dbSNP:781548186
1237 1237 a, g dbSNP:141295984
1242 1242 c, t dbSNP:768070717
1250 1250 c, g dbSNP:773956144
1252 1252 g, t dbSNP:730881781
1255 1255 c, t dbSNP:761558457
1256 1256 -, cct dbSNP:63751138
1256 1256 c, t dbSNP:786203116
1257 1257 -, ctc dbSNP:587779082
1257 1257 -, ct dbSNP:63750251
1257 1257 c, t dbSNP:771789692
1259 1259 -, ct dbSNP:587779083
1260 1260 cc, ttactgat dbSNP:63749931
1260 1260 c, t dbSNP:587779084
1262 1262 -, a dbSNP:63750807
1262 1262 a, c dbSNP:587779086
1272 1272 g, t dbSNP:557339938
1275 1275 c, t dbSNP:752067883
1279 1279 c, g dbSNP:766379227
1280 1280 g, t dbSNP:63751217
1281 1281 -, gg dbSNP:267607696
1282 1282 c, g, t dbSNP:587781373
1284 1284 c, g dbSNP:587782524
1286 1286 -, aagt dbSNP:267607955
1286 1286 a, t dbSNP:63749920
1288 1288 c, g dbSNP:587781331
1292 1292 c, t dbSNP:786201066
1293 1293 -, ag dbSNP:63750957
1295 1295 g, t dbSNP:267607954
1297 1297 a, g dbSNP:63751212
1299 1299 a, t dbSNP:63750697
1301 1301 a, g, t dbSNP:587781627
1307 1307 a, g dbSNP:758636279
1308 1308 c, t dbSNP:777963115
1314 1314 g, t dbSNP:63750521
1315 1315 a, g dbSNP:767639853
1319 1319 a, g dbSNP:575905950
1321 1321 a, g dbSNP:757534022
1323 1323 a, c, g dbSNP:730881756
1327 1327 c, g dbSNP:587781997
1331 1331 -, g dbSNP:587779088
1332 1332 a, g dbSNP:750737783
1338 1338 a, g dbSNP:544265737
1340 1340 g, t dbSNP:587779089
1346 1346 c, g dbSNP:780702096
1349 1349 -, g dbSNP:63750384
1350 1350 a, c, t dbSNP:267607959
1351 1351 a, t dbSNP:757958558
1354 1354 a, c dbSNP:745874745
1359 1359 c, g, t dbSNP:63751403
1360 1360 a, g dbSNP:746674539
1370 1370 a, c dbSNP:587781346
1375 1375 -, tc dbSNP:587779091
1376 1376 a, c dbSNP:770550720
1377 1377 a, g dbSNP:555986369
1378 1378 g, t dbSNP:745666037
1381 1381 a, g dbSNP:138049198
1383 1383 a, g, t dbSNP:786203036
1385 1385 -, a dbSNP:63750436
1385 1385 -, a dbSNP:63750068
1385 1385 a, t dbSNP:587779092
1386 1386 -, gagaa dbSNP:267607961
1386 1386 -, taag dbSNP:63750930
1388 1388 -, ga dbSNP:63750161
1388 1388 g, t dbSNP:63749947
1393 1393 -, aatg dbSNP:63750148
1394 1394 a, g dbSNP:775377647
1398 1398 -, atga dbSNP:587776530
1398 1398 -, a dbSNP:63750986
1402 1402 c, g dbSNP:35107951
1403 1403 g, t dbSNP:587781314
1415 1415 a, t dbSNP:774419666
1417 1417 ct, gc dbSNP:63750583
1418 1418 c, t dbSNP:63750936
1419 1419 a, t dbSNP:376990143
1421 1421 c, t dbSNP:55653533
1422 1422 c, t dbSNP:370970617
1424 1424 a, g dbSNP:730881757
1425 1425 c, t dbSNP:756516114
1426 1426 a, g dbSNP:767039383
1428 1428 a, t dbSNP:587779093
1429 1429 a, g dbSNP:267607960
1430 1430 a, g dbSNP:755501968
1435 1435 -, t dbSNP:63750362
1438 1438 -, a dbSNP:63749963
1441 1441 -, c dbSNP:587779094
1443 1443 a, g dbSNP:376677710
1446 1446 a, g dbSNP:148192104
1449 1449 c, t dbSNP:587779095
1451 1451 c, g, t dbSNP:63751600
1457 1457 g, t dbSNP:63750492
1463 1463 a, g dbSNP:267607968
1464 1464 c, g dbSNP:786202710
1466 1466 a, t dbSNP:730881758
1469 1469 c, t dbSNP:587779097
1471 1471 c, g, t dbSNP:587782355
1480 1480 a, g dbSNP:777195739
1488 1488 a, c, g, t dbSNP:373564353
1492 1492 a, c dbSNP:753227902
1493 1493 -, ca dbSNP:63749930
1493 1493 c, t dbSNP:63750780
1494 1494 a, t dbSNP:763323368
1501 1501 a, g dbSNP:63750820
1504 1504 c, t dbSNP:63750330
1507 1507 c, g dbSNP:63750224
1508 1508 a, t dbSNP:267607966
1509 1509 c, t dbSNP:587782587
1510 1510 -, t dbSNP:63749955
1511 1511 c, t dbSNP:755818010
1512 1512 a, c, g, t dbSNP:63751207
1516 1516 a, g dbSNP:766009421
1517 1517 -, a dbSNP:63750094
1519 1519 -, c dbSNP:63750738
1523 1523 a, c dbSNP:199744440
1524 1524 a, g, t dbSNP:755799226
1526 1526 -, g dbSNP:63751261
1528 1528 -, a dbSNP:63750845
1534 1534 -, agtccttcgtaacaataaaaa dbSNP:63750510
1535 1535 -, g dbSNP:63750104
1536 1536 c, t dbSNP:754778750
1538 1538 c, g dbSNP:786202987
1541 1541 c, g, t dbSNP:63750029
1542 1542 a, c, g, t dbSNP:587778523
1543 1543 a, t dbSNP:267607965
1546 1546 c, t dbSNP:587779098
1548 1548 a, g dbSNP:201722703
1551 1551 a, c dbSNP:747074044
1558 1558 a, c, t dbSNP:730881759
1562 1562 a, g dbSNP:141150847
1568 1568 -, g dbSNP:63750675
1572 1572 c, t dbSNP:587778524
1573 1573 c, t dbSNP:746286801
1579 1579 a, g dbSNP:372350768
1580 1580 -, ga dbSNP:63750662
1581 1581 a, g dbSNP:267607967
1583 1583 g, t dbSNP:63750538
1588 1588 c, g, t dbSNP:763525239
1595 1595 a, c dbSNP:63750838
1598 1598 a, t dbSNP:772772789
1601 1601 a, c, g, t dbSNP:63751656
1602 1602 a, c, g dbSNP:63750597
1603 1603 c, t dbSNP:587778525
1606 1606 -, a dbSNP:63751120
1607 1607 c, t dbSNP:61756466
1608 1608 -, a dbSNP:267607694
1608 1608 c, t dbSNP:587779101
1608 1608 -, t dbSNP:587779100
1609 1609 -, g dbSNP:63751324
1610 1610 a, c dbSNP:63750432
1611 1611 c, g dbSNP:139920308
1613 1613 -, t dbSNP:63751303
1616 1616 a, t dbSNP:750453437
1617 1617 -, t dbSNP:63750633
1620 1620 -, a dbSNP:63750054
1621 1621 c, t dbSNP:200056411
1622 1622 a, g dbSNP:63750328
1624 1624 -, a dbSNP:63750406
1626 1626 a, t dbSNP:63750997
1627 1627 c, g dbSNP:786203850
1628 1628 -, t dbSNP:587779103
1629 1629 a, c dbSNP:63751054
1631 1631 a, g dbSNP:55778204
1633 1633 c, g dbSNP:786203290
1634 1634 a, t dbSNP:587779104
1637 1637 -, aa dbSNP:63750737
1638 1638 -, a dbSNP:587781531
1640 1640 a, g, t dbSNP:63751149
1641 1641 -, aaaca dbSNP:63750474
1643 1643 -, a dbSNP:587779105
1645 1645 -, ag dbSNP:63751463
1646 1646 -, ga dbSNP:63750393
1646 1646 -, t dbSNP:587779106
1647 1647 -, aa dbSNP:63749883
1647 1647 -, ga, t dbSNP:281864941
1647 1647 a, g dbSNP:786201077
1650 1650 a, g dbSNP:587779963
1651 1651 c, t dbSNP:772510691
1656 1656 a, c dbSNP:776263190
1658 1658 a, g dbSNP:200766962
1658 1658 -, g dbSNP:267607974
1661 1661 -, c dbSNP:63751299
1661 1661 c, t dbSNP:63751298
1665 1665 a, g dbSNP:370330868
1667 1667 c, g dbSNP:587779107
1670 1670 a, g dbSNP:774985655
1671 1671 c, t dbSNP:63749910
1678 1678 -, a dbSNP:63750480
1678 1678 a, g dbSNP:61756467
1679 1679 g, t dbSNP:63751411
1681 1681 a, c dbSNP:751336185
1682 1682 -, a dbSNP:63750141
1682 1682 a, g dbSNP:761859271
1685 1685 -, g dbSNP:587779964
1687 1687 c, t dbSNP:786201486
1689 1689 a, c, g dbSNP:201118107
1694 1694 -, t dbSNP:63751433
1696 1696 c, t dbSNP:63750112
1700 1700 c, g dbSNP:63751140
1701 1701 -, g dbSNP:63750103
1705 1705 c, g, t dbSNP:63750844
1711 1711 a, c, g dbSNP:760619442
1712 1712 -, a dbSNP:267607977
1713 1713 c, t dbSNP:587782643
1714 1714 -, a dbSNP:63750015
1714 1714 a, g dbSNP:786203894
1715 1715 a, g dbSNP:371614039
1718 1718 c, t dbSNP:63750200
1720 1720 -, gaca dbSNP:63750113
1721 1721 a, g dbSNP:753897195
1722 1722 -, ct dbSNP:267607691
1725 1725 g, t dbSNP:786201590
1727 1727 -, aat dbSNP:63749831
1728 1728 -, a dbSNP:587779111
1728 1728 a, g dbSNP:41295288
1729 1729 -, tg dbSNP:63750495
1730 1730 a, g dbSNP:765442101
1731 1731 a, c dbSNP:548407418
1732 1732 c, t dbSNP:758742390
1733 1733 a, g dbSNP:778152746
1734 1734 -, t dbSNP:786202790
1736 1736 g, t dbSNP:112457919
1737 1737 c, t dbSNP:747504492
1739 1739 a, g, t dbSNP:587778526
1740 1740 c, t dbSNP:63751236
1742 1742 c, t dbSNP:63750047
1743 1743 a, g dbSNP:779447213
1744 1744 -, g dbSNP:786203704
1745 1745 c, g dbSNP:748797209
1748 1748 a, g, t dbSNP:63750657
1749 1749 a, g dbSNP:267607985
1750 1750 -, t dbSNP:63751129
1754 1754 a, c, g, t dbSNP:730881777
1756 1756 -, tgt dbSNP:267607978
1758 1758 a, t dbSNP:376044376
1760 1760 a, g dbSNP:772991620
1766 1766 g, t dbSNP:150980616
1767 1767 c, t dbSNP:63750665
1768 1768 -, t dbSNP:587779112
1769 1769 a, c, t dbSNP:267607980
1771 1771 c, t dbSNP:766326295
1772 1772 a, g dbSNP:369385048
1776 1776 c, g dbSNP:63750493
1778 1778 a, c dbSNP:200147804
1785 1785 c, t dbSNP:765493709
1787 1787 c, t dbSNP:587782627
1788 1788 c, g dbSNP:587779965
1794 1794 -, c dbSNP:267607984
1795 1795 a, g dbSNP:786203744
1797 1797 a, g dbSNP:63749982
1798 1798 g, t dbSNP:63750312
1799 1799 -, tg dbSNP:63750031
1800 1800 -, gt dbSNP:63750806
1802 1802 c, g, t dbSNP:63750508
1803 1803 a, g dbSNP:759263820
1804 1804 a, t dbSNP:786203119
1805 1805 a, c, g dbSNP:63750280
1806 1806 c, t dbSNP:28929483
1807 1807 a, c dbSNP:757766951
1809 1809 c, g dbSNP:781698416
1814 1814 g, t dbSNP:63750669
1822 1822 a, c dbSNP:63750626
1823 1823 a, g dbSNP:371776176
1825 1825 a, t dbSNP:786202663
1826 1826 c, t dbSNP:63750203
1827 1827 a, g dbSNP:61756468
1830 1830 -, gaag dbSNP:63750960
1831 1831 a, g dbSNP:778523544
1834 1834 a, t dbSNP:747805096
1837 1837 -, a dbSNP:63751038
1838 1838 -, a dbSNP:587779114
1838 1838 a, g dbSNP:771695599
1847 1847 c, g dbSNP:63750875
1848 1848 c, t dbSNP:63750279
1852 1852 -, c dbSNP:63750893
1853 1853 a, g dbSNP:267607981
1856 1856 c, t dbSNP:28929484
1857 1857 -, atgc dbSNP:730881776
1857 1857 a, g dbSNP:587779116
1858 1858 a, g, t dbSNP:1800152
1859 1859 g, t dbSNP:531276135
1862 1862 g, t dbSNP:63749946
1863 1863 a, g dbSNP:786204110
1865 1865 -, gt dbSNP:587779117
1865 1865 a, g dbSNP:776528054
1868 1868 a, g dbSNP:374840361
1874 1874 c, g dbSNP:267607982
1876 1876 a, c dbSNP:587780684
1878 1878 a, c, g dbSNP:41295290
1879 1879 c, t dbSNP:775484022
1880 1880 c, g, t dbSNP:63750078
1883 1883 a, g dbSNP:373475495
1884 1884 a, c, t dbSNP:763100088
1886 1886 a, g dbSNP:786201822
1896 1896 a, c dbSNP:267607983
1903 1903 c, t dbSNP:751939698
1904 1904 a, g dbSNP:549467183
1906 1906 a, c dbSNP:767941059
1908 1908 a, c, g dbSNP:185356145
1909 1909 c, g dbSNP:63751317
1911 1911 -, actt dbSNP:587779118
1914 1914 a, g dbSNP:200827721
1920 1920 -, at dbSNP:63750988
1921 1921 -, ta dbSNP:587779119
1923 1923 -, aaca dbSNP:587779120
1924 1924 -, a dbSNP:63751055
1925 1925 -, ca dbSNP:587779121
1925 1925 c, t dbSNP:786204321
1926 1926 -, ag dbSNP:63749976
1927 1927 -, ga dbSNP:587779122
1927 1927 a, c, g dbSNP:587780685
1927 1927 -, g dbSNP:63749929
1928 1928 a, g, t dbSNP:752241362
1933 1933 c, t dbSNP:777450803
1937 1937 -, at dbSNP:63751700
1946 1946 a, c, g dbSNP:63751668
1947 1947 a, c, g, t dbSNP:63751640
1950 1950 c, t dbSNP:41294982
1951 1951 -, c dbSNP:63751123
1951 1951 c, t dbSNP:766618212
1952 1952 a, t dbSNP:63751232
1954 1954 a, t dbSNP:587779127
1955 1955 a, g dbSNP:763690339
1956 1956 g, t dbSNP:786203126
1956 1956 -, t dbSNP:63751161
1959 1959 -, g dbSNP:63751462
1961 1961 a, c, g dbSNP:63750234
1962 1962 -, gt dbSNP:267608000
1962 1962 a, c, g dbSNP:267607996
1963 1963 c, t dbSNP:786203120
1964 1964 aaa, gcc dbSNP:587779128
1965 1965 a, g dbSNP:63751445
1967 1967 c, t dbSNP:63751089
1972 1972 -, at dbSNP:63749928
1972 1972 a, g dbSNP:786203923
1976 1976 -, at dbSNP:587779129
1979 1979 c, g, t dbSNP:63749932
1982 1982 c, g dbSNP:730881762
1984 1984 a, c, g, t dbSNP:730881763
1985 1985 a, g dbSNP:63751002
1986 1986 c, t dbSNP:587779130
1987 1987 -, tg dbSNP:587779131
1988 1988 a, g, t dbSNP:267607995
1989 1989 c, g dbSNP:755920849
1997 1997 gtactcatggcccaaattgggtgtttt, tatatgttgtgccatgtgaatata dbSNP:587779132
1997 1997 -, atag dbSNP:63750422
2001 2001 c, t dbSNP:587779133
2002 2002 c, g dbSNP:63750032
2004 2004 g, t dbSNP:63749993
2005 2005 a, g dbSNP:63750790
2009 2009 c, g dbSNP:587779134
2012 2012 -, a dbSNP:63749878
2013 2013 c, t dbSNP:754824872
2014 2014 g, t dbSNP:779101144
2015 2015 -, gggtgttt dbSNP:587779135
2015 2015 c, g dbSNP:63750232
2016 2016 g, t dbSNP:63751432
2021 2021 c, t dbSNP:63751409
2023 2023 c, t dbSNP:748210094
2023 2023 -, t dbSNP:63750689
2024 2024 c, g dbSNP:772491283
2027 2027 c, g dbSNP:546201898
2028 2028 c, t dbSNP:267607994
2030 2030 c, t dbSNP:63750961
2031 2031 a, g, t dbSNP:63750398
2032 2032 a, t dbSNP:63750872
2035 2035 a, g dbSNP:773555449
2037 2037 c, g dbSNP:587779136
2038 2038 a, c dbSNP:747170086
2041 2041 a, g dbSNP:771426077
2042 2042 a, g dbSNP:776820509
2046 2046 g, t dbSNP:587779137
2047 2047 a, g dbSNP:786201108
2049 2049 a, c dbSNP:267607999
2051 2051 a, g dbSNP:730881764
2052 2052 c, t dbSNP:564657106
2054 2054 -, g dbSNP:63749811
2059 2059 a, c dbSNP:773949031
2061 2061 a, c, g dbSNP:373226409
2063 2063 a, g dbSNP:750084297
2064 2064 a, t dbSNP:63750108
2070 2070 a, c, g dbSNP:373717132
2072 2072 c, t dbSNP:63750636
2073 2073 a, g dbSNP:138465383
2076 2076 -, t dbSNP:63751453
2079 2079 a, g, t dbSNP:753555602
2080 2080 c, g, t dbSNP:63750003
2082 2082 -, c dbSNP:63750545
2082 2082 c, t dbSNP:63751224
2090 2090 a, g dbSNP:778712654
2091 2091 a, g dbSNP:752883472
2093 2093 c, t dbSNP:587779139
2095 2095 a, g dbSNP:63750810
2097 2097 g, t dbSNP:777933557
2099 2099 a, g dbSNP:747265823
2101 2101 -, agga dbSNP:63750722
2105 2105 a, g dbSNP:587781996
2108 2108 -, t dbSNP:587779140
2109 2109 c, t dbSNP:63750794
2112 2112 a, c, t dbSNP:63751125
2113 2113 a, g, t dbSNP:370636719
2119 2119 c, g dbSNP:587782396
2120 2120 c, g, t dbSNP:104895026
2122 2122 c, t dbSNP:763387694
2128 2128 g, t dbSNP:587779141
2132 2132 g, t dbSNP:63749802
2135 2135 -, act dbSNP:63750562
2136 2136 c, g dbSNP:730881765
2138 2138 a, g dbSNP:772662439
2143 2143 c, t dbSNP:760371665
2144 2144 a, g dbSNP:2229061
2145 2145 -, t dbSNP:63750572
2146 2146 a, c, t dbSNP:533553381
2149 2149 c, t dbSNP:541880457
2151 2151 c, g dbSNP:267607997
2169 2169 -, catt dbSNP:63751156
2169 2169 a, c, g dbSNP:63751155
2172 2172 g, t dbSNP:63750403
2174 2174 -, ataatc dbSNP:267608008
2177 2177 -, atcata dbSNP:587779142
2178 2178 -, a, aat dbSNP:267607690
2179 2179 c, t dbSNP:764090611
2180 2180 -, at dbSNP:267607993
2181 2181 -, ta dbSNP:63751036
2183 2183 g, t dbSNP:267608007
2186 2186 a, g, t dbSNP:63751477
2189 2189 c, t dbSNP:527725593
2192 2192 a, g dbSNP:63751119
2201 2201 a, g, t dbSNP:757268664
2202 2202 -, c dbSNP:267608009
2207 2207 a, g dbSNP:750646335
2208 2208 c, g dbSNP:372383829
2211 2211 a, c dbSNP:780448421
2212 2212 c, t dbSNP:56076152
2216 2216 g, t dbSNP:63749854
2217 2217 a, g dbSNP:386833406
2222 2222 -, g dbSNP:786204050
2224 2224 a, g dbSNP:755548149
2227 2227 a, g dbSNP:779381010
2229 2229 c, t dbSNP:144412585
2231 2231 -, t dbSNP:63749913
2232 2232 a, g dbSNP:587779143
2233 2233 a, c, g dbSNP:63751105
2234 2234 a, g dbSNP:63750368
2235 2235 -, c dbSNP:63750346
2236 2236 a, t dbSNP:786202925
2236 2236 -, t dbSNP:63751143
2237 2237 a, g dbSNP:374399939
2245 2245 -, a dbSNP:587783053
2245 2245 a, g dbSNP:1800153
2246 2246 -, t dbSNP:63750896
2249 2249 a, g dbSNP:63750684
2250 2250 c, t dbSNP:371718349
2260 2260 c, g, t dbSNP:745528772
2261 2261 a, t dbSNP:775464903
2263 2263 a, c, t dbSNP:56397910
2272 2272 c, t dbSNP:781410136
2275 2275 a, c dbSNP:63750618
2276 2276 -, a dbSNP:63750149
2278 2278 a, g dbSNP:41295292
2285 2285 a, g dbSNP:35784190
2288 2288 -, c dbSNP:63750233
2289 2289 a, g dbSNP:587781594
2295 2295 a, c, g dbSNP:200252727
2302 2302 -, t, tt dbSNP:63750803
2303 2303 -, a dbSNP:63750463
2303 2303 a, c dbSNP:774440277
2304 2304 -, ct dbSNP:63750937
2308 2308 c, t dbSNP:786202414
2316 2316 a, g dbSNP:587782891
2318 2318 c, g dbSNP:730881769
2320 2320 g, t dbSNP:767520406
2329 2329 -, t dbSNP:63749983
2333 2333 a, g dbSNP:786203105
2334 2334 a, g dbSNP:786204073
2335 2335 g, t dbSNP:750498919
2338 2338 a, c, t dbSNP:368988823
2339 2339 c, t dbSNP:766586857
2341 2341 a, g dbSNP:201298777
2348 2348 a, g dbSNP:63751168
2349 2349 -, ca dbSNP:63750060
2349 2349 c, t dbSNP:786202362
2353 2353 a, c dbSNP:141523959
2354 2354 c, t dbSNP:779182536
2356 2356 c, t dbSNP:139317211
2358 2358 c, t dbSNP:758889557
2359 2359 -, c dbSNP:587779144
2361 2361 a, c, g, t dbSNP:41295294
2362 2362 c, t dbSNP:372661586
2363 2363 g, t dbSNP:34986638
2366 2366 a, g dbSNP:202145681
2368 2368 -, g dbSNP:63751079
2373 2373 g, t dbSNP:63751018
2377 2377 c, t dbSNP:375358440
2378 2378 a, g dbSNP:63749841
2380 2380 a, g dbSNP:587781678
2387 2387 c, t dbSNP:63749917
2388 2388 a, g dbSNP:768572053
2398 2398 a, g dbSNP:774152293
2407 2407 -, tg dbSNP:63751621
2407 2407 a, t dbSNP:63749846
2411 2411 c, g, t dbSNP:63750623
2420 2420 a, g dbSNP:63750478
2422 2422 a, g dbSNP:765467019
2424 2424 g, t dbSNP:753067992
2426 2426 -, c dbSNP:63751117
2437 2437 g, t dbSNP:763361583
2439 2439 -, catgttgcagagct dbSNP:587779146
2441 2441 a, g dbSNP:63750757
2442 2442 -, ctaattt dbSNP:267608014
2443 2443 -, taatttc dbSNP:63751447
2444 2444 a, c, g dbSNP:41295296
2445 2445 a, g dbSNP:779729016
2448 2448 -, t dbSNP:63750008
2457 2457 a, g dbSNP:63750027
2458 2458 a, t dbSNP:267608016
2462 2462 -, a dbSNP:587779147
2466 2466 -, ag dbSNP:587779148
2466 2466 a, t dbSNP:373393954
2467 2467 a, g dbSNP:778617066
2469 2469 a, g dbSNP:747700106
2470 2470 -, tg dbSNP:63749975
2474 2474 a, g dbSNP:63750571
2477 2477 c, t dbSNP:63750857
2478 2478 a, g dbSNP:140754514
2483 2483 a, g, t dbSNP:746972142
2486 2486 -, c dbSNP:587779149
2486 2486 c, g, t dbSNP:587778527
2492 2492 a, c, g dbSNP:267608015
2495 2495 -, gag dbSNP:766906365
2495 2495 c, g dbSNP:587779966
2497 2497 a, c, g dbSNP:587781453
2499 2499 a, c, g dbSNP:63750797
2502 2502 g, t dbSNP:774804216
2505 2505 a, g dbSNP:587782256
2507 2507 c, t dbSNP:786203818
2508 2508 a, g, t dbSNP:587779150
2509 2509 a, t dbSNP:768137500
2510 2510 a, g dbSNP:753459308
2513 2513 a, g dbSNP:754533481
2515 2515 -, agaatcgca dbSNP:774869661
2516 2516 a, g, t dbSNP:63749830
2517 2517 -, aatcgcaag dbSNP:587781278
2520 2520 a, c, t dbSNP:63750849
2521 2521 a, g dbSNP:752428475
2522 2522 c, t dbSNP:63750291
2524 2524 a, g dbSNP:63751093
2530 2530 c, t dbSNP:757938946
2534 2534 -, atcat dbSNP:587779151
2534 2534 -, atc dbSNP:759912716
2535 2535 c, t dbSNP:549759248
2536 2536 a, c, t dbSNP:547695133
2543 2543 c, g, t dbSNP:63751400
2547 2547 a, c dbSNP:730881772
2550 2550 c, g dbSNP:63750709
2553 2553 a, g dbSNP:587782214
2556 2556 a, g dbSNP:587780686
2558 2558 g, t dbSNP:63750795
2562 2562 a, g dbSNP:775390721
2563 2563 a, t dbSNP:587779152
2573 2573 -, ga dbSNP:267608013
2573 2573 c, g dbSNP:749543152
2574 2574 -, ag dbSNP:63751618
2575 2575 a, c, g dbSNP:63751624
2576 2576 a, c, t dbSNP:63751469
2588 2588 -, a dbSNP:63750145
2588 2588 -, a dbSNP:63750084
2590 2590 g, t dbSNP:768983827
2591 2591 a, t dbSNP:774732579
2592 2592 g, t dbSNP:63750409
2594 2594 c, t dbSNP:63750808
2598 2598 a, g dbSNP:63750350
2603 2603 -, c dbSNP:63751007
2604 2604 g, t dbSNP:63751205
2608 2608 c, g dbSNP:561680100
2618 2618 -, a dbSNP:756190190
2625 2625 c, g dbSNP:786203553
2632 2632 c, t dbSNP:148653184
2641 2641 a, g dbSNP:786202996
2648 2648 a, t dbSNP:748318462
2655 2655 c, g, t dbSNP:267608022
2658 2658 c, g, t dbSNP:587780687
2667 2667 a, g, t dbSNP:34319539
2669 2669 a, c, g dbSNP:775130557
2673 2673 g, t dbSNP:41295182
2681 2681 g, t dbSNP:267608024
2687 2687 a, c dbSNP:751216225
2690 2690 a, g dbSNP:200581817
2691 2691 c, t dbSNP:767318526
2707 2707 c, t dbSNP:55859129
2708 2708 c, g dbSNP:561565629
2709 2709 a, t dbSNP:146421227
2712 2712 a, g dbSNP:779846182
2718 2718 a, t dbSNP:199747712
2719 2719 c, g dbSNP:755118317
2723 2723 g, t dbSNP:587781852
2724 2724 a, c dbSNP:1802577
2726 2726 c, t dbSNP:551060742
2727 2727 a, g dbSNP:587779967
2730 2730 -, t dbSNP:786202481
2730 2730 a, t dbSNP:587783054
2731 2731 a, g dbSNP:587779155
2733 2733 a, c dbSNP:267608023
2738 2738 -, a dbSNP:587779156
2739 2739 c, t dbSNP:587779968
2741 2741 a, t dbSNP:786203590
2742 2742 a, c, t dbSNP:587779969
2743 2743 a, c, g dbSNP:150259097
2752 2752 a, c dbSNP:777017457
2755 2755 -, agt dbSNP:764232113
2770 2770 -, taa dbSNP:754120570
2776 2776 c, t dbSNP:760020644
2778 2778 c, g dbSNP:192502889
2784 2784 c, t dbSNP:773798070
2786 2786 a, g dbSNP:750339780
2791 2791 c, g dbSNP:551767246
2797 2797 -, tagtt dbSNP:757487336
2799 2799 -, gttttatatt dbSNP:779045017
2807 2807 a, t dbSNP:104895027
2822 2822 c, t dbSNP:368904632
2841 2841 c, t dbSNP:587779062
2865 2865 c, g, t dbSNP:528007802
2875 2875 c, t dbSNP:587779059
2887 2887 g, t dbSNP:17225053
2897 2897 a, t dbSNP:145007871
2955 2955 c, t dbSNP:557058172
2967 2967 g, t dbSNP:587779060
2972 2972 a, g dbSNP:17225060
2979 2979 a, g dbSNP:539453465

Target ORF information:

RefSeq Version NM_001258281
Organism Homo sapiens (human)
Definition Homo sapiens mutS homolog 2 (MSH2), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59053
Accession Version XM_005264332.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2925bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530367622. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)124..468(+)
Misc Feature(2)139..2631(+)
Misc Feature(3)544..924(+)
Misc Feature(4)985..1902(+)
Misc Feature(5)1969..2628(+)
Misc Feature(6)2077..2100(+)
Misc Feature(7)2086..2421(+)
Misc Feature(8)2200..2211(+)
Misc Feature(9)2224..2265(+)
Misc Feature(10)2302..2319(+)
Misc Feature(11)2326..2337(+)
Misc Feature(12)2407..2427(+)
Position Chain Variation Link
3 3 a, g dbSNP:746702986
5 5 a, g dbSNP:576303132
17 17 c, t dbSNP:543647908
23 23 a, g dbSNP:778304645
25 25 a, g dbSNP:751932753
28 28 g, t dbSNP:757842312
30 30 c, g dbSNP:781492698
31 31 c, g dbSNP:748885234
34 34 c, t dbSNP:768044277
37 37 g, t dbSNP:771263105
40 40 -, t dbSNP:766903439
44 44 c, t dbSNP:199841800
47 47 a, c dbSNP:771667817
49 49 a, g dbSNP:183204578
50 50 a, c, g, t dbSNP:368949534
51 51 c, g, t dbSNP:770870694
52 52 a, t dbSNP:776559145
55 55 a, t dbSNP:759730085
63 63 a, g dbSNP:765201464
64 64 c, g dbSNP:547444746
70 70 c, g dbSNP:587779960
73 73 a, c, g, t dbSNP:267607911
76 76 a, g dbSNP:63750466
77 77 a, c, t dbSNP:587778521
78 78 c, g, t dbSNP:368270856
83 83 -, a dbSNP:730881775
83 83 a, t dbSNP:754562075
86 86 a, c, t dbSNP:56170584
87 87 a, g dbSNP:758054171
88 88 a, g dbSNP:777351049
90 90 c, g dbSNP:146017810
91 91 a, g dbSNP:375561490
92 92 -, a dbSNP:267607915
92 92 a, c dbSNP:530071578
93 93 -, g, gcggtgcagccgaaggag dbSNP:281864943
95 95 c, t dbSNP:17217716
100 100 a, c, t dbSNP:63751099
101 101 -, a dbSNP:63750589
102 102 g, t dbSNP:786203228
106 106 -, g dbSNP:63750614
110 110 g, t dbSNP:63749907
114 114 a, g dbSNP:374396150
116 116 c, g dbSNP:776671839
119 119 a, c dbSNP:745771647
121 121 g, t dbSNP:63750966
122 122 g, t dbSNP:769731040
123 123 a, c, t dbSNP:397515879
126 126 c, g dbSNP:63750777
127 127 c, t dbSNP:141711342
129 129 c, t dbSNP:764466720
132 132 a, g dbSNP:368874228
133 133 c, g dbSNP:774708147
134 134 a, g dbSNP:730881760
138 138 c, g, t dbSNP:200632093
139 139 c, t dbSNP:372619120
142 142 c, t dbSNP:587779976
143 143 -, a dbSNP:587779175
145 145 -, c dbSNP:587779177
145 145 a, g, t dbSNP:746259256
146 146 a, g dbSNP:767747378
152 152 c, g, t dbSNP:750746034
153 153 -, g dbSNP:63751091
154 154 a, g, t dbSNP:63751246
154 154 -, g dbSNP:587779188
156 156 a, g dbSNP:752220575
160 160 a, c dbSNP:786203822
161 161 a, c, t dbSNP:757892928
164 164 c, t dbSNP:746635262
166 166 -, accacagtgc dbSNP:63750728
167 167 c, g dbSNP:552361923
169 169 a, c, g dbSNP:63751107
170 170 c, t dbSNP:769631146
171 171 a, c dbSNP:267607912
173 173 a, t dbSNP:63751424
177 177 c, g dbSNP:775554736
182 182 -, t dbSNP:63751056
184 184 g, t dbSNP:730881761
186 186 c, g dbSNP:587779074
187 187 a, c dbSNP:786202334
188 188 c, g dbSNP:587782759
188 188 -, g dbSNP:755777450
189 189 a, g dbSNP:63750974
190 190 a, g dbSNP:63751260
191 191 -, g dbSNP:63750984
195 195 -, ttct dbSNP:587782561
195 195 c, g, t dbSNP:761960690
198 198 a, c, g dbSNP:730881766
199 199 c, t dbSNP:786202731
200 200 a, g dbSNP:17217723
201 201 a, g, t dbSNP:63750894
203 203 a, c, t dbSNP:587779085
204 204 a, g dbSNP:766856128
205 205 g, t dbSNP:754341095
206 206 -, cgcacggcgaggacgcgctgctggccgcc dbSNP:63750089
206 206 c, t dbSNP:63750285
208 208 -, cacggcgaggacgcgctgctggccgcccg dbSNP:63751482
210 210 c, g dbSNP:33946261
211 211 c, g dbSNP:763573151
213 213 a, c dbSNP:587779090
214 214 g, t dbSNP:63750615
217 217 -, ga dbSNP:63750334
217 217 -, g dbSNP:63750644
218 218 a, t dbSNP:63750335
219 219 a, c, g dbSNP:730881771
226 226 -, g dbSNP:63750352
226 226 c, t dbSNP:786202335
227 227 c, t dbSNP:780840040
228 228 g, t dbSNP:750241099
229 229 g, t dbSNP:755931648
231 231 c, t dbSNP:780178752
232 232 g, t dbSNP:749212640
233 233 c, t dbSNP:768661914
235 235 -, c dbSNP:63750337
235 235 c, g dbSNP:587782354
236 236 a, g dbSNP:748196422
237 237 a, g dbSNP:772201676
238 238 a, g, t dbSNP:587779102
238 238 -, g dbSNP:63750087
239 239 a, t dbSNP:587782004
241 241 a, g dbSNP:267607913
246 246 a, c, g, t dbSNP:372189599
247 247 a, g dbSNP:771255106
248 248 a, g dbSNP:777174093
252 252 c, t dbSNP:760058815
253 253 c, t dbSNP:63750951
254 254 a, c dbSNP:587779113
255 255 c, g, t dbSNP:751082926
256 256 a, g dbSNP:767140240
258 258 a, g dbSNP:750058876
259 259 -, g, gg dbSNP:281864942
259 259 -, g dbSNP:63750160
270 270 c, t dbSNP:730881784
271 271 a, g dbSNP:768824654
276 276 -, g dbSNP:63750199
276 276 g, t dbSNP:753643218
280 280 a, g dbSNP:587778522
281 281 c, t dbSNP:587782481
283 283 c, g dbSNP:587782659
288 288 a, g dbSNP:746298214
289 289 a, g dbSNP:770110491
291 291 a, g dbSNP:1800150
292 292 a, c dbSNP:150548839
295 295 -, ct dbSNP:63750712
298 298 c, g, t dbSNP:63750042
300 300 g, t dbSNP:587782857
301 301 -, ag dbSNP:63749848
304 304 a, g dbSNP:772779997
306 306 g, t dbSNP:786202437
309 309 g, t dbSNP:786202203
315 315 c, t dbSNP:760201111
316 316 a, t dbSNP:587779145
319 319 -, a dbSNP:63749912
319 319 a, c dbSNP:766196837
323 323 -, a dbSNP:786202037
327 327 -, t dbSNP:63751158
327 327 -, tg dbSNP:267607921
328 328 c, g dbSNP:776423120
332 332 c, g dbSNP:587781447
333 333 -, t dbSNP:786204257
335 335 -, tt dbSNP:267607920
337 337 c, g dbSNP:587782586
345 345 -, tct dbSNP:528263777
346 346 c, g dbSNP:587779154
349 349 -, ctt dbSNP:267607918
349 349 c, t dbSNP:63751429
350 350 -, tt dbSNP:63749872
350 350 c, t dbSNP:63751456
351 351 -, tct dbSNP:267607919
354 354 a, g dbSNP:752387348
359 359 a, g dbSNP:63750002
361 361 -, aaagatcttcttctggttcgtc dbSNP:63751295
361 361 c, t dbSNP:63750970
362 362 -, aagatcttcttctggttcgtca dbSNP:587776529
365 365 a, g dbSNP:63750887
366 366 c, t dbSNP:763872353
367 367 a, c dbSNP:63750230
368 368 -, g dbSNP:63749861
369 369 -, agttga dbSNP:63750506
369 369 a, t dbSNP:587782283
373 373 -, gaagtt dbSNP:587779157
373 373 g, t dbSNP:63750318
376 376 a, g dbSNP:193922373
379 379 c, t dbSNP:587780688
380 380 a, g dbSNP:63751173
384 384 c, g dbSNP:372972328
387 387 c, t dbSNP:746066632
389 389 a, g dbSNP:41295286
391 391 c, g dbSNP:587779158
397 397 a, g dbSNP:780496649
398 398 a, g dbSNP:749545338
399 399 c, t dbSNP:63751437
400 400 a, c dbSNP:587779970
401 401 a, g dbSNP:63751040
407 407 c, g dbSNP:769215192
408 408 a, c dbSNP:34312619
411 411 a, g dbSNP:35898375
416 416 -, a dbSNP:63751195
417 417 g, t dbSNP:770536851
419 419 -, attg dbSNP:63750501
420 420 c, t dbSNP:548225893
422 422 c, g dbSNP:786202083
424 424 -, t dbSNP:587779159
434 434 a, g dbSNP:587779971
435 435 g, t dbSNP:63750458
436 436 a, c dbSNP:374127044
439 439 a, g dbSNP:768313992
440 440 -, c dbSNP:63750210
440 440 c, g, t dbSNP:730881767
445 445 c, t dbSNP:761767467
448 448 a, g dbSNP:767371843
452 452 -, at dbSNP:63751227
452 452 a, g, t dbSNP:17217772
454 454 c, g dbSNP:145649774
455 455 g, t dbSNP:730881768
456 456 c, g dbSNP:766694099
458 458 c, g, t dbSNP:587779972
459 459 -, tc dbSNP:63750924
460 460 -, ca dbSNP:63750704
463 463 g, t dbSNP:755423698
471 471 -, c dbSNP:63751290
471 471 c, t dbSNP:61756462
475 475 c, g, t dbSNP:193096019
477 477 c, g dbSNP:778368203
478 478 -, t dbSNP:776948651
480 480 -, t dbSNP:63750408
481 481 c, g dbSNP:587781795
485 485 a, g dbSNP:769154205
488 488 -, a dbSNP:63750401
490 490 g, t dbSNP:779803074
493 493 a, g dbSNP:193922374
494 494 c, t dbSNP:768313658
497 497 c, g dbSNP:63750910
506 506 c, t dbSNP:774132884
507 507 g, t dbSNP:63750124
509 509 g, t dbSNP:772052262
510 510 c, g, t dbSNP:587779161
511 511 a, g dbSNP:773125415
512 512 g, t dbSNP:760851623
518 518 a, g dbSNP:587779162
519 519 c, t dbSNP:786203142
526 526 -, a dbSNP:63751449
530 530 c, g dbSNP:766349734
531 531 c, t dbSNP:63751065
532 532 a, g dbSNP:759712763
541 541 -, ggc dbSNP:762825105
542 542 c, g dbSNP:765489269
543 543 a, c dbSNP:61756463
544 544 c, t dbSNP:63751226
547 547 -, a dbSNP:786204319
548 548 g, t dbSNP:786202921
550 550 c, t dbSNP:63751426
553 553 a, g dbSNP:149511545
554 554 a, t dbSNP:63750126
555 555 g, t dbSNP:375202935
556 556 a, g dbSNP:63750624
557 557 c, g dbSNP:63750773
560 560 a, g, t dbSNP:63750214
562 562 a, g, t dbSNP:63750582
563 563 a, g dbSNP:786204082
565 565 g, t dbSNP:587779163
567 567 g, t dbSNP:63749949
571 571 c, g dbSNP:63750255
573 573 g, t dbSNP:757733033
577 577 a, g dbSNP:63750716
578 578 -, taca dbSNP:63751013
579 579 a, g dbSNP:748762580
580 580 c, g, t dbSNP:63750843
584 584 a, g dbSNP:63750902
585 585 -, g dbSNP:63750933
589 589 a, ctaggactgtgt dbSNP:63751067
590 590 c, g, t dbSNP:63750070
590 590 -, t dbSNP:63750069
593 593 a, g dbSNP:147346837
595 595 -, ctgtgtgaattccctgataatgatcagttctccaatcttgag dbSNP:63750705
596 596 c, t dbSNP:63751291
597 597 a, g dbSNP:771827041
600 600 -, tg dbSNP:587779164
601 601 a, g, t dbSNP:63750382
602 602 -, aa dbSNP:63750551
602 602 a, t dbSNP:786203795
615 615 c, t dbSNP:528114416
616 616 g, t dbSNP:730881770
619 619 c, t dbSNP:63750037
623 623 -, t dbSNP:267607928
624 624 c, t dbSNP:786202238
628 628 a, g dbSNP:766497093
629 629 a, g dbSNP:151129360
631 631 c, g dbSNP:759603999
632 632 c, g, t dbSNP:63751444
633 633 -, tgaggctct dbSNP:63750088
636 636 -, tcagttctccaatcttgag dbSNP:63750080
637 637 a, g, t dbSNP:63750821
638 638 c, g dbSNP:141021599
640 640 c, g dbSNP:763459034
641 641 ct, tc dbSNP:267607927
642 642 c, g dbSNP:764573221
643 643 -, ctc dbSNP:587779165
645 645 c, g, t dbSNP:1800151
646 646 a, t dbSNP:768006988
649 649 c, t dbSNP:63751326
653 653 c, t dbSNP:730881778
658 658 c, t dbSNP:587782804
659 659 -, c dbSNP:63750682
659 659 c, t dbSNP:754478179
661 661 a, c dbSNP:778573140
664 664 -, g dbSNP:63750786
664 664 a, g, t dbSNP:587779166
665 665 a, g dbSNP:63750327
666 666 a, g dbSNP:369685768
667 667 c, t dbSNP:63751110
668 668 a, g dbSNP:63751136
671 671 a, t dbSNP:587779167
678 678 c, g, t dbSNP:63750600
679 679 a, g dbSNP:587779973
682 682 a, g, t dbSNP:63750574
683 683 a, g dbSNP:770787472
685 685 c, g, t dbSNP:63749984
688 688 -, a dbSNP:63750995
691 691 a, g, t dbSNP:63750913
692 692 c, t dbSNP:781178004
695 695 -, g dbSNP:63750121
696 696 a, c dbSNP:786202651
697 697 g, t dbSNP:746013810
702 702 a, g dbSNP:769971586
703 703 a, g dbSNP:587780689
710 710 -, tg dbSNP:63751622
711 711 a, c, g dbSNP:751250018
713 713 g, t dbSNP:763298811
714 714 -, acag dbSNP:63751695
714 714 a, g dbSNP:768931909
715 715 c, t dbSNP:63751274
718 718 a, c, g dbSNP:63749936
719 719 c, t dbSNP:786203108
721 721 a, g dbSNP:762436663
722 722 -, ttcaa dbSNP:63751602
724 724 c, t dbSNP:587779170
736 736 a, t dbSNP:763720908
741 741 a, g dbSNP:751195930
744 744 c, g dbSNP:587779171
747 747 agaaa, taat dbSNP:587779172
747 747 -, agaa dbSNP:587782537
751 751 a, g dbSNP:756809051
754 754 a, g dbSNP:200313142
757 757 a, t dbSNP:587779173
758 758 -, aa dbSNP:587779975
759 759 -, a dbSNP:63750364
759 759 -, a dbSNP:63749897
763 763 -, g dbSNP:587779174
765 765 c, t dbSNP:541325199
768 768 -, tt dbSNP:63750426
770 770 c, g dbSNP:587781724
773 773 c, t dbSNP:730881773
774 774 a, g dbSNP:780121922
775 775 a, g dbSNP:749442037
776 776 -, aa dbSNP:281864944
777 777 -, a dbSNP:281864945
781 781 a, g dbSNP:63751307
783 783 -, ttat dbSNP:63751288
786 786 c, t dbSNP:369670665
787 787 c, t dbSNP:63750488
788 788 a, g dbSNP:199676483
789 789 ggacc, tta dbSNP:63750690
797 797 -, a dbSNP:587779176
797 797 a, g dbSNP:779051492
798 798 c, t dbSNP:748427458
799 799 c, t dbSNP:138857091
800 800 a, g dbSNP:63751455
807 807 -, g dbSNP:63750107
808 808 a, c, t dbSNP:63750881
813 813 c, g dbSNP:747321505
814 814 a, g dbSNP:587779178
818 818 -, a dbSNP:63749832
818 818 a, c dbSNP:61756464
819 819 a, g dbSNP:786201568
821 821 a, g, t dbSNP:730881779
823 823 a, g dbSNP:147389443
826 826 c, t dbSNP:63750347
827 827 a, g dbSNP:370906735
828 828 -, c dbSNP:35170366
828 828 c, g dbSNP:763639520
831 831 -, gaat dbSNP:267607931
831 831 -, g dbSNP:63751160
833 833 -, a dbSNP:587779179
834 834 c, t dbSNP:587779180
835 835 agtg, tt dbSNP:63750329
835 835 a, g dbSNP:761529282
836 836 a, c, g dbSNP:763184168
838 838 a, g dbSNP:377403073
840 840 -, ct dbSNP:587779181
846 846 a, g, t dbSNP:755965129
847 847 c, t dbSNP:587781294
849 849 a, g dbSNP:544212322
853 853 a, t dbSNP:786201941
854 854 -, a dbSNP:786204144
854 854 c, t dbSNP:63749969
854 854 -, t dbSNP:63749968
858 858 c, g dbSNP:754820584
860 860 -, at dbSNP:63751614
863 863 a, g dbSNP:730881780
864 864 c, g dbSNP:587779183
867 867 c, g, t dbSNP:63749903
867 867 -, t dbSNP:63749902
869 869 c, t dbSNP:587781745
875 875 c, t dbSNP:563410947
878 878 c, t dbSNP:63750058
879 879 -, a dbSNP:63750225
880 880 -, ctgt dbSNP:63750326
880 880 c, g dbSNP:758403441
882 882 -, gtct dbSNP:63749978
882 882 -, gt dbSNP:63751133
883 883 -, tctg dbSNP:587779185
884 884 c, t dbSNP:139891783
886 886 at, gc dbSNP:587779186
887 887 c, t dbSNP:34136999
888 888 a, g dbSNP:368912987
889 889 aa, gt dbSNP:63749840
889 889 a, g dbSNP:530814648
890 890 c, t dbSNP:144288433
891 891 a, g dbSNP:146577635
892 892 a, g dbSNP:371944271
894 894 c, g dbSNP:781569442
902 902 g, t dbSNP:786203424
907 907 c, g dbSNP:375351205
908 908 -, tct dbSNP:267607936
908 908 -, t dbSNP:63751159
909 909 c, g dbSNP:747730026
911 911 -, t dbSNP:63750091
912 912 -, a dbSNP:63750154
913 913 c, t dbSNP:587779977
914 914 a, c, g dbSNP:63749991
915 915 a, t dbSNP:150197753
916 916 c, g dbSNP:760432160
917 917 a, g dbSNP:587779978
919 919 g, t dbSNP:63750381
920 920 a, t dbSNP:770643326
923 923 a, c dbSNP:776501892
926 926 -, a dbSNP:63750701
927 927 c, t dbSNP:759242666
930 930 -, g dbSNP:34198889
931 931 g, t dbSNP:63750276
932 932 -, g dbSNP:193922375
932 932 c, g dbSNP:587782567
934 934 c, t dbSNP:63750097
935 935 -, a dbSNP:587779189
940 940 g, t dbSNP:587779190
945 945 -, gact dbSNP:587779191
946 946 a, t dbSNP:104895022
953 953 -, tt dbSNP:63751115
957 957 c, g dbSNP:201334592
960 960 -, c dbSNP:587779192
963 963 c, g dbSNP:551236465
964 964 c, t dbSNP:63750934
965 965 a, c dbSNP:267607998
966 966 c, g dbSNP:587781397
970 970 a, g dbSNP:730881753
971 971 -, at dbSNP:63750885
972 972 a, g dbSNP:587782530
973 973 a, t dbSNP:63749915
977 977 a, t dbSNP:63749914
978 978 a, g dbSNP:786202947
984 984 c, t dbSNP:786202261
985 985 -, g dbSNP:786203604
985 985 a, g dbSNP:63751454
986 986 a, c dbSNP:751600874
987 987 a, c dbSNP:757483245
994 994 -, agcagtca dbSNP:63750046
997 997 a, g dbSNP:781257094
1000 1000 c, g dbSNP:750866402
1001 1001 c, g, t dbSNP:63750640
1004 1004 -, a dbSNP:587779979
1006 1006 -, c dbSNP:267607937
1006 1006 c, g dbSNP:756398636
1010 1010 c, t dbSNP:780656204
1014 1014 a, g dbSNP:587779197
1016 1016 a, g, t dbSNP:202026056
1028 1028 a, t dbSNP:786204185
1030 1030 -, a dbSNP:63749852
1030 1030 a, g dbSNP:368982417
1033 1033 a, c dbSNP:587781550
1036 1036 a, g dbSNP:773301485
1037 1037 a, g, t dbSNP:4987188
1040 1040 a, c, g, t dbSNP:63750732
1042 1042 -, ca dbSNP:63751044
1042 1042 -, nnnn dbSNP:587779199
1042 1042 c, t dbSNP:63750502
1044 1044 a, g dbSNP:63750505
1045 1045 -, t dbSNP:63749945
1046 1046 c, t dbSNP:765886157
1054 1054 c, g, t dbSNP:753237286
1055 1055 c, t dbSNP:780602406
1056 1056 c, t dbSNP:4987189
1061 1061 c, t dbSNP:63750630
1063 1063 a, g dbSNP:267607938
1064 1064 a, g dbSNP:779673318
1069 1069 c, t dbSNP:63750468
1070 1070 a, g dbSNP:63750828
1072 1072 a, t dbSNP:587779063
1076 1076 -, cccc dbSNP:63751289
1076 1076 c, t dbSNP:63750602
1077 1077 c, g dbSNP:749117915
1078 1078 c, g, t dbSNP:63751062
1079 1079 -, c dbSNP:587779064
1081 1081 c, t dbSNP:63750778
1084 1084 a, g dbSNP:63751004
1085 1085 a, g dbSNP:587779065
1086 1086 a, c dbSNP:774083607
1089 1089 -, aa dbSNP:63750703
1090 1090 -, a dbSNP:587779066
1093 1093 c, g dbSNP:748115066
1094 1094 c, t dbSNP:63751147
1096 1096 a, g dbSNP:63749879
1099 1099 a, g dbSNP:587779961
1102 1102 a, c, t dbSNP:63750245
1104 1104 c, g dbSNP:375799148
1105 1105 -, tat dbSNP:587782374
1106 1106 a, g dbSNP:63751027
1107 1107 a, g dbSNP:63750396
1110 1110 -, tt dbSNP:63751483
1115 1115 a, g dbSNP:773177076
1117 1117 c, g dbSNP:267607939
1118 1118 c, g, t dbSNP:587779067
1120 1120 c, t dbSNP:771126636
1123 1123 a, g dbSNP:138026880
1125 1125 c, g, t dbSNP:373122667
1131 1131 -, g dbSNP:587779068
1136 1136 g, t dbSNP:730881754
1139 1139 c, t dbSNP:753075410
1141 1141 c, g dbSNP:587779069
1142 1142 a, c dbSNP:150503781
1143 1143 c, g dbSNP:587781617
1145 1145 a, c dbSNP:587781775
1147 1147 a, t dbSNP:587779070
1148 1148 a, c, g, t dbSNP:63751604
1149 1149 a, t dbSNP:63751617
1154 1154 a, g dbSNP:587779072
1158 1158 a, t dbSNP:63751699
1159 1159 g, t dbSNP:377345366
1167 1167 c, t dbSNP:746989189
1169 1169 -, a dbSNP:267607693
1171 1171 a, g, t dbSNP:80285180
1171 1171 -, g dbSNP:587779073
1172 1172 c, t dbSNP:770956016
1180 1180 -, g dbSNP:63749814
1181 1181 c, t dbSNP:139652783
1184 1184 a, g dbSNP:745889191
1186 1186 g, t dbSNP:770201760
1189 1189 a, c dbSNP:781061998
1191 1191 -, g dbSNP:63750516
1192 1192 c, t dbSNP:63750558
1193 1193 a, g dbSNP:749660228
1194 1194 c, g dbSNP:370378607
1196 1196 c, t dbSNP:774539871
1197 1197 -, at dbSNP:786203350
1199 1199 c, t dbSNP:762385137
1200 1200 -, ta dbSNP:63751219
1201 1201 c, g, t dbSNP:63750267
1202 1202 a, g dbSNP:776174711
1203 1203 a, g dbSNP:181852377
1207 1207 g, t dbSNP:764911657
1211 1211 c, t dbSNP:730881755
1211 1211 -, t dbSNP:63750039
1216 1216 -, c dbSNP:63750496
1216 1216 c, t dbSNP:752373431
1217 1217 a, g dbSNP:267607947
1219 1219 c, t dbSNP:63749849
1220 1220 a, c, g dbSNP:376934727
1225 1225 c, t dbSNP:763985746
1226 1226 c, t dbSNP:564736113
1229 1229 -, a dbSNP:730881774
1231 1231 c, t dbSNP:751249745
1232 1232 c, t dbSNP:63750485
1237 1237 c, t dbSNP:587779075
1238 1238 a, g dbSNP:757276241
1240 1240 c, t dbSNP:17224367
1247 1247 a, t dbSNP:61756465
1254 1254 -, t dbSNP:63750901
1254 1254 g, t dbSNP:374135434
1255 1255 c, t dbSNP:63750302
1256 1256 a, g dbSNP:779944676
1261 1261 c, g, t dbSNP:63750611
1263 1263 a, g dbSNP:768694189
1264 1264 -, g dbSNP:63751169
1269 1269 -, ca dbSNP:63749850
1275 1275 -, a dbSNP:63750586
1276 1276 a, c, t dbSNP:63751412
1276 1276 -, c dbSNP:63751413
1282 1282 -, t dbSNP:587782777
1287 1287 a, c dbSNP:63751271
1288 1288 c, t dbSNP:63751108
1289 1289 a, g dbSNP:146567853
1290 1290 -, ccga dbSNP:267607946
1291 1291 -, cgac dbSNP:63751192
1292 1292 -, c dbSNP:760228651
1293 1293 -, ct dbSNP:587779076
1293 1293 c, g, t dbSNP:63750813
1294 1294 -, t dbSNP:63751142
1295 1295 a, g, t dbSNP:63750379
1296 1296 c, t dbSNP:63750132
1297 1297 a, c, g dbSNP:151244108
1298 1298 -, ag dbSNP:63750086
1299 1299 a, g dbSNP:759098126
1300 1300 g, t dbSNP:587782242
1303 1303 a, t dbSNP:764825558
1307 1307 -, atcaactacctaatgttatacaggctctggaaa dbSNP:63751644
1308 1308 -, tcaactacctaatgttatacaggctctggaaaa dbSNP:587779077
1310 1310 a, c dbSNP:587779962
1313 1313 c, t dbSNP:587779078
1314 1314 a, t dbSNP:757250110
1315 1315 -, ccta dbSNP:63751206
1315 1315 c, g, t dbSNP:35717997
1320 1320 c, t dbSNP:786201156
1321 1321 -, gttat dbSNP:587779079
1321 1321 -, g dbSNP:63751059
1324 1324 a, t dbSNP:763600083
1325 1325 c, t dbSNP:786202303
1326 1326 a, g dbSNP:751431238
1327 1327 a, c, t dbSNP:63750006
1330 1330 c, g dbSNP:767609290
1333 1333 a, c dbSNP:63750228
1334 1334 c, t dbSNP:587779080
1336 1336 g, t dbSNP:63751712
1339 1339 a, g dbSNP:201059765
1340 1340 a, g dbSNP:756071499
1341 1341 -, a dbSNP:63751667
1342 1342 c, t dbSNP:587782278
1343 1343 -, a dbSNP:587783055
1343 1343 a, g dbSNP:200429136
1347 1347 a, g dbSNP:63751650
1356 1356 c, g dbSNP:776034412
1357 1357 c, t dbSNP:63751693
1359 1359 -, g dbSNP:63751626
1360 1360 a, t dbSNP:63751646
1364 1364 a, t dbSNP:63751315
1365 1365 a, g dbSNP:781548186
1368 1368 a, g dbSNP:141295984
1373 1373 c, t dbSNP:768070717
1381 1381 c, g dbSNP:773956144
1383 1383 g, t dbSNP:730881781
1386 1386 c, t dbSNP:761558457
1387 1387 -, cct dbSNP:63751138
1387 1387 c, t dbSNP:786203116
1388 1388 -, ctc dbSNP:587779082
1388 1388 -, ct dbSNP:63750251
1388 1388 c, t dbSNP:771789692
1390 1390 -, ct dbSNP:587779083
1391 1391 cc, ttactgat dbSNP:63749931
1391 1391 c, t dbSNP:587779084
1393 1393 -, a dbSNP:63750807
1393 1393 a, c dbSNP:587779086
1403 1403 g, t dbSNP:557339938
1406 1406 c, t dbSNP:752067883
1410 1410 c, g dbSNP:766379227
1411 1411 g, t dbSNP:63751217
1412 1412 -, gg dbSNP:267607696
1413 1413 c, g, t dbSNP:587781373
1415 1415 c, g dbSNP:587782524
1417 1417 -, aagt dbSNP:267607955
1417 1417 a, t dbSNP:63749920
1419 1419 c, g dbSNP:587781331
1423 1423 c, t dbSNP:786201066
1424 1424 -, ag dbSNP:63750957
1426 1426 g, t dbSNP:267607954
1428 1428 a, g dbSNP:63751212
1430 1430 a, t dbSNP:63750697
1432 1432 a, g, t dbSNP:587781627
1438 1438 a, g dbSNP:758636279
1439 1439 c, t dbSNP:777963115
1445 1445 g, t dbSNP:63750521
1446 1446 a, g dbSNP:767639853
1450 1450 a, g dbSNP:575905950
1452 1452 a, g dbSNP:757534022
1454 1454 a, c, g dbSNP:730881756
1458 1458 c, g dbSNP:587781997
1462 1462 -, g dbSNP:587779088
1463 1463 a, g dbSNP:750737783
1469 1469 a, g dbSNP:544265737
1471 1471 g, t dbSNP:587779089
1477 1477 c, g dbSNP:780702096
1480 1480 -, g dbSNP:63750384
1481 1481 a, c, t dbSNP:267607959
1482 1482 a, t dbSNP:757958558
1485 1485 a, c dbSNP:745874745
1490 1490 c, g, t dbSNP:63751403
1491 1491 a, g dbSNP:746674539
1501 1501 a, c dbSNP:587781346
1506 1506 -, tc dbSNP:587779091
1507 1507 a, c dbSNP:770550720
1508 1508 a, g dbSNP:555986369
1509 1509 g, t dbSNP:745666037
1512 1512 a, g dbSNP:138049198
1514 1514 a, g, t dbSNP:786203036
1516 1516 -, a dbSNP:63750436
1516 1516 -, a dbSNP:63750068
1516 1516 a, t dbSNP:587779092
1517 1517 -, gagaa dbSNP:267607961
1517 1517 -, taag dbSNP:63750930
1519 1519 -, ga dbSNP:63750161
1519 1519 g, t dbSNP:63749947
1524 1524 -, aatg dbSNP:63750148
1525 1525 a, g dbSNP:775377647
1529 1529 -, atga dbSNP:587776530
1529 1529 -, a dbSNP:63750986
1533 1533 c, g dbSNP:35107951
1534 1534 g, t dbSNP:587781314
1546 1546 a, t dbSNP:774419666
1548 1548 ct, gc dbSNP:63750583
1549 1549 c, t dbSNP:63750936
1550 1550 a, t dbSNP:376990143
1552 1552 c, t dbSNP:55653533
1553 1553 c, t dbSNP:370970617
1555 1555 a, g dbSNP:730881757
1556 1556 c, t dbSNP:756516114
1557 1557 a, g dbSNP:767039383
1559 1559 a, t dbSNP:587779093
1560 1560 a, g dbSNP:267607960
1561 1561 a, g dbSNP:755501968
1566 1566 -, t dbSNP:63750362
1569 1569 -, a dbSNP:63749963
1572 1572 -, c dbSNP:587779094
1574 1574 a, g dbSNP:376677710
1577 1577 a, g dbSNP:148192104
1580 1580 c, t dbSNP:587779095
1582 1582 c, g, t dbSNP:63751600
1588 1588 g, t dbSNP:63750492
1594 1594 a, g dbSNP:267607968
1595 1595 c, g dbSNP:786202710
1597 1597 a, t dbSNP:730881758
1600 1600 c, t