Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

MSH2 mutS homolog 2 [Homo sapiens (human)]

Gene Symbol MSH2
Entrez Gene ID 4436
Full Name mutS homolog 2
General protein information
Preferred Names
DNA mismatch repair protein Msh2
DNA mismatch repair protein Msh2
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer, hereditary nonpolyposis, type 1, 120435 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu16740 NM_001258281 Homo sapiens mutS homolog 2 (MSH2), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu59053 XM_005264332 PREDICTED: Homo sapiens mutS homolog 2 (MSH2), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu59054 XM_011532867 PREDICTED: Homo sapiens mutS homolog 2 (MSH2), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu20167 NM_000251 Homo sapiens mutS homolog 2 (MSH2), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu16740D
Sequence Information ORF Nucleotide Sequence (Length: 2607bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 20-APR-2014
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh2 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC342099.1, AK304496.1 and CB250419.1. Summary: This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (2) lacks an alternate segment of the first exon, including the translation start site, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK304496.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)5..7(+)
Misc Feature(2)152..337(+)
Misc Feature(3)413..793(+)
Misc Feature(4)854..1771(+)
Misc Feature(5)908..1876(+)
Misc Feature(6)1838..2497(+)
Misc Feature(7)1946..1969(+)
Misc Feature(8)1955..2290(+)
Misc Feature(9)2069..2080(+)
Misc Feature(10)2093..2134(+)
Misc Feature(11)2171..2188(+)
Misc Feature(12)2195..2206(+)
Misc Feature(13)2276..2296(+)
Exon (1)1..109
Gene Synonym:
Exon (2)110..152
Gene Synonym:
Exon (3)153..307
Gene Synonym:
Exon (4)308..586
Gene Synonym:
Exon (5)587..733
Gene Synonym:
Exon (6)734..883
Gene Synonym:
Exon (7)884..1017
Gene Synonym:
Exon (8)1018..1217
Gene Synonym:
Exon (9)1218..1327
Gene Synonym:
Exon (10)1328..1451
Gene Synonym:
Exon (11)1452..1602
Gene Synonym:
Exon (12)1603..1700
Gene Synonym:
Exon (13)1701..1946
Gene Synonym:
Exon (14)1947..2151
Gene Synonym:
Exon (15)2152..2399
Gene Synonym:
Exon (16)2400..2575
Gene Synonym:
Exon (17)2576..3025
Gene Synonym:
Position Chain Variation Link
8 8 c, t dbSNP:2303425
10 10 g, t dbSNP:587782786
12 12 a, g dbSNP:786203146
14 14 a, g dbSNP:553751848
19 19 a, c dbSNP:587782649
20 20 c, g dbSNP:786202882
24 24 c, t dbSNP:17217709
28 28 c, t dbSNP:777285149
30 30 a, g dbSNP:56062561
32 32 c, t dbSNP:786202841
36 36 c, g dbSNP:372200074
43 43 a, g, t dbSNP:571975131
44 44 -, a dbSNP:560991330
45 45 -, a dbSNP:587779187
45 45 a, t dbSNP:542893403
48 48 -, tg dbSNP:587779182
50 50 a, g dbSNP:34355730
52 52 a, g dbSNP:786201938
53 53 a, g dbSNP:552303079
56 56 a, g dbSNP:746702986
58 58 a, g dbSNP:576303132
70 70 c, t dbSNP:543647908
76 76 a, g dbSNP:778304645
78 78 a, g dbSNP:751932753
81 81 g, t dbSNP:757842312
83 83 c, g dbSNP:781492698
84 84 c, g dbSNP:748885234
87 87 c, t dbSNP:768044277
90 90 g, t dbSNP:771263105
93 93 -, t dbSNP:766903439
97 97 c, t dbSNP:199841800
100 100 a, c dbSNP:771667817
102 102 a, g dbSNP:183204578
103 103 a, c, g, t dbSNP:368949534
104 104 c, g, t dbSNP:770870694
105 105 a, t dbSNP:776559145
108 108 a, t dbSNP:759730085
110 110 a, g dbSNP:267607913
115 115 a, c, g, t dbSNP:372189599
116 116 a, g dbSNP:771255106
117 117 a, g dbSNP:777174093
121 121 c, t dbSNP:760058815
122 122 c, t dbSNP:63750951
123 123 a, c dbSNP:587779113
124 124 c, g, t dbSNP:751082926
125 125 a, g dbSNP:767140240
127 127 a, g dbSNP:750058876
128 128 -, g, gg dbSNP:281864942
128 128 -, g dbSNP:63750160
139 139 c, t dbSNP:730881784
140 140 a, g dbSNP:768824654
145 145 -, g dbSNP:63750199
145 145 g, t dbSNP:753643218
149 149 a, g dbSNP:587778522
150 150 c, t dbSNP:587782481
152 152 c, g dbSNP:587782659
157 157 a, g dbSNP:746298214
158 158 a, g dbSNP:770110491
160 160 a, g dbSNP:1800150
161 161 a, c dbSNP:150548839
164 164 -, ct dbSNP:63750712
167 167 c, g, t dbSNP:63750042
169 169 g, t dbSNP:587782857
170 170 -, ag dbSNP:63749848
173 173 a, g dbSNP:772779997
175 175 g, t dbSNP:786202437
178 178 g, t dbSNP:786202203
184 184 c, t dbSNP:760201111
185 185 a, t dbSNP:587779145
188 188 -, a dbSNP:63749912
188 188 a, c dbSNP:766196837
192 192 -, a dbSNP:786202037
196 196 -, t dbSNP:63751158
196 196 -, tg dbSNP:267607921
197 197 c, g dbSNP:776423120
201 201 c, g dbSNP:587781447
202 202 -, t dbSNP:786204257
204 204 -, tt dbSNP:267607920
206 206 c, g dbSNP:587782586
214 214 -, tct dbSNP:528263777
215 215 c, g dbSNP:587779154
218 218 -, ctt dbSNP:267607918
218 218 c, t dbSNP:63751429
219 219 -, tt dbSNP:63749872
219 219 c, t dbSNP:63751456
220 220 -, tct dbSNP:267607919
223 223 a, g dbSNP:752387348
228 228 a, g dbSNP:63750002
230 230 -, aaagatcttcttctggttcgtc dbSNP:63751295
230 230 c, t dbSNP:63750970
231 231 -, aagatcttcttctggttcgtca dbSNP:587776529
234 234 a, g dbSNP:63750887
235 235 c, t dbSNP:763872353
236 236 a, c dbSNP:63750230
237 237 -, g dbSNP:63749861
238 238 -, agttga dbSNP:63750506
238 238 a, t dbSNP:587782283
242 242 -, gaagtt dbSNP:587779157
242 242 g, t dbSNP:63750318
245 245 a, g dbSNP:193922373
248 248 c, t dbSNP:587780688
249 249 a, g dbSNP:63751173
253 253 c, g dbSNP:372972328
256 256 c, t dbSNP:746066632
258 258 a, g dbSNP:41295286
260 260 c, g dbSNP:587779158
266 266 a, g dbSNP:780496649
267 267 a, g dbSNP:749545338
268 268 c, t dbSNP:63751437
269 269 a, c dbSNP:587779970
270 270 a, g dbSNP:63751040
276 276 c, g dbSNP:769215192
277 277 a, c dbSNP:34312619
280 280 a, g dbSNP:35898375
285 285 -, a dbSNP:63751195
286 286 g, t dbSNP:770536851
288 288 -, attg dbSNP:63750501
289 289 c, t dbSNP:548225893
291 291 c, g dbSNP:786202083
293 293 -, t dbSNP:587779159
303 303 a, g dbSNP:587779971
304 304 g, t dbSNP:63750458
305 305 a, c dbSNP:374127044
308 308 a, g dbSNP:768313992
309 309 -, c dbSNP:63750210
309 309 c, g, t dbSNP:730881767
314 314 c, t dbSNP:761767467
317 317 a, g dbSNP:767371843
321 321 -, at dbSNP:63751227
321 321 a, g, t dbSNP:17217772
323 323 c, g dbSNP:145649774
324 324 g, t dbSNP:730881768
325 325 c, g dbSNP:766694099
327 327 c, g, t dbSNP:587779972
328 328 -, tc dbSNP:63750924
329 329 -, ca dbSNP:63750704
332 332 g, t dbSNP:755423698
340 340 -, c dbSNP:63751290
340 340 c, t dbSNP:61756462
344 344 c, g, t dbSNP:193096019
346 346 c, g dbSNP:778368203
347 347 -, t dbSNP:776948651
349 349 -, t dbSNP:63750408
350 350 c, g dbSNP:587781795
354 354 a, g dbSNP:769154205
357 357 -, a dbSNP:63750401
359 359 g, t dbSNP:779803074
362 362 a, g dbSNP:193922374
363 363 c, t dbSNP:768313658
366 366 c, g dbSNP:63750910
375 375 c, t dbSNP:774132884
376 376 g, t dbSNP:63750124
378 378 g, t dbSNP:772052262
379 379 c, g, t dbSNP:587779161
380 380 a, g dbSNP:773125415
381 381 g, t dbSNP:760851623
387 387 a, g dbSNP:587779162
388 388 c, t dbSNP:786203142
395 395 -, a dbSNP:63751449
399 399 c, g dbSNP:766349734
400 400 c, t dbSNP:63751065
401 401 a, g dbSNP:759712763
410 410 -, ggc dbSNP:762825105
411 411 c, g dbSNP:765489269
412 412 a, c dbSNP:61756463
413 413 c, t dbSNP:63751226
416 416 -, a dbSNP:786204319
417 417 g, t dbSNP:786202921
419 419 c, t dbSNP:63751426
422 422 a, g dbSNP:149511545
423 423 a, t dbSNP:63750126
424 424 g, t dbSNP:375202935
425 425 a, g dbSNP:63750624
426 426 c, g dbSNP:63750773
429 429 a, g, t dbSNP:63750214
431 431 a, g, t dbSNP:63750582
432 432 a, g dbSNP:786204082
434 434 g, t dbSNP:587779163
436 436 g, t dbSNP:63749949
440 440 c, g dbSNP:63750255
442 442 g, t dbSNP:757733033
446 446 a, g dbSNP:63750716
447 447 -, taca dbSNP:63751013
448 448 a, g dbSNP:748762580
449 449 c, g, t dbSNP:63750843
453 453 a, g dbSNP:63750902
454 454 -, g dbSNP:63750933
458 458 a, ctaggactgtgt dbSNP:63751067
459 459 c, g, t dbSNP:63750070
459 459 -, t dbSNP:63750069
462 462 a, g dbSNP:147346837
464 464 -, ctgtgtgaattccctgataatgatcagttctccaatcttgag dbSNP:63750705
465 465 c, t dbSNP:63751291
466 466 a, g dbSNP:771827041
469 469 -, tg dbSNP:587779164
470 470 a, g, t dbSNP:63750382
471 471 -, aa dbSNP:63750551
471 471 a, t dbSNP:786203795
484 484 c, t dbSNP:528114416
485 485 g, t dbSNP:730881770
488 488 c, t dbSNP:63750037
492 492 -, t dbSNP:267607928
493 493 c, t dbSNP:786202238
497 497 a, g dbSNP:766497093
498 498 a, g dbSNP:151129360
500 500 c, g dbSNP:759603999
501 501 c, g, t dbSNP:63751444
502 502 -, tgaggctct dbSNP:63750088
505 505 -, tcagttctccaatcttgag dbSNP:63750080
506 506 a, g, t dbSNP:63750821
507 507 c, g dbSNP:141021599
509 509 c, g dbSNP:763459034
510 510 ct, tc dbSNP:267607927
511 511 c, g dbSNP:764573221
512 512 -, ctc dbSNP:587779165
514 514 c, g, t dbSNP:1800151
515 515 a, t dbSNP:768006988
518 518 c, t dbSNP:63751326
522 522 c, t dbSNP:730881778
527 527 c, t dbSNP:587782804
528 528 -, c dbSNP:63750682
528 528 c, t dbSNP:754478179
530 530 a, c dbSNP:778573140
533 533 -, g dbSNP:63750786
533 533 a, g, t dbSNP:587779166
534 534 a, g dbSNP:63750327
535 535 a, g dbSNP:369685768
536 536 c, t dbSNP:63751110
537 537 a, g dbSNP:63751136
540 540 a, t dbSNP:587779167
547 547 c, g, t dbSNP:63750600
548 548 a, g dbSNP:587779973
551 551 a, g, t dbSNP:63750574
552 552 a, g dbSNP:770787472
554 554 c, g, t dbSNP:63749984
557 557 -, a dbSNP:63750995
560 560 a, g, t dbSNP:63750913
561 561 c, t dbSNP:781178004
564 564 -, g dbSNP:63750121
565 565 a, c dbSNP:786202651
566 566 g, t dbSNP:746013810
571 571 a, g dbSNP:769971586
572 572 a, g dbSNP:587780689
579 579 -, tg dbSNP:63751622
580 580 a, c, g dbSNP:751250018
582 582 g, t dbSNP:763298811
583 583 -, acag dbSNP:63751695
583 583 a, g dbSNP:768931909
584 584 c, t dbSNP:63751274
587 587 a, c, g dbSNP:63749936
588 588 c, t dbSNP:786203108
590 590 a, g dbSNP:762436663
591 591 -, ttcaa dbSNP:63751602
593 593 c, t dbSNP:587779170
605 605 a, t dbSNP:763720908
610 610 a, g dbSNP:751195930
613 613 c, g dbSNP:587779171
616 616 agaaa, taat dbSNP:587779172
616 616 -, agaa dbSNP:587782537
620 620 a, g dbSNP:756809051
623 623 a, g dbSNP:200313142
626 626 a, t dbSNP:587779173
627 627 -, aa dbSNP:587779975
628 628 -, a dbSNP:63750364
628 628 -, a dbSNP:63749897
632 632 -, g dbSNP:587779174
634 634 c, t dbSNP:541325199
637 637 -, tt dbSNP:63750426
639 639 c, g dbSNP:587781724
642 642 c, t dbSNP:730881773
643 643 a, g dbSNP:780121922
644 644 a, g dbSNP:749442037
645 645 -, aa dbSNP:281864944
646 646 -, a dbSNP:281864945
650 650 a, g dbSNP:63751307
652 652 -, ttat dbSNP:63751288
655 655 c, t dbSNP:369670665
656 656 c, t dbSNP:63750488
657 657 a, g dbSNP:199676483
658 658 ggacc, tta dbSNP:63750690
666 666 -, a dbSNP:587779176
666 666 a, g dbSNP:779051492
667 667 c, t dbSNP:748427458
668 668 c, t dbSNP:138857091
669 669 a, g dbSNP:63751455
676 676 -, g dbSNP:63750107
677 677 a, c, t dbSNP:63750881
682 682 c, g dbSNP:747321505
683 683 a, g dbSNP:587779178
687 687 -, a dbSNP:63749832
687 687 a, c dbSNP:61756464
688 688 a, g dbSNP:786201568
690 690 a, g, t dbSNP:730881779
692 692 a, g dbSNP:147389443
695 695 c, t dbSNP:63750347
696 696 a, g dbSNP:370906735
697 697 -, c dbSNP:35170366
697 697 c, g dbSNP:763639520
700 700 -, gaat dbSNP:267607931
700 700 -, g dbSNP:63751160
702 702 -, a dbSNP:587779179
703 703 c, t dbSNP:587779180
704 704 agtg, tt dbSNP:63750329
704 704 a, g dbSNP:761529282
705 705 a, c, g dbSNP:763184168
707 707 a, g dbSNP:377403073
709 709 -, ct dbSNP:587779181
715 715 a, g, t dbSNP:755965129
716 716 c, t dbSNP:587781294
718 718 a, g dbSNP:544212322
722 722 a, t dbSNP:786201941
723 723 -, a dbSNP:786204144
723 723 c, t dbSNP:63749969
723 723 -, t dbSNP:63749968
727 727 c, g dbSNP:754820584
729 729 -, at dbSNP:63751614
732 732 a, g dbSNP:730881780
733 733 c, g dbSNP:587779183
736 736 c, g, t dbSNP:63749903
736 736 -, t dbSNP:63749902
738 738 c, t dbSNP:587781745
744 744 c, t dbSNP:563410947
747 747 c, t dbSNP:63750058
748 748 -, a dbSNP:63750225
749 749 -, ctgt dbSNP:63750326
749 749 c, g dbSNP:758403441
751 751 -, gtct dbSNP:63749978
751 751 -, gt dbSNP:63751133
752 752 -, tctg dbSNP:587779185
753 753 c, t dbSNP:139891783
755 755 at, gc dbSNP:587779186
756 756 c, t dbSNP:34136999
757 757 a, g dbSNP:368912987
758 758 aa, gt dbSNP:63749840
758 758 a, g dbSNP:530814648
759 759 c, t dbSNP:144288433
760 760 a, g dbSNP:146577635
761 761 a, g dbSNP:371944271
763 763 c, g dbSNP:781569442
771 771 g, t dbSNP:786203424
776 776 c, g dbSNP:375351205
777 777 -, tct dbSNP:267607936
777 777 -, t dbSNP:63751159
778 778 c, g dbSNP:747730026
780 780 -, t dbSNP:63750091
781 781 -, a dbSNP:63750154
782 782 c, t dbSNP:587779977
783 783 a, c, g dbSNP:63749991
784 784 a, t dbSNP:150197753
785 785 c, g dbSNP:760432160
786 786 a, g dbSNP:587779978
788 788 g, t dbSNP:63750381
789 789 a, t dbSNP:770643326
792 792 a, c dbSNP:776501892
795 795 -, a dbSNP:63750701
796 796 c, t dbSNP:759242666
799 799 -, g dbSNP:34198889
800 800 g, t dbSNP:63750276
801 801 -, g dbSNP:193922375
801 801 c, g dbSNP:587782567
803 803 c, t dbSNP:63750097
804 804 -, a dbSNP:587779189
809 809 g, t dbSNP:587779190
814 814 -, gact dbSNP:587779191
815 815 a, t dbSNP:104895022
822 822 -, tt dbSNP:63751115
826 826 c, g dbSNP:201334592
829 829 -, c dbSNP:587779192
832 832 c, g dbSNP:551236465
833 833 c, t dbSNP:63750934
834 834 a, c dbSNP:267607998
835 835 c, g dbSNP:587781397
839 839 a, g dbSNP:730881753
840 840 -, at dbSNP:63750885
841 841 a, g dbSNP:587782530
842 842 a, t dbSNP:63749915
846 846 a, t dbSNP:63749914
847 847 a, g dbSNP:786202947
853 853 c, t dbSNP:786202261
854 854 -, g dbSNP:786203604
854 854 a, g dbSNP:63751454
855 855 a, c dbSNP:751600874
856 856 a, c dbSNP:757483245
863 863 -, agcagtca dbSNP:63750046
866 866 a, g dbSNP:781257094
869 869 c, g dbSNP:750866402
870 870 c, g, t dbSNP:63750640
873 873 -, a dbSNP:587779979
875 875 -, c dbSNP:267607937
875 875 c, g dbSNP:756398636
879 879 c, t dbSNP:780656204
883 883 a, g dbSNP:587779197
885 885 a, g, t dbSNP:202026056
897 897 a, t dbSNP:786204185
899 899 -, a dbSNP:63749852
899 899 a, g dbSNP:368982417
902 902 a, c dbSNP:587781550
905 905 a, g dbSNP:773301485
906 906 a, g, t dbSNP:4987188
909 909 a, c, g, t dbSNP:63750732
911 911 -, ca dbSNP:63751044
911 911 -, nnnn dbSNP:587779199
911 911 c, t dbSNP:63750502
913 913 a, g dbSNP:63750505
914 914 -, t dbSNP:63749945
915 915 c, t dbSNP:765886157
923 923 c, g, t dbSNP:753237286
924 924 c, t dbSNP:780602406
925 925 c, t dbSNP:4987189
930 930 c, t dbSNP:63750630
932 932 a, g dbSNP:267607938
933 933 a, g dbSNP:779673318
938 938 c, t dbSNP:63750468
939 939 a, g dbSNP:63750828
941 941 a, t dbSNP:587779063
945 945 -, cccc dbSNP:63751289
945 945 c, t dbSNP:63750602
946 946 c, g dbSNP:749117915
947 947 c, g, t dbSNP:63751062
948 948 -, c dbSNP:587779064
950 950 c, t dbSNP:63750778
953 953 a, g dbSNP:63751004
954 954 a, g dbSNP:587779065
955 955 a, c dbSNP:774083607
958 958 -, aa dbSNP:63750703
959 959 -, a dbSNP:587779066
962 962 c, g dbSNP:748115066
963 963 c, t dbSNP:63751147
965 965 a, g dbSNP:63749879
968 968 a, g dbSNP:587779961
971 971 a, c, t dbSNP:63750245
973 973 c, g dbSNP:375799148
974 974 -, tat dbSNP:587782374
975 975 a, g dbSNP:63751027
976 976 a, g dbSNP:63750396
979 979 -, tt dbSNP:63751483
984 984 a, g dbSNP:773177076
986 986 c, g dbSNP:267607939
987 987 c, g, t dbSNP:587779067
989 989 c, t dbSNP:771126636
992 992 a, g dbSNP:138026880
994 994 c, g, t dbSNP:373122667
1000 1000 -, g dbSNP:587779068
1005 1005 g, t dbSNP:730881754
1008 1008 c, t dbSNP:753075410
1010 1010 c, g dbSNP:587779069
1011 1011 a, c dbSNP:150503781
1012 1012 c, g dbSNP:587781617
1014 1014 a, c dbSNP:587781775
1016 1016 a, t dbSNP:587779070
1017 1017 a, c, g, t dbSNP:63751604
1018 1018 a, t dbSNP:63751617
1023 1023 a, g dbSNP:587779072
1027 1027 a, t dbSNP:63751699
1028 1028 g, t dbSNP:377345366
1036 1036 c, t dbSNP:746989189
1038 1038 -, a dbSNP:267607693
1040 1040 a, g, t dbSNP:80285180
1040 1040 -, g dbSNP:587779073
1041 1041 c, t dbSNP:770956016
1049 1049 -, g dbSNP:63749814
1050 1050 c, t dbSNP:139652783
1053 1053 a, g dbSNP:745889191
1055 1055 g, t dbSNP:770201760
1058 1058 a, c dbSNP:781061998
1060 1060 -, g dbSNP:63750516
1061 1061 c, t dbSNP:63750558
1062 1062 a, g dbSNP:749660228
1063 1063 c, g dbSNP:370378607
1065 1065 c, t dbSNP:774539871
1066 1066 -, at dbSNP:786203350
1068 1068 c, t dbSNP:762385137
1069 1069 -, ta dbSNP:63751219
1070 1070 c, g, t dbSNP:63750267
1071 1071 a, g dbSNP:776174711
1072 1072 a, g dbSNP:181852377
1076 1076 g, t dbSNP:764911657
1080 1080 c, t dbSNP:730881755
1080 1080 -, t dbSNP:63750039
1085 1085 -, c dbSNP:63750496
1085 1085 c, t dbSNP:752373431
1086 1086 a, g dbSNP:267607947
1088 1088 c, t dbSNP:63749849
1089 1089 a, c, g dbSNP:376934727
1094 1094 c, t dbSNP:763985746
1095 1095 c, t dbSNP:564736113
1098 1098 -, a dbSNP:730881774
1100 1100 c, t dbSNP:751249745
1101 1101 c, t dbSNP:63750485
1106 1106 c, t dbSNP:587779075
1107 1107 a, g dbSNP:757276241
1109 1109 c, t dbSNP:17224367
1116 1116 a, t dbSNP:61756465
1123 1123 -, t dbSNP:63750901
1123 1123 g, t dbSNP:374135434
1124 1124 c, t dbSNP:63750302
1125 1125 a, g dbSNP:779944676
1130 1130 c, g, t dbSNP:63750611
1132 1132 a, g dbSNP:768694189
1133 1133 -, g dbSNP:63751169
1138 1138 -, ca dbSNP:63749850
1144 1144 -, a dbSNP:63750586
1145 1145 a, c, t dbSNP:63751412
1145 1145 -, c dbSNP:63751413
1151 1151 -, t dbSNP:587782777
1156 1156 a, c dbSNP:63751271
1157 1157 c, t dbSNP:63751108
1158 1158 a, g dbSNP:146567853
1159 1159 -, ccga dbSNP:267607946
1160 1160 -, cgac dbSNP:63751192
1161 1161 -, c dbSNP:760228651
1162 1162 -, ct dbSNP:587779076
1162 1162 c, g, t dbSNP:63750813
1163 1163 -, t dbSNP:63751142
1164 1164 a, g, t dbSNP:63750379
1165 1165 c, t dbSNP:63750132
1166 1166 a, c, g dbSNP:151244108
1167 1167 -, ag dbSNP:63750086
1168 1168 a, g dbSNP:759098126
1169 1169 g, t dbSNP:587782242
1172 1172 a, t dbSNP:764825558
1176 1176 -, atcaactacctaatgttatacaggctctggaaa dbSNP:63751644
1177 1177 -, tcaactacctaatgttatacaggctctggaaaa dbSNP:587779077
1179 1179 a, c dbSNP:587779962
1182 1182 c, t dbSNP:587779078
1183 1183 a, t dbSNP:757250110
1184 1184 -, ccta dbSNP:63751206
1184 1184 c, g, t dbSNP:35717997
1189 1189 c, t dbSNP:786201156
1190 1190 -, gttat dbSNP:587779079
1190 1190 -, g dbSNP:63751059
1193 1193 a, t dbSNP:763600083
1194 1194 c, t dbSNP:786202303
1195 1195 a, g dbSNP:751431238
1196 1196 a, c, t dbSNP:63750006
1199 1199 c, g dbSNP:767609290
1202 1202 a, c dbSNP:63750228
1203 1203 c, t dbSNP:587779080
1205 1205 g, t dbSNP:63751712
1208 1208 a, g dbSNP:201059765
1209 1209 a, g dbSNP:756071499
1210 1210 -, a dbSNP:63751667
1211 1211 c, t dbSNP:587782278
1212 1212 -, a dbSNP:587783055
1212 1212 a, g dbSNP:200429136
1216 1216 a, g dbSNP:63751650
1225 1225 c, g dbSNP:776034412
1226 1226 c, t dbSNP:63751693
1228 1228 -, g dbSNP:63751626
1229 1229 a, t dbSNP:63751646
1233 1233 a, t dbSNP:63751315
1234 1234 a, g dbSNP:781548186
1237 1237 a, g dbSNP:141295984
1242 1242 c, t dbSNP:768070717
1250 1250 c, g dbSNP:773956144
1252 1252 g, t dbSNP:730881781
1255 1255 c, t dbSNP:761558457
1256 1256 -, cct dbSNP:63751138
1256 1256 c, t dbSNP:786203116
1257 1257 -, ctc dbSNP:587779082
1257 1257 -, ct dbSNP:63750251
1257 1257 c, t dbSNP:771789692
1259 1259 -, ct dbSNP:587779083
1260 1260 cc, ttactgat dbSNP:63749931
1260 1260 c, t dbSNP:587779084
1262 1262 -, a dbSNP:63750807
1262 1262 a, c dbSNP:587779086
1272 1272 g, t dbSNP:557339938
1275 1275 c, t dbSNP:752067883
1279 1279 c, g dbSNP:766379227
1280 1280 g, t dbSNP:63751217
1281 1281 -, gg dbSNP:267607696
1282 1282 c, g, t dbSNP:587781373
1284 1284 c, g dbSNP:587782524
1286 1286 -, aagt dbSNP:267607955
1286 1286 a, t dbSNP:63749920
1288 1288 c, g dbSNP:587781331
1292 1292 c, t dbSNP:786201066
1293 1293 -, ag dbSNP:63750957
1295 1295 g, t dbSNP:267607954
1297 1297 a, g dbSNP:63751212
1299 1299 a, t dbSNP:63750697
1301 1301 a, g, t dbSNP:587781627
1307 1307 a, g dbSNP:758636279
1308 1308 c, t dbSNP:777963115
1314 1314 g, t dbSNP:63750521
1315 1315 a, g dbSNP:767639853
1319 1319 a, g dbSNP:575905950
1321 1321 a, g dbSNP:757534022
1323 1323 a, c, g dbSNP:730881756
1327 1327 c, g dbSNP:587781997
1331 1331 -, g dbSNP:587779088
1332 1332 a, g dbSNP:750737783
1338 1338 a, g dbSNP:544265737
1340 1340 g, t dbSNP:587779089
1346 1346 c, g dbSNP:780702096
1349 1349 -, g dbSNP:63750384
1350 1350 a, c, t dbSNP:267607959
1351 1351 a, t dbSNP:757958558
1354 1354 a, c dbSNP:745874745
1359 1359 c, g, t dbSNP:63751403
1360 1360 a, g dbSNP:746674539
1370 1370 a, c dbSNP:587781346
1375 1375 -, tc dbSNP:587779091
1376 1376 a, c dbSNP:770550720
1377 1377 a, g dbSNP:555986369
1378 1378 g, t dbSNP:745666037
1381 1381 a, g dbSNP:138049198
1383 1383 a, g, t dbSNP:786203036
1385 1385 -, a dbSNP:63750436
1385 1385 -, a dbSNP:63750068
1385 1385 a, t dbSNP:587779092
1386 1386 -, gagaa dbSNP:267607961
1386 1386 -, taag dbSNP:63750930
1388 1388 -, ga dbSNP:63750161
1388 1388 g, t dbSNP:63749947
1393 1393 -, aatg dbSNP:63750148
1394 1394 a, g dbSNP:775377647
1398 1398 -, atga dbSNP:587776530
1398 1398 -, a dbSNP:63750986
1402 1402 c, g dbSNP:35107951
1403 1403 g, t dbSNP:587781314
1415 1415 a, t dbSNP:774419666
1417 1417 ct, gc dbSNP:63750583
1418 1418 c, t dbSNP:63750936
1419 1419 a, t dbSNP:376990143
1421 1421 c, t dbSNP:55653533
1422 1422 c, t dbSNP:370970617
1424 1424 a, g dbSNP:730881757
1425 1425 c, t dbSNP:756516114
1426 1426 a, g dbSNP:767039383
1428 1428 a, t dbSNP:587779093
1429 1429 a, g dbSNP:267607960
1430 1430 a, g dbSNP:755501968
1435 1435 -, t dbSNP:63750362
1438 1438 -, a dbSNP:63749963
1441 1441 -, c dbSNP:587779094
1443 1443 a, g dbSNP:376677710
1446 1446 a, g dbSNP:148192104
1449 1449 c, t dbSNP:587779095
1451 1451 c, g, t dbSNP:63751600
1457 1457 g, t dbSNP:63750492
1463 1463 a, g dbSNP:267607968
1464 1464 c, g dbSNP:786202710
1466 1466 a, t dbSNP:730881758
1469 1469 c, t dbSNP:587779097
1471 1471 c, g, t dbSNP:587782355
1480 1480 a, g dbSNP:777195739
1488 1488 a, c, g, t dbSNP:373564353
1492 1492 a, c dbSNP:753227902
1493 1493 -, ca dbSNP:63749930
1493 1493 c, t dbSNP:63750780
1494 1494 a, t dbSNP:763323368
1501 1501 a, g dbSNP:63750820
1504 1504 c, t dbSNP:63750330
1507 1507 c, g dbSNP:63750224
1508 1508 a, t dbSNP:267607966
1509 1509 c, t dbSNP:587782587
1510 1510 -, t dbSNP:63749955
1511 1511 c, t dbSNP:755818010
1512 1512 a, c, g, t dbSNP:63751207
1516 1516 a, g dbSNP:766009421
1517 1517 -, a dbSNP:63750094
1519 1519 -, c dbSNP:63750738
1523 1523 a, c dbSNP:199744440
1524 1524 a, g, t dbSNP:755799226
1526 1526 -, g dbSNP:63751261
1528 1528 -, a dbSNP:63750845
1534 1534 -, agtccttcgtaacaataaaaa dbSNP:63750510
1535 1535 -, g dbSNP:63750104
1536 1536 c, t dbSNP:754778750
1538 1538 c, g dbSNP:786202987
1541 1541 c, g, t dbSNP:63750029
1542 1542 a, c, g, t dbSNP:587778523
1543 1543 a, t dbSNP:267607965
1546 1546 c, t dbSNP:587779098
1548 1548 a, g dbSNP:201722703
1551 1551 a, c dbSNP:747074044
1558 1558 a, c, t dbSNP:730881759
1562 1562 a, g dbSNP:141150847
1568 1568 -, g dbSNP:63750675
1572 1572 c, t dbSNP:587778524
1573 1573 c, t dbSNP:746286801
1579 1579 a, g dbSNP:372350768
1580 1580 -, ga dbSNP:63750662
1581 1581 a, g dbSNP:267607967
1583 1583 g, t dbSNP:63750538
1588 1588 c, g, t dbSNP:763525239
1595 1595 a, c dbSNP:63750838
1598 1598 a, t dbSNP:772772789
1601 1601 a, c, g, t dbSNP:63751656
1602 1602 a, c, g dbSNP:63750597
1603 1603 c, t dbSNP:587778525
1606 1606 -, a dbSNP:63751120
1607 1607 c, t dbSNP:61756466
1608 1608 -, a dbSNP:267607694
1608 1608 c, t dbSNP:587779101
1608 1608 -, t dbSNP:587779100
1609 1609 -, g dbSNP:63751324
1610 1610 a, c dbSNP:63750432
1611 1611 c, g dbSNP:139920308
1613 1613 -, t dbSNP:63751303
1616 1616 a, t dbSNP:750453437
1617 1617 -, t dbSNP:63750633
1620 1620 -, a dbSNP:63750054
1621 1621 c, t dbSNP:200056411
1622 1622 a, g dbSNP:63750328
1624 1624 -, a dbSNP:63750406
1626 1626 a, t dbSNP:63750997
1627 1627 c, g dbSNP:786203850
1628 1628 -, t dbSNP:587779103
1629 1629 a, c dbSNP:63751054
1631 1631 a, g dbSNP:55778204
1633 1633 c, g dbSNP:786203290
1634 1634 a, t dbSNP:587779104
1637 1637 -, aa dbSNP:63750737
1638 1638 -, a dbSNP:587781531
1640 1640 a, g, t dbSNP:63751149
1641 1641 -, aaaca dbSNP:63750474
1643 1643 -, a dbSNP:587779105
1645 1645 -, ag dbSNP:63751463
1646 1646 -, ga dbSNP:63750393
1646 1646 -, t dbSNP:587779106
1647 1647 -, aa dbSNP:63749883
1647 1647 -, ga, t dbSNP:281864941
1647 1647 a, g dbSNP:786201077
1650 1650 a, g dbSNP:587779963
1651 1651 c, t dbSNP:772510691
1656 1656 a, c dbSNP:776263190
1658 1658 a, g dbSNP:200766962
1658 1658 -, g dbSNP:267607974
1661 1661 -, c dbSNP:63751299
1661 1661 c, t dbSNP:63751298
1665 1665 a, g dbSNP:370330868
1667 1667 c, g dbSNP:587779107
1670 1670 a, g dbSNP:774985655
1671 1671 c, t dbSNP:63749910
1678 1678 -, a dbSNP:63750480
1678 1678 a, g dbSNP:61756467
1679 1679 g, t dbSNP:63751411
1681 1681 a, c dbSNP:751336185
1682 1682 -, a dbSNP:63750141
1682 1682 a, g dbSNP:761859271
1685 1685 -, g dbSNP:587779964
1687 1687 c, t dbSNP:786201486
1689 1689 a, c, g dbSNP:201118107
1694 1694 -, t dbSNP:63751433
1696 1696 c, t dbSNP:63750112
1700 1700 c, g dbSNP:63751140
1701 1701 -, g dbSNP:63750103
1705 1705 c, g, t dbSNP:63750844
1711 1711 a, c, g dbSNP:760619442
1712 1712 -, a dbSNP:267607977
1713 1713 c, t dbSNP:587782643
1714 1714 -, a dbSNP:63750015
1714 1714 a, g dbSNP:786203894
1715 1715 a, g dbSNP:371614039
1718 1718 c, t dbSNP:63750200
1720 1720 -, gaca dbSNP:63750113
1721 1721 a, g dbSNP:753897195
1722 1722 -, ct dbSNP:267607691
1725 1725 g, t dbSNP:786201590
1727 1727 -, aat dbSNP:63749831
1728 1728 -, a dbSNP:587779111
1728 1728 a, g dbSNP:41295288
1729 1729 -, tg dbSNP:63750495
1730 1730 a, g dbSNP:765442101
1731 1731 a, c dbSNP:548407418
1732 1732 c, t dbSNP:758742390
1733 1733 a, g dbSNP:778152746
1734 1734 -, t dbSNP:786202790
1736 1736 g, t dbSNP:112457919
1737 1737 c, t dbSNP:747504492
1739 1739 a, g, t dbSNP:587778526
1740 1740 c, t dbSNP:63751236
1742 1742 c, t dbSNP:63750047
1743 1743 a, g dbSNP:779447213
1744 1744 -, g dbSNP:786203704
1745 1745 c, g dbSNP:748797209
1748 1748 a, g, t dbSNP:63750657
1749 1749 a, g dbSNP:267607985
1750 1750 -, t dbSNP:63751129
1754 1754 a, c, g, t dbSNP:730881777
1756 1756 -, tgt dbSNP:267607978
1758 1758 a, t dbSNP:376044376
1760 1760 a, g dbSNP:772991620
1766 1766 g, t dbSNP:150980616
1767 1767 c, t dbSNP:63750665
1768 1768 -, t dbSNP:587779112
1769 1769 a, c, t dbSNP:267607980
1771 1771 c, t dbSNP:766326295
1772 1772 a, g dbSNP:369385048
1776 1776 c, g dbSNP:63750493
1778 1778 a, c dbSNP:200147804
1785 1785 c, t dbSNP:765493709
1787 1787 c, t dbSNP:587782627
1788 1788 c, g dbSNP:587779965
1794 1794 -, c dbSNP:267607984
1795 1795 a, g dbSNP:786203744
1797 1797 a, g dbSNP:63749982
1798 1798 g, t dbSNP:63750312
1799 1799 -, tg dbSNP:63750031
1800 1800 -, gt dbSNP:63750806
1802 1802 c, g, t dbSNP:63750508
1803 1803 a, g dbSNP:759263820
1804 1804 a, t dbSNP:786203119
1805 1805 a, c, g dbSNP:63750280
1806 1806 c, t dbSNP:28929483
1807 1807 a, c dbSNP:757766951
1809 1809 c, g dbSNP:781698416
1814 1814 g, t dbSNP:63750669
1822 1822 a, c dbSNP:63750626
1823 1823 a, g dbSNP:371776176
1825 1825 a, t dbSNP:786202663
1826 1826 c, t dbSNP:63750203
1827 1827 a, g dbSNP:61756468
1830 1830 -, gaag dbSNP:63750960
1831 1831 a, g dbSNP:778523544
1834 1834 a, t dbSNP:747805096
1837 1837 -, a dbSNP:63751038
1838 1838 -, a dbSNP:587779114
1838 1838 a, g dbSNP:771695599
1847 1847 c, g dbSNP:63750875
1848 1848 c, t dbSNP:63750279
1852 1852 -, c dbSNP:63750893
1853 1853 a, g dbSNP:267607981
1856 1856 c, t dbSNP:28929484
1857 1857 -, atgc dbSNP:730881776
1857 1857 a, g dbSNP:587779116
1858 1858 a, g, t dbSNP:1800152
1859 1859 g, t dbSNP:531276135
1862 1862 g, t dbSNP:63749946
1863 1863 a, g dbSNP:786204110
1865 1865 -, gt dbSNP:587779117
1865 1865 a, g dbSNP:776528054
1868 1868 a, g dbSNP:374840361
1874 1874 c, g dbSNP:267607982
1876 1876 a, c dbSNP:587780684
1878 1878 a, c, g dbSNP:41295290
1879 1879 c, t dbSNP:775484022
1880 1880 c, g, t dbSNP:63750078
1883 1883 a, g dbSNP:373475495
1884 1884 a, c, t dbSNP:763100088
1886 1886 a, g dbSNP:786201822
1896 1896 a, c dbSNP:267607983
1903 1903 c, t dbSNP:751939698
1904 1904 a, g dbSNP:549467183
1906 1906 a, c dbSNP:767941059
1908 1908 a, c, g dbSNP:185356145
1909 1909 c, g dbSNP:63751317
1911 1911 -, actt dbSNP:587779118
1914 1914 a, g dbSNP:200827721
1920 1920 -, at dbSNP:63750988
1921 1921 -, ta dbSNP:587779119
1923 1923 -, aaca dbSNP:587779120
1924 1924 -, a dbSNP:63751055
1925 1925 -, ca dbSNP:587779121
1925 1925 c, t dbSNP:786204321
1926 1926 -, ag dbSNP:63749976
1927 1927 -, ga dbSNP:587779122
1927 1927 a, c, g dbSNP:587780685
1927 1927 -, g dbSNP:63749929
1928 1928 a, g, t dbSNP:752241362
1933 1933 c, t dbSNP:777450803
1937 1937 -, at dbSNP:63751700
1946 1946 a, c, g dbSNP:63751668
1947 1947 a, c, g, t dbSNP:63751640
1950 1950 c, t dbSNP:41294982
1951 1951 -, c dbSNP:63751123
1951 1951 c, t dbSNP:766618212
1952 1952 a, t dbSNP:63751232
1954 1954 a, t dbSNP:587779127
1955 1955 a, g dbSNP:763690339
1956 1956 g, t dbSNP:786203126
1956 1956 -, t dbSNP:63751161
1959 1959 -, g dbSNP:63751462
1961 1961 a, c, g dbSNP:63750234
1962 1962 -, gt dbSNP:267608000
1962 1962 a, c, g dbSNP:267607996
1963 1963 c, t dbSNP:786203120
1964 1964 aaa, gcc dbSNP:587779128
1965 1965 a, g dbSNP:63751445
1967 1967 c, t dbSNP:63751089
1972 1972 -, at dbSNP:63749928
1972 1972 a, g dbSNP:786203923
1976 1976 -, at dbSNP:587779129
1979 1979 c, g, t dbSNP:63749932
1982 1982 c, g dbSNP:730881762
1984 1984 a, c, g, t dbSNP:730881763
1985 1985 a, g dbSNP:63751002
1986 1986 c, t dbSNP:587779130
1987 1987 -, tg dbSNP:587779131
1988 1988 a, g, t dbSNP:267607995
1989 1989 c, g dbSNP:755920849
1997 1997 gtactcatggcccaaattgggtgtttt, tatatgttgtgccatgtgaatata dbSNP:587779132
1997 1997 -, atag dbSNP:63750422
2001 2001 c, t dbSNP:587779133
2002 2002 c, g dbSNP:63750032
2004 2004 g, t dbSNP:63749993
2005 2005 a, g dbSNP:63750790
2009 2009 c, g dbSNP:587779134
2012 2012 -, a dbSNP:63749878
2013 2013 c, t dbSNP:754824872
2014 2014 g, t dbSNP:779101144
2015 2015 -, gggtgttt dbSNP:587779135
2015 2015 c, g dbSNP:63750232
2016 2016 g, t dbSNP:63751432
2021 2021 c, t dbSNP:63751409
2023 2023 c, t dbSNP:748210094
2023 2023 -, t dbSNP:63750689
2024 2024 c, g dbSNP:772491283
2027 2027 c, g dbSNP:546201898
2028 2028 c, t dbSNP:267607994
2030 2030 c, t dbSNP:63750961
2031 2031 a, g, t dbSNP:63750398
2032 2032 a, t dbSNP:63750872
2035 2035 a, g dbSNP:773555449
2037 2037 c, g dbSNP:587779136
2038 2038 a, c dbSNP:747170086
2041 2041 a, g dbSNP:771426077
2042 2042 a, g dbSNP:776820509
2046 2046 g, t dbSNP:587779137
2047 2047 a, g dbSNP:786201108
2049 2049 a, c dbSNP:267607999
2051 2051 a, g dbSNP:730881764
2052 2052 c, t dbSNP:564657106
2054 2054 -, g dbSNP:63749811
2059 2059 a, c dbSNP:773949031
2061 2061 a, c, g dbSNP:373226409
2063 2063 a, g dbSNP:750084297
2064 2064 a, t dbSNP:63750108
2070 2070 a, c, g dbSNP:373717132
2072 2072 c, t dbSNP:63750636
2073 2073 a, g dbSNP:138465383
2076 2076 -, t dbSNP:63751453
2079 2079 a, g, t dbSNP:753555602
2080 2080 c, g, t dbSNP:63750003
2082 2082 -, c dbSNP:63750545
2082 2082 c, t dbSNP:63751224
2090 2090 a, g dbSNP:778712654
2091 2091 a, g dbSNP:752883472
2093 2093 c, t dbSNP:587779139
2095 2095 a, g dbSNP:63750810
2097 2097 g, t dbSNP:777933557
2099 2099 a, g dbSNP:747265823
2101 2101 -, agga dbSNP:63750722
2105 2105 a, g dbSNP:587781996
2108 2108 -, t dbSNP:587779140
2109 2109 c, t dbSNP:63750794
2112 2112 a, c, t dbSNP:63751125
2113 2113 a, g, t dbSNP:370636719
2119 2119 c, g dbSNP:587782396
2120 2120 c, g, t dbSNP:104895026
2122 2122 c, t dbSNP:763387694
2128 2128 g, t dbSNP:587779141
2132 2132 g, t dbSNP:63749802
2135 2135 -, act dbSNP:63750562
2136 2136 c, g dbSNP:730881765
2138 2138 a, g dbSNP:772662439
2143 2143 c, t dbSNP:760371665
2144 2144 a, g dbSNP:2229061
2145 2145 -, t dbSNP:63750572
2146 2146 a, c, t dbSNP:533553381
2149 2149 c, t dbSNP:541880457
2151 2151 c, g dbSNP:267607997
2169 2169 -, catt dbSNP:63751156
2169 2169 a, c, g dbSNP:63751155
2172 2172 g, t dbSNP:63750403
2174 2174 -, ataatc dbSNP:267608008
2177 2177 -, atcata dbSNP:587779142
2178 2178 -, a, aat dbSNP:267607690
2179 2179 c, t dbSNP:764090611
2180 2180 -, at dbSNP:267607993
2181 2181 -, ta dbSNP:63751036
2183 2183 g, t dbSNP:267608007
2186 2186 a, g, t dbSNP:63751477
2189 2189 c, t dbSNP:527725593
2192 2192 a, g dbSNP:63751119
2201 2201 a, g, t dbSNP:757268664
2202 2202 -, c dbSNP:267608009
2207 2207 a, g dbSNP:750646335
2208 2208 c, g dbSNP:372383829
2211 2211 a, c dbSNP:780448421
2212 2212 c, t dbSNP:56076152
2216 2216 g, t dbSNP:63749854
2217 2217 a, g dbSNP:386833406
2222 2222 -, g dbSNP:786204050
2224 2224 a, g dbSNP:755548149
2227 2227 a, g dbSNP:779381010
2229 2229 c, t dbSNP:144412585
2231 2231 -, t dbSNP:63749913
2232 2232 a, g dbSNP:587779143
2233 2233 a, c, g dbSNP:63751105
2234 2234 a, g dbSNP:63750368
2235 2235 -, c dbSNP:63750346
2236 2236 a, t dbSNP:786202925
2236 2236 -, t dbSNP:63751143
2237 2237 a, g dbSNP:374399939
2245 2245 -, a dbSNP:587783053
2245 2245 a, g dbSNP:1800153
2246 2246 -, t dbSNP:63750896
2249 2249 a, g dbSNP:63750684
2250 2250 c, t dbSNP:371718349
2260 2260 c, g, t dbSNP:745528772
2261 2261 a, t dbSNP:775464903
2263 2263 a, c, t dbSNP:56397910
2272 2272 c, t dbSNP:781410136
2275 2275 a, c dbSNP:63750618
2276 2276 -, a dbSNP:63750149
2278 2278 a, g dbSNP:41295292
2285 2285 a, g dbSNP:35784190
2288 2288 -, c dbSNP:63750233
2289 2289 a, g dbSNP:587781594
2295 2295 a, c, g dbSNP:200252727
2302 2302 -, t, tt dbSNP:63750803
2303 2303 -, a dbSNP:63750463
2303 2303 a, c dbSNP:774440277
2304 2304 -, ct dbSNP:63750937
2308 2308 c, t dbSNP:786202414
2316 2316 a, g dbSNP:587782891
2318 2318 c, g dbSNP:730881769
2320 2320 g, t dbSNP:767520406
2329 2329 -, t dbSNP:63749983
2333 2333 a, g dbSNP:786203105
2334 2334 a, g dbSNP:786204073
2335 2335 g, t dbSNP:750498919
2338 2338 a, c, t dbSNP:368988823
2339 2339 c, t dbSNP:766586857
2341 2341 a, g dbSNP:201298777
2348 2348 a, g dbSNP:63751168
2349 2349 -, ca dbSNP:63750060
2349 2349 c, t dbSNP:786202362
2353 2353 a, c dbSNP:141523959
2354 2354 c, t dbSNP:779182536
2356 2356 c, t dbSNP:139317211
2358 2358 c, t dbSNP:758889557
2359 2359 -, c dbSNP:587779144
2361 2361 a, c, g, t dbSNP:41295294
2362 2362 c, t dbSNP:372661586
2363 2363 g, t dbSNP:34986638
2366 2366 a, g dbSNP:202145681
2368 2368 -, g dbSNP:63751079
2373 2373 g, t dbSNP:63751018
2377 2377 c, t dbSNP:375358440
2378 2378 a, g dbSNP:63749841
2380 2380 a, g dbSNP:587781678
2387 2387 c, t dbSNP:63749917
2388 2388 a, g dbSNP:768572053
2398 2398 a, g dbSNP:774152293
2407 2407 -, tg dbSNP:63751621
2407 2407 a, t dbSNP:63749846
2411 2411 c, g, t dbSNP:63750623
2420 2420 a, g dbSNP:63750478
2422 2422 a, g dbSNP:765467019
2424 2424 g, t dbSNP:753067992
2426 2426 -, c dbSNP:63751117
2437 2437 g, t dbSNP:763361583
2439 2439 -, catgttgcagagct dbSNP:587779146
2441 2441 a, g dbSNP:63750757
2442 2442 -, ctaattt dbSNP:267608014
2443 2443 -, taatttc dbSNP:63751447
2444 2444 a, c, g dbSNP:41295296
2445 2445 a, g dbSNP:779729016
2448 2448 -, t dbSNP:63750008
2457 2457 a, g dbSNP:63750027
2458 2458 a, t dbSNP:267608016
2462 2462 -, a dbSNP:587779147
2466 2466 -, ag dbSNP:587779148
2466 2466 a, t dbSNP:373393954
2467 2467 a, g dbSNP:778617066
2469 2469 a, g dbSNP:747700106
2470 2470 -, tg dbSNP:63749975
2474 2474 a, g dbSNP:63750571
2477 2477 c, t dbSNP:63750857
2478 2478 a, g dbSNP:140754514
2483 2483 a, g, t dbSNP:746972142
2486 2486 -, c dbSNP:587779149
2486 2486 c, g, t dbSNP:587778527
2492 2492 a, c, g dbSNP:267608015
2495 2495 -, gag dbSNP:766906365
2495 2495 c, g dbSNP:587779966
2497 2497 a, c, g dbSNP:587781453
2499 2499 a, c, g dbSNP:63750797
2502 2502 g, t dbSNP:774804216
2505 2505 a, g dbSNP:587782256
2507 2507 c, t dbSNP:786203818
2508 2508 a, g, t dbSNP:587779150
2509 2509 a, t dbSNP:768137500
2510 2510 a, g dbSNP:753459308
2513 2513 a, g dbSNP:754533481
2515 2515 -, agaatcgca dbSNP:774869661
2516 2516 a, g, t dbSNP:63749830
2517 2517 -, aatcgcaag dbSNP:587781278
2520 2520 a, c, t dbSNP:63750849
2521 2521 a, g dbSNP:752428475
2522 2522 c, t dbSNP:63750291
2524 2524 a, g dbSNP:63751093
2530 2530 c, t dbSNP:757938946
2534 2534 -, atcat dbSNP:587779151
2534 2534 -, atc dbSNP:759912716
2535 2535 c, t dbSNP:549759248
2536 2536 a, c, t dbSNP:547695133
2543 2543 c, g, t dbSNP:63751400
2547 2547 a, c dbSNP:730881772
2550 2550 c, g dbSNP:63750709
2553 2553 a, g dbSNP:587782214
2556 2556 a, g dbSNP:587780686
2558 2558 g, t dbSNP:63750795
2562 2562 a, g dbSNP:775390721
2563 2563 a, t dbSNP:587779152
2573 2573 -, ga dbSNP:267608013
2573 2573 c, g dbSNP:749543152
2574 2574 -, ag dbSNP:63751618
2575 2575 a, c, g dbSNP:63751624
2576 2576 a, c, t dbSNP:63751469
2588 2588 -, a dbSNP:63750145
2588 2588 -, a dbSNP:63750084
2590 2590 g, t dbSNP:768983827
2591 2591 a, t dbSNP:774732579
2592 2592 g, t dbSNP:63750409
2594 2594 c, t dbSNP:63750808
2598 2598 a, g dbSNP:63750350
2603 2603 -, c dbSNP:63751007
2604 2604 g, t dbSNP:63751205
2608 2608 c, g dbSNP:561680100
2618 2618 -, a dbSNP:756190190
2625 2625 c, g dbSNP:786203553
2632 2632 c, t dbSNP:148653184
2641 2641 a, g dbSNP:786202996
2648 2648 a, t dbSNP:748318462
2655 2655 c, g, t dbSNP:267608022
2658 2658 c, g, t dbSNP:587780687
2667 2667 a, g, t dbSNP:34319539
2669 2669 a, c, g dbSNP:775130557
2673 2673 g, t dbSNP:41295182
2681 2681 g, t dbSNP:267608024
2687 2687 a, c dbSNP:751216225
2690 2690 a, g dbSNP:200581817
2691 2691 c, t dbSNP:767318526
2707 2707 c, t dbSNP:55859129
2708 2708 c, g dbSNP:561565629
2709 2709 a, t dbSNP:146421227
2712 2712 a, g dbSNP:779846182
2718 2718 a, t dbSNP:199747712
2719 2719 c, g dbSNP:755118317
2723 2723 g, t dbSNP:587781852
2724 2724 a, c dbSNP:1802577
2726 2726 c, t dbSNP:551060742
2727 2727 a, g dbSNP:587779967
2730 2730 -, t dbSNP:786202481
2730 2730 a, t dbSNP:587783054
2731 2731 a, g dbSNP:587779155
2733 2733 a, c dbSNP:267608023
2738 2738 -, a dbSNP:587779156
2739 2739 c, t dbSNP:587779968
2741 2741 a, t dbSNP:786203590
2742 2742 a, c, t dbSNP:587779969
2743 2743 a, c, g dbSNP:150259097
2752 2752 a, c dbSNP:777017457
2755 2755 -, agt dbSNP:764232113
2770 2770 -, taa dbSNP:754120570
2776 2776 c, t dbSNP:760020644
2778 2778 c, g dbSNP:192502889
2784 2784 c, t dbSNP:773798070
2786 2786 a, g dbSNP:750339780
2791 2791 c, g dbSNP:551767246
2797 2797 -, tagtt dbSNP:757487336
2799 2799 -, gttttatatt dbSNP:779045017
2807 2807 a, t dbSNP:104895027
2822 2822 c, t dbSNP:368904632
2841 2841 c, t dbSNP:587779062
2865 2865 c, g, t dbSNP:528007802
2875 2875 c, t dbSNP:587779059
2887 2887 g, t dbSNP:17225053
2897 2897 a, t dbSNP:145007871
2955 2955 c, t dbSNP:557058172
2967 2967 g, t dbSNP:587779060
2972 2972 a, g dbSNP:17225060
2979 2979 a, g dbSNP:539453465

Target ORF information:

RefSeq Version NM_001258281
Organism Homo sapiens (human)
Definition Homo sapiens mutS homolog 2 (MSH2), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59053D
Sequence Information ORF Nucleotide Sequence (Length: 2925bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA mismatch repair protein Msh2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022184.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530367622. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)124..468(+)
Misc Feature(2)139..2631(+)
Misc Feature(3)544..924(+)
Misc Feature(4)985..1902(+)
Misc Feature(5)1969..2628(+)
Misc Feature(6)2077..2100(+)
Misc Feature(7)2086..2421(+)
Misc Feature(8)2200..2211(+)
Misc Feature(9)2224..2265(+)
Misc Feature(10)2302..2319(+)
Misc Feature(11)2326..2337(+)
Misc Feature(12)2407..2427(+)
Position Chain Variation Link
3 3 a, g dbSNP:746702986
5 5 a, g dbSNP:576303132
17 17 c, t dbSNP:543647908
23 23 a, g dbSNP:778304645
25 25 a, g dbSNP:751932753
28 28 g, t dbSNP:757842312
30 30 c, g dbSNP:781492698
31 31 c, g dbSNP:748885234
34 34 c, t dbSNP:768044277
37 37 g, t dbSNP:771263105
40 40 -, t dbSNP:766903439
44 44 c, t dbSNP:199841800
47 47 a, c dbSNP:771667817
49 49 a, g dbSNP:183204578
50 50 a, c, g, t dbSNP:368949534
51 51 c, g, t dbSNP:770870694
52 52 a, t dbSNP:776559145
55 55 a, t dbSNP:759730085
63 63 a, g dbSNP:765201464
64 64 c, g dbSNP:547444746
70 70 c, g dbSNP:587779960
73 73 a, c, g, t dbSNP:267607911
76 76 a, g dbSNP:63750466
77 77 a, c, t dbSNP:587778521
78 78 c, g, t dbSNP:368270856
83 83 -, a dbSNP:730881775
83 83 a, t dbSNP:754562075
86 86 a, c, t dbSNP:56170584
87 87 a, g dbSNP:758054171
88 88 a, g dbSNP:777351049
90 90 c, g dbSNP:146017810
91 91 a, g dbSNP:375561490
92 92 -, a dbSNP:267607915
92 92 a, c dbSNP:530071578
93 93 -, g, gcggtgcagccgaaggag dbSNP:281864943
95 95 c, t dbSNP:17217716
100 100 a, c, t dbSNP:63751099
101 101 -, a dbSNP:63750589
102 102 g, t dbSNP:786203228
106 106 -, g dbSNP:63750614
110 110 g, t dbSNP:63749907
114 114 a, g dbSNP:374396150
116 116 c, g dbSNP:776671839
119 119 a, c dbSNP:745771647
121 121 g, t dbSNP:63750966
122 122 g, t dbSNP:769731040
123 123 a, c, t dbSNP:397515879
126 126 c, g dbSNP:63750777
127 127 c, t dbSNP:141711342
129 129 c, t dbSNP:764466720
132 132 a, g dbSNP:368874228
133 133 c, g dbSNP:774708147
134 134 a, g dbSNP:730881760
138 138 c, g, t dbSNP:200632093
139 139 c, t dbSNP:372619120
142 142 c, t dbSNP:587779976
143 143 -, a dbSNP:587779175
145 145 -, c dbSNP:587779177
145 145 a, g, t dbSNP:746259256
146 146 a, g dbSNP:767747378
152 152 c, g, t dbSNP:750746034
153 153 -, g dbSNP:63751091
154 154 a, g, t dbSNP:63751246
154 154 -, g dbSNP:587779188
156 156 a, g dbSNP:752220575
160 160 a, c dbSNP:786203822
161 161 a, c, t dbSNP:757892928
164 164 c, t dbSNP:746635262
166 166 -, accacagtgc dbSNP:63750728
167 167 c, g dbSNP:552361923
169 169 a, c, g dbSNP:63751107
170 170 c, t dbSNP:769631146
171 171 a, c dbSNP:267607912
173 173 a, t dbSNP:63751424
177 177 c, g dbSNP:775554736
182 182 -, t dbSNP:63751056
184 184 g, t dbSNP:730881761
186 186 c, g dbSNP:587779074
187 187 a, c dbSNP:786202334
188 188 c, g dbSNP:587782759
188 188 -, g dbSNP:755777450
189 189 a, g dbSNP:63750974
190 190 a, g dbSNP:63751260
191 191 -, g dbSNP:63750984
195 195 -, ttct dbSNP:587782561
195 195 c, g, t dbSNP:761960690
198 198 a, c, g dbSNP:730881766
199 199 c, t dbSNP:786202731
200 200 a, g dbSNP:17217723
201 201 a, g, t dbSNP:63750894
203 203 a, c, t dbSNP:587779085
204 204 a, g dbSNP:766856128
205 205 g, t dbSNP:754341095
206 206 -, cgcacggcgaggacgcgctgctggccgcc dbSNP:63750089
206 206 c, t dbSNP:63750285
208 208 -, cacggcgaggacgcgctgctggccgcccg dbSNP:63751482
210 210 c, g dbSNP:33946261
211 211 c, g dbSNP:763573151
213 213 a, c dbSNP:587779090
214 214 g, t dbSNP:63750615
217 217 -, ga dbSNP:63750334
217 217 -, g dbSNP:63750644
218 218 a, t dbSNP:63750335
219 219 a, c, g dbSNP:730881771
226 226 -, g dbSNP:63750352
226 226 c, t dbSNP:786202335
227 227 c, t dbSNP:780840040
228 228 g, t dbSNP:750241099
229 229 g, t dbSNP:755931648
231 231 c, t dbSNP:780178752
232 232 g, t dbSNP:749212640
233 233 c, t dbSNP:768661914
235 235 -, c dbSNP:63750337
235 235 c, g dbSNP:587782354
236 236 a, g dbSNP:748196422
237 237 a, g dbSNP:772201676
238 238 a, g, t dbSNP:587779102
238 238 -, g dbSNP:63750087
239 239 a, t dbSNP:587782004
241 241 a, g dbSNP:267607913
246 246 a, c, g, t dbSNP:372189599
247 247 a, g dbSNP:771255106
248 248 a, g dbSNP:777174093
252 252 c, t dbSNP:760058815
253 253 c, t dbSNP:63750951
254 254 a, c dbSNP:587779113
255 255 c, g, t dbSNP:751082926
256 256 a, g dbSNP:767140240
258 258 a, g dbSNP:750058876
259 259 -, g, gg dbSNP:281864942
259 259 -, g dbSNP:63750160
270 270 c, t dbSNP:730881784
271 271 a, g dbSNP:768824654
276 276 -, g dbSNP:63750199
276 276 g, t dbSNP:753643218
280 280 a, g dbSNP:587778522
281 281 c, t dbSNP:587782481
283 283 c, g dbSNP:587782659
288 288 a, g dbSNP:746298214
289 289 a, g dbSNP:770110491
291 291 a, g dbSNP:1800150
292 292 a, c dbSNP:150548839
295 295 -, ct dbSNP:63750712
298 298 c, g, t dbSNP:63750042
300 300 g, t dbSNP:587782857
301 301 -, ag dbSNP:63749848
304 304 a, g dbSNP:772779997
306 306 g, t dbSNP:786202437
309 309 g, t dbSNP:786202203
315 315 c, t dbSNP:760201111
316 316 a, t dbSNP:587779145
319 319 -, a dbSNP:63749912
319 319 a, c dbSNP:766196837
323 323 -, a dbSNP:786202037
327 327 -, t dbSNP:63751158
327 327 -, tg dbSNP:267607921
328 328 c, g dbSNP:776423120
332 332 c, g dbSNP:587781447
333 333 -, t dbSNP:786204257
335 335 -, tt dbSNP:267607920
337 337 c, g dbSNP:587782586
345 345 -, tct dbSNP:528263777
346 346 c, g dbSNP:587779154
349 349 -, ctt dbSNP:267607918
349 349 c, t dbSNP:63751429
350 350 -, tt dbSNP:63749872
350 350 c, t dbSNP:63751456
351 351 -, tct dbSNP:267607919
354 354 a, g dbSNP:752387348
359 359 a, g dbSNP:63750002
361 361 -, aaagatcttcttctggttcgtc dbSNP:63751295
361 361 c, t dbSNP:63750970
362 362 -, aagatcttcttctggttcgtca dbSNP:587776529
365 365 a, g dbSNP:63750887
366 366 c, t dbSNP:763872353
367 367 a, c dbSNP:63750230
368 368 -, g dbSNP:63749861
369 369 -, agttga dbSNP:63750506
369 369 a, t dbSNP:587782283
373 373 -, gaagtt dbSNP:587779157
373 373 g, t dbSNP:63750318
376 376 a, g dbSNP:193922373
379 379 c, t dbSNP:587780688
380 380 a, g dbSNP:63751173
384 384 c, g dbSNP:372972328
387 387 c, t dbSNP:746066632
389 389 a, g dbSNP:41295286
391 391 c, g dbSNP:587779158
397 397 a, g dbSNP:780496649
398 398 a, g dbSNP:749545338
399 399 c, t dbSNP:63751437
400 400 a, c dbSNP:587779970
401 401 a, g dbSNP:63751040
407 407 c, g dbSNP:769215192
408 408 a, c dbSNP:34312619
411 411 a, g dbSNP:35898375
416 416 -, a dbSNP:63751195
417 417 g, t dbSNP:770536851
419 419 -, attg dbSNP:63750501
420 420 c, t dbSNP:548225893
422 422 c, g dbSNP:786202083
424 424 -, t dbSNP:587779159
434 434 a, g dbSNP:587779971
435 435 g, t dbSNP:63750458
436 436 a, c dbSNP:374127044
439 439 a, g dbSNP:768313992
440 440 -, c dbSNP:63750210
440 440 c, g, t dbSNP:730881767
445 445 c, t dbSNP:761767467
448 448 a, g dbSNP:767371843
452 452 -, at dbSNP:63751227
452 452 a, g, t dbSNP:17217772
454 454 c, g dbSNP:145649774
455 455 g, t dbSNP:730881768
456 456 c, g dbSNP:766694099
458 458 c, g, t dbSNP:587779972
459 459 -, tc dbSNP:63750924
460 460 -, ca dbSNP:63750704
463 463 g, t dbSNP:755423698
471 471 -, c dbSNP:63751290
471 471 c, t dbSNP:61756462
475 475 c, g, t dbSNP:193096019
477 477 c, g dbSNP:778368203
478 478 -, t dbSNP:776948651
480 480 -, t dbSNP:63750408
481 481 c, g dbSNP:587781795
485 485 a, g dbSNP:769154205
488 488 -, a dbSNP:63750401
490 490 g, t dbSNP:779803074
493 493 a, g dbSNP:193922374
494 494 c, t dbSNP:768313658
497 497 c, g dbSNP:63750910
506 506 c, t dbSNP:774132884
507 507 g, t dbSNP:63750124
509 509 g, t dbSNP:772052262
510 510 c, g, t dbSNP:587779161
511 511 a, g dbSNP:773125415
512 512 g, t dbSNP:760851623
518 518 a, g dbSNP:587779162
519 519 c, t dbSNP:786203142
526 526 -, a dbSNP:63751449
530 530 c, g dbSNP:766349734
531 531 c, t dbSNP:63751065
532 532 a, g dbSNP:759712763
541 541 -, ggc dbSNP:762825105
542 542 c, g dbSNP:765489269
543 543 a, c dbSNP:61756463
544 544 c, t dbSNP:63751226
547 547 -, a dbSNP:786204319
548 548 g, t dbSNP:786202921
550 550 c, t dbSNP:63751426
553 553 a, g dbSNP:149511545
554 554 a, t dbSNP:63750126
555 555 g, t dbSNP:375202935
556 556 a, g dbSNP:63750624
557 557 c, g dbSNP:63750773
560 560 a, g, t dbSNP:63750214
562 562 a, g, t dbSNP:63750582
563 563 a, g dbSNP:786204082
565 565 g, t dbSNP:587779163
567 567 g, t dbSNP:63749949
571 571 c, g dbSNP:63750255
573 573 g, t dbSNP:757733033
577 577 a, g dbSNP:63750716
578 578 -, taca dbSNP:63751013
579 579 a, g dbSNP:748762580
580 580 c, g, t dbSNP:63750843
584 584 a, g dbSNP:63750902
585 585 -, g dbSNP:63750933
589 589 a, ctaggactgtgt dbSNP:63751067
590 590 c, g, t dbSNP:63750070
590 590 -, t dbSNP:63750069
593 593 a, g dbSNP:147346837
595 595 -, ctgtgtgaattccctgataatgatcagttctccaatcttgag dbSNP:63750705
596 596 c, t dbSNP:63751291
597 597 a, g dbSNP:771827041
600 600 -, tg dbSNP:587779164
601 601 a, g, t dbSNP:63750382
602 602 -, aa dbSNP:63750551
602 602 a, t dbSNP:786203795
615 615 c, t dbSNP:528114416
616 616 g, t dbSNP:730881770
619 619 c, t dbSNP:63750037
623 623 -, t dbSNP:267607928
624 624 c, t dbSNP:786202238
628 628 a, g dbSNP:766497093
629 629 a, g dbSNP:151129360
631 631 c, g dbSNP:759603999
632 632 c, g, t dbSNP:63751444
633 633 -, tgaggctct dbSNP:63750088
636 636 -, tcagttctccaatcttgag dbSNP:63750080
637 637 a, g, t dbSNP:63750821
638 638 c, g dbSNP:141021599
640 640 c, g dbSNP:763459034
641 641 ct, tc dbSNP:267607927
642 642 c, g dbSNP:764573221
643 643 -, ctc dbSNP:587779165
645 645 c, g, t dbSNP:1800151
646 646 a, t dbSNP:768006988
649 649 c, t dbSNP:63751326
653 653 c, t dbSNP:730881778
658 658 c, t dbSNP:587782804
659 659 -, c dbSNP:63750682
659 659 c, t dbSNP:754478179
661 661 a, c dbSNP:778573140
664 664 -, g dbSNP:63750786
664 664 a, g, t dbSNP:587779166
665 665 a, g dbSNP:63750327
666 666 a, g dbSNP:369685768
667 667 c, t dbSNP:63751110
668 668 a, g dbSNP:63751136
671 671 a, t dbSNP:587779167
678 678 c, g, t dbSNP:63750600
679 679 a, g dbSNP:587779973
682 682 a, g, t dbSNP:63750574
683 683 a, g dbSNP:770787472
685 685 c, g, t dbSNP:63749984
688 688 -, a dbSNP:63750995
691 691 a, g, t dbSNP:63750913
692 692 c, t dbSNP:781178004
695 695 -, g dbSNP:63750121
696 696 a, c dbSNP:786202651
697 697 g, t dbSNP:746013810
702 702 a, g dbSNP:769971586
703 703 a, g dbSNP:587780689
710 710 -, tg dbSNP:63751622
711 711 a, c, g dbSNP:751250018
713 713 g, t dbSNP:763298811
714 714 -, acag dbSNP:63751695
714 714 a, g dbSNP:768931909
715 715 c, t dbSNP:63751274
718 718 a, c, g dbSNP:63749936
719 719 c, t dbSNP:786203108
721 721 a, g dbSNP:762436663
722 722 -, ttcaa dbSNP:63751602
724 724 c, t dbSNP:587779170
736 736 a, t dbSNP:763720908
741 741 a, g dbSNP:751195930
744 744 c, g dbSNP:587779171
747 747 agaaa, taat dbSNP:587779172
747 747 -, agaa dbSNP:587782537
751 751 a, g dbSNP:756809051
754 754 a, g dbSNP:200313142
757 757 a, t dbSNP:587779173
758 758 -, aa dbSNP:587779975
759 759 -, a dbSNP:63750364
759 759 -, a dbSNP:63749897
763 763 -, g dbSNP:587779174
765 765 c, t dbSNP:541325199
768 768 -, tt dbSNP:63750426
770 770 c, g dbSNP:587781724
773 773 c, t dbSNP:730881773
774 774 a, g dbSNP:780121922
775 775 a, g dbSNP:749442037
776 776 -, aa dbSNP:281864944
777 777 -, a dbSNP:281864945
781 781 a, g dbSNP:63751307
783 783 -, ttat dbSNP:63751288
786 786 c, t dbSNP:369670665
787 787 c, t dbSNP:63750488
788 788 a, g dbSNP:199676483
789 789 ggacc, tta dbSNP:63750690
797 797 -, a dbSNP:587779176
797 797 a, g dbSNP:779051492
798 798 c, t dbSNP:748427458
799 799 c, t dbSNP:138857091
800 800 a, g dbSNP:63751455
807 807 -, g dbSNP:63750107
808 808 a, c, t dbSNP:63750881
813 813 c, g dbSNP:747321505
814 814 a, g dbSNP:587779178
818 818 -, a dbSNP:63749832
818 818 a, c dbSNP:61756464
819 819 a, g dbSNP:786201568
821 821 a, g, t dbSNP:730881779
823 823 a, g dbSNP:147389443
826 826 c, t dbSNP:63750347
827 827 a, g dbSNP:370906735
828 828 -, c dbSNP:35170366
828 828 c, g dbSNP:763639520
831 831 -, gaat dbSNP:267607931
831 831 -, g dbSNP:63751160
833 833 -, a dbSNP:587779179
834 834 c, t dbSNP:587779180
835 835 agtg, tt dbSNP:63750329
835 835 a, g dbSNP:761529282
836 836 a, c, g dbSNP:763184168
838 838 a, g dbSNP:377403073
840 840 -, ct dbSNP:587779181
846 846 a, g, t dbSNP:755965129
847 847 c, t dbSNP:587781294
849 849 a, g dbSNP:544212322
853 853 a, t dbSNP:786201941
854 854 -, a dbSNP:786204144
854 854 c, t dbSNP:63749969
854 854 -, t dbSNP:63749968
858 858 c, g dbSNP:754820584
860 860 -, at dbSNP:63751614
863 863 a, g dbSNP:730881780
864 864 c, g dbSNP:587779183
867 867 c, g, t dbSNP:63749903
867 867 -, t dbSNP:63749902
869 869 c, t dbSNP:587781745
875 875 c, t dbSNP:563410947
878 878 c, t dbSNP:63750058
879 879 -, a dbSNP:63750225
880 880 -, ctgt dbSNP:63750326
880 880 c, g dbSNP:758403441
882 882 -, gtct dbSNP:63749978
882 882 -, gt dbSNP:63751133
883 883 -, tctg dbSNP:587779185
884 884 c, t dbSNP:139891783
886 886 at, gc dbSNP:587779186
887 887 c, t dbSNP:34136999
888 888 a, g dbSNP:368912987
889 889 aa, gt dbSNP:63749840
889 889 a, g dbSNP:530814648
890 890 c, t dbSNP:144288433
891 891 a, g dbSNP:146577635
892 892 a, g dbSNP:371944271
894 894 c, g dbSNP:781569442
902 902 g, t dbSNP:786203424
907 907 c, g dbSNP:375351205
908 908 -, tct dbSNP:267607936
908 908 -, t dbSNP:63751159
909 909 c, g dbSNP:747730026
911 911 -, t dbSNP:63750091
912 912 -, a dbSNP:63750154
913 913 c, t dbSNP:587779977
914 914 a, c, g dbSNP:63749991
915 915 a, t dbSNP:150197753
916 916 c, g dbSNP:760432160
917 917 a, g dbSNP:587779978
919 919 g, t dbSNP:63750381
920 920 a, t dbSNP:770643326
923 923 a, c dbSNP:776501892
926 926 -, a dbSNP:63750701
927 927 c, t dbSNP:759242666
930 930 -, g dbSNP:34198889
931 931 g, t dbSNP:63750276
932 932 -, g dbSNP:193922375
932 932 c, g dbSNP:587782567
934 934 c, t dbSNP:63750097
935 935 -, a dbSNP:587779189
940 940 g, t dbSNP:587779190
945 945 -, gact dbSNP:587779191
946 946 a, t dbSNP:104895022
953 953 -, tt dbSNP:63751115
957 957 c, g dbSNP:201334592
960 960 -, c dbSNP:587779192
963 963 c, g dbSNP:551236465
964 964 c, t dbSNP:63750934
965 965 a, c dbSNP:267607998
966 966 c, g dbSNP:587781397
970 970 a, g dbSNP:730881753
971 971 -, at dbSNP:63750885
972 972 a, g dbSNP:587782530
973 973 a, t dbSNP:63749915
977 977 a, t dbSNP:63749914
978 978 a, g dbSNP:786202947
984 984 c, t dbSNP:786202261
985 985 -, g dbSNP:786203604
985 985 a, g dbSNP:63751454
986 986 a, c dbSNP:751600874
987 987 a, c dbSNP:757483245
994 994 -, agcagtca dbSNP:63750046
997 997 a, g dbSNP:781257094
1000 1000 c, g dbSNP:750866402
1001 1001 c, g, t dbSNP:63750640
1004 1004 -, a dbSNP:587779979
1006 1006 -, c dbSNP:267607937
1006 1006 c, g dbSNP:756398636
1010 1010 c, t dbSNP:780656204
1014 1014 a, g dbSNP:587779197
1016 1016 a, g, t dbSNP:202026056
1028 1028 a, t dbSNP:786204185
1030 1030 -, a dbSNP:63749852
1030 1030 a, g dbSNP:368982417
1033 1033 a, c dbSNP:587781550
1036 1036 a, g dbSNP:773301485
1037 1037 a, g, t dbSNP:4987188
1040 1040 a, c, g, t dbSNP:63750732
1042 1042 -, ca dbSNP:63751044
1042 1042 -, nnnn dbSNP:587779199
1042 1042 c, t dbSNP:63750502
1044 1044 a, g dbSNP:63750505
1045 1045 -, t dbSNP:63749945
1046 1046 c, t dbSNP:765886157
1054 1054 c, g, t dbSNP:753237286
1055 1055 c, t dbSNP:780602406
1056 1056 c, t dbSNP:4987189
1061 1061 c, t dbSNP:63750630
1063 1063 a, g dbSNP:267607938
1064 1064 a, g dbSNP:779673318
1069 1069 c, t dbSNP:63750468
1070 1070 a, g dbSNP:63750828
1072 1072 a, t dbSNP:587779063
1076 1076 -, cccc dbSNP:63751289
1076 1076 c, t dbSNP:63750602
1077 1077 c, g dbSNP:749117915
1078 1078 c, g, t dbSNP:63751062
1079 1079 -, c dbSNP:587779064
1081 1081 c, t dbSNP:63750778
1084 1084 a, g dbSNP:63751004
1085 1085 a, g dbSNP:587779065
1086 1086 a, c dbSNP:774083607
1089 1089 -, aa dbSNP:63750703
1090 1090 -, a dbSNP:587779066
1093 1093 c, g dbSNP:748115066
1094 1094 c, t dbSNP:63751147
1096 1096 a, g dbSNP:63749879
1099 1099 a, g dbSNP:587779961
1102 1102 a, c, t dbSNP:63750245
1104 1104 c, g dbSNP:375799148
1105 1105 -, tat dbSNP:587782374
1106 1106 a, g dbSNP:63751027
1107 1107 a, g dbSNP:63750396
1110 1110 -, tt dbSNP:63751483
1115 1115 a, g dbSNP:773177076
1117 1117 c, g dbSNP:267607939
1118 1118 c, g, t dbSNP:587779067
1120 1120 c, t dbSNP:771126636
1123 1123 a, g dbSNP:138026880
1125 1125 c, g, t dbSNP:373122667
1131 1131 -, g dbSNP:587779068
1136 1136 g, t dbSNP:730881754
1139 1139 c, t dbSNP:753075410
1141 1141 c, g dbSNP:587779069
1142 1142 a, c dbSNP:150503781
1143 1143 c, g dbSNP:587781617
1145 1145 a, c dbSNP:587781775
1147 1147 a, t dbSNP:587779070
1148 1148 a, c, g, t dbSNP:63751604
1149 1149 a, t dbSNP:63751617
1154 1154 a, g dbSNP:587779072
1158 1158 a, t dbSNP:63751699
1159 1159 g, t dbSNP:377345366
1167 1167 c, t dbSNP:746989189
1169 1169 -, a dbSNP:267607693
1171 1171 a, g, t dbSNP:80285180
1171 1171 -, g dbSNP:587779073
1172 1172 c, t dbSNP:770956016
1180 1180 -, g dbSNP:63749814
1181 1181 c, t dbSNP:139652783
1184 1184 a, g dbSNP:745889191
1186 1186 g, t dbSNP:770201760
1189 1189 a, c dbSNP:781061998
1191 1191 -, g dbSNP:63750516
1192 1192 c, t dbSNP:63750558
1193 1193 a, g dbSNP:749660228
1194 1194 c, g dbSNP:370378607
1196 1196 c, t dbSNP:774539871
1197 1197 -, at dbSNP:786203350
1199 1199 c, t dbSNP:762385137
1200 1200 -, ta dbSNP:63751219
1201 1201 c, g, t dbSNP:63750267
1202 1202 a, g dbSNP:776174711
1203 1203 a, g dbSNP:181852377
1207 1207 g, t dbSNP:764911657
1211 1211 c, t dbSNP:730881755
1211 1211 -, t dbSNP:63750039
1216 1216 -, c dbSNP:63750496
1216 1216 c, t dbSNP:752373431
1217 1217 a, g dbSNP:267607947
1219 1219 c, t dbSNP:63749849
1220 1220 a, c, g dbSNP:376934727
1225 1225 c, t dbSNP:763985746
1226 1226 c, t dbSNP:564736113
1229 1229 -, a dbSNP:730881774
1231 1231 c, t dbSNP:751249745
1232 1232 c, t dbSNP:63750485
1237 1237 c, t dbSNP:587779075
1238 1238 a, g dbSNP:757276241
1240 1240 c, t dbSNP:17224367
1247 1247 a, t dbSNP:61756465
1254 1254 -, t dbSNP:63750901
1254 1254 g, t dbSNP:374135434
1255 1255 c, t dbSNP:63750302
1256 1256 a, g dbSNP:779944676
1261 1261 c, g, t dbSNP:63750611
1263 1263 a, g dbSNP:768694189
1264 1264 -, g dbSNP:63751169
1269 1269 -, ca dbSNP:63749850
1275 1275 -, a dbSNP:63750586
1276 1276 a, c, t dbSNP:63751412
1276 1276 -, c dbSNP:63751413
1282 1282 -, t dbSNP:587782777
1287 1287 a, c dbSNP:63751271
1288 1288 c, t dbSNP:63751108
1289 1289 a, g dbSNP:146567853
1290 1290 -, ccga dbSNP:267607946
1291 1291 -, cgac dbSNP:63751192
1292 1292 -, c dbSNP:760228651
1293 1293 -, ct dbSNP:587779076
1293 1293 c, g, t dbSNP:63750813
1294 1294 -, t dbSNP:63751142
1295 1295 a, g, t dbSNP:63750379
1296 1296 c, t dbSNP:63750132
1297 1297 a, c, g dbSNP:151244108
1298 1298 -, ag dbSNP:63750086
1299 1299 a, g dbSNP:759098126
1300 1300 g, t dbSNP:587782242
1303 1303 a, t dbSNP:764825558
1307 1307 -, atcaactacctaatgttatacaggctctggaaa dbSNP:63751644
1308 1308 -, tcaactacctaatgttatacaggctctggaaaa dbSNP:587779077
1310 1310 a, c dbSNP:587779962
1313 1313 c, t dbSNP:587779078
1314 1314 a, t dbSNP:757250110
1315 1315 -, ccta dbSNP:63751206
1315 1315 c, g, t dbSNP:35717997
1320 1320 c, t dbSNP:786201156
1321 1321 -, gttat dbSNP:587779079
1321 1321 -, g dbSNP:63751059
1324 1324 a, t dbSNP:763600083
1325 1325 c, t dbSNP:786202303
1326 1326 a, g dbSNP:751431238
1327 1327 a, c, t dbSNP:63750006
1330 1330 c, g dbSNP:767609290
1333 1333 a, c dbSNP:63750228
1334 1334 c, t dbSNP:587779080
1336 1336 g, t dbSNP:63751712
1339 1339 a, g dbSNP:201059765
1340 1340 a, g dbSNP:756071499
1341 1341 -, a dbSNP:63751667
1342 1342 c, t dbSNP:587782278
1343 1343 -, a dbSNP:587783055
1343 1343 a, g dbSNP:200429136
1347 1347 a, g dbSNP:63751650
1356 1356 c, g dbSNP:776034412
1357 1357 c, t dbSNP:63751693
1359 1359 -, g dbSNP:63751626
1360 1360 a, t dbSNP:63751646
1364 1364 a, t dbSNP:63751315
1365 1365 a, g dbSNP:781548186
1368 1368 a, g dbSNP:141295984
1373 1373 c, t dbSNP:768070717
1381 1381 c, g dbSNP:773956144
1383 1383 g, t dbSNP:730881781
1386 1386 c, t dbSNP:761558457
1387 1387 -, cct dbSNP:63751138
1387 1387 c, t dbSNP:786203116
1388 1388 -, ctc dbSNP:587779082
1388 1388 -, ct dbSNP:63750251
1388 1388 c, t dbSNP:771789692
1390 1390 -, ct dbSNP:587779083
1391 1391 cc, ttactgat dbSNP:63749931
1391 1391 c, t dbSNP:587779084
1393 1393 -, a dbSNP:63750807
1393 1393 a, c dbSNP:587779086
1403 1403 g, t dbSNP:557339938
1406 1406 c, t dbSNP:752067883
1410 1410 c, g dbSNP:766379227
1411 1411 g, t dbSNP:63751217
1412 1412 -, gg dbSNP:267607696
1413 1413 c, g, t dbSNP:587781373
1415 1415 c, g dbSNP:587782524
1417 1417 -, aagt dbSNP:267607955
1417 1417 a, t dbSNP:63749920
1419 1419 c, g dbSNP:587781331
1423 1423 c, t dbSNP:786201066
1424 1424 -, ag dbSNP:63750957
1426 1426 g, t dbSNP:267607954
1428 1428 a, g dbSNP:63751212
1430 1430 a, t dbSNP:63750697
1432 1432 a, g, t dbSNP:587781627
1438 1438 a, g dbSNP:758636279
1439 1439 c, t dbSNP:777963115
1445 1445 g, t dbSNP:63750521
1446 1446 a, g dbSNP:767639853
1450 1450 a, g dbSNP:575905950
1452 1452 a, g dbSNP:757534022
1454 1454 a, c, g dbSNP:730881756
1458 1458 c, g dbSNP:587781997
1462 1462 -, g dbSNP:587779088
1463 1463 a, g dbSNP:750737783
1469 1469 a, g dbSNP:544265737
1471 1471 g, t dbSNP:587779089
1477 1477 c, g dbSNP:780702096
1480 1480 -, g dbSNP:63750384
1481 1481 a, c, t dbSNP:267607959
1482 1482 a, t dbSNP:757958558
1485 1485 a, c dbSNP:745874745
1490 1490 c, g, t dbSNP:63751403
1491 1491 a, g dbSNP:746674539
1501 1501 a, c dbSNP:587781346
1506 1506 -, tc dbSNP:587779091
1507 1507 a, c dbSNP:770550720
1508 1508 a, g dbSNP:555986369
1509 1509 g, t dbSNP:745666037
1512 1512 a, g dbSNP:138049198
1514 1514 a, g, t dbSNP:786203036
1516 1516 -, a dbSNP:63750436
1516 1516 -, a dbSNP:63750068
1516 1516 a, t dbSNP:587779092
1517 1517 -, gagaa dbSNP:267607961
1517 1517 -, taag dbSNP:63750930
1519 1519 -, ga dbSNP:63750161
1519 1519 g, t dbSNP:63749947
1524 1524 -, aatg dbSNP:63750148
1525 1525 a, g dbSNP:775377647
1529 1529 -, atga dbSNP:587776530
1529 1529 -, a dbSNP:63750986
1533 1533 c, g dbSNP:35107951
1534 1534 g, t dbSNP:587781314
1546 1546 a, t dbSNP:774419666
1548 1548 ct, gc dbSNP:63750583
1549 1549 c, t dbSNP:63750936
1550 1550 a, t dbSNP:376990143
1552 1552 c, t dbSNP:55653533
1553 1553 c, t dbSNP:370970617
1555 1555 a, g dbSNP:730881757
1556 1556 c, t dbSNP:756516114
1557 1557 a, g dbSNP:767039383
1559 1559 a, t dbSNP:587779093
1560 1560 a, g dbSNP:267607960
1561 1561 a, g dbSNP:755501968
1566 1566 -, t dbSNP:63750362
1569 1569 -, a dbSNP:63749963
1572 1572 -, c dbSNP:587779094
1574 1574 a, g dbSNP:376677710
1577 1577 a, g dbSNP:148192104
1580 1580 c, t dbSNP:587779095
1582 1582 c, g, t dbSNP:63751600
1588 1588 g, t dbSNP:63750492
1594 1594 a, g dbSNP:267607968
1595 1595 c, g dbSNP:786202710
1597 1597 a, t dbSNP:730881758
1600 1600 c, t dbSNP:587779097
1602 1602 c, g, t dbSNP:587782355
1611 1611 a, g dbSNP:777195739
1619 1619 a, c, g, t dbSNP:373564353
1623 1623 a, c dbSNP:753227902
1624 1624 -, ca dbSNP:63749930
1624 1624 c, t dbSNP:63750780
1625 1625 a, t dbSNP:763323368
1632 1632 a, g dbSNP:63750820
1635 1635 c, t dbSNP:63750330
1638 1638 c, g dbSNP:63750224
1639 1639 a, t dbSNP:267607966
1640 1640 c, t dbSNP:587782587
1641 1641 -, t dbSNP:63749955
1642 1642 c, t dbSNP:755818010
1643 1643 a, c, g, t dbSNP:63751207
1647 1647 a, g dbSNP:766009421
1648 1648 -, a dbSNP:63750094
1650 1650 -, c dbSNP:63750738
1654 1654 a, c dbSNP:199744440
1655 1655 a, g, t dbSNP:755799226
1657 1657 -, g dbSNP:63751261
1659 1659 -, a dbSNP:63750845
1665 1665 -, agtccttcgtaacaataaaaa dbSNP:63750510
1666 1666 -, g dbSNP:63750104
1667 1667 c, t dbSNP:754778750
1669 1669 c, g dbSNP:786202987
1672 1672 c, g, t dbSNP:63750029
1673 1673 a, c, g, t dbSNP:587778523
1674 1674 a, t dbSNP:267607965
1677 1677 c, t dbSNP:587779098
1679 1679 a, g dbSNP:201722703
1682 1682 a, c dbSNP:747074044
1689 1689 a, c, t dbSNP:730881759
1693 1693 a, g dbSNP:141150847
1699 1699 -, g dbSNP:63750675
1703 1703 c, t dbSNP:587778524
1704 1704 c, t dbSNP:746286801
1710 1710 a, g dbSNP:372350768
1711 1711 -, ga dbSNP:63750662
1712 1712 a, g dbSNP:267607967
1714 1714 g, t dbSNP:63750538
1719 1719 c, g, t dbSNP:763525239
1726 1726 a, c dbSNP:63750838
1729 1729 a, t dbSNP:772772789
1732 1732 a, c, g, t dbSNP:63751656
1733 1733 a, c, g dbSNP:63750597
1734 1734 c, t dbSNP:587778525
1737 1737 -, a dbSNP:63751120
1738 1738 c, t dbSNP:61756466
1739 1739 -, a dbSNP:267607694
1739 1739 c, t dbSNP:587779101
1739 1739 -, t dbSNP:587779100
1740 1740 -, g dbSNP:63751324
1741 1741 a, c dbSNP:63750432
1742 1742 c, g dbSNP:139920308
1744 1744 -, t dbSNP:63751303
1747 1747 a, t dbSNP:750453437
1748 1748 -, t dbSNP:63750633
1751 1751 -, a dbSNP:63750054
1752 1752 c, t dbSNP:200056411
1753 1753 a, g dbSNP:63750328
1755 1755 -, a dbSNP:63750406
1757 1757 a, t dbSNP:63750997
1758 1758 c, g dbSNP:786203850
1759 1759 -, t dbSNP:587779103
1760 1760 a, c dbSNP:63751054
1762 1762 a, g dbSNP:55778204
1764 1764 c, g dbSNP:786203290
1765 1765 a, t dbSNP:587779104
1768 1768 -, aa dbSNP:63750737
1769 1769 -, a dbSNP:587781531
1771 1771 a, g, t dbSNP:63751149
1772 1772 -, aaaca dbSNP:63750474
1774 1774 -, a dbSNP:587779105
1776 1776 -, ag dbSNP:63751463
1777 1777 -, ga dbSNP:63750393
1777 1777 -, t dbSNP:587779106
1778 1778 -, aa dbSNP:63749883
1778 1778 -, ga, t dbSNP:281864941
1778 1778 a, g dbSNP:786201077
1781 1781 a, g dbSNP:587779963
1782 1782 c, t dbSNP:772510691
1787 1787 a, c dbSNP:776263190
1789 1789 a, g dbSNP:200766962
1789 1789 -, g dbSNP:267607974
1792 1792 -, c dbSNP:63751299
1792 1792 c, t dbSNP:63751298
1796 1796 a, g dbSNP:370330868
1798 1798 c, g dbSNP:587779107
1801 1801 a, g dbSNP:774985655
1802 1802 c, t dbSNP:63749910
1809 1809 -, a dbSNP:63750480
1809 1809 a, g dbSNP:61756467
1810 1810 g, t dbSNP:63751411
1812 1812 a, c dbSNP:751336185
1813 1813 -, a dbSNP:63750141
1813 1813 a, g dbSNP:761859271
1816 1816 -, g dbSNP:587779964
1818 1818 c, t dbSNP:786201486
1820 1820 a, c, g dbSNP:201118107
1825 1825 -, t dbSNP:63751433
1827 1827 c, t dbSNP:63750112
1831 1831 c, g dbSNP:63751140
1832 1832 -, g dbSNP:63750103
1836 1836 c, g, t dbSNP:63750844
1842 1842 a, c, g dbSNP:760619442
1843 1843 -, a dbSNP:267607977
1844 1844 c, t dbSNP:587782643
1845 1845 -, a dbSNP:63750015
1845 1845 a, g dbSNP:786203894
1846 1846 a, g dbSNP:371614039
1849 1849 c, t dbSNP:63750200
1851 1851 -, gaca dbSNP:63750113
1852 1852 a, g dbSNP:753897195
1853 1853 -, ct dbSNP:267607691
1856 1856 g, t dbSNP:786201590
1858 1858 -, aat dbSNP:63749831
1859 1859 -, a dbSNP:587779111
1859 1859 a, g dbSNP:41295288
1860 1860 -, tg dbSNP:63750495
1861 1861 a, g dbSNP:765442101
1862 1862 a, c dbSNP:548407418
1863 1863 c, t dbSNP:758742390
1864 1864 a, g dbSNP:778152746
1865 1865 -, t dbSNP:786202790
1867 1867 g, t dbSNP:112457919
1868 1868 c, t dbSNP:747504492
1870 1870 a, g, t dbSNP:587778526
1871 1871 c, t dbSNP:63751236
1873 1873 c, t dbSNP:63750047
1874 1874 a, g dbSNP:779447213
1875 1875 -, g dbSNP:786203704
1876 1876 c, g dbSNP:748797209
1879 1879 a, g, t dbSNP:63750657
1880 1880 a, g dbSNP:267607985
1881 1881 -, t dbSNP:63751129
1885 1885 a, c, g, t dbSNP:730881777
1887 1887 -, tgt dbSNP:267607978
1889 1889 a, t dbSNP:376044376
1891 1891 a, g dbSNP:772991620
1897 1897 g, t dbSNP:150980616
1898 1898 c, t dbSNP:63750665
1899 1899 -, t dbSNP:587779112
1900 1900 a, c, t dbSNP:267607980
1902 1902 c, t dbSNP:766326295
1903 1903 a, g dbSNP:369385048
1907 1907 c, g dbSNP:63750493
1909 1909 a, c dbSNP:200147804
1916 1916 c, t dbSNP:765493709
1918 1918 c, t dbSNP:587782627
1919 1919 c, g dbSNP:587779965
1925 1925 -, c dbSNP:267607984
1926 1926 a, g dbSNP:786203744
1928 1928 a, g dbSNP:63749982
1929 1929 g, t dbSNP:63750312
1930 1930 -, tg dbSNP:63750031
1931 1931 -, gt dbSNP:63750806
1933 1933 c, g, t dbSNP:63750508
1934 1934 a, g dbSNP:759263820
1935 1935 a, t dbSNP:786203119
1936 1936 a, c, g dbSNP:63750280
1937 1937 c, t dbSNP:28929483
1938 1938 a, c dbSNP:757766951
1940 1940 c, g dbSNP:781698416
1945 1945 g, t dbSNP:63750669
1953 1953 a, c dbSNP:63750626
1954 1954 a, g dbSNP:371776176
1956 1956 a, t dbSNP:786202663
1957 1957 c, t dbSNP:63750203
1958 1958 a, g dbSNP:61756468
1961 1961 -, gaag dbSNP:63750960
1962 1962 a, g dbSNP:778523544
1965 1965 a, t dbSNP:747805096
1968 1968 -, a dbSNP:63751038
1969 1969 -, a dbSNP:587779114
1969 1969 a, g dbSNP:771695599
1978 1978 c, g dbSNP:63750875
1979 1979 c, t dbSNP:63750279
1983 1983 -, c dbSNP:63750893
1984 1984 a, g dbSNP:267607981
1987 1987 c, t dbSNP:28929484
1988 1988 -, atgc dbSNP:730881776
1988 1988 a, g dbSNP:587779116
1989 1989 a, g, t dbSNP:1800152
1990 1990 g, t dbSNP:531276135
1993 1993 g, t dbSNP:63749946
1994 1994 a, g dbSNP:786204110
1996 1996 -, gt dbSNP:587779117
1996 1996 a, g dbSNP:776528054
1999 1999 a, g dbSNP:374840361
2005 2005 c, g dbSNP:267607982
2007 2007 a, c dbSNP:587780684
2009 2009 a, c, g dbSNP:41295290
2010 2010 c, t dbSNP:775484022
2011 2011 c, g, t dbSNP:63750078
2014 2014 a, g dbSNP:373475495
2015 2015 a, c, t dbSNP:763100088
2017 2017 a, g dbSNP:786201822
2027 2027 a, c dbSNP:267607983
2034 2034 c, t dbSNP:751939698
2035 2035 a, g dbSNP:549467183
2037 2037 a, c dbSNP:767941059
2039 2039 a, c, g dbSNP:185356145
2040 2040 c, g dbSNP:63751317
2042 2042 -, actt dbSNP:587779118
2045 2045 a, g dbSNP:200827721
2051 2051 -, at dbSNP:63750988
2052 2052 -, ta dbSNP:587779119
2054 2054 -, aaca dbSNP:587779120
2055 2055 -, a dbSNP:63751055
2056 2056 -, ca dbSNP:587779121
2056 2056 c, t dbSNP:786204321
2057 2057 -, ag dbSNP:63749976
2058 2058 -, ga dbSNP:587779122
2058 2058 a, c, g dbSNP:587780685
2058 2058 -, g dbSNP:63749929
2059 2059 a, g, t dbSNP:752241362
2064 2064 c, t dbSNP:777450803
2068 2068 -, at dbSNP:63751700
2077 2077 a, c, g dbSNP:63751668
2078 2078 a, c, g, t dbSNP:63751640
2081 2081 c, t dbSNP:41294982
2082 2082 -, c dbSNP:63751123
2082 2082 c, t dbSNP:766618212
2083 2083 a, t dbSNP:63751232
2085 2085 a, t dbSNP:587779127
2086 2086 a, g dbSNP:763690339
2087 2087 g, t dbSNP:786203126
2087 2087 -, t dbSNP:63751161
2090 2090 -, g dbSNP:63751462
2092 2092 a, c, g dbSNP:63750234
2093 2093 -, gt dbSNP:267608000
2093 2093 a, c, g dbSNP:267607996
2094 2094 c, t dbSNP:786203120
2095 2095 aaa, gcc dbSNP:587779128