Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

MYBPC3 myosin binding protein C, cardiac [Homo sapiens (human)]

Gene Symbol MYBPC3
Entrez Gene ID 4607
Full Name myosin binding protein C, cardiac
Synonyms CMD1MM, CMH4, FHC, LVNC10, MYBP-C
General protein information
Preferred Names
myosin-binding protein C, cardiac-type
myosin-binding protein C, cardiac-type
C-protein, cardiac muscle isoform
Gene Type protein-coding
Organism Homo sapiens (human)



Summary MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cardiomyopathy, familial hypertrophic, 4, 115197 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu44879 XM_011520117 PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu59134 XM_011520118 PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu27085 NM_000256 Homo sapiens myosin binding protein C, cardiac (MYBPC3), mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu44879D
Sequence Information ORF Nucleotide Sequence (Length: 3807bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product myosin-binding protein C, cardiac-type isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)89..337(+)
Misc Feature(2)98..322(+)
Misc Feature(3)536..823(+)
Misc Feature(4)596..787(+)
Misc Feature(5)1130..1384(+)
Misc Feature(6)1208..1351(+)
Misc Feature(7)1403..1660(+)
Misc Feature(8)1448..>1612(+)
Misc Feature(9)1724..1924(+)
Misc Feature(10)1997..2341(+)
Misc Feature(11)2000..2341(+)
Misc Feature(12)2351..2623(+)
Misc Feature(13)2351..2596(+)
Misc Feature(14)2597..2611(+)
Misc Feature(15)2645..2926(+)
Misc Feature(16)2645..2890(+)
Misc Feature(17)2891..2905(+)
Misc Feature(18)2978..3223(+)
Misc Feature(19)3005..3223(+)
Misc Feature(20)3233..3499(+)
Misc Feature(21)3233..3475(+)
Misc Feature(22)3476..3490(+)
Misc Feature(23)3578..3847(+)
Misc Feature(24)3629..3832(+)
Position Chain Variation Link
6 6 -, c dbSNP:768257586
9 9 c, t dbSNP:763924149
10 10 c, t dbSNP:760572113
14 14 a, g dbSNP:553644150
18 18 c, t dbSNP:767039719
31 31 c, t dbSNP:758914519
32 32 a, g dbSNP:369797789
38 38 a, g dbSNP:770669714
45 45 c, t dbSNP:762719022
46 46 a, g dbSNP:567307744
58 58 a, c, g dbSNP:397516045
66 66 c, t dbSNP:748689012
67 67 a, g dbSNP:377292092
68 68 c, g dbSNP:201278114
82 82 a, c dbSNP:746076911
88 88 c, t dbSNP:2596402
94 94 c, g dbSNP:730880136
96 96 a, g dbSNP:779049126
101 101 c, t dbSNP:730880573
104 104 c, t dbSNP:747857800
105 105 a, g, t dbSNP:374630007
109 109 a, g dbSNP:751590263
121 121 c, t dbSNP:765986295
122 122 a, c, g dbSNP:758044508
128 128 a, t dbSNP:749970304
129 129 a, g dbSNP:371140684
136 136 c, t dbSNP:761547225
137 137 a, g dbSNP:776834755
142 142 c, t dbSNP:764557472
143 143 a, g dbSNP:761079937
146 146 a, g dbSNP:536744834
148 148 c, t dbSNP:397516085
149 149 a, c, g dbSNP:730880575
153 153 -, ca dbSNP:745811346
158 158 a, c, t dbSNP:727504249
159 159 a, g dbSNP:397515885
162 162 a, c dbSNP:376646845
163 163 a, g dbSNP:754870909
172 172 g, t dbSNP:747965077
173 173 a, g dbSNP:780085131
176 176 a, c, t dbSNP:373638535
177 177 a, g dbSNP:764849803
179 179 -, tggc dbSNP:730880659
185 185 c, t dbSNP:557439091
186 186 a, g dbSNP:369205562
187 187 a, c, t dbSNP:377579620
188 188 a, g dbSNP:775837337
193 193 c, g dbSNP:767973005
200 200 a, t dbSNP:760058908
201 201 -, tca dbSNP:781207661
202 202 c, t dbSNP:774273586
203 203 a, g dbSNP:373164247
205 205 c, t dbSNP:368918487
206 206 a, g, t dbSNP:534282225
207 207 c, t dbSNP:746738538
220 220 c, t dbSNP:780012957
221 221 a, g dbSNP:397515918
227 227 -, g dbSNP:730880662
230 230 a, g dbSNP:121909375
232 232 -, agagggcacac dbSNP:397515925
234 234 -, ag dbSNP:786204324
237 237 a, g dbSNP:546345474
237 237 -, g dbSNP:730880663
239 239 a, c dbSNP:377225516
242 242 c, t dbSNP:373315466
243 243 a, g dbSNP:549239819
249 249 c, t dbSNP:753300898
250 250 a, g dbSNP:370102200
261 261 a, g dbSNP:397515945
262 262 c, g dbSNP:397515946
263 263 g, t dbSNP:11570045
270 270 -, gg dbSNP:730880362
271 271 a, c, t dbSNP:760007714
278 278 a, g dbSNP:375471260
283 283 a, g dbSNP:766359851
285 285 a, g dbSNP:730880580
290 290 a, t dbSNP:730880581
292 292 -, c dbSNP:730880664
292 292 c, g, t dbSNP:730880698
293 293 a, g dbSNP:730880700
294 294 c, gagg dbSNP:727504335
295 295 a, g dbSNP:770089112
301 301 c, t dbSNP:372502369
306 306 a, g dbSNP:569824900
312 312 c, g dbSNP:772057451
318 318 a, t dbSNP:730880583
325 325 c, t dbSNP:367990952
326 326 a, g dbSNP:778851720
335 335 g, t dbSNP:770777166
338 338 a, c dbSNP:549758428
339 339 c, t dbSNP:727504945
342 342 a, g dbSNP:777170653
345 345 c, t dbSNP:397515993
360 360 c, t dbSNP:730880610
370 370 c, g dbSNP:770853232
377 377 c, t dbSNP:749233808
378 378 c, t dbSNP:772678776
379 379 -, t dbSNP:730880721
381 381 c, t dbSNP:397516011
387 387 c, t dbSNP:730880530
388 388 -, t dbSNP:730880335
388 388 c, t dbSNP:397516017
393 393 a, c dbSNP:730880611
394 394 c, t dbSNP:786204325
395 395 a, g dbSNP:730880612
398 398 a, g, t dbSNP:727503220
405 405 -, c dbSNP:397516023
410 410 a, g dbSNP:397516025
417 417 -, c dbSNP:397516032
417 417 c, t dbSNP:551888783
418 418 a, g dbSNP:780768974
419 419 a, g dbSNP:754633960
427 427 c, t dbSNP:11570046
428 428 a, g, t dbSNP:370958401
433 433 a, g dbSNP:758903546
436 436 a, g dbSNP:750955473
457 457 c, t dbSNP:397516046
460 460 a, g dbSNP:727504318
461 461 a, g dbSNP:730880613
463 463 -, g dbSNP:771005018
465 465 c, g dbSNP:730880703
467 467 a, g dbSNP:776154213
471 471 c, g dbSNP:730880704
473 473 c, g dbSNP:730880614
474 474 c, t dbSNP:786205352
483 483 a, g dbSNP:730880705
486 486 -, gt dbSNP:397516047
489 489 a, c dbSNP:768309693
491 491 -, a dbSNP:397516049
491 491 a, c, g dbSNP:397516048
492 492 c, t dbSNP:780458215
495 495 c, t dbSNP:730880615
497 497 a, g dbSNP:397516050
501 501 a, c, t dbSNP:779493486
505 505 -, c dbSNP:730880677
505 505 c, g, t dbSNP:377520770
506 506 a, g dbSNP:397516051
508 508 -, t dbSNP:730880679
510 510 -, ac dbSNP:730880680
513 513 a, c dbSNP:756328813
514 514 -, c dbSNP:397516052
516 516 c, t dbSNP:373946195
521 521 -, c dbSNP:730880366
522 522 c, t dbSNP:730880616
526 526 c, t dbSNP:150291001
527 527 a, g dbSNP:3729986
532 532 a, g dbSNP:730880706
533 533 c, t dbSNP:193068692
534 534 a, g dbSNP:730880617
536 536 a, c dbSNP:397516053
538 538 a, g dbSNP:373133807
539 539 c, t dbSNP:730880618
547 547 c, t dbSNP:3218719
550 550 c, g dbSNP:730880619
556 556 c, t dbSNP:397516054
557 557 a, g dbSNP:569740494
558 558 c, t dbSNP:727505267
559 559 a, g dbSNP:550047739
567 567 a, g dbSNP:369683229
568 568 c, t dbSNP:778679153
572 572 a, g dbSNP:727505168
573 573 a, c, t dbSNP:113941605
576 576 -, tct dbSNP:730880722
582 582 c, g, t dbSNP:753683535
584 584 c, t dbSNP:193922385
585 585 a, g dbSNP:201012766
586 586 c, t dbSNP:368035400
587 587 a, g dbSNP:727503218
588 588 -, t dbSNP:727503217
589 589 g, t dbSNP:759249105
592 592 c, t dbSNP:11570051
593 593 a, g dbSNP:766132641
595 595 -, cgccagcctcctgaagccgc dbSNP:397516058
595 595 c, t dbSNP:371842442
596 596 a, g dbSNP:773646282
597 597 -, gc dbSNP:786204327
604 604 c, t dbSNP:368604485
606 606 -, t dbSNP:397516059
607 607 a, g dbSNP:748725922
608 608 a, c, t dbSNP:375607980
609 609 a, g dbSNP:768795353
612 612 c, t dbSNP:727503216
613 613 a, g, t dbSNP:370962887
620 620 a, g dbSNP:11570052
621 621 a, t dbSNP:397516060
623 623 a, g dbSNP:777665200
626 626 c, t dbSNP:730880622
628 628 g, t dbSNP:755983199
637 637 a, c dbSNP:375673378
641 641 -, t dbSNP:730880681
643 643 c, g dbSNP:727503215
653 653 a, g dbSNP:370554185
658 658 c, t dbSNP:762834457
659 659 a, c dbSNP:730880623
668 668 c, t dbSNP:397516061
673 673 c, t dbSNP:751125697
679 679 c, g dbSNP:202139499
685 685 c, t dbSNP:762695516
686 686 a, g dbSNP:773414747
688 688 c, t dbSNP:765678794
689 689 a, g dbSNP:762226459
691 691 c, g dbSNP:397516062
694 694 c, t dbSNP:727504858
695 695 a, g dbSNP:769167548
698 698 c, t dbSNP:397516063
699 699 a, g dbSNP:775580020
700 700 c, t dbSNP:397516064
701 701 a, g dbSNP:201098973
703 703 c, t dbSNP:777418402
704 704 a, g dbSNP:138753870
708 708 a, g dbSNP:730880707
710 710 c, g, t dbSNP:397516068
714 714 a, g dbSNP:779693951
721 721 c, t dbSNP:371331114
722 722 a, g dbSNP:397516069
724 724 a, g dbSNP:778582048
736 736 c, t dbSNP:756894628
737 737 a, g dbSNP:369300885
739 739 c, g, t dbSNP:532498780
755 755 a, c, g dbSNP:753271103
756 756 -, atcaccgatgcccagcctgccttcac dbSNP:786204329
760 760 c, t dbSNP:767913494
761 761 a, g dbSNP:3729989
764 764 c, t dbSNP:730880624
765 765 a, c dbSNP:397516070
766 766 c, t dbSNP:774316050
767 767 c, t dbSNP:771143409
768 768 a, g dbSNP:727504396
771 771 g, t dbSNP:776541959
777 777 -, t dbSNP:730880683
782 782 a, c dbSNP:730880625
794 794 c, t dbSNP:372574446
797 797 g, t dbSNP:768625454
799 799 a, c dbSNP:2857543
800 800 c, t dbSNP:397516071
801 801 a, g dbSNP:780085082
802 802 c, t dbSNP:771929829
807 807 a, t dbSNP:368588523
813 813 a, g dbSNP:727503214
827 827 a, g dbSNP:397516074
831 831 c, t dbSNP:187455402
834 834 -, t dbSNP:786204332
838 838 a, c dbSNP:766472497
840 840 c, g dbSNP:730880627
841 841 c, t dbSNP:11570058
842 842 a, g dbSNP:373730381
845 845 -, g dbSNP:786204333
854 854 c, g dbSNP:370941975
860 860 c, t dbSNP:762169683
863 863 a, g dbSNP:775337081
869 869 c, t dbSNP:397516075
870 870 a, g dbSNP:759515993
872 872 c, t dbSNP:551119259
873 873 a, g dbSNP:376461745
876 876 c, t dbSNP:748746951
877 877 a, g dbSNP:751392149
888 888 a, g dbSNP:147315081
888 888 -, g dbSNP:727503212
891 891 c, g dbSNP:375774648
896 896 c, t dbSNP:371711564
897 897 a, g dbSNP:11570060
899 899 c, t dbSNP:727504234
900 900 a, g dbSNP:761520688
905 905 a, g dbSNP:776075902
908 908 a, g dbSNP:727504523
914 914 c, t dbSNP:776238883
939 939 -, t dbSNP:730880684
941 941 a, g dbSNP:768164989
947 947 c, t dbSNP:760429280
956 956 a, t dbSNP:730880629
968 968 a, t dbSNP:397516084
969 969 a, c, t dbSNP:193922386
970 970 a, c, g dbSNP:374326087
980 980 g, t dbSNP:749867888
986 986 a, g dbSNP:780896631
993 993 a, c dbSNP:545675333
997 997 c, g, t dbSNP:369900803
998 998 a, c, g dbSNP:200119454
1001 1001 c, t dbSNP:730880708
1003 1003 a, g dbSNP:727503211
1007 1007 a, t dbSNP:765732047
1013 1013 a, c, t dbSNP:776681371
1014 1014 a, g dbSNP:34580776
1016 1016 c, t dbSNP:727503210
1030 1030 -, t dbSNP:727503209
1031 1031 a, g dbSNP:397516086
1036 1036 c, g, t dbSNP:367947846
1037 1037 a, g, t dbSNP:573916965
1040 1040 c, t dbSNP:730880630
1043 1043 a, t dbSNP:777470695
1045 1045 c, t dbSNP:397515880
1046 1046 a, g dbSNP:769830766
1052 1052 c, t dbSNP:730880631
1057 1057 c, t dbSNP:556616131
1058 1058 a, g dbSNP:397515881
1060 1060 c, t dbSNP:754469813
1061 1061 a, g dbSNP:397515882
1062 1062 a, t dbSNP:730880709
1065 1065 -, c dbSNP:730880686
1072 1072 a, g dbSNP:779704622
1074 1074 a, g dbSNP:397515883
1075 1075 c, t dbSNP:758016271
1076 1076 a, g dbSNP:397515884
1079 1079 -, cggca dbSNP:730880336
1093 1093 c, g dbSNP:375007425
1106 1106 cgcg, gc dbSNP:730880687
1107 1107 a, g dbSNP:199741162
1108 1108 a, c, t dbSNP:371308153
1109 1109 a, g dbSNP:746267533
1111 1111 a, t dbSNP:775464343
1117 1117 c, g dbSNP:730880632
1119 1119 -, aga dbSNP:775069579
1120 1120 a, g dbSNP:781216464
1121 1121 -, a dbSNP:730880723
1121 1121 a, g dbSNP:730880633
1128 1128 c, t dbSNP:778161908
1137 1137 a, g dbSNP:756633062
1138 1138 g, t dbSNP:753209030
1149 1149 c, g, t dbSNP:397515887
1157 1157 -, c dbSNP:730880688
1157 1157 a, c, t dbSNP:730880635
1160 1160 a, g dbSNP:727503208
1170 1170 c, g dbSNP:766664184
1180 1180 -, tc dbSNP:769490852
1181 1181 -, c dbSNP:759194130
1181 1181 c, t dbSNP:11570076
1182 1182 a, g dbSNP:753660871
1184 1184 c, g dbSNP:11570077
1189 1189 c, g, t dbSNP:775237084
1190 1190 a, g dbSNP:772073491
1193 1193 g, t dbSNP:397515888
1199 1199 -, g dbSNP:730880724
1205 1205 -, c dbSNP:397515889
1208 1208 -, gaactggctgaccatg dbSNP:730880689
1208 1208 g, t dbSNP:759008026
1210 1210 c, t dbSNP:377328238
1216 1216 a, g dbSNP:770549835
1217 1217 a, g dbSNP:749000345
1219 1219 a, c, g dbSNP:730880636
1225 1225 a, g, t dbSNP:397515890
1238 1238 c, t dbSNP:730880637
1247 1247 c, t dbSNP:727504329
1248 1248 a, c dbSNP:769985511
1250 1250 a, g dbSNP:727503207
1251 1251 a, t dbSNP:560140258
1255 1255 c, t dbSNP:748558425
1256 1256 a, g dbSNP:727505266
1259 1259 a, c dbSNP:730880638
1265 1265 -, ggt dbSNP:746979805
1269 1269 a, t dbSNP:774293794
1272 1272 -, tt dbSNP:397515894
1275 1275 a, g dbSNP:730880532
1283 1283 a, g dbSNP:371513491
1289 1289 a, t dbSNP:730880533
1292 1292 a, c, t dbSNP:368770848
1293 1293 a, c, g dbSNP:770030288
1301 1301 a, c dbSNP:727503206
1310 1310 c, t dbSNP:397515895
1315 1315 c, t dbSNP:746770543
1318 1318 a, g dbSNP:779873317
1319 1319 c, t dbSNP:758253767
1323 1323 a, c, t dbSNP:370412052
1324 1324 a, g dbSNP:778718628
1325 1325 a, g dbSNP:730880534
1327 1327 c, t dbSNP:200664621
1328 1328 a, g dbSNP:753321277
1330 1330 c, t dbSNP:763808974
1331 1331 a, g dbSNP:371167525
1339 1339 c, t dbSNP:190228518
1342 1342 a, g dbSNP:768065513
1345 1345 c, t dbSNP:759826878
1346 1346 a, g, t dbSNP:730880535
1347 1347 -, t dbSNP:397515896
1353 1353 a, g dbSNP:763045718
1353 1353 -, g dbSNP:730880710
1356 1356 a, g dbSNP:142317339
1357 1357 c, t dbSNP:368192024
1358 1358 a, g dbSNP:193922377
1362 1362 a, g dbSNP:779820034
1363 1363 a, g dbSNP:771832243
1367 1367 -, a dbSNP:727505152
1371 1371 c, t dbSNP:745661443
1372 1372 a, g dbSNP:727503205
1375 1375 a, g dbSNP:757182984
1380 1380 c, t dbSNP:727504279
1384 1384 g, t dbSNP:539453748
1388 1388 g, t dbSNP:786204338
1392 1392 a, c dbSNP:730880536
1394 1394 -, cc dbSNP:727503203
1394 1394 c, g dbSNP:749310275
1395 1395 -, c dbSNP:730880711
1395 1395 c, t dbSNP:397515898
1398 1398 c, t dbSNP:755631466
1400 1400 c, t dbSNP:747686377
1402 1402 c, t dbSNP:780854746
1407 1407 c, t dbSNP:370538243
1408 1408 a, g dbSNP:538072263
1409 1409 c, t dbSNP:377577698
1410 1410 a, g dbSNP:374255707
1412 1412 c, t dbSNP:758901980
1414 1414 -, c dbSNP:786204339
1418 1418 g, t dbSNP:730880537
1421 1421 a, g dbSNP:755991329
1424 1424 c, t dbSNP:730880538
1432 1432 a, g dbSNP:750861980
1434 1434 a, t dbSNP:397515899
1442 1442 c, g, t dbSNP:730880539
1446 1446 a, g dbSNP:776734314
1447 1447 -, gg dbSNP:730880642
1455 1455 c, t dbSNP:397515900
1459 1459 a, c, g dbSNP:397515901
1460 1460 c, t dbSNP:760864668
1468 1468 a, g dbSNP:587781042
1470 1470 c, t dbSNP:730880540
1471 1471 a, g dbSNP:770568659
1477 1477 a, g dbSNP:749110971
1479 1479 a, g dbSNP:773237942
1482 1482 c, t dbSNP:370285346
1483 1483 g, t dbSNP:747627648
1484 1484 c, t dbSNP:730880541
1493 1493 c, g, t dbSNP:397515902
1494 1494 a, g dbSNP:730880542
1496 1496 a, c dbSNP:771741441
1502 1502 g, t dbSNP:546002111
1504 1504 c, g, t dbSNP:35690719
1505 1505 a, g dbSNP:200625851
1506 1506 a, g, t dbSNP:397514752
1508 1508 a, g dbSNP:730880543
1509 1509 g, t dbSNP:778361492
1519 1519 c, t dbSNP:756101990
1520 1520 a, c, g, t dbSNP:397515905
1521 1521 a, g dbSNP:200411226
1524 1524 a, g dbSNP:759884209
1530 1530 a, c dbSNP:750225859
1531 1531 c, g dbSNP:397515906
1536 1536 a, c dbSNP:761672176
1540 1540 c, g dbSNP:776373836
1541 1541 c, t dbSNP:375882485
1542 1542 -, ggttc dbSNP:587782957
1542 1542 a, g, t dbSNP:397515907
1550 1550 -, aag dbSNP:727504287
1550 1550 a, t dbSNP:786204340
1555 1555 c, t dbSNP:397515908
1556 1556 a, g dbSNP:35736435
1559 1559 c, t dbSNP:730880544
1572 1572 a, c, t dbSNP:397515909
1573 1573 a, g dbSNP:771702316
1577 1577 a, g dbSNP:727503200
1580 1580 -, aac dbSNP:730880643
1581 1581 a, g dbSNP:181834806
1582 1582 c, t dbSNP:771230605
1583 1583 a, g dbSNP:730880545
1584 1584 -, agg dbSNP:786204341
1591 1591 a, g dbSNP:372499440
1594 1594 g, t dbSNP:778105166
1600 1600 c, t dbSNP:367915627
1601 1601 a, g dbSNP:11570082
1602 1602 c, t dbSNP:370362589
1603 1603 a, g dbSNP:376041792
1612 1612 g, t dbSNP:397515910
1615 1615 a, g, t dbSNP:766721220
1617 1617 -, cact dbSNP:730880712
1617 1617 c, t dbSNP:761466191
1623 1623 c, g dbSNP:397515911
1626 1626 a, g dbSNP:753696015
1627 1627 c, t dbSNP:763905291
1628 1628 a, c, g dbSNP:397515912
1630 1630 a, g dbSNP:727503199
1632 1632 a, g, t dbSNP:730880547
1632 1632 -, g dbSNP:730880640
1636 1636 c, g dbSNP:773947559
1638 1638 c, t dbSNP:374349666
1639 1639 a, g dbSNP:370945942
1641 1641 c, t dbSNP:730880548
1645 1645 a, t dbSNP:200224422
1652 1652 a, g dbSNP:770186287
1660 1660 a, c, g dbSNP:781764759
1661 1661 c, g dbSNP:121909374
1665 1665 -, a dbSNP:727504248
1670 1670 a, c dbSNP:377163678
1676 1676 a, g dbSNP:752523427
1676 1676 -, g dbSNP:757777349
1678 1678 -, gt dbSNP:398123279
1678 1678 a, g dbSNP:397515915
1689 1689 -, tcgca dbSNP:730880644
1690 1690 c, t dbSNP:767414501
1691 1691 g, t dbSNP:727504887
1701 1701 c, t dbSNP:730880692
1706 1706 a, g dbSNP:730880693
1707 1707 a, g dbSNP:730880549
1708 1708 c, t dbSNP:751052593
1709 1709 a, g dbSNP:727503198
1714 1714 a, g dbSNP:762369686
1715 1715 c, g dbSNP:750030159
1715 1715 -, g dbSNP:727504366
1721 1721 a, g dbSNP:397515919
1722 1722 a, c, t dbSNP:730880694
1723 1723 a, g dbSNP:762228885
1726 1726 a, g dbSNP:777173469
1730 1730 a, t dbSNP:397515920
1733 1733 c, t dbSNP:730880695
1736 1736 -, ga dbSNP:727503197
1737 1737 -, ag dbSNP:730880645
1756 1756 a, g, t dbSNP:397515921
1757 1757 a, c, t dbSNP:61897383
1758 1758 a, g dbSNP:397515922
1763 1763 a, g dbSNP:772132916
1768 1768 a, g dbSNP:730880546
1769 1769 c, t dbSNP:745957052
1771 1771 -, g dbSNP:730880646
1795 1795 c, t dbSNP:727505203
1796 1796 a, g dbSNP:730880526
1801 1801 c, t dbSNP:747918558
1803 1803 a, g dbSNP:397515923
1805 1805 a, g dbSNP:754904833
1810 1810 g, t dbSNP:754902004
1813 1813 -, gt dbSNP:730880713
1813 1813 a, g dbSNP:727503196
1815 1815 c, t dbSNP:397515924
1820 1820 a, g dbSNP:730880550
1822 1822 c, t dbSNP:572227730
1823 1823 a, g dbSNP:199728019
1826 1826 c, t dbSNP:201596087
1827 1827 a, g dbSNP:727503195
1828 1828 c, g dbSNP:772488845
1829 1829 -, g dbSNP:730880647
1837 1837 -, a dbSNP:397515926
1840 1840 a, g dbSNP:397515927
1842 1842 c, t dbSNP:730880551
1843 1843 a, c dbSNP:566461224
1843 1843 -, c dbSNP:730880648
1845 1845 c, t dbSNP:397515928
1846 1846 g, t dbSNP:774348756
1849 1849 c, t dbSNP:397515929
1850 1850 -, cg dbSNP:764743402
1850 1850 a, g dbSNP:376736293
1851 1851 -, acg dbSNP:397515930
1851 1851 a, g dbSNP:372371774
1852 1852 c, t dbSNP:768380030
1853 1853 a, g dbSNP:368482358
1857 1857 c, t dbSNP:375196922
1858 1858 a, g dbSNP:758306575
1859 1859 c, t dbSNP:730880552
1860 1860 c, g dbSNP:778623429
1863 1863 c, t dbSNP:730880553
1864 1864 c, g, t dbSNP:535853707
1865 1865 a, c, g dbSNP:371564200
1866 1866 a, t dbSNP:730880554
1867 1867 c, t dbSNP:768049705
1868 1868 a, g dbSNP:730880555
1870 1870 a, g dbSNP:760023583
1875 1875 -, a dbSNP:730880649
1878 1878 a, g dbSNP:727503194
1879 1879 c, t dbSNP:774488435
1892 1892 a, g dbSNP:200352299
1894 1894 a, g dbSNP:763030622
1896 1896 g, t dbSNP:730880556
1897 1897 c, g dbSNP:773371075
1900 1900 -, c dbSNP:397515931
1900 1900 c, t dbSNP:193922378
1904 1904 a, t dbSNP:746786287
1906 1906 a, c, t dbSNP:397515932
1908 1908 a, g dbSNP:772032697
1923 1923 c, t dbSNP:730880137
1926 1926 a, t dbSNP:745859544
1929 1929 -, t dbSNP:397515933
1932 1932 -, t dbSNP:397515934
1951 1951 c, t dbSNP:377227442
1952 1952 a, g dbSNP:780907679
1956 1956 c, t dbSNP:755244836
1961 1961 c, t dbSNP:727504293
1969 1969 c, t dbSNP:768391385
1971 1971 c, t dbSNP:397515938
1972 1972 c, t dbSNP:727503193
1975 1975 c, g dbSNP:780452445
1979 1979 c, t dbSNP:758901926
1981 1981 c, t dbSNP:750861887
1984 1984 a, c, g dbSNP:757244311
1987 1987 c, g dbSNP:727504250
1992 1992 c, g dbSNP:753992239
1997 1997 c, g, t dbSNP:397515939
1998 1998 a, g dbSNP:1800565
2000 2000 a, c dbSNP:374447249
2005 2005 a, g dbSNP:397515940
2008 2008 c, t dbSNP:751397614
2010 2010 c, t dbSNP:766213616
2013 2013 c, t dbSNP:397515941
2015 2015 a, g, t dbSNP:730880560
2022 2022 c, t dbSNP:772970643
2026 2026 a, t dbSNP:375467797
2036 2036 a, ct, g dbSNP:727503192
2036 2036 a, c dbSNP:761194404
2039 2039 c, t dbSNP:730880561
2040 2040 a, g dbSNP:727503191
2047 2047 c, t dbSNP:558051480
2050 2050 ccct, gg dbSNP:397515943
2053 2053 c, t dbSNP:775127671
2055 2055 c, t dbSNP:772364751
2056 2056 c, t dbSNP:746263346
2067 2067 c, t dbSNP:786204345
2070 2070 a, c dbSNP:779258481
2071 2071 c, t dbSNP:757832991
2072 2072 c, t dbSNP:372493586
2074 2074 a, c dbSNP:749317445
2077 2077 -, t dbSNP:397515944
2078 2078 a, g dbSNP:777978931
2085 2085 a, g dbSNP:397515942
2093 2093 a, c, g dbSNP:367992212
2100 2100 a, c, t dbSNP:3729946
2101 2101 a, g dbSNP:758224257
2111 2111 a, c dbSNP:730880562
2114 2114 g, t dbSNP:771753579
2119 2119 a, g dbSNP:756589409
2133 2133 -, c dbSNP:397515947
2136 2136 a, t dbSNP:746198398
2149 2149 c, t dbSNP:547477069
2150 2150 -, a dbSNP:397515948
2156 2156 a, g dbSNP:774838273
2161 2161 c, t dbSNP:113658284
2165 2165 c, g dbSNP:371020684
2171 2171 g, t dbSNP:749740197
2172 2172 c, t dbSNP:778160438
2191 2191 a, g dbSNP:781477048
2198 2198 a, t dbSNP:768993308
2200 2200 a, c, t dbSNP:397515951
2200 2200 -, c dbSNP:397515952
2201 2201 a, c, g dbSNP:730880696
2207 2207 c, t dbSNP:200399246
2208 2208 a, g dbSNP:756102881
2213 2213 c, t dbSNP:752200396
2214 2214 a, g dbSNP:397515953
2215 2215 c, t dbSNP:370676057
2216 2216 a, g dbSNP:564378953
2219 2219 g, t dbSNP:397515954
2224 2224 c, t dbSNP:765983279
2225 2225 a, c dbSNP:763341155
2226 2226 c, t dbSNP:773757669
2231 2231 g, t dbSNP:770408214
2233 2233 c, t dbSNP:397515955
2234 2234 a, c, t dbSNP:397515956
2235 2235 a, g, t dbSNP:534345197
2237 2237 a, g dbSNP:747081382
2239 2239 c, t dbSNP:780282339
2247 2247 c, t dbSNP:199893357
2248 2248 a, g dbSNP:113265977
2251 2251 c, t dbSNP:777613325
2254 2254 g, t dbSNP:786204348
2258 2258 -, g dbSNP:730880650
2271 2271 a, g dbSNP:727503190
2278 2278 c, t dbSNP:755910458
2279 2279 a, g dbSNP:730880563
2286 2286 c, t dbSNP:727503189
2287 2287 a, g dbSNP:373338699
2295 2295 -, t dbSNP:774521272
2304 2304 -, c dbSNP:730880651
2306 2306 a, g dbSNP:369790992
2308 2308 a, g dbSNP:766029254
2311 2311 c, t dbSNP:397515957
2312 2312 a, g dbSNP:750810342
2314 2314 a, g dbSNP:765629179
2315 2315 c, g dbSNP:762280284
2325 2325 a, g dbSNP:730880527
2326 2326 c, t dbSNP:777228369
2332 2332 a, t dbSNP:764539455
2337 2337 a, g dbSNP:760786216
2344 2344 c, t dbSNP:775491112
2345 2345 a, g dbSNP:36211723
2347 2347 c, t dbSNP:397515959
2348 2348 -, g dbSNP:397515960
2348 2348 a, g dbSNP:371488302
2349 2349 c, t dbSNP:397515961
2356 2356 c, t dbSNP:397515962
2357 2357 a, g dbSNP:368104687
2361 2361 c, g dbSNP:730880564
2367 2367 c, t dbSNP:759631792
2373 2373 a, g dbSNP:774512738
2374 2374 g, t dbSNP:771179191
2376 2376 g, t dbSNP:747912257
2382 2382 a, g dbSNP:776351251
2383 2383 c, t dbSNP:768638405
2389 2389 a, g dbSNP:746858516
2400 2400 g, t dbSNP:780056346
2409 2409 a, g dbSNP:757934210
2410 2410 -, g dbSNP:397515963
2411 2411 c, g, t dbSNP:187830361
2414 2414 c, g dbSNP:778678513
2418 2418 c, t dbSNP:730880565
2419 2419 -, g dbSNP:730880714
2428 2428 a, c, t dbSNP:727504864
2429 2429 a, g dbSNP:764297991
2431 2431 -, t dbSNP:730880341
2434 2434 c, t dbSNP:756512665
2435 2435 a, g dbSNP:727504574
2446 2446 a, c dbSNP:202088839
2447 2447 a, c dbSNP:3729950
2451 2451 a, g dbSNP:730880566
2463 2463 a, g dbSNP:766382260
2466 2466 a, g, t dbSNP:375675796
2472 2472 a, g dbSNP:786204350
2473 2473 g, t dbSNP:727504251
2474 2474 a, t dbSNP:727504252
2476 2476 c, g dbSNP:727505264
2478 2478 -, aga dbSNP:727504288
2480 2480 -, cga dbSNP:746234586
2486 2486 c, t dbSNP:727503188
2487 2487 a, c, g dbSNP:397515964
2491 2491 a, g dbSNP:397515965
2492 2492 -, atgcg dbSNP:730880652
2495 2495 c, t dbSNP:775404728
2496 2496 a, c, g dbSNP:2856655
2497 2497 a, g dbSNP:532996422
2507 2507 a, g dbSNP:774442478
2516 2516 a, c dbSNP:375322174
2519 2519 c, g dbSNP:770514536
2521 2521 a, g dbSNP:765583270
2524 2524 g, t dbSNP:201040413
2526 2526 a, g dbSNP:769531658
2527 2527 -, t dbSNP:397515966
2528 2528 c, t dbSNP:748443032
2534 2534 a, g dbSNP:199865688
2535 2535 c, t dbSNP:3729952
2536 2536 a, g dbSNP:397515967
2537 2537 c, t dbSNP:752007810
2538 2538 a, g dbSNP:540988604
2539 2539 g, t dbSNP:758371979
2540 2540 a, c, t dbSNP:765356720
2541 2541 a, g, t dbSNP:527305885
2542 2542 c, t dbSNP:561942028
2548 2548 -, c dbSNP:730880653
2548 2548 c, t dbSNP:542181308
2549 2549 a, c, g dbSNP:397515969
2554 2554 -, cgtggtgtacgagatgcgcgtc dbSNP:727503187
2554 2554 c, t dbSNP:370561202
2555 2555 a, g dbSNP:376936056
2561 2561 -, t dbSNP:397515970
2562 2562 a, g dbSNP:397515971
2563 2563 c, t dbSNP:373792537
2564 2564 a, g dbSNP:730880567
2565 2565 -, agatgcgcg dbSNP:397515972
2569 2569 -, gcgcgtc dbSNP:730880654
2570 2570 c, g, t dbSNP:727504345
2571 2571 -, gcgtc dbSNP:397515973
2571 2571 a, c, g dbSNP:730880568
2573 2573 a, g dbSNP:747774791
2574 2574 a, t dbSNP:193922379
2575 2575 c, g dbSNP:776282342
2576 2576 c, t dbSNP:768963157
2578 2578 a, c, g dbSNP:397515974
2579 2579 a, g dbSNP:747407752
2580 2580 -, c dbSNP:730880715
2580 2580 c, g, t dbSNP:730880569
2581 2581 a, g dbSNP:369904619
2583 2583 c, t dbSNP:745922957
2584 2584 c, t dbSNP:3729953
2586 2586 a, t dbSNP:730880570
2588 2588 a, g dbSNP:730880571
2589 2589 c, t dbSNP:774172488
2592 2592 -, t dbSNP:752104988
2593 2593 cg, tct dbSNP:397515975
2593 2593 -, c dbSNP:727503186
2593 2593 c, t dbSNP:754062873
2594 2594 a, g, t dbSNP:397515976
2595 2595 -, g dbSNP:397515977
2597 2597 a, g, t dbSNP:373171036
2599 2599 a, g dbSNP:730880572
2602 2602 c, g dbSNP:763010875
2605 2605 g, t dbSNP:773032022
2607 2607 c, t dbSNP:764750484
2610 2610 a, g dbSNP:727503185
2613 2613 c, t dbSNP:761338253
2623 2623 a, g dbSNP:776229039
2635 2635 c, t dbSNP:767998170
2636 2636 a, g dbSNP:768339148
2638 2638 c, t dbSNP:11570097
2639 2639 a, g dbSNP:775890771
2641 2641 a, tc dbSNP:727504371
2641 2641 -, t dbSNP:730880655
2647 2647 -, c dbSNP:397515979
2647 2647 -, c dbSNP:730880656
2650 2650 c, t dbSNP:531228202
2651 2651 a, g dbSNP:190765116
2655 2655 a, c, t dbSNP:371401403
2658 2658 c, t dbSNP:759847861
2661 2661 a, t dbSNP:774889182
2669 2669 a, g dbSNP:730880574
2677 2677 c, t dbSNP:397515980
2678 2678 a, g dbSNP:727504360
2691 2691 c, t dbSNP:397515981
2692 2692 a, g dbSNP:769996102
2705 2705 g, t dbSNP:748326848
2707 2707 a, g dbSNP:397515982
2708 2708 c, t dbSNP:727504418
2709 2709 a, g dbSNP:727504378
2713 2713 a, c, g dbSNP:559961809
2719 2719 g, t dbSNP:369289966
2720 2720 c, t dbSNP:374976635
2721 2721 a, g dbSNP:372628478
2723 2723 a, g dbSNP:35078470
2730 2730 c, t dbSNP:752354801
2739 2739 c, t dbSNP:767113733
2746 2746 -, ctacagcgtgg dbSNP:730880657
2751 2751 a, g dbSNP:397515983
2752 2752 c, t dbSNP:759920601
2753 2753 a, g dbSNP:774634021
2760 2760 a, g dbSNP:397515984
2765 2765 a, c dbSNP:397515985
2774 2774 -, t dbSNP:730880658
2776 2776 -, c dbSNP:730880660
2781 2781 -, a dbSNP:730880661
2784 2784 a, g dbSNP:727504349
2785 2785 a, g dbSNP:730880576
2790 2790 -, g dbSNP:34114081
2795 2795 c, t dbSNP:767182632
2798 2798 c, g dbSNP:367729718
2802 2802 a, g dbSNP:751224775
2806 2806 a, g dbSNP:577575638
2808 2808 c, t dbSNP:200406864
2817 2817 -, ca dbSNP:727504265
2820 2820 c, t dbSNP:773819168
2821 2821 a, c, g dbSNP:372510974
2829 2829 -, t dbSNP:730880716
2837 2837 c, g, t dbSNP:367980215
2844 2844 a, c, t dbSNP:374946555
2845 2845 a, g dbSNP:370530334
2849 2849 g, t dbSNP:556390274
2852 2852 c, t dbSNP:534366414
2859 2859 c, t dbSNP:575117255
2864 2864 c, t dbSNP:387907267
2865 2865 a, g dbSNP:397515986
2870 2870 -, cg dbSNP:397515987
2870 2870 c, t dbSNP:727503183
2875 2875 a, g dbSNP:376858768
2876 2876 a, c dbSNP:397515988
2877 2877 a, g dbSNP:754525416
2878 2878 a, c dbSNP:751120827
2880 2880 a, c dbSNP:121909376
2883 2883 -, t dbSNP:786204352
2883 2883 c, t dbSNP:766165160
2886 2886 c, t dbSNP:730880577
2891 2891 c, g dbSNP:554694434
2893 2893 g, t dbSNP:397515989
2897 2897 a, g dbSNP:373744177
2901 2901 -, ct dbSNP:397515990
2907 2907 c, g dbSNP:193922380
2910 2910 c, t dbSNP:376504548
2912 2912 -, ac dbSNP:727503182
2913 2913 c, t dbSNP:730880697
2914 2914 a, g dbSNP:727503181
2919 2919 c, t dbSNP:373056282
2920 2920 a, g dbSNP:568935618
2921 2921 c, g dbSNP:772327857
2923 2923 a, g dbSNP:369685402
2928 2928 c, t dbSNP:773053868
2930 2930 c, t dbSNP:730880578
2931 2931 a, g dbSNP:769631967
2934 2934 a, t dbSNP:730880579
2941 2941 c, g dbSNP:747974933
2942 2942 c, t dbSNP:397515992
2945 2945 c, t dbSNP:730880138
2946 2946 a, g dbSNP:727504346
2951 2951 c, t dbSNP:193922382
2952 2952 a, g dbSNP:761696555
2957 2957 c, t dbSNP:727503180
2975 2975 c, t dbSNP:397515994
2976 2976 a, g dbSNP:727503179
2979 2979 a, c dbSNP:730880582
2980 2980 -, gacca dbSNP:397515995
2990 2990 a, t dbSNP:727504423
2998 2998 c, t dbSNP:761700877
2999 2999 a, g dbSNP:779781718
3000 3000 g, t dbSNP:727504942
3002 3002 g, t dbSNP:727503178
3005 3005 a, c dbSNP:776100156
3017 3017 c, t dbSNP:375776406
3019 3019 c, t dbSNP:745460535
3021 3021 a, t dbSNP:778651716
3029 3029 c, g, t dbSNP:11570112
3030 3030 a, g dbSNP:727503177
3034 3034 c, t dbSNP:377283955
3040 3040 c, t dbSNP:397515996
3041 3041 c, t dbSNP:3729799
3042 3042 a, g dbSNP:727504235
3046 3046 g, t dbSNP:749611054
3054 3054 a, c dbSNP:778132423
3056 3056 c, t dbSNP:730880585
3058 3058 a, g dbSNP:730880701
3066 3066 -, ag dbSNP:730880665
3068 3068 a, g dbSNP:756480912
3070 3070 a, g dbSNP:748601708
3071 3071 c, t dbSNP:730880586
3077 3077 -, c dbSNP:397515997
3080 3080 a, g dbSNP:781685082
3085 3085 c, t dbSNP:397515998
3086 3086 a, g dbSNP:368180702
3088 3088 a, g dbSNP:375552602
3089 3089 c, g dbSNP:372003333
3094 3094 c, g dbSNP:750618688
3101 3101 c, t dbSNP:397515999
3102 3102 a, c, g dbSNP:397516000
3104 3104 a, g dbSNP:775530483
3105 3105 -, a dbSNP:397516001
3109 3109 a, c dbSNP:767605155
3116 3116 aa, g dbSNP:730880666
3116 3116 c, g dbSNP:759102022
3120 3120 c, g, t dbSNP:397516002
3123 3123 a, t dbSNP:730880587
3124 3124 c, t dbSNP:201515977
3126 3126 -, tgttcatccgggc dbSNP:727503175
3126 3126 c, t dbSNP:730880588
3127 3127 a, g, t dbSNP:770351760
3134 3134 c, t dbSNP:748909815
3135 3135 a, g dbSNP:397516003
3139 3139 c, t dbSNP:200663253
3140 3140 a, g dbSNP:552505566
3142 3142 a, t dbSNP:748548738
3143 3143 c, t dbSNP:61729664
3144 3144 a, g dbSNP:374255381
3145 3145 c, g dbSNP:747059136
3146 3146 c, g, t dbSNP:758421775
3147 3147 a, g dbSNP:750609594
3148 3148 c, t dbSNP:765589466
3149 3149 a, g dbSNP:370223247
3150 3150 a, t dbSNP:752595474
3153 3153 a, g dbSNP:368633238
3155 3155 g, t dbSNP:730880139
3159 3159 a, g dbSNP:759450911
3160 3160 c, t dbSNP:374626656
3164 3164 a, c, t dbSNP:762396429
3166 3166 a, c, t dbSNP:573821685
3174 3174 c, t dbSNP:371061770
3175 3175 a, g dbSNP:762154672
3179 3179 c, t dbSNP:11570113
3180 3180 a, g dbSNP:769018051
3184 3184 a, t dbSNP:747495607
3185 3185 a, g dbSNP:780449220
3189 3189 a, g dbSNP:772151277
3191 3191 a, g dbSNP:730880589
3202 3202 a, g dbSNP:779257107
3203 3203 -, g dbSNP:727503174
3205 3205 -, c dbSNP:760491068
3205 3205 c, t dbSNP:373208282
3206 3206 a, g dbSNP:786204355
3207 3207 c, t dbSNP:754115924
3208 3208 a, g dbSNP:397516004
3212 3212 c, g dbSNP:754747269
3218 3218 c, t dbSNP:397516005
3227 3227 a, g dbSNP:727505191
3229 3229 -, c dbSNP:397516007
3235 3235 a, g dbSNP:756786807
3253 3253 a, c dbSNP:753449535
3254 3254 -, c dbSNP:730880669
3254 3254 -, c dbSNP:730880668
3254 3254 c, t dbSNP:368973872
3255 3255 a, g dbSNP:376598916
3258 3258 c, t dbSNP:775777449
3260 3260 a, g dbSNP:767927162
3261 3261 c, g dbSNP:150786409
3262 3262 g, t dbSNP:374289617
3263 3263 -, t dbSNP:397516008
3264 3264 a, g dbSNP:730880140
3265 3265 c, t dbSNP:369999866
3266 3266 a, g, t dbSNP:397516009
3269 3269 c, t dbSNP:773543130
3270 3270 a, g dbSNP:397516006
3279 3279 a, c dbSNP:746818740
3290 3290 c, g, t dbSNP:397516010
3294 3294 a, g dbSNP:779650200
3301 3301 a, t dbSNP:758229677
3304 3304 a, c dbSNP:745761062
3311 3311 a, g dbSNP:778853122
3313 3313 c, t dbSNP:376344765
3314 3314 g, t dbSNP:727503173
3316 3316 c, t dbSNP:36212064
3318 3318 a, t dbSNP:397516012
3321 3321 c, t dbSNP:755653624
3322 3322 a, c, g dbSNP:367927327
3323 3323 a, g, t dbSNP:121909377
3325 3325 a, g dbSNP:1052373
3325 3325 -, g dbSNP:727503172
3330 3330 a, g, t dbSNP:397516013
3331 3331 g, t dbSNP:767039057
3334 3334 -, g dbSNP:397516014
3334 3334 a, g dbSNP:371301665
3335 3335 a, t dbSNP:773230208
3336 3336 a, t dbSNP:769925144
3339 3339 -, ca dbSNP:730880671
3339 3339 -, c dbSNP:730880670
3340 3340 a, g dbSNP:748263197
3342 3342 a, t dbSNP:730880590
3345 3345 a, c dbSNP:730880591
3346 3346 a, c, g dbSNP:185428948
3351 3351 c, g dbSNP:786204356
3352 3352 a, c, t dbSNP:200372325
3353 3353 a, g dbSNP:377106864
3358 3358 -, g dbSNP:730880672
3360 3360 -, aga dbSNP:767318190
3360 3360 a, c dbSNP:397516015
3361 3361 c, g dbSNP:748794011
3363 3363 c, t dbSNP:397516016
3364 3364 a, c dbSNP:777087155
3364 3364 -, c dbSNP:730880719
3372 3372 -, agtg dbSNP:730880337
3372 3372 a, g dbSNP:727504276
3374 3374 -, ggt dbSNP:730880673
3377 3377 -, acc dbSNP:763160213
3379 3379 c, t dbSNP:749130484
3380 3380 a, g dbSNP:531189495
3383 3383 g, t dbSNP:370952321
3395 3395 c, t dbSNP:368721523
3398 3398 c, t dbSNP:747738308
3399 3399 a, g dbSNP:397516018
3400 3400 c, t dbSNP:754741486
3408 3408 a, g dbSNP:751258646
3409 3409 a, c, t dbSNP:727504289
3410 3410 a, g, t dbSNP:121909378
3420 3420 a, c dbSNP:765817791
3421 3421 c, g dbSNP:375116558
3429 3429 c, t dbSNP:370890951
3433 3433 c, t dbSNP:764298445
3444 3444 -, act dbSNP:730880674
3445 3445 a, c, t dbSNP:193922383
3449 3449 c, t dbSNP:377171707
3450 3450 a, c, g dbSNP:187705120
3451 3451 c, t dbSNP:753671465
3452 3452 a, g dbSNP:373519667
3463 3463 a, g dbSNP:769827229
3468 3468 c, t dbSNP:730880529
3470 3470 a, g dbSNP:747606711
3479 3479 a, c, g dbSNP:370658083
3486 3486 a, g dbSNP:746613719
3489 3489 c, t dbSNP:779884363
3491 3491 g, t dbSNP:758660149
3494 3494 a, t dbSNP:746297609
3498 3498 c, t dbSNP:779279057
3500 3500 a, g dbSNP:377352427
3504 3504 -, a dbSNP:730880720
3506 3506 c, g dbSNP:727505286
3507 3507 c, t dbSNP:373304680
3509 3509 -, gtctttatcc dbSNP:730880675
3509 3509 a, g dbSNP:542350927
3513 3513 -, tt dbSNP:727504321
3516 3516 -, ttat dbSNP:397516019
3517 3517 c, t dbSNP:756214979
3522 3522 a, g dbSNP:370040023
3523 3523 a, t dbSNP:786204358
3529 3529 c, t dbSNP:779273875
3535 3535 c, g dbSNP:373620343
3547 3547 c, t dbSNP:772168796
3549 3549 a, g dbSNP:749752972
3555 3555 -, agg dbSNP:781641320
3560 3560 c, g dbSNP:778289016
3571 3571 c, t dbSNP:756160183
3572 3572 a, g dbSNP:199669878
3578 3578 c, g dbSNP:730880593
3584 3584 c, t dbSNP:786204359
3585 3585 g, t dbSNP:397516024
3590 3590 c, t dbSNP:730880699
3595 3595 c, g dbSNP:577832590
3605 3605 c, t dbSNP:755160084
3606 3606 a, g, t dbSNP:117354682
3609 3609 c, t dbSNP:761545914
3610 3610 a, g dbSNP:371488508
3615 3615 c, t dbSNP:546744563
3616 3616 c, t dbSNP:541204647
3617 3617 a, g dbSNP:397516026
3618 3618 c, t dbSNP:730880594
3619 3619 a, g dbSNP:771490490
3621 3621 g, t dbSNP:730880595
3622 3622 a, c dbSNP:397516027
3636 3636 c, t dbSNP:397516028
3637 3637 -, ctgctgtgct dbSNP:727504271
3642 3642 a, g dbSNP:727503170
3648 3648 c, t dbSNP:786205470
3650 3650 c, t dbSNP:727503171
3651 3651 a, g dbSNP:730880596
3652 3652 a, g dbSNP:771292799
3657 3657 g, t dbSNP:749697983
3661 3661 -, c dbSNP:397516029
3661 3661 -, c dbSNP:397516030
3678 3678 a, g dbSNP:730880597
3679 3679 a, g dbSNP:368765949
3681 3681 -, t dbSNP:730880361
3688 3688 c, t dbSNP:528649058
3691 3691 c, t dbSNP:374755212
3694 3694 g, t dbSNP:770157084
3701 3701 g, t dbSNP:730880598
3704 3704 a, g dbSNP:748603864
3705 3705 a, g dbSNP:372821359
3707 3707 a, g dbSNP:768751160
3709 3709 c, t dbSNP:368221517
3713 3713 c, t dbSNP:397516033
3714 3714 a, g, t dbSNP:397516034
3716 3716 a, t dbSNP:730880599
3719 3719 c, t dbSNP:201312636
3720 3720 a, c, g dbSNP:528940575
3722 3722 a, g dbSNP:727503169
3727 3727 -, ca dbSNP:727504390
3731 3731 a, t dbSNP:397516035
3734 3734 c, t dbSNP:397516037
3736 3736 a, g dbSNP:200162906
3742 3742 a, g dbSNP:397516036
3745 3745 a, g dbSNP:767400149
3746 3746 a, c dbSNP:727503168
3750 3750 c, t dbSNP:730880702
3752 3752 a, g dbSNP:267602904
3757 3757 c, t dbSNP:751092574
3763 3763 g, t dbSNP:778267366
3769 3769 a, c dbSNP:730880600
3772 3772 -, c dbSNP:397516038
3774 3774 c, t dbSNP:786204361
3778 3778 c, t dbSNP:543376073
3779 3779 a, g dbSNP:202147520
3781 3781 -, gggcatctatgtctg dbSNP:730880676
3783 3783 g, t dbSNP:727504259
3784 3784 c, t dbSNP:772872595
3787 3787 c, g dbSNP:770102135
3788 3788 c, t dbSNP:730880601
3789 3789 a, g dbSNP:730880602
3790 3790 c, g, t dbSNP:397516039
3793 3793 c, g dbSNP:374760003
3796 3796 -, gggggcatctatgtctgc dbSNP:193922384
3799 3799 a, g dbSNP:769101292
3800 3800 a, g dbSNP:727503167
3800 3800 -, g dbSNP:786204362
3801 3801 a, c dbSNP:727504722
3804 3804 -, cca dbSNP:397516040
3804 3804 c, t dbSNP:775370325
3808 3808 a, c dbSNP:730880603
3810 3810 g, t dbSNP:730880604
3812 3812 c, t dbSNP:730880605
3813 3813 -, a dbSNP:727503166
3814 3814 a, c, g dbSNP:746042492
3816 3816 a, g dbSNP:730880606
3817 3817 c, t dbSNP:779312310
3818 3818 a, g dbSNP:730880141
3824 3824 c, t dbSNP:370338674
3825 3825 a, g dbSNP:781180230
3828 3828 a, g, t dbSNP:397514751
3830 3830 a, g dbSNP:751527360
3831 3831 a, t dbSNP:730880607
3833 3833 c, t dbSNP:730880608
3834 3834 a, g dbSNP:397516041
3836 3836 c, t dbSNP:765825263
3837 3837 -, gcc dbSNP:727504933
3837 3837 a, g dbSNP:730880142
3838 3838 c, t dbSNP:541377415
3840 3840 c, t dbSNP:786204363
3848 3848 c, t dbSNP:397516042
3849 3849 a, g dbSNP:762225417
3850 3850 a, g dbSNP:776927697
3851 3851 a, g dbSNP:730880609
3853 3853 a, g dbSNP:776112819
3855 3855 c, t dbSNP:369184972
3862 3862 a, g dbSNP:727504380
3868 3868 -, ctggctcctgg dbSNP:727504359
3868 3868 a, c, t dbSNP:557198352
3871 3871 g, t dbSNP:774501793
3873 3873 c, t dbSNP:771053385
3880 3880 a, g dbSNP:763036348
3882 3882 c, t dbSNP:773513675
3884 3884 a, g dbSNP:768303629
3886 3886 a, c dbSNP:746869742
3897 3897 a, g dbSNP:752327972
3902 3902 c, t dbSNP:148237662
3922 3922 c, t dbSNP:764002145
3931 3931 a, g dbSNP:11570120
3968 3968 a, g dbSNP:755799319
3975 3975 g, t dbSNP:117960173
3981 3981 c, t dbSNP:764758393
3989 3989 a, g dbSNP:549519453
3990 3990 c, t dbSNP:752355863
3991 3991 a, g dbSNP:767296899
3993 3993 c, t dbSNP:570058149
4002 4002 a, g dbSNP:569710158
4022 4022 a, g dbSNP:549643481
4037 4037 c, t dbSNP:759054956
4092 4092 -, a dbSNP:376645369
4098 4098 a, g dbSNP:11570121
4128 4128 a, g dbSNP:564117422
4129 4129 a, c dbSNP:773912126
4182 4182 a, g dbSNP:541031071
4198 4198 c, t dbSNP:527543611

Target ORF information:

RefSeq Version XM_011520117
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59134D
Sequence Information ORF Nucleotide Sequence (Length: 3744bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product myosin-binding protein C, cardiac-type isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)89..337(+)
Misc Feature(2)98..322(+)
Misc Feature(3)536..823(+)
Misc Feature(4)596..787(+)
Misc Feature(5)1148..1402(+)
Misc Feature(6)1226..1369(+)
Misc Feature(7)1421..1678(+)
Misc Feature(8)1466..>1630(+)
Misc Feature(9)1742..1942(+)
Misc Feature(10)2015..2278(+)
Misc Feature(11)2018..2278(+)
Misc Feature(12)2288..2560(+)
Misc Feature(13)2288..2533(+)
Misc Feature(14)2534..2548(+)
Misc Feature(15)2582..2863(+)
Misc Feature(16)2582..2827(+)
Misc Feature(17)2828..2842(+)
Misc Feature(18)2915..3160(+)
Misc Feature(19)2942..3160(+)
Misc Feature(20)3170..3436(+)
Misc Feature(21)3170..3412(+)
Misc Feature(22)3413..3427(+)
Misc Feature(23)3515..3784(+)
Misc Feature(24)3566..3769(+)
Position Chain Variation Link
6 6 -, c dbSNP:768257586
9 9 c, t dbSNP:763924149
10 10 c, t dbSNP:760572113
14 14 a, g dbSNP:553644150
18 18 c, t dbSNP:767039719
31 31 c, t dbSNP:758914519
32 32 a, g dbSNP:369797789
38 38 a, g dbSNP:770669714
45 45 c, t dbSNP:762719022
46 46 a, g dbSNP:567307744
58 58 a, c, g dbSNP:397516045
66 66 c, t dbSNP:748689012
67 67 a, g dbSNP:377292092
68 68 c, g dbSNP:201278114
82 82 a, c dbSNP:746076911
88 88 c, t dbSNP:2596402
94 94 c, g dbSNP:730880136
96 96 a, g dbSNP:779049126
101 101 c, t dbSNP:730880573
104 104 c, t dbSNP:747857800
105 105 a, g, t dbSNP:374630007
109 109 a, g dbSNP:751590263
121 121 c, t dbSNP:765986295
122 122 a, c, g dbSNP:758044508
128 128 a, t dbSNP:749970304
129 129 a, g dbSNP:371140684
136 136 c, t dbSNP:761547225
137 137 a, g dbSNP:776834755
142 142 c, t dbSNP:764557472
143 143 a, g dbSNP:761079937
146 146 a, g dbSNP:536744834
148 148 c, t dbSNP:397516085
149 149 a, c, g dbSNP:730880575
153 153 -, ca dbSNP:745811346
158 158 a, c, t dbSNP:727504249
159 159 a, g dbSNP:397515885
162 162 a, c dbSNP:376646845
163 163 a, g dbSNP:754870909
172 172 g, t dbSNP:747965077
173 173 a, g dbSNP:780085131
176 176 a, c, t dbSNP:373638535
177 177 a, g dbSNP:764849803
179 179 -, tggc dbSNP:730880659
185 185 c, t dbSNP:557439091
186 186 a, g dbSNP:369205562
187 187 a, c, t dbSNP:377579620
188 188 a, g dbSNP:775837337
193 193 c, g dbSNP:767973005
200 200 a, t dbSNP:760058908
201 201 -, tca dbSNP:781207661
202 202 c, t dbSNP:774273586
203 203 a, g dbSNP:373164247
205 205 c, t dbSNP:368918487
206 206 a, g, t dbSNP:534282225
207 207 c, t dbSNP:746738538
220 220 c, t dbSNP:780012957
221 221 a, g dbSNP:397515918
227 227 -, g dbSNP:730880662
230 230 a, g dbSNP:121909375
232 232 -, agagggcacac dbSNP:397515925
234 234 -, ag dbSNP:786204324
237 237 a, g dbSNP:546345474
237 237 -, g dbSNP:730880663
239 239 a, c dbSNP:377225516
242 242 c, t dbSNP:373315466
243 243 a, g dbSNP:549239819
249 249 c, t dbSNP:753300898
250 250 a, g dbSNP:370102200
261 261 a, g dbSNP:397515945
262 262 c, g dbSNP:397515946
263 263 g, t dbSNP:11570045
270 270 -, gg dbSNP:730880362
271 271 a, c, t dbSNP:760007714
278 278 a, g dbSNP:375471260
283 283 a, g dbSNP:766359851
285 285 a, g dbSNP:730880580
290 290 a, t dbSNP:730880581
292 292 -, c dbSNP:730880664
292 292 c, g, t dbSNP:730880698
293 293 a, g dbSNP:730880700
294 294 c, gagg dbSNP:727504335
295 295 a, g dbSNP:770089112
301 301 c, t dbSNP:372502369
306 306 a, g dbSNP:569824900
312 312 c, g dbSNP:772057451
318 318 a, t dbSNP:730880583
325 325 c, t dbSNP:367990952
326 326 a, g dbSNP:778851720
335 335 g, t dbSNP:770777166
338 338 a, c dbSNP:549758428
339 339 c, t dbSNP:727504945
342 342 a, g dbSNP:777170653
345 345 c, t dbSNP:397515993
360 360 c, t dbSNP:730880610
370 370 c, g dbSNP:770853232
377 377 c, t dbSNP:749233808
378 378 c, t dbSNP:772678776
379 379 -, t dbSNP:730880721
381 381 c, t dbSNP:397516011
387 387 c, t dbSNP:730880530
388 388 -, t dbSNP:730880335
388 388 c, t dbSNP:397516017
393 393 a, c dbSNP:730880611
394 394 c, t dbSNP:786204325
395 395 a, g dbSNP:730880612
398 398 a, g, t dbSNP:727503220
405 405 -, c dbSNP:397516023
410 410 a, g dbSNP:397516025
417 417 -, c dbSNP:397516032
417 417 c, t dbSNP:551888783
418 418 a, g dbSNP:780768974
419 419 a, g dbSNP:754633960
427 427 c, t dbSNP:11570046
428 428 a, g, t dbSNP:370958401
433 433 a, g dbSNP:758903546
436 436 a, g dbSNP:750955473
457 457 c, t dbSNP:397516046
460 460 a, g dbSNP:727504318
461 461 a, g dbSNP:730880613
463 463 -, g dbSNP:771005018
465 465 c, g dbSNP:730880703
467 467 a, g dbSNP:776154213
471 471 c, g dbSNP:730880704
473 473 c, g dbSNP:730880614
474 474 c, t dbSNP:786205352
483 483 a, g dbSNP:730880705
486 486 -, gt dbSNP:397516047
489 489 a, c dbSNP:768309693
491 491 -, a dbSNP:397516049
491 491 a, c, g dbSNP:397516048
492 492 c, t dbSNP:780458215
495 495 c, t dbSNP:730880615
497 497 a, g dbSNP:397516050
501 501 a, c, t dbSNP:779493486
505 505 -, c dbSNP:730880677
505 505 c, g, t dbSNP:377520770
506 506 a, g dbSNP:397516051
508 508 -, t dbSNP:730880679
510 510 -, ac dbSNP:730880680
513 513 a, c dbSNP:756328813
514 514 -, c dbSNP:397516052
516 516 c, t dbSNP:373946195
521 521 -, c dbSNP:730880366
522 522 c, t dbSNP:730880616
526 526 c, t dbSNP:150291001
527 527 a, g dbSNP:3729986
532 532 a, g dbSNP:730880706
533 533 c, t dbSNP:193068692
534 534 a, g dbSNP:730880617
536 536 a, c dbSNP:397516053
538 538 a, g dbSNP:373133807
539 539 c, t dbSNP:730880618
547 547 c, t dbSNP:3218719
550 550 c, g dbSNP:730880619
556 556 c, t dbSNP:397516054
557 557 a, g dbSNP:569740494
558 558 c, t dbSNP:727505267
559 559 a, g dbSNP:550047739
567 567 a, g dbSNP:369683229
568 568 c, t dbSNP:778679153
572 572 a, g dbSNP:727505168
573 573 a, c, t dbSNP:113941605
576 576 -, tct dbSNP:730880722
582 582 c, g, t dbSNP:753683535
584 584 c, t dbSNP:193922385
585 585 a, g dbSNP:201012766
586 586 c, t dbSNP:368035400
587 587 a, g dbSNP:727503218
588 588 -, t dbSNP:727503217
589 589 g, t dbSNP:759249105
592 592 c, t dbSNP:11570051
593 593 a, g dbSNP:766132641
595 595 -, cgccagcctcctgaagccgc dbSNP:397516058
595 595 c, t dbSNP:371842442
596 596 a, g dbSNP:773646282
597 597 -, gc dbSNP:786204327
604 604 c, t dbSNP:368604485
606 606 -, t dbSNP:397516059
607 607 a, g dbSNP:748725922
608 608 a, c, t dbSNP:375607980
609 609 a, g dbSNP:768795353
612 612 c, t dbSNP:727503216
613 613 a, g, t dbSNP:370962887
620 620 a, g dbSNP:11570052
621 621 a, t dbSNP:397516060
623 623 a, g dbSNP:777665200
626 626 c, t dbSNP:730880622
628 628 g, t dbSNP:755983199
637 637 a, c dbSNP:375673378
641 641 -, t dbSNP:730880681
643 643 c, g dbSNP:727503215
653 653 a, g dbSNP:370554185
658 658 c, t dbSNP:762834457
659 659 a, c dbSNP:730880623
668 668 c, t dbSNP:397516061
673 673 c, t dbSNP:751125697
679 679 c, g dbSNP:202139499
685 685 c, t dbSNP:762695516
686 686 a, g dbSNP:773414747
688 688 c, t dbSNP:765678794
689 689 a, g dbSNP:762226459
691 691 c, g dbSNP:397516062
694 694 c, t dbSNP:727504858
695 695 a, g dbSNP:769167548
698 698 c, t dbSNP:397516063
699 699 a, g dbSNP:775580020
700 700 c, t dbSNP:397516064
701 701 a, g dbSNP:201098973
703 703 c, t dbSNP:777418402
704 704 a, g dbSNP:138753870
708 708 a, g dbSNP:730880707
710 710 c, g, t dbSNP:397516068
714 714 a, g dbSNP:779693951
721 721 c, t dbSNP:371331114
722 722 a, g dbSNP:397516069
724 724 a, g dbSNP:778582048
736 736 c, t dbSNP:756894628
737 737 a, g dbSNP:369300885
739 739 c, g, t dbSNP:532498780
755 755 a, c, g dbSNP:753271103
756 756 -, atcaccgatgcccagcctgccttcac dbSNP:786204329
760 760 c, t dbSNP:767913494
761 761 a, g dbSNP:3729989
764 764 c, t dbSNP:730880624
765 765 a, c dbSNP:397516070
766 766 c, t dbSNP:774316050
767 767 c, t dbSNP:771143409
768 768 a, g dbSNP:727504396
771 771 g, t dbSNP:776541959
777 777 -, t dbSNP:730880683
782 782 a, c dbSNP:730880625
794 794 c, t dbSNP:372574446
797 797 g, t dbSNP:768625454
799 799 a, c dbSNP:2857543
800 800 c, t dbSNP:397516071
801 801 a, g dbSNP:780085082
802 802 c, t dbSNP:771929829
807 807 a, t dbSNP:368588523
813 813 a, g dbSNP:727503214
827 827 a, g dbSNP:397516074
831 831 c, t dbSNP:187455402
834 834 -, t dbSNP:786204332
838 838 a, c dbSNP:766472497
840 840 c, g dbSNP:730880627
841 841 c, t dbSNP:11570058
842 842 a, g dbSNP:373730381
845 845 -, g dbSNP:786204333
854 854 c, g dbSNP:370941975
860 860 c, t dbSNP:762169683
863 863 a, g dbSNP:775337081
869 869 c, t dbSNP:397516075
870 870 a, g dbSNP:759515993
872 872 c, t dbSNP:551119259
873 873 a, g dbSNP:376461745
876 876 c, t dbSNP:748746951
877 877 a, g dbSNP:751392149
888 888 a, g dbSNP:147315081
888 888 -, g dbSNP:727503212
891 891 c, g dbSNP:375774648
896 896 c, t dbSNP:371711564
897 897 a, g dbSNP:11570060
899 899 c, t dbSNP:727504234
900 900 a, g dbSNP:761520688
905 905 a, g dbSNP:776075902
908 908 a, g dbSNP:727504523
914 914 c, t dbSNP:776238883
939 939 -, t dbSNP:730880684
941 941 a, g dbSNP:768164989
947 947 c, t dbSNP:760429280
956 956 a, t dbSNP:730880629
964 964 c, t dbSNP:200713257
967 967 -, tt dbSNP:730880685
968 968 -, tt dbSNP:397516080
971 971 c, t dbSNP:753884765
972 972 a, g dbSNP:373204728
976 976 a, c, g dbSNP:370632180
978 978 -, aact dbSNP:730880678
979 979 a, g dbSNP:771875597
986 986 a, t dbSNP:397516084
987 987 a, c, t dbSNP:193922386
988 988 a, c, g dbSNP:374326087
998 998 g, t dbSNP:749867888
1004 1004 a, g dbSNP:780896631
1011 1011 a, c dbSNP:545675333
1015 1015 c, g, t dbSNP:369900803
1016 1016 a, c, g dbSNP:200119454
1019 1019 c, t dbSNP:730880708
1021 1021 a, g dbSNP:727503211
1025 1025 a, t dbSNP:765732047
1031 1031 a, c, t dbSNP:776681371
1032 1032 a, g dbSNP:34580776
1034 1034 c, t dbSNP:727503210
1048 1048 -, t dbSNP:727503209
1049 1049 a, g dbSNP:397516086
1054 1054 c, g, t dbSNP:367947846
1055 1055 a, g, t dbSNP:573916965
1058 1058 c, t dbSNP:730880630
1061 1061 a, t dbSNP:777470695
1063 1063 c, t dbSNP:397515880
1064 1064 a, g dbSNP:769830766
1070 1070 c, t dbSNP:730880631
1075 1075 c, t dbSNP:556616131
1076 1076 a, g dbSNP:397515881
1078 1078 c, t dbSNP:754469813
1079 1079 a, g dbSNP:397515882
1080 1080 a, t dbSNP:730880709
1083 1083 -, c dbSNP:730880686
1090 1090 a, g dbSNP:779704622
1092 1092 a, g dbSNP:397515883
1093 1093 c, t dbSNP:758016271
1094 1094 a, g dbSNP:397515884
1097 1097 -, cggca dbSNP:730880336
1111 1111 c, g dbSNP:375007425
1124 1124 cgcg, gc dbSNP:730880687
1125 1125 a, g dbSNP:199741162
1126 1126 a, c, t dbSNP:371308153
1127 1127 a, g dbSNP:746267533
1129 1129 a, t dbSNP:775464343
1135 1135 c, g dbSNP:730880632
1137 1137 -, aga dbSNP:775069579
1138 1138 a, g dbSNP:781216464
1139 1139 -, a dbSNP:730880723
1139 1139 a, g dbSNP:730880633
1146 1146 c, t dbSNP:778161908
1155 1155 a, g dbSNP:756633062
1156 1156 g, t dbSNP:753209030
1167 1167 c, g, t dbSNP:397515887
1175 1175 -, c dbSNP:730880688
1175 1175 a, c, t dbSNP:730880635
1178 1178 a, g dbSNP:727503208
1188 1188 c, g dbSNP:766664184
1198 1198 -, tc dbSNP:769490852
1199 1199 -, c dbSNP:759194130
1199 1199 c, t dbSNP:11570076
1200 1200 a, g dbSNP:753660871
1202 1202 c, g dbSNP:11570077
1207 1207 c, g, t dbSNP:775237084
1208 1208 a, g dbSNP:772073491
1211 1211 g, t dbSNP:397515888
1217 1217 -, g dbSNP:730880724
1223 1223 -, c dbSNP:397515889
1226 1226 -, gaactggctgaccatg dbSNP:730880689
1226 1226 g, t dbSNP:759008026
1228 1228 c, t dbSNP:377328238
1234 1234 a, g dbSNP:770549835
1235 1235 a, g dbSNP:749000345
1237 1237 a, c, g dbSNP:730880636
1243 1243 a, g, t dbSNP:397515890
1256 1256 c, t dbSNP:730880637
1265 1265 c, t dbSNP:727504329
1266 1266 a, c dbSNP:769985511
1268 1268 a, g dbSNP:727503207
1269 1269 a, t dbSNP:560140258
1273 1273 c, t dbSNP:748558425
1274 1274 a, g dbSNP:727505266
1277 1277 a, c dbSNP:730880638
1283 1283 -, ggt dbSNP:746979805
1287 1287 a, t dbSNP:774293794
1290 1290 -, tt dbSNP:397515894
1293 1293 a, g dbSNP:730880532
1301 1301 a, g dbSNP:371513491
1307 1307 a, t dbSNP:730880533
1310 1310 a, c, t dbSNP:368770848
1311 1311 a, c, g dbSNP:770030288
1319 1319 a, c dbSNP:727503206
1328 1328 c, t dbSNP:397515895
1333 1333 c, t dbSNP:746770543
1336 1336 a, g dbSNP:779873317
1337 1337 c, t dbSNP:758253767
1341 1341 a, c, t dbSNP:370412052
1342 1342 a, g dbSNP:778718628
1343 1343 a, g dbSNP:730880534
1345 1345 c, t dbSNP:200664621
1346 1346 a, g dbSNP:753321277
1348 1348 c, t dbSNP:763808974
1349 1349 a, g dbSNP:371167525
1357 1357 c, t dbSNP:190228518
1360 1360 a, g dbSNP:768065513
1363 1363 c, t dbSNP:759826878
1364 1364 a, g, t dbSNP:730880535
1365 1365 -, t dbSNP:397515896
1371 1371 a, g dbSNP:763045718
1371 1371 -, g dbSNP:730880710
1374 1374 a, g dbSNP:142317339
1375 1375 c, t dbSNP:368192024
1376 1376 a, g dbSNP:193922377
1380 1380 a, g dbSNP:779820034
1381 1381 a, g dbSNP:771832243
1385 1385 -, a dbSNP:727505152
1389 1389 c, t dbSNP:745661443
1390 1390 a, g dbSNP:727503205
1393 1393 a, g dbSNP:757182984
1398 1398 c, t dbSNP:727504279
1402 1402 g, t dbSNP:539453748
1406 1406 g, t dbSNP:786204338
1410 1410 a, c dbSNP:730880536
1412 1412 -, cc dbSNP:727503203
1412 1412 c, g dbSNP:749310275
1413 1413 -, c dbSNP:730880711
1413 1413 c, t dbSNP:397515898
1416 1416 c, t dbSNP:755631466
1418 1418 c, t dbSNP:747686377
1420 1420 c, t dbSNP:780854746
1425 1425 c, t dbSNP:370538243
1426 1426 a, g dbSNP:538072263
1427 1427 c, t dbSNP:377577698
1428 1428 a, g dbSNP:374255707
1430 1430 c, t dbSNP:758901980
1432 1432 -, c dbSNP:786204339
1436 1436 g, t dbSNP:730880537
1439 1439 a, g dbSNP:755991329
1442 1442 c, t dbSNP:730880538
1450 1450 a, g dbSNP:750861980
1452 1452 a, t dbSNP:397515899
1460 1460 c, g, t dbSNP:730880539
1464 1464 a, g dbSNP:776734314
1465 1465 -, gg dbSNP:730880642
1473 1473 c, t dbSNP:397515900
1477 1477 a, c, g dbSNP:397515901
1478 1478 c, t dbSNP:760864668
1486 1486 a, g dbSNP:587781042
1488 1488 c, t dbSNP:730880540
1489 1489 a, g dbSNP:770568659
1495 1495 a, g dbSNP:749110971
1497 1497 a, g dbSNP:773237942
1500 1500 c, t dbSNP:370285346
1501 1501 g, t dbSNP:747627648
1502 1502 c, t dbSNP:730880541
1511 1511 c, g, t dbSNP:397515902
1512 1512 a, g dbSNP:730880542
1514 1514 a, c dbSNP:771741441
1520 1520 g, t dbSNP:546002111
1522 1522 c, g, t dbSNP:35690719
1523 1523 a, g dbSNP:200625851
1524 1524 a, g, t dbSNP:397514752
1526 1526 a, g dbSNP:730880543
1527 1527 g, t dbSNP:778361492
1537 1537 c, t dbSNP:756101990
1538 1538 a, c, g, t dbSNP:397515905
1539 1539 a, g dbSNP:200411226
1542 1542 a, g dbSNP:759884209
1548 1548 a, c dbSNP:750225859
1549 1549 c, g dbSNP:397515906
1554 1554 a, c dbSNP:761672176
1558 1558 c, g dbSNP:776373836
1559 1559 c, t dbSNP:375882485
1560 1560 -, ggttc dbSNP:587782957
1560 1560 a, g, t dbSNP:397515907
1568 1568 -, aag dbSNP:727504287
1568 1568 a, t dbSNP:786204340
1573 1573 c, t dbSNP:397515908
1574 1574 a, g dbSNP:35736435
1577 1577 c, t dbSNP:730880544
1590 1590 a, c, t dbSNP:397515909
1591 1591 a, g dbSNP:771702316
1595 1595 a, g dbSNP:727503200
1598 1598 -, aac dbSNP:730880643
1599 1599 a, g dbSNP:181834806
1600 1600 c, t dbSNP:771230605
1601 1601 a, g dbSNP:730880545
1602 1602 -, agg dbSNP:786204341
1609 1609 a, g dbSNP:372499440
1612 1612 g, t dbSNP:778105166
1618 1618 c, t dbSNP:367915627
1619 1619 a, g dbSNP:11570082
1620 1620 c, t dbSNP:370362589
1621 1621 a, g dbSNP:376041792
1630 1630 g, t dbSNP:397515910
1633 1633 a, g, t dbSNP:766721220
1635 1635 -, cact dbSNP:730880712
1635 1635 c, t dbSNP:761466191
1641 1641 c, g dbSNP:397515911
1644 1644 a, g dbSNP:753696015
1645 1645 c, t dbSNP:763905291
1646 1646 a, c, g dbSNP:397515912
1648 1648 a, g dbSNP:727503199
1650 1650 a, g, t dbSNP:730880547
1650 1650 -, g dbSNP:730880640
1654 1654 c, g dbSNP:773947559
1656 1656 c, t dbSNP:374349666
1657 1657 a, g dbSNP:370945942
1659 1659 c, t dbSNP:730880548
1663 1663 a, t dbSNP:200224422
1670 1670 a, g dbSNP:770186287
1678 1678 a, c, g dbSNP:781764759
1679 1679 c, g dbSNP:121909374
1683 1683 -, a dbSNP:727504248
1688 1688 a, c dbSNP:377163678
1694 1694 a, g dbSNP:752523427
1694 1694 -, g dbSNP:757777349
1696 1696 -, gt dbSNP:398123279
1696 1696 a, g dbSNP:397515915
1707 1707 -, tcgca dbSNP:730880644
1708 1708 c, t dbSNP:767414501
1709 1709 g, t dbSNP:727504887
1719 1719 c, t dbSNP:730880692
1724 1724 a, g dbSNP:730880693
1725 1725 a, g dbSNP:730880549
1726 1726 c, t dbSNP:751052593
1727 1727 a, g dbSNP:727503198
1732 1732 a, g dbSNP:762369686
1733 1733 c, g dbSNP:750030159
1733 1733 -, g dbSNP:727504366
1739 1739 a, g dbSNP:397515919
1740 1740 a, c, t dbSNP:730880694
1741 1741 a, g dbSNP:762228885
1744 1744 a, g dbSNP:777173469
1748 1748 a, t dbSNP:397515920
1751 1751 c, t dbSNP:730880695
1754 1754 -, ga dbSNP:727503197
1755 1755 -, ag dbSNP:730880645
1774 1774 a, g, t dbSNP:397515921
1775 1775 a, c, t dbSNP:61897383
1776 1776 a, g dbSNP:397515922
1781 1781 a, g dbSNP:772132916
1786 1786 a, g dbSNP:730880546
1787 1787 c, t dbSNP:745957052
1789 1789 -, g dbSNP:730880646
1813 1813 c, t dbSNP:727505203
1814 1814 a, g dbSNP:730880526
1819 1819 c, t dbSNP:747918558
1821 1821 a, g dbSNP:397515923
1823 1823 a, g dbSNP:754904833
1828 1828 g, t dbSNP:754902004
1831 1831 -, gt dbSNP:730880713
1831 1831 a, g dbSNP:727503196
1833 1833 c, t dbSNP:397515924
1838 1838 a, g dbSNP:730880550
1840 1840 c, t dbSNP:572227730
1841 1841 a, g dbSNP:199728019
1844 1844 c, t dbSNP:201596087
1845 1845 a, g dbSNP:727503195
1846 1846 c, g dbSNP:772488845
1847 1847 -, g dbSNP:730880647
1855 1855 -, a dbSNP:397515926
1858 1858 a, g dbSNP:397515927
1860 1860 c, t dbSNP:730880551
1861 1861 a, c dbSNP:566461224
1861 1861 -, c dbSNP:730880648
1863 1863 c, t dbSNP:397515928
1864 1864 g, t dbSNP:774348756
1867 1867 c, t dbSNP:397515929
1868 1868 -, cg dbSNP:764743402
1868 1868 a, g dbSNP:376736293
1869 1869 -, acg dbSNP:397515930
1869 1869 a, g dbSNP:372371774
1870 1870 c, t dbSNP:768380030
1871 1871 a, g dbSNP:368482358
1875 1875 c, t dbSNP:375196922
1876 1876 a, g dbSNP:758306575
1877 1877 c, t dbSNP:730880552
1878 1878 c, g dbSNP:778623429
1881 1881 c, t dbSNP:730880553
1882 1882 c, g, t dbSNP:535853707
1883 1883 a, c, g dbSNP:371564200
1884 1884 a, t dbSNP:730880554
1885 1885 c, t dbSNP:768049705
1886 1886 a, g dbSNP:730880555
1888 1888 a, g dbSNP:760023583
1893 1893 -, a dbSNP:730880649
1896 1896 a, g dbSNP:727503194
1897 1897 c, t dbSNP:774488435
1910 1910 a, g dbSNP:200352299
1912 1912 a, g dbSNP:763030622
1914 1914 g, t dbSNP:730880556
1915 1915 c, g dbSNP:773371075
1918 1918 -, c dbSNP:397515931
1918 1918 c, t dbSNP:193922378
1922 1922 a, t dbSNP:746786287
1924 1924 a, c, t dbSNP:397515932
1926 1926 a, g dbSNP:772032697
1941 1941 c, t dbSNP:730880137
1944 1944 a, t dbSNP:745859544
1947 1947 -, t dbSNP:397515933
1950 1950 -, t dbSNP:397515934
1969 1969 c, t dbSNP:377227442
1970 1970 a, g dbSNP:780907679
1974 1974 c, t dbSNP:755244836
1979 1979 c, t dbSNP:727504293
1987 1987 c, t dbSNP:768391385
1989 1989 c, t dbSNP:397515938
1990 1990 c, t dbSNP:727503193
1993 1993 c, g dbSNP:780452445
1997 1997 c, t dbSNP:758901926
1999 1999 c, t dbSNP:750861887
2002 2002 a, c, g dbSNP:757244311
2005 2005 c, g dbSNP:727504250
2010 2010 c, g dbSNP:753992239
2015 2015 c, g, t dbSNP:397515939
2016 2016 a, g dbSNP:1800565
2018 2018 a, c dbSNP:374447249
2023 2023 a, g dbSNP:397515940
2026 2026 c, t dbSNP:751397614
2028 2028 c, t dbSNP:766213616
2031 2031 c, t dbSNP:397515941
2033 2033 a, g, t dbSNP:730880560
2040 2040 c, t dbSNP:772970643
2044 2044 a, t dbSNP:375467797
2054 2054 a, ct, g dbSNP:727503192
2054 2054 a, c dbSNP:761194404
2057 2057 c, t dbSNP:730880561
2058 2058 a, g dbSNP:727503191
2065 2065 c, t dbSNP:558051480
2068 2068 ccct, gg dbSNP:397515943
2071 2071 c, t dbSNP:775127671
2073 2073 c, t dbSNP:772364751
2074 2074 c, t dbSNP:746263346
2085 2085 c, t dbSNP:786204345
2088 2088 a, c dbSNP:779258481
2089 2089 c, t dbSNP:757832991
2090 2090 c, t dbSNP:372493586
2092 2092 a, c dbSNP:749317445
2095 2095 -, t dbSNP:397515944
2096 2096 a, g dbSNP:777978931
2103 2103 a, g dbSNP:397515942
2111 2111 a, c, g dbSNP:367992212
2118 2118 a, c, t dbSNP:3729946
2119 2119 a, g dbSNP:758224257
2128 2128 a, g dbSNP:781477048
2135 2135 a, t dbSNP:768993308
2137 2137 a, c, t dbSNP:397515951
2137 2137 -, c dbSNP:397515952
2138 2138 a, c, g dbSNP:730880696
2144 2144 c, t dbSNP:200399246
2145 2145 a, g dbSNP:756102881
2150 2150 c, t dbSNP:752200396
2151 2151 a, g dbSNP:397515953
2152 2152 c, t dbSNP:370676057
2153 2153 a, g dbSNP:564378953
2156 2156 g, t dbSNP:397515954
2161 2161 c, t dbSNP:765983279
2162 2162 a, c dbSNP:763341155
2163 2163 c, t dbSNP:773757669
2168 2168 g, t dbSNP:770408214
2170 2170 c, t dbSNP:397515955
2171 2171 a, c, t dbSNP:397515956
2172 2172 a, g, t dbSNP:534345197
2174 2174 a, g dbSNP:747081382
2176 2176 c, t dbSNP:780282339
2184 2184 c, t dbSNP:199893357
2185 2185 a, g dbSNP:113265977
2188 2188 c, t dbSNP:777613325
2191 2191 g, t dbSNP:786204348
2195 2195 -, g dbSNP:730880650
2208 2208 a, g dbSNP:727503190
2215 2215 c, t dbSNP:755910458
2216 2216 a, g dbSNP:730880563
2223 2223 c, t dbSNP:727503189
2224 2224 a, g dbSNP:373338699
2232 2232 -, t dbSNP:774521272
2241 2241 -, c dbSNP:730880651
2243 2243 a, g dbSNP:369790992
2245 2245 a, g dbSNP:766029254
2248 2248 c, t dbSNP:397515957
2249 2249 a, g dbSNP:750810342
2251 2251 a, g dbSNP:765629179
2252 2252 c, g dbSNP:762280284
2262 2262 a, g dbSNP:730880527
2263 2263 c, t dbSNP:777228369
2269 2269 a, t dbSNP:764539455
2274 2274 a, g dbSNP:760786216
2281 2281 c, t dbSNP:775491112
2282 2282 a, g dbSNP:36211723
2284 2284 c, t dbSNP:397515959
2285 2285 -, g dbSNP:397515960
2285 2285 a, g dbSNP:371488302
2286 2286 c, t dbSNP:397515961
2293 2293 c, t dbSNP:397515962
2294 2294 a, g dbSNP:368104687
2298 2298 c, g dbSNP:730880564
2304 2304 c, t dbSNP:759631792
2310 2310 a, g dbSNP:774512738
2311 2311 g, t dbSNP:771179191
2313 2313 g, t dbSNP:747912257
2319 2319 a, g dbSNP:776351251
2320 2320 c, t dbSNP:768638405
2326 2326 a, g dbSNP:746858516
2337 2337 g, t dbSNP:780056346
2346 2346 a, g dbSNP:757934210
2347 2347 -, g dbSNP:397515963
2348 2348 c, g, t dbSNP:187830361
2351 2351 c, g dbSNP:778678513
2355 2355 c, t dbSNP:730880565
2356 2356 -, g dbSNP:730880714
2365 2365 a, c, t dbSNP:727504864
2366 2366 a, g dbSNP:764297991
2368 2368 -, t dbSNP:730880341
2371 2371 c, t dbSNP:756512665
2372 2372 a, g dbSNP:727504574
2383 2383 a, c dbSNP:202088839
2384 2384 a, c dbSNP:3729950
2388 2388 a, g dbSNP:730880566
2400 2400 a, g dbSNP:766382260
2403 2403 a, g, t dbSNP:375675796
2409 2409 a, g dbSNP:786204350
2410 2410 g, t dbSNP:727504251
2411 2411 a, t dbSNP:727504252
2413 2413 c, g dbSNP:727505264
2415 2415 -, aga dbSNP:727504288
2417 2417 -, cga dbSNP:746234586
2423 2423 c, t dbSNP:727503188
2424 2424 a, c, g dbSNP:397515964
2428 2428 a, g dbSNP:397515965
2429 2429 -, atgcg dbSNP:730880652
2432 2432 c, t dbSNP:775404728
2433 2433 a, c, g dbSNP:2856655
2434 2434 a, g dbSNP:532996422
2444 2444 a, g dbSNP:774442478
2453 2453 a, c dbSNP:375322174
2456 2456 c, g dbSNP:770514536
2458 2458 a, g dbSNP:765583270
2461 2461 g, t dbSNP:201040413
2463 2463 a, g dbSNP:769531658
2464 2464 -, t dbSNP:397515966
2465 2465 c, t dbSNP:748443032
2471 2471 a, g dbSNP:199865688
2472 2472 c, t dbSNP:3729952
2473 2473 a, g dbSNP:397515967
2474 2474 c, t dbSNP:752007810
2475 2475 a, g dbSNP:540988604
2476 2476 g, t dbSNP:758371979
2477 2477 a, c, t dbSNP:765356720
2478 2478 a, g, t dbSNP:527305885
2479 2479 c, t dbSNP:561942028
2485 2485 -, c dbSNP:730880653
2485 2485 c, t dbSNP:542181308
2486 2486 a, c, g dbSNP:397515969
2491 2491 -, cgtggtgtacgagatgcgcgtc dbSNP:727503187
2491 2491 c, t dbSNP:370561202
2492 2492 a, g dbSNP:376936056
2498 2498 -, t dbSNP:397515970
2499 2499 a, g dbSNP:397515971
2500 2500 c, t dbSNP:373792537
2501 2501 a, g dbSNP:730880567
2502 2502 -, agatgcgcg dbSNP:397515972
2506 2506 -, gcgcgtc dbSNP:730880654
2507 2507 c, g, t dbSNP:727504345
2508 2508 -, gcgtc dbSNP:397515973
2508 2508 a, c, g dbSNP:730880568
2510 2510 a, g dbSNP:747774791
2511 2511 a, t dbSNP:193922379
2512 2512 c, g dbSNP:776282342
2513 2513 c, t dbSNP:768963157
2515 2515 a, c, g dbSNP:397515974
2516 2516 a, g dbSNP:747407752
2517 2517 -, c dbSNP:730880715
2517 2517 c, g, t dbSNP:730880569
2518 2518 a, g dbSNP:369904619
2520 2520 c, t dbSNP:745922957
2521 2521 c, t dbSNP:3729953
2523 2523 a, t dbSNP:730880570
2525 2525 a, g dbSNP:730880571
2526 2526 c, t dbSNP:774172488
2529 2529 -, t dbSNP:752104988
2530 2530 cg, tct dbSNP:397515975
2530 2530 -, c dbSNP:727503186
2530 2530 c, t dbSNP:754062873
2531 2531 a, g, t dbSNP:397515976
2532 2532 -, g dbSNP:397515977
2534 2534 a, g, t dbSNP:373171036
2536 2536 a, g dbSNP:730880572
2539 2539 c, g dbSNP:763010875
2542 2542 g, t dbSNP:773032022
2544 2544 c, t dbSNP:764750484
2547 2547 a, g dbSNP:727503185
2550 2550 c, t dbSNP:761338253
2560 2560 a, g dbSNP:776229039
2572 2572 c, t dbSNP:767998170
2573 2573 a, g dbSNP:768339148
2575 2575 c, t dbSNP:11570097
2576 2576 a, g dbSNP:775890771
2578 2578 a, tc dbSNP:727504371
2578 2578 -, t dbSNP:730880655
2584 2584 -, c dbSNP:397515979
2584 2584 -, c dbSNP:730880656
2587 2587 c, t dbSNP:531228202
2588 2588 a, g dbSNP:190765116
2592 2592 a, c, t dbSNP:371401403
2595 2595 c, t dbSNP:759847861
2598 2598 a, t dbSNP:774889182
2606 2606 a, g dbSNP:730880574
2614 2614 c, t dbSNP:397515980
2615 2615 a, g dbSNP:727504360
2628 2628 c, t dbSNP:397515981
2629 2629 a, g dbSNP:769996102
2642 2642 g, t dbSNP:748326848
2644 2644 a, g dbSNP:397515982
2645 2645 c, t dbSNP:727504418
2646 2646 a, g dbSNP:727504378
2650 2650 a, c, g dbSNP:559961809
2656 2656 g, t dbSNP:369289966
2657 2657 c, t dbSNP:374976635
2658 2658 a, g dbSNP:372628478
2660 2660 a, g dbSNP:35078470
2667 2667 c, t dbSNP:752354801
2676 2676 c, t dbSNP:767113733
2683 2683 -, ctacagcgtgg dbSNP:730880657
2688 2688 a, g dbSNP:397515983
2689 2689 c, t dbSNP:759920601
2690 2690 a, g dbSNP:774634021
2697 2697 a, g dbSNP:397515984
2702 2702 a, c dbSNP:397515985
2711 2711 -, t dbSNP:730880658
2713 2713 -, c dbSNP:730880660
2718 2718 -, a dbSNP:730880661
2721 2721 a, g dbSNP:727504349
2722 2722 a, g dbSNP:730880576
2727 2727 -, g dbSNP:34114081
2732 2732 c, t dbSNP:767182632
2735 2735 c, g dbSNP:367729718
2739 2739 a, g dbSNP:751224775
2743 2743 a, g dbSNP:577575638
2745 2745 c, t dbSNP:200406864
2754 2754 -, ca dbSNP:727504265
2757 2757 c, t dbSNP:773819168
2758 2758 a, c, g dbSNP:372510974
2766 2766 -, t dbSNP:730880716
2774 2774 c, g, t dbSNP:367980215
2781 2781 a, c, t dbSNP:374946555
2782 2782 a, g dbSNP:370530334
2786 2786 g, t dbSNP:556390274
2789 2789 c, t dbSNP:534366414
2796 2796 c, t dbSNP:575117255
2801 2801 c, t dbSNP:387907267
2802 2802 a, g dbSNP:397515986
2807 2807 -, cg dbSNP:397515987
2807 2807 c, t dbSNP:727503183
2812 2812 a, g dbSNP:376858768
2813 2813 a, c dbSNP:397515988
2814 2814 a, g dbSNP:754525416
2815 2815 a, c dbSNP:751120827
2817 2817 a, c dbSNP:121909376
2820 2820 -, t dbSNP:786204352
2820 2820 c, t dbSNP:766165160
2823 2823 c, t dbSNP:730880577
2828 2828 c, g dbSNP:554694434
2830 2830 g, t dbSNP:397515989
2834 2834 a, g dbSNP:373744177
2838 2838 -, ct dbSNP:397515990
2844 2844 c, g dbSNP:193922380
2847 2847 c, t dbSNP:376504548
2849 2849 -, ac dbSNP:727503182
2850 2850 c, t dbSNP:730880697
2851 2851 a, g dbSNP:727503181
2856 2856 c, t dbSNP:373056282
2857 2857 a, g dbSNP:568935618
2858 2858 c, g dbSNP:772327857
2860 2860 a, g dbSNP:369685402
2865 2865 c, t dbSNP:773053868
2867 2867 c, t dbSNP:730880578
2868 2868 a, g dbSNP:769631967
2871 2871 a, t dbSNP:730880579
2878 2878 c, g dbSNP:747974933
2879 2879 c, t dbSNP:397515992
2882 2882 c, t dbSNP:730880138
2883 2883 a, g dbSNP:727504346
2888 2888 c, t dbSNP:193922382
2889 2889 a, g dbSNP:761696555
2894 2894 c, t dbSNP:727503180
2912 2912 c, t dbSNP:397515994
2913 2913 a, g dbSNP:727503179
2916 2916 a, c dbSNP:730880582
2917 2917 -, gacca dbSNP:397515995
2927 2927 a, t dbSNP:727504423
2935 2935 c, t dbSNP:761700877
2936 2936 a, g dbSNP:779781718
2937 2937 g, t dbSNP:727504942
2939 2939 g, t dbSNP:727503178
2942 2942 a, c dbSNP:776100156
2954 2954 c, t dbSNP:375776406
2956 2956 c, t dbSNP:745460535
2958 2958 a, t dbSNP:778651716
2966 2966 c, g, t dbSNP:11570112
2967 2967 a, g dbSNP:727503177
2971 2971 c, t dbSNP:377283955
2977 2977 c, t dbSNP:397515996
2978 2978 c, t dbSNP:3729799
2979 2979 a, g dbSNP:727504235
2983 2983 g, t dbSNP:749611054
2991 2991 a, c dbSNP:778132423
2993 2993 c, t dbSNP:730880585
2995 2995 a, g dbSNP:730880701
3003 3003 -, ag dbSNP:730880665
3005 3005 a, g dbSNP:756480912
3007 3007 a, g dbSNP:748601708
3008 3008 c, t dbSNP:730880586
3014 3014 -, c dbSNP:397515997
3017 3017 a, g dbSNP:781685082
3022 3022 c, t dbSNP:397515998
3023 3023 a, g dbSNP:368180702
3025 3025 a, g dbSNP:375552602
3026 3026 c, g dbSNP:372003333
3031 3031 c, g dbSNP:750618688
3038 3038 c, t dbSNP:397515999
3039 3039 a, c, g dbSNP:397516000
3041 3041 a, g dbSNP:775530483
3042 3042 -, a dbSNP:397516001
3046 3046 a, c dbSNP:767605155
3053 3053 aa, g dbSNP:730880666
3053 3053 c, g dbSNP:759102022
3057 3057 c, g, t dbSNP:397516002
3060 3060 a, t dbSNP:730880587
3061 3061 c, t dbSNP:201515977
3063 3063 -, tgttcatccgggc dbSNP:727503175
3063 3063 c, t dbSNP:730880588
3064 3064 a, g, t dbSNP:770351760
3071 3071 c, t dbSNP:748909815
3072 3072 a, g dbSNP:397516003
3076 3076 c, t dbSNP:200663253
3077 3077 a, g dbSNP:552505566
3079 3079 a, t dbSNP:748548738
3080 3080 c, t dbSNP:61729664
3081 3081 a, g dbSNP:374255381
3082 3082 c, g dbSNP:747059136
3083 3083 c, g, t dbSNP:758421775
3084 3084 a, g dbSNP:750609594
3085 3085 c, t dbSNP:765589466
3086 3086 a, g dbSNP:370223247
3087 3087 a, t dbSNP:752595474
3090 3090 a, g dbSNP:368633238
3092 3092 g, t dbSNP:730880139
3096 3096 a, g dbSNP:759450911
3097 3097 c, t dbSNP:374626656
3101 3101 a, c, t dbSNP:762396429
3103 3103 a, c, t dbSNP:573821685
3111 3111 c, t dbSNP:371061770
3112 3112 a, g dbSNP:762154672
3116 3116 c, t dbSNP:11570113
3117 3117 a, g dbSNP:769018051
3121 3121 a, t dbSNP:747495607
3122 3122 a, g dbSNP:780449220
3126 3126 a, g dbSNP:772151277
3128 3128 a, g dbSNP:730880589
3139 3139 a, g dbSNP:779257107
3140 3140 -, g dbSNP:727503174
3142 3142 -, c dbSNP:760491068
3142 3142 c, t dbSNP:373208282
3143 3143 a, g dbSNP:786204355
3144 3144 c, t dbSNP:754115924
3145 3145 a, g dbSNP:397516004
3149 3149 c, g dbSNP:754747269
3155 3155 c, t dbSNP:397516005
3164 3164 a, g dbSNP:727505191
3166 3166 -, c dbSNP:397516007
3172 3172 a, g dbSNP:756786807
3190 3190 a, c dbSNP:753449535
3191 3191 -, c dbSNP:730880669
3191 3191 -, c dbSNP:730880668
3191 3191 c, t dbSNP:368973872
3192 3192 a, g dbSNP:376598916
3195 3195 c, t dbSNP:775777449
3197 3197 a, g dbSNP:767927162
3198 3198 c, g dbSNP:150786409
3199 3199 g, t dbSNP:374289617
3200 3200 -, t dbSNP:397516008
3201 3201 a, g dbSNP:730880140
3202 3202 c, t dbSNP:369999866
3203 3203 a, g, t dbSNP:397516009
3206 3206 c, t dbSNP:773543130
3207 3207 a, g dbSNP:397516006
3216 3216 a, c dbSNP:746818740
3227 3227 c, g, t dbSNP:397516010
3231 3231 a, g dbSNP:779650200
3238 3238 a, t dbSNP:758229677
3241 3241 a, c dbSNP:745761062
3248 3248 a, g dbSNP:778853122
3250 3250 c, t dbSNP:376344765
3251 3251 g, t dbSNP:727503173
3253 3253 c, t dbSNP:36212064
3255 3255 a, t dbSNP:397516012
3258 3258 c, t dbSNP:755653624
3259 3259 a, c, g dbSNP:367927327
3260 3260 a, g, t dbSNP:121909377
3262 3262 a, g dbSNP:1052373
3262 3262 -, g dbSNP:727503172
3267 3267 a, g, t dbSNP:397516013
3268 3268 g, t dbSNP:767039057
3271 3271 -, g dbSNP:397516014
3271 3271 a, g dbSNP:371301665
3272 3272 a, t dbSNP:773230208
3273 3273 a, t dbSNP:769925144
3276 3276 -, ca dbSNP:730880671
3276 3276 -, c dbSNP:730880670
3277 3277 a, g dbSNP:748263197
3279 3279 a, t dbSNP:730880590
3282 3282 a, c dbSNP:730880591
3283 3283 a, c, g dbSNP:185428948
3288 3288 c, g dbSNP:786204356
3289 3289 a, c, t dbSNP:200372325
3290 3290 a, g dbSNP:377106864
3295 3295 -, g dbSNP:730880672
3297 3297