Email to GenScript

MYBPC3 myosin binding protein C, cardiac [Homo sapiens (human)]

Gene Symbol MYBPC3
Entrez Gene ID 4607
Full Name myosin binding protein C, cardiac
Synonyms CMD1MM, CMH4, FHC, LVNC10, MYBP-C
General protein information
Preferred Names
myosin-binding protein C, cardiac-type
myosin-binding protein C, cardiac-type
C-protein, cardiac muscle isoform
Gene Type protein-coding
Organism Homo sapiens (human)



Summary MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3, the cardiac isoform, is expressed exclussively in heart muscle. Regulatory phosphorylation of the cardiac isoform in vivo by cAMP-dependent protein kinase (PKA) upon adrenergic stimulation may be linked to modulation of cardiac contraction. Mutations in MYBPC3 are one cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cardiomyopathy, familial hypertrophic, 4, 115197 (3);

The following MYBPC3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MYBPC3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu44879 XM_011520117 PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu59134 XM_011520118 PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu27085 NM_000256 Homo sapiens myosin binding protein C, cardiac (MYBPC3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu44879
Accession Version XM_011520117.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3807bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product myosin-binding protein C, cardiac-type isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)89..337(+)
Misc Feature(2)98..322(+)
Misc Feature(3)536..823(+)
Misc Feature(4)596..787(+)
Misc Feature(5)1130..1384(+)
Misc Feature(6)1208..1351(+)
Misc Feature(7)1403..1660(+)
Misc Feature(8)1448..>1612(+)
Misc Feature(9)1724..1924(+)
Misc Feature(10)1997..2341(+)
Misc Feature(11)2000..2341(+)
Misc Feature(12)2351..2623(+)
Misc Feature(13)2351..2596(+)
Misc Feature(14)2597..2611(+)
Misc Feature(15)2645..2926(+)
Misc Feature(16)2645..2890(+)
Misc Feature(17)2891..2905(+)
Misc Feature(18)2978..3223(+)
Misc Feature(19)3005..3223(+)
Misc Feature(20)3233..3499(+)
Misc Feature(21)3233..3475(+)
Misc Feature(22)3476..3490(+)
Misc Feature(23)3578..3847(+)
Misc Feature(24)3629..3832(+)
Position Chain Variation Link
6 6 -, c dbSNP:768257586
9 9 c, t dbSNP:763924149
10 10 c, t dbSNP:760572113
14 14 a, g dbSNP:553644150
18 18 c, t dbSNP:767039719
31 31 c, t dbSNP:758914519
32 32 a, g dbSNP:369797789
38 38 a, g dbSNP:770669714
45 45 c, t dbSNP:762719022
46 46 a, g dbSNP:567307744
58 58 a, c, g dbSNP:397516045
66 66 c, t dbSNP:748689012
67 67 a, g dbSNP:377292092
68 68 c, g dbSNP:201278114
82 82 a, c dbSNP:746076911
88 88 c, t dbSNP:2596402
94 94 c, g dbSNP:730880136
96 96 a, g dbSNP:779049126
101 101 c, t dbSNP:730880573
104 104 c, t dbSNP:747857800
105 105 a, g, t dbSNP:374630007
109 109 a, g dbSNP:751590263
121 121 c, t dbSNP:765986295
122 122 a, c, g dbSNP:758044508
128 128 a, t dbSNP:749970304
129 129 a, g dbSNP:371140684
136 136 c, t dbSNP:761547225
137 137 a, g dbSNP:776834755
142 142 c, t dbSNP:764557472
143 143 a, g dbSNP:761079937
146 146 a, g dbSNP:536744834
148 148 c, t dbSNP:397516085
149 149 a, c, g dbSNP:730880575
153 153 -, ca dbSNP:745811346
158 158 a, c, t dbSNP:727504249
159 159 a, g dbSNP:397515885
162 162 a, c dbSNP:376646845
163 163 a, g dbSNP:754870909
172 172 g, t dbSNP:747965077
173 173 a, g dbSNP:780085131
176 176 a, c, t dbSNP:373638535
177 177 a, g dbSNP:764849803
179 179 -, tggc dbSNP:730880659
185 185 c, t dbSNP:557439091
186 186 a, g dbSNP:369205562
187 187 a, c, t dbSNP:377579620
188 188 a, g dbSNP:775837337
193 193 c, g dbSNP:767973005
200 200 a, t dbSNP:760058908
201 201 -, tca dbSNP:781207661
202 202 c, t dbSNP:774273586
203 203 a, g dbSNP:373164247
205 205 c, t dbSNP:368918487
206 206 a, g, t dbSNP:534282225
207 207 c, t dbSNP:746738538
220 220 c, t dbSNP:780012957
221 221 a, g dbSNP:397515918
227 227 -, g dbSNP:730880662
230 230 a, g dbSNP:121909375
232 232 -, agagggcacac dbSNP:397515925
234 234 -, ag dbSNP:786204324
237 237 a, g dbSNP:546345474
237 237 -, g dbSNP:730880663
239 239 a, c dbSNP:377225516
242 242 c, t dbSNP:373315466
243 243 a, g dbSNP:549239819
249 249 c, t dbSNP:753300898
250 250 a, g dbSNP:370102200
261 261 a, g dbSNP:397515945
262 262 c, g dbSNP:397515946
263 263 g, t dbSNP:11570045
270 270 -, gg dbSNP:730880362
271 271 a, c, t dbSNP:760007714
278 278 a, g dbSNP:375471260
283 283 a, g dbSNP:766359851
285 285 a, g dbSNP:730880580
290 290 a, t dbSNP:730880581
292 292 -, c dbSNP:730880664
292 292 c, g, t dbSNP:730880698
293 293 a, g dbSNP:730880700
294 294 c, gagg dbSNP:727504335
295 295 a, g dbSNP:770089112
301 301 c, t dbSNP:372502369
306 306 a, g dbSNP:569824900
312 312 c, g dbSNP:772057451
318 318 a, t dbSNP:730880583
325 325 c, t dbSNP:367990952
326 326 a, g dbSNP:778851720
335 335 g, t dbSNP:770777166
338 338 a, c dbSNP:549758428
339 339 c, t dbSNP:727504945
342 342 a, g dbSNP:777170653
345 345 c, t dbSNP:397515993
360 360 c, t dbSNP:730880610
370 370 c, g dbSNP:770853232
377 377 c, t dbSNP:749233808
378 378 c, t dbSNP:772678776
379 379 -, t dbSNP:730880721
381 381 c, t dbSNP:397516011
387 387 c, t dbSNP:730880530
388 388 -, t dbSNP:730880335
388 388 c, t dbSNP:397516017
393 393 a, c dbSNP:730880611
394 394 c, t dbSNP:786204325
395 395 a, g dbSNP:730880612
398 398 a, g, t dbSNP:727503220
405 405 -, c dbSNP:397516023
410 410 a, g dbSNP:397516025
417 417 -, c dbSNP:397516032
417 417 c, t dbSNP:551888783
418 418 a, g dbSNP:780768974
419 419 a, g dbSNP:754633960
427 427 c, t dbSNP:11570046
428 428 a, g, t dbSNP:370958401
433 433 a, g dbSNP:758903546
436 436 a, g dbSNP:750955473
457 457 c, t dbSNP:397516046
460 460 a, g dbSNP:727504318
461 461 a, g dbSNP:730880613
463 463 -, g dbSNP:771005018
465 465 c, g dbSNP:730880703
467 467 a, g dbSNP:776154213
471 471 c, g dbSNP:730880704
473 473 c, g dbSNP:730880614
474 474 c, t dbSNP:786205352
483 483 a, g dbSNP:730880705
486 486 -, gt dbSNP:397516047
489 489 a, c dbSNP:768309693
491 491 -, a dbSNP:397516049
491 491 a, c, g dbSNP:397516048
492 492 c, t dbSNP:780458215
495 495 c, t dbSNP:730880615
497 497 a, g dbSNP:397516050
501 501 a, c, t dbSNP:779493486
505 505 -, c dbSNP:730880677
505 505 c, g, t dbSNP:377520770
506 506 a, g dbSNP:397516051
508 508 -, t dbSNP:730880679
510 510 -, ac dbSNP:730880680
513 513 a, c dbSNP:756328813
514 514 -, c dbSNP:397516052
516 516 c, t dbSNP:373946195
521 521 -, c dbSNP:730880366
522 522 c, t dbSNP:730880616
526 526 c, t dbSNP:150291001
527 527 a, g dbSNP:3729986
532 532 a, g dbSNP:730880706
533 533 c, t dbSNP:193068692
534 534 a, g dbSNP:730880617
536 536 a, c dbSNP:397516053
538 538 a, g dbSNP:373133807
539 539 c, t dbSNP:730880618
547 547 c, t dbSNP:3218719
550 550 c, g dbSNP:730880619
556 556 c, t dbSNP:397516054
557 557 a, g dbSNP:569740494
558 558 c, t dbSNP:727505267
559 559 a, g dbSNP:550047739
567 567 a, g dbSNP:369683229
568 568 c, t dbSNP:778679153
572 572 a, g dbSNP:727505168
573 573 a, c, t dbSNP:113941605
576 576 -, tct dbSNP:730880722
582 582 c, g, t dbSNP:753683535
584 584 c, t dbSNP:193922385
585 585 a, g dbSNP:201012766
586 586 c, t dbSNP:368035400
587 587 a, g dbSNP:727503218
588 588 -, t dbSNP:727503217
589 589 g, t dbSNP:759249105
592 592 c, t dbSNP:11570051
593 593 a, g dbSNP:766132641
595 595 -, cgccagcctcctgaagccgc dbSNP:397516058
595 595 c, t dbSNP:371842442
596 596 a, g dbSNP:773646282
597 597 -, gc dbSNP:786204327
604 604 c, t dbSNP:368604485
606 606 -, t dbSNP:397516059
607 607 a, g dbSNP:748725922
608 608 a, c, t dbSNP:375607980
609 609 a, g dbSNP:768795353
612 612 c, t dbSNP:727503216
613 613 a, g, t dbSNP:370962887
620 620 a, g dbSNP:11570052
621 621 a, t dbSNP:397516060
623 623 a, g dbSNP:777665200
626 626 c, t dbSNP:730880622
628 628 g, t dbSNP:755983199
637 637 a, c dbSNP:375673378
641 641 -, t dbSNP:730880681
643 643 c, g dbSNP:727503215
653 653 a, g dbSNP:370554185
658 658 c, t dbSNP:762834457
659 659 a, c dbSNP:730880623
668 668 c, t dbSNP:397516061
673 673 c, t dbSNP:751125697
679 679 c, g dbSNP:202139499
685 685 c, t dbSNP:762695516
686 686 a, g dbSNP:773414747
688 688 c, t dbSNP:765678794
689 689 a, g dbSNP:762226459
691 691 c, g dbSNP:397516062
694 694 c, t dbSNP:727504858
695 695 a, g dbSNP:769167548
698 698 c, t dbSNP:397516063
699 699 a, g dbSNP:775580020
700 700 c, t dbSNP:397516064
701 701 a, g dbSNP:201098973
703 703 c, t dbSNP:777418402
704 704 a, g dbSNP:138753870
708 708 a, g dbSNP:730880707
710 710 c, g, t dbSNP:397516068
714 714 a, g dbSNP:779693951
721 721 c, t dbSNP:371331114
722 722 a, g dbSNP:397516069
724 724 a, g dbSNP:778582048
736 736 c, t dbSNP:756894628
737 737 a, g dbSNP:369300885
739 739 c, g, t dbSNP:532498780
755 755 a, c, g dbSNP:753271103
756 756 -, atcaccgatgcccagcctgccttcac dbSNP:786204329
760 760 c, t dbSNP:767913494
761 761 a, g dbSNP:3729989
764 764 c, t dbSNP:730880624
765 765 a, c dbSNP:397516070
766 766 c, t dbSNP:774316050
767 767 c, t dbSNP:771143409
768 768 a, g dbSNP:727504396
771 771 g, t dbSNP:776541959
777 777 -, t dbSNP:730880683
782 782 a, c dbSNP:730880625
794 794 c, t dbSNP:372574446
797 797 g, t dbSNP:768625454
799 799 a, c dbSNP:2857543
800 800 c, t dbSNP:397516071
801 801 a, g dbSNP:780085082
802 802 c, t dbSNP:771929829
807 807 a, t dbSNP:368588523
813 813 a, g dbSNP:727503214
827 827 a, g dbSNP:397516074
831 831 c, t dbSNP:187455402
834 834 -, t dbSNP:786204332
838 838 a, c dbSNP:766472497
840 840 c, g dbSNP:730880627
841 841 c, t dbSNP:11570058
842 842 a, g dbSNP:373730381
845 845 -, g dbSNP:786204333
854 854 c, g dbSNP:370941975
860 860 c, t dbSNP:762169683
863 863 a, g dbSNP:775337081
869 869 c, t dbSNP:397516075
870 870 a, g dbSNP:759515993
872 872 c, t dbSNP:551119259
873 873 a, g dbSNP:376461745
876 876 c, t dbSNP:748746951
877 877 a, g dbSNP:751392149
888 888 a, g dbSNP:147315081
888 888 -, g dbSNP:727503212
891 891 c, g dbSNP:375774648
896 896 c, t dbSNP:371711564
897 897 a, g dbSNP:11570060
899 899 c, t dbSNP:727504234
900 900 a, g dbSNP:761520688
905 905 a, g dbSNP:776075902
908 908 a, g dbSNP:727504523
914 914 c, t dbSNP:776238883
939 939 -, t dbSNP:730880684
941 941 a, g dbSNP:768164989
947 947 c, t dbSNP:760429280
956 956 a, t dbSNP:730880629
968 968 a, t dbSNP:397516084
969 969 a, c, t dbSNP:193922386
970 970 a, c, g dbSNP:374326087
980 980 g, t dbSNP:749867888
986 986 a, g dbSNP:780896631
993 993 a, c dbSNP:545675333
997 997 c, g, t dbSNP:369900803
998 998 a, c, g dbSNP:200119454
1001 1001 c, t dbSNP:730880708
1003 1003 a, g dbSNP:727503211
1007 1007 a, t dbSNP:765732047
1013 1013 a, c, t dbSNP:776681371
1014 1014 a, g dbSNP:34580776
1016 1016 c, t dbSNP:727503210
1030 1030 -, t dbSNP:727503209
1031 1031 a, g dbSNP:397516086
1036 1036 c, g, t dbSNP:367947846
1037 1037 a, g, t dbSNP:573916965
1040 1040 c, t dbSNP:730880630
1043 1043 a, t dbSNP:777470695
1045 1045 c, t dbSNP:397515880
1046 1046 a, g dbSNP:769830766
1052 1052 c, t dbSNP:730880631
1057 1057 c, t dbSNP:556616131
1058 1058 a, g dbSNP:397515881
1060 1060 c, t dbSNP:754469813
1061 1061 a, g dbSNP:397515882
1062 1062 a, t dbSNP:730880709
1065 1065 -, c dbSNP:730880686
1072 1072 a, g dbSNP:779704622
1074 1074 a, g dbSNP:397515883
1075 1075 c, t dbSNP:758016271
1076 1076 a, g dbSNP:397515884
1079 1079 -, cggca dbSNP:730880336
1093 1093 c, g dbSNP:375007425
1106 1106 cgcg, gc dbSNP:730880687
1107 1107 a, g dbSNP:199741162
1108 1108 a, c, t dbSNP:371308153
1109 1109 a, g dbSNP:746267533
1111 1111 a, t dbSNP:775464343
1117 1117 c, g dbSNP:730880632
1119 1119 -, aga dbSNP:775069579
1120 1120 a, g dbSNP:781216464
1121 1121 -, a dbSNP:730880723
1121 1121 a, g dbSNP:730880633
1128 1128 c, t dbSNP:778161908
1137 1137 a, g dbSNP:756633062
1138 1138 g, t dbSNP:753209030
1149 1149 c, g, t dbSNP:397515887
1157 1157 -, c dbSNP:730880688
1157 1157 a, c, t dbSNP:730880635
1160 1160 a, g dbSNP:727503208
1170 1170 c, g dbSNP:766664184
1180 1180 -, tc dbSNP:769490852
1181 1181 -, c dbSNP:759194130
1181 1181 c, t dbSNP:11570076
1182 1182 a, g dbSNP:753660871
1184 1184 c, g dbSNP:11570077
1189 1189 c, g, t dbSNP:775237084
1190 1190 a, g dbSNP:772073491
1193 1193 g, t dbSNP:397515888
1199 1199 -, g dbSNP:730880724
1205 1205 -, c dbSNP:397515889
1208 1208 -, gaactggctgaccatg dbSNP:730880689
1208 1208 g, t dbSNP:759008026
1210 1210 c, t dbSNP:377328238
1216 1216 a, g dbSNP:770549835
1217 1217 a, g dbSNP:749000345
1219 1219 a, c, g dbSNP:730880636
1225 1225 a, g, t dbSNP:397515890
1238 1238 c, t dbSNP:730880637
1247 1247 c, t dbSNP:727504329
1248 1248 a, c dbSNP:769985511
1250 1250 a, g dbSNP:727503207
1251 1251 a, t dbSNP:560140258
1255 1255 c, t dbSNP:748558425
1256 1256 a, g dbSNP:727505266
1259 1259 a, c dbSNP:730880638
1265 1265 -, ggt dbSNP:746979805
1269 1269 a, t dbSNP:774293794
1272 1272 -, tt dbSNP:397515894
1275 1275 a, g dbSNP:730880532
1283 1283 a, g dbSNP:371513491
1289 1289 a, t dbSNP:730880533
1292 1292 a, c, t dbSNP:368770848
1293 1293 a, c, g dbSNP:770030288
1301 1301 a, c dbSNP:727503206
1310 1310 c, t dbSNP:397515895
1315 1315 c, t dbSNP:746770543
1318 1318 a, g dbSNP:779873317
1319 1319 c, t dbSNP:758253767
1323 1323 a, c, t dbSNP:370412052
1324 1324 a, g dbSNP:778718628
1325 1325 a, g dbSNP:730880534
1327 1327 c, t dbSNP:200664621
1328 1328 a, g dbSNP:753321277
1330 1330 c, t dbSNP:763808974
1331 1331 a, g dbSNP:371167525
1339 1339 c, t dbSNP:190228518
1342 1342 a, g dbSNP:768065513
1345 1345 c, t dbSNP:759826878
1346 1346 a, g, t dbSNP:730880535
1347 1347 -, t dbSNP:397515896
1353 1353 a, g dbSNP:763045718
1353 1353 -, g dbSNP:730880710
1356 1356 a, g dbSNP:142317339
1357 1357 c, t dbSNP:368192024
1358 1358 a, g dbSNP:193922377
1362 1362 a, g dbSNP:779820034
1363 1363 a, g dbSNP:771832243
1367 1367 -, a dbSNP:727505152
1371 1371 c, t dbSNP:745661443
1372 1372 a, g dbSNP:727503205
1375 1375 a, g dbSNP:757182984
1380 1380 c, t dbSNP:727504279
1384 1384 g, t dbSNP:539453748
1388 1388 g, t dbSNP:786204338
1392 1392 a, c dbSNP:730880536
1394 1394 -, cc dbSNP:727503203
1394 1394 c, g dbSNP:749310275
1395 1395 -, c dbSNP:730880711
1395 1395 c, t dbSNP:397515898
1398 1398 c, t dbSNP:755631466
1400 1400 c, t dbSNP:747686377
1402 1402 c, t dbSNP:780854746
1407 1407 c, t dbSNP:370538243
1408 1408 a, g dbSNP:538072263
1409 1409 c, t dbSNP:377577698
1410 1410 a, g dbSNP:374255707
1412 1412 c, t dbSNP:758901980
1414 1414 -, c dbSNP:786204339
1418 1418 g, t dbSNP:730880537
1421 1421 a, g dbSNP:755991329
1424 1424 c, t dbSNP:730880538
1432 1432 a, g dbSNP:750861980
1434 1434 a, t dbSNP:397515899
1442 1442 c, g, t dbSNP:730880539
1446 1446 a, g dbSNP:776734314
1447 1447 -, gg dbSNP:730880642
1455 1455 c, t dbSNP:397515900
1459 1459 a, c, g dbSNP:397515901
1460 1460 c, t dbSNP:760864668
1468 1468 a, g dbSNP:587781042
1470 1470 c, t dbSNP:730880540
1471 1471 a, g dbSNP:770568659
1477 1477 a, g dbSNP:749110971
1479 1479 a, g dbSNP:773237942
1482 1482 c, t dbSNP:370285346
1483 1483 g, t dbSNP:747627648
1484 1484 c, t dbSNP:730880541
1493 1493 c, g, t dbSNP:397515902
1494 1494 a, g dbSNP:730880542
1496 1496 a, c dbSNP:771741441
1502 1502 g, t dbSNP:546002111
1504 1504 c, g, t dbSNP:35690719
1505 1505 a, g dbSNP:200625851
1506 1506 a, g, t dbSNP:397514752
1508 1508 a, g dbSNP:730880543
1509 1509 g, t dbSNP:778361492
1519 1519 c, t dbSNP:756101990
1520 1520 a, c, g, t dbSNP:397515905
1521 1521 a, g dbSNP:200411226
1524 1524 a, g dbSNP:759884209
1530 1530 a, c dbSNP:750225859
1531 1531 c, g dbSNP:397515906
1536 1536 a, c dbSNP:761672176
1540 1540 c, g dbSNP:776373836
1541 1541 c, t dbSNP:375882485
1542 1542 -, ggttc dbSNP:587782957
1542 1542 a, g, t dbSNP:397515907
1550 1550 -, aag dbSNP:727504287
1550 1550 a, t dbSNP:786204340
1555 1555 c, t dbSNP:397515908
1556 1556 a, g dbSNP:35736435
1559 1559 c, t dbSNP:730880544
1572 1572 a, c, t dbSNP:397515909
1573 1573 a, g dbSNP:771702316
1577 1577 a, g dbSNP:727503200
1580 1580 -, aac dbSNP:730880643
1581 1581 a, g dbSNP:181834806
1582 1582 c, t dbSNP:771230605
1583 1583 a, g dbSNP:730880545
1584 1584 -, agg dbSNP:786204341
1591 1591 a, g dbSNP:372499440
1594 1594 g, t dbSNP:778105166
1600 1600 c, t dbSNP:367915627
1601 1601 a, g dbSNP:11570082
1602 1602 c, t dbSNP:370362589
1603 1603 a, g dbSNP:376041792
1612 1612 g, t dbSNP:397515910
1615 1615 a, g, t dbSNP:766721220
1617 1617 -, cact dbSNP:730880712
1617 1617 c, t dbSNP:761466191
1623 1623 c, g dbSNP:397515911
1626 1626 a, g dbSNP:753696015
1627 1627 c, t dbSNP:763905291
1628 1628 a, c, g dbSNP:397515912
1630 1630 a, g dbSNP:727503199
1632 1632 a, g, t dbSNP:730880547
1632 1632 -, g dbSNP:730880640
1636 1636 c, g dbSNP:773947559
1638 1638 c, t dbSNP:374349666
1639 1639 a, g dbSNP:370945942
1641 1641 c, t dbSNP:730880548
1645 1645 a, t dbSNP:200224422
1652 1652 a, g dbSNP:770186287
1660 1660 a, c, g dbSNP:781764759
1661 1661 c, g dbSNP:121909374
1665 1665 -, a dbSNP:727504248
1670 1670 a, c dbSNP:377163678
1676 1676 a, g dbSNP:752523427
1676 1676 -, g dbSNP:757777349
1678 1678 -, gt dbSNP:398123279
1678 1678 a, g dbSNP:397515915
1689 1689 -, tcgca dbSNP:730880644
1690 1690 c, t dbSNP:767414501
1691 1691 g, t dbSNP:727504887
1701 1701 c, t dbSNP:730880692
1706 1706 a, g dbSNP:730880693
1707 1707 a, g dbSNP:730880549
1708 1708 c, t dbSNP:751052593
1709 1709 a, g dbSNP:727503198
1714 1714 a, g dbSNP:762369686
1715 1715 c, g dbSNP:750030159
1715 1715 -, g dbSNP:727504366
1721 1721 a, g dbSNP:397515919
1722 1722 a, c, t dbSNP:730880694
1723 1723 a, g dbSNP:762228885
1726 1726 a, g dbSNP:777173469
1730 1730 a, t dbSNP:397515920
1733 1733 c, t dbSNP:730880695
1736 1736 -, ga dbSNP:727503197
1737 1737 -, ag dbSNP:730880645
1756 1756 a, g, t dbSNP:397515921
1757 1757 a, c, t dbSNP:61897383
1758 1758 a, g dbSNP:397515922
1763 1763 a, g dbSNP:772132916
1768 1768 a, g dbSNP:730880546
1769 1769 c, t dbSNP:745957052
1771 1771 -, g dbSNP:730880646
1795 1795 c, t dbSNP:727505203
1796 1796 a, g dbSNP:730880526
1801 1801 c, t dbSNP:747918558
1803 1803 a, g dbSNP:397515923
1805 1805 a, g dbSNP:754904833
1810 1810 g, t dbSNP:754902004
1813 1813 -, gt dbSNP:730880713
1813 1813 a, g dbSNP:727503196
1815 1815 c, t dbSNP:397515924
1820 1820 a, g dbSNP:730880550
1822 1822 c, t dbSNP:572227730
1823 1823 a, g dbSNP:199728019
1826 1826 c, t dbSNP:201596087
1827 1827 a, g dbSNP:727503195
1828 1828 c, g dbSNP:772488845
1829 1829 -, g dbSNP:730880647
1837 1837 -, a dbSNP:397515926
1840 1840 a, g dbSNP:397515927
1842 1842 c, t dbSNP:730880551
1843 1843 a, c dbSNP:566461224
1843 1843 -, c dbSNP:730880648
1845 1845 c, t dbSNP:397515928
1846 1846 g, t dbSNP:774348756
1849 1849 c, t dbSNP:397515929
1850 1850 -, cg dbSNP:764743402
1850 1850 a, g dbSNP:376736293
1851 1851 -, acg dbSNP:397515930
1851 1851 a, g dbSNP:372371774
1852 1852 c, t dbSNP:768380030
1853 1853 a, g dbSNP:368482358
1857 1857 c, t dbSNP:375196922
1858 1858 a, g dbSNP:758306575
1859 1859 c, t dbSNP:730880552
1860 1860 c, g dbSNP:778623429
1863 1863 c, t dbSNP:730880553
1864 1864 c, g, t dbSNP:535853707
1865 1865 a, c, g dbSNP:371564200
1866 1866 a, t dbSNP:730880554
1867 1867 c, t dbSNP:768049705
1868 1868 a, g dbSNP:730880555
1870 1870 a, g dbSNP:760023583
1875 1875 -, a dbSNP:730880649
1878 1878 a, g dbSNP:727503194
1879 1879 c, t dbSNP:774488435
1892 1892 a, g dbSNP:200352299
1894 1894 a, g dbSNP:763030622
1896 1896 g, t dbSNP:730880556
1897 1897 c, g dbSNP:773371075
1900 1900 -, c dbSNP:397515931
1900 1900 c, t dbSNP:193922378
1904 1904 a, t dbSNP:746786287
1906 1906 a, c, t dbSNP:397515932
1908 1908 a, g dbSNP:772032697
1923 1923 c, t dbSNP:730880137
1926 1926 a, t dbSNP:745859544
1929 1929 -, t dbSNP:397515933
1932 1932 -, t dbSNP:397515934
1951 1951 c, t dbSNP:377227442
1952 1952 a, g dbSNP:780907679
1956 1956 c, t dbSNP:755244836
1961 1961 c, t dbSNP:727504293
1969 1969 c, t dbSNP:768391385
1971 1971 c, t dbSNP:397515938
1972 1972 c, t dbSNP:727503193
1975 1975 c, g dbSNP:780452445
1979 1979 c, t dbSNP:758901926
1981 1981 c, t dbSNP:750861887
1984 1984 a, c, g dbSNP:757244311
1987 1987 c, g dbSNP:727504250
1992 1992 c, g dbSNP:753992239
1997 1997 c, g, t dbSNP:397515939
1998 1998 a, g dbSNP:1800565
2000 2000 a, c dbSNP:374447249
2005 2005 a, g dbSNP:397515940
2008 2008 c, t dbSNP:751397614
2010 2010 c, t dbSNP:766213616
2013 2013 c, t dbSNP:397515941
2015 2015 a, g, t dbSNP:730880560
2022 2022 c, t dbSNP:772970643
2026 2026 a, t dbSNP:375467797
2036 2036 a, ct, g dbSNP:727503192
2036 2036 a, c dbSNP:761194404
2039 2039 c, t dbSNP:730880561
2040 2040 a, g dbSNP:727503191
2047 2047 c, t dbSNP:558051480
2050 2050 ccct, gg dbSNP:397515943
2053 2053 c, t dbSNP:775127671
2055 2055 c, t dbSNP:772364751
2056 2056 c, t dbSNP:746263346
2067 2067 c, t dbSNP:786204345
2070 2070 a, c dbSNP:779258481
2071 2071 c, t dbSNP:757832991
2072 2072 c, t dbSNP:372493586
2074 2074 a, c dbSNP:749317445
2077 2077 -, t dbSNP:397515944
2078 2078 a, g dbSNP:777978931
2085 2085 a, g dbSNP:397515942
2093 2093 a, c, g dbSNP:367992212
2100 2100 a, c, t dbSNP:3729946
2101 2101 a, g dbSNP:758224257
2111 2111 a, c dbSNP:730880562
2114 2114 g, t dbSNP:771753579
2119 2119 a, g dbSNP:756589409
2133 2133 -, c dbSNP:397515947
2136 2136 a, t dbSNP:746198398
2149 2149 c, t dbSNP:547477069
2150 2150 -, a dbSNP:397515948
2156 2156 a, g dbSNP:774838273
2161 2161 c, t dbSNP:113658284
2165 2165 c, g dbSNP:371020684
2171 2171 g, t dbSNP:749740197
2172 2172 c, t dbSNP:778160438
2191 2191 a, g dbSNP:781477048
2198 2198 a, t dbSNP:768993308
2200 2200 a, c, t dbSNP:397515951
2200 2200 -, c dbSNP:397515952
2201 2201 a, c, g dbSNP:730880696
2207 2207 c, t dbSNP:200399246
2208 2208 a, g dbSNP:756102881
2213 2213 c, t dbSNP:752200396
2214 2214 a, g dbSNP:397515953
2215 2215 c, t dbSNP:370676057
2216 2216 a, g dbSNP:564378953
2219 2219 g, t dbSNP:397515954
2224 2224 c, t dbSNP:765983279
2225 2225 a, c dbSNP:763341155
2226 2226 c, t dbSNP:773757669
2231 2231 g, t dbSNP:770408214
2233 2233 c, t dbSNP:397515955
2234 2234 a, c, t dbSNP:397515956
2235 2235 a, g, t dbSNP:534345197
2237 2237 a, g dbSNP:747081382
2239 2239 c, t dbSNP:780282339
2247 2247 c, t dbSNP:199893357
2248 2248 a, g dbSNP:113265977
2251 2251 c, t dbSNP:777613325
2254 2254 g, t dbSNP:786204348
2258 2258 -, g dbSNP:730880650
2271 2271 a, g dbSNP:727503190
2278 2278 c, t dbSNP:755910458
2279 2279 a, g dbSNP:730880563
2286 2286 c, t dbSNP:727503189
2287 2287 a, g dbSNP:373338699
2295 2295 -, t dbSNP:774521272
2304 2304 -, c dbSNP:730880651
2306 2306 a, g dbSNP:369790992
2308 2308 a, g dbSNP:766029254
2311 2311 c, t dbSNP:397515957
2312 2312 a, g dbSNP:750810342
2314 2314 a, g dbSNP:765629179
2315 2315 c, g dbSNP:762280284
2325 2325 a, g dbSNP:730880527
2326 2326 c, t dbSNP:777228369
2332 2332 a, t dbSNP:764539455
2337 2337 a, g dbSNP:760786216
2344 2344 c, t dbSNP:775491112
2345 2345 a, g dbSNP:36211723
2347 2347 c, t dbSNP:397515959
2348 2348 -, g dbSNP:397515960
2348 2348 a, g dbSNP:371488302
2349 2349 c, t dbSNP:397515961
2356 2356 c, t dbSNP:397515962
2357 2357 a, g dbSNP:368104687
2361 2361 c, g dbSNP:730880564
2367 2367 c, t dbSNP:759631792
2373 2373 a, g dbSNP:774512738
2374 2374 g, t dbSNP:771179191
2376 2376 g, t dbSNP:747912257
2382 2382 a, g dbSNP:776351251
2383 2383 c, t dbSNP:768638405
2389 2389 a, g dbSNP:746858516
2400 2400 g, t dbSNP:780056346
2409 2409 a, g dbSNP:757934210
2410 2410 -, g dbSNP:397515963
2411 2411 c, g, t dbSNP:187830361
2414 2414 c, g dbSNP:778678513
2418 2418 c, t dbSNP:730880565
2419 2419 -, g dbSNP:730880714
2428 2428 a, c, t dbSNP:727504864
2429 2429 a, g dbSNP:764297991
2431 2431 -, t dbSNP:730880341
2434 2434 c, t dbSNP:756512665
2435 2435 a, g dbSNP:727504574
2446 2446 a, c dbSNP:202088839
2447 2447 a, c dbSNP:3729950
2451 2451 a, g dbSNP:730880566
2463 2463 a, g dbSNP:766382260
2466 2466 a, g, t dbSNP:375675796
2472 2472 a, g dbSNP:786204350
2473 2473 g, t dbSNP:727504251
2474 2474 a, t dbSNP:727504252
2476 2476 c, g dbSNP:727505264
2478 2478 -, aga dbSNP:727504288
2480 2480 -, cga dbSNP:746234586
2486 2486 c, t dbSNP:727503188
2487 2487 a, c, g dbSNP:397515964
2491 2491 a, g dbSNP:397515965
2492 2492 -, atgcg dbSNP:730880652
2495 2495 c, t dbSNP:775404728
2496 2496 a, c, g dbSNP:2856655
2497 2497 a, g dbSNP:532996422
2507 2507 a, g dbSNP:774442478
2516 2516 a, c dbSNP:375322174
2519 2519 c, g dbSNP:770514536
2521 2521 a, g dbSNP:765583270
2524 2524 g, t dbSNP:201040413
2526 2526 a, g dbSNP:769531658
2527 2527 -, t dbSNP:397515966
2528 2528 c, t dbSNP:748443032
2534 2534 a, g dbSNP:199865688
2535 2535 c, t dbSNP:3729952
2536 2536 a, g dbSNP:397515967
2537 2537 c, t dbSNP:752007810
2538 2538 a, g dbSNP:540988604
2539 2539 g, t dbSNP:758371979
2540 2540 a, c, t dbSNP:765356720
2541 2541 a, g, t dbSNP:527305885
2542 2542 c, t dbSNP:561942028
2548 2548 -, c dbSNP:730880653
2548 2548 c, t dbSNP:542181308
2549 2549 a, c, g dbSNP:397515969
2554 2554 -, cgtggtgtacgagatgcgcgtc dbSNP:727503187
2554 2554 c, t dbSNP:370561202
2555 2555 a, g dbSNP:376936056
2561 2561 -, t dbSNP:397515970
2562 2562 a, g dbSNP:397515971
2563 2563 c, t dbSNP:373792537
2564 2564 a, g dbSNP:730880567
2565 2565 -, agatgcgcg dbSNP:397515972
2569 2569 -, gcgcgtc dbSNP:730880654
2570 2570 c, g, t dbSNP:727504345
2571 2571 -, gcgtc dbSNP:397515973
2571 2571 a, c, g dbSNP:730880568
2573 2573 a, g dbSNP:747774791
2574 2574 a, t dbSNP:193922379
2575 2575 c, g dbSNP:776282342
2576 2576 c, t dbSNP:768963157
2578 2578 a, c, g dbSNP:397515974
2579 2579 a, g dbSNP:747407752
2580 2580 -, c dbSNP:730880715
2580 2580 c, g, t dbSNP:730880569
2581 2581 a, g dbSNP:369904619
2583 2583 c, t dbSNP:745922957
2584 2584 c, t dbSNP:3729953
2586 2586 a, t dbSNP:730880570
2588 2588 a, g dbSNP:730880571
2589 2589 c, t dbSNP:774172488
2592 2592 -, t dbSNP:752104988
2593 2593 cg, tct dbSNP:397515975
2593 2593 -, c dbSNP:727503186
2593 2593 c, t dbSNP:754062873
2594 2594 a, g, t dbSNP:397515976
2595 2595 -, g dbSNP:397515977
2597 2597 a, g, t dbSNP:373171036
2599 2599 a, g dbSNP:730880572
2602 2602 c, g dbSNP:763010875
2605 2605 g, t dbSNP:773032022
2607 2607 c, t dbSNP:764750484
2610 2610 a, g dbSNP:727503185
2613 2613 c, t dbSNP:761338253
2623 2623 a, g dbSNP:776229039
2635 2635 c, t dbSNP:767998170
2636 2636 a, g dbSNP:768339148
2638 2638 c, t dbSNP:11570097
2639 2639 a, g dbSNP:775890771
2641 2641 a, tc dbSNP:727504371
2641 2641 -, t dbSNP:730880655
2647 2647 -, c dbSNP:397515979
2647 2647 -, c dbSNP:730880656
2650 2650 c, t dbSNP:531228202
2651 2651 a, g dbSNP:190765116
2655 2655 a, c, t dbSNP:371401403
2658 2658 c, t dbSNP:759847861
2661 2661 a, t dbSNP:774889182
2669 2669 a, g dbSNP:730880574
2677 2677 c, t dbSNP:397515980
2678 2678 a, g dbSNP:727504360
2691 2691 c, t dbSNP:397515981
2692 2692 a, g dbSNP:769996102
2705 2705 g, t dbSNP:748326848
2707 2707 a, g dbSNP:397515982
2708 2708 c, t dbSNP:727504418
2709 2709 a, g dbSNP:727504378
2713 2713 a, c, g dbSNP:559961809
2719 2719 g, t dbSNP:369289966
2720 2720 c, t dbSNP:374976635
2721 2721 a, g dbSNP:372628478
2723 2723 a, g dbSNP:35078470
2730 2730 c, t dbSNP:752354801
2739 2739 c, t dbSNP:767113733
2746 2746 -, ctacagcgtgg dbSNP:730880657
2751 2751 a, g dbSNP:397515983
2752 2752 c, t dbSNP:759920601
2753 2753 a, g dbSNP:774634021
2760 2760 a, g dbSNP:397515984
2765 2765 a, c dbSNP:397515985
2774 2774 -, t dbSNP:730880658
2776 2776 -, c dbSNP:730880660
2781 2781 -, a dbSNP:730880661
2784 2784 a, g dbSNP:727504349
2785 2785 a, g dbSNP:730880576
2790 2790 -, g dbSNP:34114081
2795 2795 c, t dbSNP:767182632
2798 2798 c, g dbSNP:367729718
2802 2802 a, g dbSNP:751224775
2806 2806 a, g dbSNP:577575638
2808 2808 c, t dbSNP:200406864
2817 2817 -, ca dbSNP:727504265
2820 2820 c, t dbSNP:773819168
2821 2821 a, c, g dbSNP:372510974
2829 2829 -, t dbSNP:730880716
2837 2837 c, g, t dbSNP:367980215
2844 2844 a, c, t dbSNP:374946555
2845 2845 a, g dbSNP:370530334
2849 2849 g, t dbSNP:556390274
2852 2852 c, t dbSNP:534366414
2859 2859 c, t dbSNP:575117255
2864 2864 c, t dbSNP:387907267
2865 2865 a, g dbSNP:397515986
2870 2870 -, cg dbSNP:397515987
2870 2870 c, t dbSNP:727503183
2875 2875 a, g dbSNP:376858768
2876 2876 a, c dbSNP:397515988
2877 2877 a, g dbSNP:754525416
2878 2878 a, c dbSNP:751120827
2880 2880 a, c dbSNP:121909376
2883 2883 -, t dbSNP:786204352
2883 2883 c, t dbSNP:766165160
2886 2886 c, t dbSNP:730880577
2891 2891 c, g dbSNP:554694434
2893 2893 g, t dbSNP:397515989
2897 2897 a, g dbSNP:373744177
2901 2901 -, ct dbSNP:397515990
2907 2907 c, g dbSNP:193922380
2910 2910 c, t dbSNP:376504548
2912 2912 -, ac dbSNP:727503182
2913 2913 c, t dbSNP:730880697
2914 2914 a, g dbSNP:727503181
2919 2919 c, t dbSNP:373056282
2920 2920 a, g dbSNP:568935618
2921 2921 c, g dbSNP:772327857
2923 2923 a, g dbSNP:369685402
2928 2928 c, t dbSNP:773053868
2930 2930 c, t dbSNP:730880578
2931 2931 a, g dbSNP:769631967
2934 2934 a, t dbSNP:730880579
2941 2941 c, g dbSNP:747974933
2942 2942 c, t dbSNP:397515992
2945 2945 c, t dbSNP:730880138
2946 2946 a, g dbSNP:727504346
2951 2951 c, t dbSNP:193922382
2952 2952 a, g dbSNP:761696555
2957 2957 c, t dbSNP:727503180
2975 2975 c, t dbSNP:397515994
2976 2976 a, g dbSNP:727503179
2979 2979 a, c dbSNP:730880582
2980 2980 -, gacca dbSNP:397515995
2990 2990 a, t dbSNP:727504423
2998 2998 c, t dbSNP:761700877
2999 2999 a, g dbSNP:779781718
3000 3000 g, t dbSNP:727504942
3002 3002 g, t dbSNP:727503178
3005 3005 a, c dbSNP:776100156
3017 3017 c, t dbSNP:375776406
3019 3019 c, t dbSNP:745460535
3021 3021 a, t dbSNP:778651716
3029 3029 c, g, t dbSNP:11570112
3030 3030 a, g dbSNP:727503177
3034 3034 c, t dbSNP:377283955
3040 3040 c, t dbSNP:397515996
3041 3041 c, t dbSNP:3729799
3042 3042 a, g dbSNP:727504235
3046 3046 g, t dbSNP:749611054
3054 3054 a, c dbSNP:778132423
3056 3056 c, t dbSNP:730880585
3058 3058 a, g dbSNP:730880701
3066 3066 -, ag dbSNP:730880665
3068 3068 a, g dbSNP:756480912
3070 3070 a, g dbSNP:748601708
3071 3071 c, t dbSNP:730880586
3077 3077 -, c dbSNP:397515997
3080 3080 a, g dbSNP:781685082
3085 3085 c, t dbSNP:397515998
3086 3086 a, g dbSNP:368180702
3088 3088 a, g dbSNP:375552602
3089 3089 c, g dbSNP:372003333
3094 3094 c, g dbSNP:750618688
3101 3101 c, t dbSNP:397515999
3102 3102 a, c, g dbSNP:397516000
3104 3104 a, g dbSNP:775530483
3105 3105 -, a dbSNP:397516001
3109 3109 a, c dbSNP:767605155
3116 3116 aa, g dbSNP:730880666
3116 3116 c, g dbSNP:759102022
3120 3120 c, g, t dbSNP:397516002
3123 3123 a, t dbSNP:730880587
3124 3124 c, t dbSNP:201515977
3126 3126 -, tgttcatccgggc dbSNP:727503175
3126 3126 c, t dbSNP:730880588
3127 3127 a, g, t dbSNP:770351760
3134 3134 c, t dbSNP:748909815
3135 3135 a, g dbSNP:397516003
3139 3139 c, t dbSNP:200663253
3140 3140 a, g dbSNP:552505566
3142 3142 a, t dbSNP:748548738
3143 3143 c, t dbSNP:61729664
3144 3144 a, g dbSNP:374255381
3145 3145 c, g dbSNP:747059136
3146 3146 c, g, t dbSNP:758421775
3147 3147 a, g dbSNP:750609594
3148 3148 c, t dbSNP:765589466
3149 3149 a, g dbSNP:370223247
3150 3150 a, t dbSNP:752595474
3153 3153 a, g dbSNP:368633238
3155 3155 g, t dbSNP:730880139
3159 3159 a, g dbSNP:759450911
3160 3160 c, t dbSNP:374626656
3164 3164 a, c, t dbSNP:762396429
3166 3166 a, c, t dbSNP:573821685
3174 3174 c, t dbSNP:371061770
3175 3175 a, g dbSNP:762154672
3179 3179 c, t dbSNP:11570113
3180 3180 a, g dbSNP:769018051
3184 3184 a, t dbSNP:747495607
3185 3185 a, g dbSNP:780449220
3189 3189 a, g dbSNP:772151277
3191 3191 a, g dbSNP:730880589
3202 3202 a, g dbSNP:779257107
3203 3203 -, g dbSNP:727503174
3205 3205 -, c dbSNP:760491068
3205 3205 c, t dbSNP:373208282
3206 3206 a, g dbSNP:786204355
3207 3207 c, t dbSNP:754115924
3208 3208 a, g dbSNP:397516004
3212 3212 c, g dbSNP:754747269
3218 3218 c, t dbSNP:397516005
3227 3227 a, g dbSNP:727505191
3229 3229 -, c dbSNP:397516007
3235 3235 a, g dbSNP:756786807
3253 3253 a, c dbSNP:753449535
3254 3254 -, c dbSNP:730880669
3254 3254 -, c dbSNP:730880668
3254 3254 c, t dbSNP:368973872
3255 3255 a, g dbSNP:376598916
3258 3258 c, t dbSNP:775777449
3260 3260 a, g dbSNP:767927162
3261 3261 c, g dbSNP:150786409
3262 3262 g, t dbSNP:374289617
3263 3263 -, t dbSNP:397516008
3264 3264 a, g dbSNP:730880140
3265 3265 c, t dbSNP:369999866
3266 3266 a, g, t dbSNP:397516009
3269 3269 c, t dbSNP:773543130
3270 3270 a, g dbSNP:397516006
3279 3279 a, c dbSNP:746818740
3290 3290 c, g, t dbSNP:397516010
3294 3294 a, g dbSNP:779650200
3301 3301 a, t dbSNP:758229677
3304 3304 a, c dbSNP:745761062
3311 3311 a, g dbSNP:778853122
3313 3313 c, t dbSNP:376344765
3314 3314 g, t dbSNP:727503173
3316 3316 c, t dbSNP:36212064
3318 3318 a, t dbSNP:397516012
3321 3321 c, t dbSNP:755653624
3322 3322 a, c, g dbSNP:367927327
3323 3323 a, g, t dbSNP:121909377
3325 3325 a, g dbSNP:1052373
3325 3325 -, g dbSNP:727503172
3330 3330 a, g, t dbSNP:397516013
3331 3331 g, t dbSNP:767039057
3334 3334 -, g dbSNP:397516014
3334 3334 a, g dbSNP:371301665
3335 3335 a, t dbSNP:773230208
3336 3336 a, t dbSNP:769925144
3339 3339 -, ca dbSNP:730880671
3339 3339 -, c dbSNP:730880670
3340 3340 a, g dbSNP:748263197
3342 3342 a, t dbSNP:730880590
3345 3345 a, c dbSNP:730880591
3346 3346 a, c, g dbSNP:185428948
3351 3351 c, g dbSNP:786204356
3352 3352 a, c, t dbSNP:200372325
3353 3353 a, g dbSNP:377106864
3358 3358 -, g dbSNP:730880672
3360 3360 -, aga dbSNP:767318190
3360 3360 a, c dbSNP:397516015
3361 3361 c, g dbSNP:748794011
3363 3363 c, t dbSNP:397516016
3364 3364 a, c dbSNP:777087155
3364 3364 -, c dbSNP:730880719
3372 3372 -, agtg dbSNP:730880337
3372 3372 a, g dbSNP:727504276
3374 3374 -, ggt dbSNP:730880673
3377 3377 -, acc dbSNP:763160213
3379 3379 c, t dbSNP:749130484
3380 3380 a, g dbSNP:531189495
3383 3383 g, t dbSNP:370952321
3395 3395 c, t dbSNP:368721523
3398 3398 c, t dbSNP:747738308
3399 3399 a, g dbSNP:397516018
3400 3400 c, t dbSNP:754741486
3408 3408 a, g dbSNP:751258646
3409 3409 a, c, t dbSNP:727504289
3410 3410 a, g, t dbSNP:121909378
3420 3420 a, c dbSNP:765817791
3421 3421 c, g dbSNP:375116558
3429 3429 c, t dbSNP:370890951
3433 3433 c, t dbSNP:764298445
3444 3444 -, act dbSNP:730880674
3445 3445 a, c, t dbSNP:193922383
3449 3449 c, t dbSNP:377171707
3450 3450 a, c, g dbSNP:187705120
3451 3451 c, t dbSNP:753671465
3452 3452 a, g dbSNP:373519667
3463 3463 a, g dbSNP:769827229
3468 3468 c, t dbSNP:730880529
3470 3470 a, g dbSNP:747606711
3479 3479 a, c, g dbSNP:370658083
3486 3486 a, g dbSNP:746613719
3489 3489 c, t dbSNP:779884363
3491 3491 g, t dbSNP:758660149
3494 3494 a, t dbSNP:746297609
3498 3498 c, t dbSNP:779279057
3500 3500 a, g dbSNP:377352427
3504 3504 -, a dbSNP:730880720
3506 3506 c, g dbSNP:727505286
3507 3507 c, t dbSNP:373304680
3509 3509 -, gtctttatcc dbSNP:730880675
3509 3509 a, g dbSNP:542350927
3513 3513 -, tt dbSNP:727504321
3516 3516 -, ttat dbSNP:397516019
3517 3517 c, t dbSNP:756214979
3522 3522 a, g dbSNP:370040023
3523 3523 a, t dbSNP:786204358
3529 3529 c, t dbSNP:779273875
3535 3535 c, g dbSNP:373620343
3547 3547 c, t dbSNP:772168796
3549 3549 a, g dbSNP:749752972
3555 3555 -, agg dbSNP:781641320
3560 3560 c, g dbSNP:778289016
3571 3571 c, t dbSNP:756160183
3572 3572 a, g dbSNP:199669878
3578 3578 c, g dbSNP:730880593
3584 3584 c, t dbSNP:786204359
3585 3585 g, t dbSNP:397516024
3590 3590 c, t dbSNP:730880699
3595 3595 c, g dbSNP:577832590
3605 3605 c, t dbSNP:755160084
3606 3606 a, g, t dbSNP:117354682
3609 3609 c, t dbSNP:761545914
3610 3610 a, g dbSNP:371488508
3615 3615 c, t dbSNP:546744563
3616 3616 c, t dbSNP:541204647
3617 3617 a, g dbSNP:397516026
3618 3618 c, t dbSNP:730880594
3619 3619 a, g dbSNP:771490490
3621 3621 g, t dbSNP:730880595
3622 3622 a, c dbSNP:397516027
3636 3636 c, t dbSNP:397516028
3637 3637 -, ctgctgtgct dbSNP:727504271
3642 3642 a, g dbSNP:727503170
3648 3648 c, t dbSNP:786205470
3650 3650 c, t dbSNP:727503171
3651 3651 a, g dbSNP:730880596
3652 3652 a, g dbSNP:771292799
3657 3657 g, t dbSNP:749697983
3661 3661 -, c dbSNP:397516029
3661 3661 -, c dbSNP:397516030
3678 3678 a, g dbSNP:730880597
3679 3679 a, g dbSNP:368765949
3681 3681 -, t dbSNP:730880361
3688 3688 c, t dbSNP:528649058
3691 3691 c, t dbSNP:374755212
3694 3694 g, t dbSNP:770157084
3701 3701 g, t dbSNP:730880598
3704 3704 a, g dbSNP:748603864
3705 3705 a, g dbSNP:372821359
3707 3707 a, g dbSNP:768751160
3709 3709 c, t dbSNP:368221517
3713 3713 c, t dbSNP:397516033
3714 3714 a, g, t dbSNP:397516034
3716 3716 a, t dbSNP:730880599
3719 3719 c, t dbSNP:201312636
3720 3720 a, c, g dbSNP:528940575
3722 3722 a, g dbSNP:727503169
3727 3727 -, ca dbSNP:727504390
3731 3731 a, t dbSNP:397516035
3734 3734 c, t dbSNP:397516037
3736 3736 a, g dbSNP:200162906
3742 3742 a, g dbSNP:397516036
3745 3745 a, g dbSNP:767400149
3746 3746 a, c dbSNP:727503168
3750 3750 c, t dbSNP:730880702
3752 3752 a, g dbSNP:267602904
3757 3757 c, t dbSNP:751092574
3763 3763 g, t dbSNP:778267366
3769 3769 a, c dbSNP:730880600
3772 3772 -, c dbSNP:397516038
3774 3774 c, t dbSNP:786204361
3778 3778 c, t dbSNP:543376073
3779 3779 a, g dbSNP:202147520
3781 3781 -, gggcatctatgtctg dbSNP:730880676
3783 3783 g, t dbSNP:727504259
3784 3784 c, t dbSNP:772872595
3787 3787 c, g dbSNP:770102135
3788 3788 c, t dbSNP:730880601
3789 3789 a, g dbSNP:730880602
3790 3790 c, g, t dbSNP:397516039
3793 3793 c, g dbSNP:374760003
3796 3796 -, gggggcatctatgtctgc dbSNP:193922384
3799 3799 a, g dbSNP:769101292
3800 3800 a, g dbSNP:727503167
3800 3800 -, g dbSNP:786204362
3801 3801 a, c dbSNP:727504722
3804 3804 -, cca dbSNP:397516040
3804 3804 c, t dbSNP:775370325
3808 3808 a, c dbSNP:730880603
3810 3810 g, t dbSNP:730880604
3812 3812 c, t dbSNP:730880605
3813 3813 -, a dbSNP:727503166
3814 3814 a, c, g dbSNP:746042492
3816 3816 a, g dbSNP:730880606
3817 3817 c, t dbSNP:779312310
3818 3818 a, g dbSNP:730880141
3824 3824 c, t dbSNP:370338674
3825 3825 a, g dbSNP:781180230
3828 3828 a, g, t dbSNP:397514751
3830 3830 a, g dbSNP:751527360
3831 3831 a, t dbSNP:730880607
3833 3833 c, t dbSNP:730880608
3834 3834 a, g dbSNP:397516041
3836 3836 c, t dbSNP:765825263
3837 3837 -, gcc dbSNP:727504933
3837 3837 a, g dbSNP:730880142
3838 3838 c, t dbSNP:541377415
3840 3840 c, t dbSNP:786204363
3848 3848 c, t dbSNP:397516042
3849 3849 a, g dbSNP:762225417
3850 3850 a, g dbSNP:776927697
3851 3851 a, g dbSNP:730880609
3853 3853 a, g dbSNP:776112819
3855 3855 c, t dbSNP:369184972
3862 3862 a, g dbSNP:727504380
3868 3868 -, ctggctcctgg dbSNP:727504359
3868 3868 a, c, t dbSNP:557198352
3871 3871 g, t dbSNP:774501793
3873 3873 c, t dbSNP:771053385
3880 3880 a, g dbSNP:763036348
3882 3882 c, t dbSNP:773513675
3884 3884 a, g dbSNP:768303629
3886 3886 a, c dbSNP:746869742
3897 3897 a, g dbSNP:752327972
3902 3902 c, t dbSNP:148237662
3922 3922 c, t dbSNP:764002145
3931 3931 a, g dbSNP:11570120
3968 3968 a, g dbSNP:755799319
3975 3975 g, t dbSNP:117960173
3981 3981 c, t dbSNP:764758393
3989 3989 a, g dbSNP:549519453
3990 3990 c, t dbSNP:752355863
3991 3991 a, g dbSNP:767296899
3993 3993 c, t dbSNP:570058149
4002 4002 a, g dbSNP:569710158
4022 4022 a, g dbSNP:549643481
4037 4037 c, t dbSNP:759054956
4092 4092 -, a dbSNP:376645369
4098 4098 a, g dbSNP:11570121
4128 4128 a, g dbSNP:564117422
4129 4129 a, c dbSNP:773912126
4182 4182 a, g dbSNP:541031071
4198 4198 c, t dbSNP:527543611

Target ORF information:

RefSeq Version XM_011520117
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens myosin binding protein C, cardiac (MYBPC3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59134
Accession Version XM_011520118.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3744bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product myosin-binding protein C, cardiac-type isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009237.19) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)89..337(+)
Misc Feature(2)98..322(+)
Misc Feature(3)536..823(+)
Misc Feature(4)596..787(+)
Misc Feature(5)1148..1402(+)
Misc Feature(6)1226..1369(+)
Misc Feature(7)1421..1678(+)
Misc Feature(8)1466..>1630(+)
Misc Feature(9)1742..1942(+)
Misc Feature(10)2015..2278(+)
Misc Feature(11)2018..2278(+)
Misc Feature(12)2288..2560(+)
Misc Feature(13)2288..2533(+)
Misc Feature(14)2534..2548(+)
Misc Feature(15)2582..2863(+)
Misc Feature(16)2582..2827(+)
Misc Feature(17)2828..2842(+)
Misc Feature(18)2915..3160(+)
Misc Feature(19)2942..3160(+)
Misc Feature(20)3170..3436(+)
Misc Feature(21)3170..3412(+)
Misc Feature(22)3413..3427(+)
Misc Feature(23)3515..3784(+)
Misc Feature(24)3566..3769(+)
Position Chain Variation Link
6 6 -, c dbSNP:768257586
9 9 c, t dbSNP:763924149
10 10 c, t dbSNP:760572113
14 14 a, g dbSNP:553644150
18 18 c, t dbSNP:767039719
31 31 c, t dbSNP:758914519
32 32 a, g dbSNP:369797789
38 38 a, g dbSNP:770669714
45 45 c, t dbSNP:762719022
46 46 a, g dbSNP:567307744
58 58 a, c, g dbSNP:397516045
66 66 c, t dbSNP:748689012
67 67 a, g dbSNP:377292092
68 68 c, g dbSNP:201278114
82 82 a, c dbSNP:746076911
88 88 c, t dbSNP:2596402
94 94 c, g dbSNP:730880136
96 96 a, g dbSNP:779049126
101 101 c, t dbSNP:730880573
104 104 c, t dbSNP:747857800
105 105 a, g, t dbSNP:374630007
109 109 a, g dbSNP:751590263
121 121 c, t dbSNP:765986295
122 122 a, c, g dbSNP:758044508
128 128 a, t dbSNP:749970304
129 129 a, g dbSNP:371140684
136 136 c, t dbSNP:761547225
137 137 a, g dbSNP:776834755
142 142 c, t dbSNP:764557472
143 143 a, g dbSNP:761079937
146 146 a, g dbSNP:536744834
148 148 c, t dbSNP:397516085
149 149 a, c, g dbSNP:730880575
153 153 -, ca dbSNP:745811346
158 158 a, c, t dbSNP:727504249
159 159 a, g dbSNP:397515885
162 162 a, c dbSNP:376646845
163 163 a, g dbSNP:754870909
172 172 g, t dbSNP:747965077
173 173 a, g dbSNP:780085131
176 176 a, c, t dbSNP:373638535
177 177 a, g dbSNP:764849803
179 179 -, tggc dbSNP:730880659
185 185 c, t dbSNP:557439091
186 186 a, g dbSNP:369205562
187 187 a, c, t dbSNP:377579620
188 188 a, g dbSNP:775837337
193 193 c, g dbSNP:767973005
200 200 a, t dbSNP:760058908
201 201 -, tca dbSNP:781207661
202 202 c, t dbSNP:774273586
203 203 a, g dbSNP:373164247
205 205 c, t dbSNP:368918487
206 206 a, g, t dbSNP:534282225
207 207 c, t dbSNP:746738538
220 220 c, t dbSNP:780012957
221 221 a, g dbSNP:397515918
227 227 -, g dbSNP:730880662
230 230 a, g dbSNP:121909375
232 232 -, agagggcacac dbSNP:397515925
234 234 -, ag dbSNP:786204324
237 237 a, g dbSNP:546345474
237 237 -, g dbSNP:730880663
239 239 a, c dbSNP:377225516
242 242 c, t dbSNP:373315466
243 243 a, g dbSNP:549239819
249 249 c, t dbSNP:753300898
250 250 a, g dbSNP:370102200
261 261 a, g dbSNP:397515945
262 262 c, g dbSNP:397515946
263 263 g, t dbSNP:11570045
270 270 -, gg dbSNP:730880362
271 271 a, c, t dbSNP:760007714
278 278 a, g dbSNP:375471260
283 283 a, g dbSNP:766359851
285 285 a, g dbSNP:730880580
290 290 a, t dbSNP:730880581
292 292 -, c dbSNP:730880664
292 292 c, g, t dbSNP:730880698
293 293 a, g dbSNP:730880700
294 294 c, gagg dbSNP:727504335
295 295 a, g dbSNP:770089112
301 301 c, t dbSNP:372502369
306 306 a, g dbSNP:569824900
312 312 c, g dbSNP:772057451
318 318 a, t dbSNP:730880583
325 325 c, t dbSNP:367990952
326 326 a, g dbSNP:778851720
335 335 g, t dbSNP:770777166
338 338 a, c dbSNP:549758428
339 339 c, t dbSNP:727504945
342 342 a, g dbSNP:777170653
345 345 c, t dbSNP:397515993
360 360 c, t dbSNP:730880610
370 370 c, g dbSNP:770853232
377 377 c, t dbSNP:749233808
378 378 c, t dbSNP:772678776
379 379 -, t dbSNP:730880721
381 381 c, t dbSNP:397516011
387 387 c, t dbSNP:730880530
388 388 -, t dbSNP:730880335
388 388 c, t dbSNP:397516017
393 393 a, c dbSNP:730880611
394 394 c, t dbSNP:786204325
395 395 a, g dbSNP:730880612
398 398 a, g, t dbSNP:727503220
405 405 -, c dbSNP:397516023
410 410 a, g dbSNP:397516025
417 417 -, c dbSNP:397516032
417 417 c, t dbSNP:551888783
418 418 a, g dbSNP:780768974
419 419 a, g dbSNP:754633960
427 427 c, t dbSNP:11570046
428 428 a, g, t dbSNP:370958401
433 433 a, g dbSNP:758903546
436 436 a, g dbSNP:750955473
457 457 c, t dbSNP:397516046
460 460 a, g dbSNP:727504318
461 461 a, g dbSNP:730880613
463 463 -, g dbSNP:771005018
465 465 c, g dbSNP:730880703
467 467 a, g dbSNP:776154213
471 471 c, g dbSNP:730880704
473 473 c, g dbSNP:730880614
474 474 c, t dbSNP:786205352
483 483 a, g dbSNP:730880705
486 486 -, gt dbSNP:397516047
489 489 a, c dbSNP:768309693
491 491 -, a dbSNP:397516049
491 491 a, c, g dbSNP:397516048
492 492 c, t dbSNP:780458215
495 495 c, t dbSNP:730880615
497 497 a, g dbSNP:397516050
501 501 a, c, t dbSNP:779493486
505 505 -, c dbSNP:730880677
505 505 c, g, t dbSNP:377520770
506 506 a, g dbSNP:397516051
508 508 -, t dbSNP:730880679
510 510 -, ac dbSNP:730880680
513 513 a, c dbSNP:756328813
514 514 -, c dbSNP:397516052
516 516 c, t dbSNP:373946195
521 521 -, c dbSNP:730880366
522 522 c, t dbSNP:730880616
526 526 c, t dbSNP:150291001
527 527 a, g dbSNP:3729986
532 532 a, g dbSNP:730880706
533 533 c, t dbSNP:193068692
534 534 a, g dbSNP:730880617
536 536 a, c dbSNP:397516053
538 538 a, g dbSNP:373133807
539 539 c, t dbSNP:730880618
547 547 c, t dbSNP:3218719
550 550 c, g dbSNP:730880619
556 556 c, t dbSNP:397516054
557 557 a, g dbSNP:569740494
558 558 c, t dbSNP:727505267
559 559 a, g dbSNP:550047739
567 567 a, g dbSNP:369683229
568 568 c, t dbSNP:778679153
572 572 a, g dbSNP:727505168
573 573 a, c, t dbSNP:113941605
576 576 -, tct dbSNP:730880722
582 582 c, g, t dbSNP:753683535
584 584 c, t dbSNP:193922385
585 585 a, g dbSNP:201012766
586 586 c, t dbSNP:368035400
587 587 a, g dbSNP:727503218
588 588 -, t dbSNP:727503217
589 589 g, t dbSNP:759249105
592 592 c, t dbSNP:11570051
593 593 a, g dbSNP:766132641
595 595 -, cgccagcctcctgaagccgc dbSNP:397516058
595 595 c, t dbSNP:371842442
596 596 a, g dbSNP:773646282
597 597 -, gc dbSNP:786204327
604 604 c, t dbSNP:368604485
606 606 -, t dbSNP:397516059
607 607 a, g dbSNP:748725922
608 608 a, c, t dbSNP:375607980
609 609 a, g dbSNP:768795353
612 612 c, t dbSNP:727503216
613 613 a, g, t dbSNP:370962887
620 620 a, g dbSNP:11570052
621 621 a, t dbSNP:397516060
623 623 a, g dbSNP:777665200
626 626 c, t dbSNP:730880622
628 628 g, t dbSNP:755983199
637 637 a, c dbSNP:375673378
641 641 -, t dbSNP:730880681
643 643 c, g dbSNP:727503215
653 653 a, g dbSNP:370554185
658 658 c, t dbSNP:762834457
659 659 a, c dbSNP:730880623
668 668 c, t dbSNP:397516061
673 673 c, t dbSNP:751125697
679 679 c, g dbSNP:202139499
685 685 c, t dbSNP:762695516
686 686 a, g dbSNP:773414747
688 688 c, t dbSNP:765678794
689 689 a, g dbSNP:762226459
691 691 c, g dbSNP:397516062
694 694 c, t dbSNP:727504858
695 695 a, g dbSNP:769167548
698 698 c, t dbSNP:397516063
699 699 a, g dbSNP:775580020
700 700 c, t dbSNP:397516064
701 701 a, g dbSNP:201098973
703 703 c, t dbSNP:777418402
704 704 a, g dbSNP:138753870
708 708 a, g dbSNP:730880707
710 710 c, g, t dbSNP:397516068
714 714 a, g dbSNP:779693951
721 721 c, t dbSNP:371331114
722 722 a, g dbSNP:397516069
724 724 a, g dbSNP:778582048
736 736 c, t dbSNP:756894628
737 737 a, g dbSNP:369300885
739 739 c, g, t dbSNP:532498780
755 755 a, c, g dbSNP:753271103
756 756 -, atcaccgatgcccagcctgccttcac dbSNP:786204329
760 760 c, t dbSNP:767913494
761 761 a, g dbSNP:3729989
764 764 c, t dbSNP:730880624
765 765 a, c dbSNP:397516070
766 766 c, t dbSNP:774316050
767 767 c, t dbSNP:771143409
768 768 a, g dbSNP:727504396
771 771 g, t dbSNP:776541959
777 777 -, t dbSNP:730880683
782 782 a, c dbSNP:730880625
794 794 c, t dbSNP:372574446
797 797 g, t dbSNP:768625454
799 799 a, c dbSNP:2857543
800 800 c, t dbSNP:397516071
801 801 a, g dbSNP:780085082
802 802 c, t dbSNP:771929829
807 807 a, t dbSNP:368588523
813 813 a, g dbSNP:727503214
827 827 a, g dbSNP:397516074
831 831 c, t dbSNP:187455402
834 834 -, t dbSNP:786204332
838 838 a, c dbSNP:766472497
840 840 c, g dbSNP:730880627
841 841 c, t dbSNP:11570058
842 842 a, g dbSNP:373730381
845 845 -, g dbSNP:786204333
854 854 c, g dbSNP:370941975
860 860 c, t dbSNP:762169683
863 863 a, g dbSNP:775337081
869 869 c, t dbSNP:397516075
870 870 a, g dbSNP:759515993
872 872 c, t dbSNP:551119259
873 873 a, g dbSNP:376461745
876 876 c, t dbSNP:748746951
877 877 a, g dbSNP:751392149
888 888 a, g dbSNP:147315081
888 888 -, g dbSNP:727503212
891 891 c, g dbSNP:375774648
896 896 c, t dbSNP:371711564
897 897 a, g dbSNP:11570060
899 899 c, t dbSNP:727504234
900 900 a, g dbSNP:761520688
905 905 a, g dbSNP:776075902
908 908 a, g dbSNP:727504523
914 914 c, t dbSNP:776238883
939 939 -, t dbSNP:730880684
941 941 a, g dbSNP:768164989
947 947 c, t dbSNP:760429280
956 956 a, t dbSNP:730880629
964 964 c, t dbSNP:200713257
967 967 -, tt dbSNP:730880685
968 968 -, tt dbSNP:397516080
971 971 c, t dbSNP:753884765
972 972 a, g dbSNP:373204728
976 976 a, c, g dbSNP:370632180
978 978 -, aact dbSNP:730880678
979 979 a, g dbSNP:771875597
986 986 a, t dbSNP:397516084
987 987 a, c, t dbSNP:193922386
988 988 a, c, g dbSNP:374326087
998 998 g, t dbSNP:749867888
1004 1004 a, g dbSNP:780896631
1011 1011 a, c dbSNP:545675333
1015 1015 c, g, t dbSNP:369900803
1016 1016 a, c, g dbSNP:200119454
1019 1019 c, t dbSNP:730880708
1021 1021 a, g dbSNP:727503211
1025 1025 a, t dbSNP:765732047
1031 1031 a, c, t dbSNP:776681371
1032 1032 a, g dbSNP:34580776
1034 1034 c, t dbSNP:727503210
1048 1048 -, t dbSNP:727503209
1049 1049 a, g dbSNP:397516086
1054 1054 c, g, t dbSNP:367947846
1055 1055 a, g, t dbSNP:573916965
1058 1058 c, t dbSNP:730880630
1061 1061 a, t dbSNP:777470695
1063 1063 c, t dbSNP:397515880
1064 1064 a, g dbSNP:769830766
1070 1070 c, t dbSNP:730880631
1075 1075 c, t dbSNP:556616131
1076 1076 a, g dbSNP:397515881
1078 1078 c, t dbSNP:754469813
1079 1079 a, g dbSNP:397515882
1080 1080 a, t dbSNP:730880709
1083 1083 -, c dbSNP:730880686
1090 1090 a, g dbSNP:779704622
1092 1092 a, g dbSNP:397515883
1093 1093 c, t dbSNP:758016271
1094 1094 a, g dbSNP:397515884
1097 1097 -, cggca dbSNP:730880336
1111 1111 c, g dbSNP:375007425
1124 1124 cgcg, gc dbSNP:730880687
1125 1125 a, g dbSNP:199741162
1126 1126 a, c, t dbSNP:371308153
1127 1127 a, g dbSNP:746267533
1129 1129 a, t dbSNP:775464343
1135 1135 c, g dbSNP:730880632
1137 1137 -, aga dbSNP:775069579
1138 1138 a, g dbSNP:781216464
1139 1139 -, a dbSNP:730880723
1139 1139 a, g dbSNP:730880633
1146 1146 c, t dbSNP:778161908
1155 1155 a, g dbSNP:756633062
1156 1156 g, t dbSNP:753209030
1167 1167 c, g, t dbSNP:397515887
1175 1175 -, c dbSNP:730880688
1175 1175 a, c, t dbSNP:730880635
1178 1178 a, g dbSNP:727503208
1188 1188 c, g dbSNP:766664184
1198 1198 -, tc dbSNP:769490852
1199 1199 -, c dbSNP:759194130
1199 1199 c, t dbSNP:11570076
1200 1200 a, g dbSNP:753660871
1202 1202 c, g dbSNP:11570077
1207 1207 c, g, t dbSNP:775237084
1208 1208 a, g dbSNP:772073491
1211 1211 g, t dbSNP:397515888
1217 1217 -, g dbSNP:730880724
1223 1223 -, c dbSNP:397515889
1226 1226 -, gaactggctgaccatg dbSNP:730880689
1226 1226 g, t dbSNP:759008026
1228 1228 c, t dbSNP:377328238
1234 1234 a, g dbSNP:770549835
1235 1235 a, g dbSNP:749000345
1237 1237 a, c, g dbSNP:730880636
1243 1243 a, g, t dbSNP:397515890
1256 1256 c, t dbSNP:730880637
1265 1265 c, t dbSNP:727504329
1266 1266 a, c dbSNP:769985511
1268 1268 a, g dbSNP:727503207
1269 1269 a, t dbSNP:560140258
1273 1273 c, t dbSNP:748558425
1274 1274 a, g dbSNP:727505266
1277 1277 a, c dbSNP:730880638
1283 1283 -, ggt dbSNP:746979805
1287 1287 a, t dbSNP:774293794
1290 1290 -, tt dbSNP:397515894
1293 1293 a, g dbSNP:730880532
1301 1301 a, g dbSNP:371513491
1307 1307 a, t dbSNP:730880533
1310 1310 a, c, t dbSNP:368770848
1311 1311 a, c, g dbSNP:770030288
1319 1319 a, c dbSNP:727503206
1328 1328 c, t dbSNP:397515895
1333 1333 c, t dbSNP:746770543
1336 1336 a, g dbSNP:779873317
1337 1337 c, t dbSNP:758253767
1341 1341 a, c, t dbSNP:370412052
1342 1342 a, g dbSNP:778718628
1343 1343 a, g dbSNP:730880534
1345 1345 c, t dbSNP:200664621
1346 1346 a, g dbSNP:753321277
1348 1348 c, t dbSNP:763808974
1349 1349 a, g dbSNP:371167525
1357 1357 c, t dbSNP:190228518
1360 1360 a, g dbSNP:768065513
1363 1363 c, t dbSNP:759826878
1364 1364 a, g, t dbSNP:730880535
1365 1365 -, t dbSNP:397515896
1371 1371 a, g dbSNP:763045718
1371 1371 -, g dbSNP:730880710
1374 1374 a, g dbSNP:142317339
1375 1375 c, t dbSNP:368192024
1376 1376 a, g dbSNP:193922377
1380 1380 a, g dbSNP:779820034
1381 1381 a, g dbSNP:771832243
1385 1385 -, a dbSNP:727505152
1389 1389 c, t dbSNP:745661443
1390 1390 a, g dbSNP:727503205
1393 1393 a, g dbSNP:757182984
1398 1398 c, t dbSNP:727504279
1402 1402 g, t dbSNP:539453748
1406 1406 g, t dbSNP:786204338
1410 1410 a, c dbSNP:730880536
1412 1412 -, cc dbSNP:727503203
1412 1412 c, g dbSNP:749310275
1413 1413 -, c dbSNP:730880711
1413 1413 c, t dbSNP:397515898
1416 1416 c, t dbSNP:755631466
1418 1418 c, t dbSNP:747686377
1420 1420 c, t dbSNP:780854746
1425 1425 c, t dbSNP:370538243
1426 1426 a, g dbSNP:538072263
1427 1427 c, t dbSNP:377577698
1428 1428 a, g dbSNP:374255707
1430 1430 c, t dbSNP:758901980
1432 1432 -, c dbSNP:786204339
1436 1436 g, t dbSNP:730880537
1439 1439 a, g dbSNP:755991329
1442 1442 c, t dbSNP:730880538
1450 1450 a, g dbSNP:750861980
1452 1452 a, t dbSNP:397515899
1460 1460 c, g, t dbSNP:730880539
1464 1464 a, g dbSNP:776734314
1465 1465 -, gg dbSNP:730880642
1473 1473 c, t dbSNP:397515900
1477 1477 a, c, g dbSNP:397515901
1478 1478 c, t dbSNP:760864668
1486 1486 a, g dbSNP:587781042
1488 1488 c, t dbSNP:730880540
1489 1489 a, g dbSNP:770568659
1495 1495 a, g dbSNP:749110971
1497 1497 a, g dbSNP:773237942
1500 1500 c, t dbSNP:370285346
1501 1501 g, t dbSNP:747627648
1502 1502 c, t dbSNP:730880541
1511 1511 c, g, t dbSNP:397515902
1512 1512 a, g dbSNP:730880542
1514 1514 a, c dbSNP:771741441
1520 1520 g, t dbSNP:546002111
1522 1522 c, g, t dbSNP:35690719
1523 1523 a, g dbSNP:200625851
1524 1524 a, g, t dbSNP:397514752
1526 1526 a, g dbSNP:730880543
1527 1527 g, t dbSNP:778361492
1537 1537 c, t dbSNP:756101990
1538 1538 a, c, g, t dbSNP:397515905
1539 1539 a, g dbSNP:200411226
1542 1542 a, g dbSNP:759884209
1548 1548 a, c dbSNP:750225859
1549 1549 c, g dbSNP:397515906
1554 1554 a, c dbSNP:761672176
1558 1558 c, g dbSNP:776373836
1559 1559 c, t dbSNP:375882485
1560 1560 -, ggttc dbSNP:587782957
1560 1560 a, g, t dbSNP:397515907
1568 1568 -, aag dbSNP:727504287
1568 1568 a, t dbSNP:786204340
1573 1573 c, t dbSNP:397515908
1574 1574 a, g dbSNP:35736435
1577 1577 c, t dbSNP:730880544
1590 1590 a, c, t dbSNP:397515909
1591 1591 a, g dbSNP:771702316
1595 1595 a, g dbSNP:727503200
1598 1598 -, aac dbSNP:730880643
1599 1599 a, g dbSNP:181834806
1600 1600 c, t dbSNP:771230605
1601 1601 a, g dbSNP:730880545
1602 1602 -, agg dbSNP:786204341
1609 1609 a, g dbSNP:372499440
1612 1612 g, t dbSNP:778105166
1618 1618 c, t dbSNP:367915627
1619 1619 a, g dbSNP:11570082
1620 1620 c, t dbSNP:370362589
1621 1621 a, g dbSNP:376041792
1630 1630 g, t dbSNP:397515910
1633 1633 a, g, t dbSNP:766721220
1635 1635 -, cact dbSNP:730880712
1635 1635 c, t dbSNP:761466191
1641 1641 c, g dbSNP:397515911
1644 1644 a, g dbSNP:753696015
1645 1645 c, t dbSNP:763905291
1646 1646 a, c, g dbSNP:397515912
1648 1648 a, g dbSNP:727503199
1650 1650 a, g, t dbSNP:730880547
1650 1650 -, g dbSNP:730880640
1654 1654 c, g dbSNP:773947559
1656 1656 c, t dbSNP:374349666
1657 1657 a, g dbSNP:370945942
1659 1659 c, t dbSNP:730880548
1663 1663 a, t dbSNP:200224422
1670 1670 a, g dbSNP:770186287
1678 1678 a, c, g dbSNP:781764759
1679 1679 c, g dbSNP:121909374
1683 1683 -, a dbSNP:727504248
1688 1688 a, c dbSNP:377163678
1694 1694 a, g dbSNP:752523427
1694 1694 -, g dbSNP:757777349
1696 1696 -, gt dbSNP:398123279
1696 1696 a, g dbSNP:397515915
1707 1707 -, tcgca dbSNP:730880644
1708 1708 c, t dbSNP:767414501
1709 1709 g, t dbSNP:727504887
1719 1719 c, t dbSNP:730880692
1724 1724 a, g dbSNP:730880693
1725 1725 a, g dbSNP:730880549
1726 1726 c, t dbSNP:751052593
1727 1727 a, g dbSNP:727503198
1732 1732 a, g dbSNP:762369686
1733 1733 c, g dbSNP:750030159
1733 1733 -, g dbSNP:727504366
1739 1739 a, g dbSNP:397515919
1740 1740 a, c, t dbSNP:730880694
1741 1741 a, g dbSNP:762228885
1744 1744 a, g dbSNP:777173469
1748 1748 a, t dbSNP:397515920
1751 1751 c, t dbSNP:730880695
1754 1754 -, ga dbSNP:727503197
1755 1755 -, ag dbSNP:730880645
1774 1774 a, g, t dbSNP:397515921
1775 1775 a, c, t dbSNP:61897383
1776 1776 a, g dbSNP:397515922
1781 1781 a, g dbSNP:772132916
1786 1786 a, g dbSNP:730880546
1787 1787 c, t dbSNP:745957052
1789 1789 -, g dbSNP:730880646
1813 1813 c, t dbSNP:727505203
1814 1814 a, g dbSNP:730880526
1819 1819 c, t dbSNP:747918558
1821 1821 a, g dbSNP:397515923
1823 1823 a, g dbSNP:754904833
1828 1828 g, t dbSNP:754902004
1831 1831 -, gt dbSNP:730880713
1831 1831 a, g dbSNP:727503196
1833 1833 c, t dbSNP:397515924
1838 1838 a, g dbSNP:730880550
1840 1840 c, t dbSNP:572227730
1841 1841 a, g dbSNP:199728019
1844 1844 c, t dbSNP:201596087
1845 1845 a, g dbSNP:727503195
1846 1846 c, g dbSNP:772488845
1847 1847 -, g dbSNP:730880647
1855 1855 -, a dbSNP:397515926
1858 1858 a, g dbSNP:397515927
1860 1860 c, t dbSNP:730880551
1861 1861 a, c dbSNP:566461224
1861 1861 -, c dbSNP:730880648
1863 1863 c, t dbSNP:397515928
1864 1864 g, t dbSNP:774348756
1867 1867 c, t dbSNP:397515929
1868 1868 -, cg dbSNP:764743402
1868 1868 a, g dbSNP:376736293
1869 1869 -, acg dbSNP:397515930
1869 1869 a, g dbSNP:372371774
1870 1870 c, t dbSNP:768380030
1871 1871 a, g dbSNP:368482358
1875 1875 c, t dbSNP:375196922
1876 1876 a, g dbSNP:758306575
1877 1877 c, t dbSNP:730880552
1878 1878 c, g dbSNP:778623429
1881 1881 c, t dbSNP:730880553
1882 1882 c, g, t dbSNP:535853707
1883 1883 a, c, g dbSNP:371564200
1884 1884 a, t dbSNP:730880554
1885 1885 c, t dbSNP:768049705
1886 1886 a, g dbSNP:730880555
1888 1888 a, g dbSNP:760023583
1893 1893 -, a dbSNP:730880649
1896 1896 a, g dbSNP:727503194
1897 1897 c, t dbSNP:774488435
1910 1910 a, g dbSNP:200352299
1912 1912 a, g dbSNP:763030622
1914 1914 g, t dbSNP:730880556
1915 1915 c, g dbSNP:773371075
1918 1918 -, c dbSNP:397515931
1918 1918 c, t dbSNP:193922378
1922 1922 a, t dbSNP:746786287
1924 1924 a, c, t dbSNP:397515932
1926 1926 a, g dbSNP:772032697
1941 1941 c, t dbSNP:730880137
1944 1944 a, t dbSNP:745859544
1947 1947 -, t dbSNP:397515933
1950 1950 -, t dbSNP:397515934
1969 1969 c, t dbSNP:377227442
1970 1970 a, g dbSNP:780907679
1974 1974 c, t dbSNP:755244836
1979 1979 c, t dbSNP:727504293
1987 1987 c, t dbSNP:768391385
1989 1989 c, t dbSNP:397515938
1990 1990 c, t dbSNP:727503193
1993 1993 c, g dbSNP:780452445
1997 1997 c, t dbSNP:758901926
1999 1999 c, t dbSNP:750861887
2002 2002 a, c, g dbSNP:757244311
2005 2005 c, g dbSNP:727504250
2010 2010 c, g dbSNP:753992239
2015 2015 c, g, t dbSNP:397515939
2016 2016 a, g dbSNP:1800565
2018 2018 a, c dbSNP:374447249
2023 2023 a, g dbSNP:397515940
2026 2026 c, t dbSNP:751397614
2028 2028 c, t dbSNP:766213616
2031 2031 c, t dbSNP:397515941
2033 2033 a, g, t dbSNP:730880560
2040 2040 c, t dbSNP:772970643
2044 2044 a, t dbSNP:375467797
2054 2054 a, ct, g dbSNP:727503192
2054 2054 a, c dbSNP:761194404
2057 2057 c, t dbSNP:730880561
2058 2058 a, g dbSNP:727503191
2065 2065 c, t dbSNP:558051480
2068 2068 ccct, gg dbSNP:397515943
2071 2071 c, t dbSNP:775127671
2073 2073 c, t dbSNP:772364751
2074 2074 c, t dbSNP:746263346
2085 2085 c, t dbSNP:786204345
2088 2088 a, c dbSNP:779258481
2089 2089 c, t dbSNP:757832991
2090 2090 c, t dbSNP:372493586
2092 2092 a, c dbSNP:749317445
2095 2095 -, t dbSNP:397515944
2096 2096 a, g dbSNP:777978931
2103 2103 a, g dbSNP:397515942
2111 2111 a, c, g dbSNP:367992212
2118 2118 a, c, t dbSNP:3729946
2119 2119 a, g dbSNP:758224257
2128 2128 a, g dbSNP:781477048
2135 2135 a, t dbSNP:768993308
2137 2137 a, c, t dbSNP:397515951
2137 2137 -, c dbSNP:397515952
2138 2138 a, c, g dbSNP:730880696
2144 2144 c, t dbSNP:200399246
2145 2145 a, g dbSNP:756102881
2150 2150 c, t dbSNP:752200396
2151 2151 a, g dbSNP:397515953
2152 2152 c, t dbSNP:370676057
2153 2153 a, g dbSNP:564378953
2156 2156 g, t dbSNP:397515954
2161 2161 c, t dbSNP:765983279
2162 2162 a, c dbSNP:763341155
2163 2163 c, t dbSNP:773757669
2168 2168 g, t dbSNP:770408214
2170 2170 c, t dbSNP:397515955
2171 2171 a, c, t dbSNP:397515956
2172 2172 a, g, t dbSNP:534345197
2174 2174 a, g dbSNP:747081382
2176 2176 c, t dbSNP:780282339
2184 2184 c, t dbSNP:199893357
2185 2185 a, g dbSNP:113265977
2188 2188 c, t dbSNP:777613325
2191 2191 g, t dbSNP:786204348
2195 2195 -, g dbSNP:730880650
2208 2208 a, g dbSNP:727503190
2215 2215 c, t dbSNP:755910458
2216 2216 a, g dbSNP:730880563
2223 2223 c, t dbSNP:727503189
2224 2224 a, g dbSNP:373338699
2232 2232 -, t dbSNP:774521272
2241 2241 -, c dbSNP:730880651
2243 2243 a, g dbSNP:369790992
2245 2245 a, g dbSNP:766029254
2248 2248 c, t dbSNP:397515957
2249 2249 a, g dbSNP:750810342
2251 2251 a, g dbSNP:765629179
2252 2252 c, g dbSNP:762280284
2262 2262 a, g dbSNP:730880527
2263 2263 c, t dbSNP:777228369
2269 2269 a, t dbSNP:764539455
2274 2274 a, g dbSNP:760786216
2281 2281 c, t dbSNP:775491112
2282 2282 a, g dbSNP:36211723
2284 2284 c, t dbSNP:397515959
2285 2285 -, g dbSNP:397515960
2285 2285 a, g dbSNP:371488302
2286 2286 c, t dbSNP:397515961
2293 2293 c, t dbSNP:397515962
2294 2294 a, g dbSNP:368104687
2298 2298 c, g dbSNP:730880564
2304 2304 c, t dbSNP:759631792
2310 2310 a, g dbSNP:774512738
2311 2311 g, t dbSNP:771179191
2313 2313 g, t dbSNP:747912257
2319 2319 a, g dbSNP:776351251
2320 2320 c, t dbSNP:768638405
2326 2326 a, g dbSNP:746858516
2337 2337 g, t dbSNP:780056346
2346 2346 a, g dbSNP:757934210
2347 2347 -, g dbSNP:397515963
2348 2348 c, g, t dbSNP:187830361
2351 2351 c, g dbSNP:778678513
2355 2355 c, t dbSNP:730880565
2356 2356 -, g dbSNP:730880714
2365 2365 a, c, t dbSNP:727504864
2366 2366 a, g dbSNP:764297991
2368 2368 -, t dbSNP:730880341
2371 2371 c, t dbSNP:756512665
2372 2372 a, g dbSNP:727504574
2383 2383 a, c dbSNP:202088839
2384 2384 a, c dbSNP:3729950
2388 2388 a, g dbSNP:730880566
2400 2400 a, g dbSNP:766382260
2403 2403 a, g, t dbSNP:375675796
2409 2409 a, g dbSNP:786204350
2410 2410 g, t dbSNP:727504251
2411 2411 a, t dbSNP:727504252
2413 2413 c, g dbSNP:727505264
2415 2415 -, aga dbSNP:727504288
2417 2417 -, cga dbSNP:746234586
2423 2423 c, t dbSNP:727503188
2424 2424 a, c, g dbSNP:397515964
2428 2428 a, g dbSNP:397515965
2429 2429 -, atgcg dbSNP:730880652
2432 2432 c, t dbSNP:775404728
2433 2433 a, c, g dbSNP:2856655
2434 2434 a, g dbSNP:532996422
2444 2444 a, g dbSNP:774442478
2453 2453 a, c dbSNP:375322174
2456 2456 c, g dbSNP:770514536
2458 2458 a, g dbSNP:765583270
2461 2461 g, t dbSNP:201040413
2463 2463 a, g dbSNP:769531658
2464 2464 -, t dbSNP:397515966
2465 2465 c, t dbSNP:748443032
2471 2471 a, g dbSNP:199865688
2472 2472 c, t dbSNP:3729952
2473 2473 a, g dbSNP:397515967
2474 2474 c, t dbSNP:752007810
2475 2475 a, g dbSNP:540988604
2476 2476 g, t dbSNP:758371979
2477 2477 a, c, t dbSNP:765356720
2478 2478 a, g, t dbSNP:527305885
2479 2479 c, t dbSNP:561942028
2485 2485 -, c dbSNP:730880653
2485 2485 c, t dbSNP:542181308
2486 2486 a, c, g dbSNP:397515969
2491 2491 -, cgtggtgtacgagatgcgcgtc dbSNP:727503187
2491 2491 c, t dbSNP:370561202
2492 2492 a, g dbSNP:376936056
2498 2498 -, t dbSNP:397515970
2499 2499 a, g dbSNP:397515971
2500 2500 c, t dbSNP:373792537
2501 2501 a, g dbSNP:730880567
2502 2502 -, agatgcgcg dbSNP:397515972
2506 2506 -, gcgcgtc dbSNP:730880654
2507 2507 c, g, t dbSNP:727504345
2508 2508 -, gcgtc dbSNP:397515973
2508 2508 a, c, g dbSNP:730880568
2510 2510 a, g dbSNP:747774791
2511 2511 a, t dbSNP:193922379
2512 2512 c, g dbSNP:776282342
2513 2513 c, t dbSNP:768963157
2515 2515 a, c, g dbSNP:397515974
2516 2516 a, g dbSNP:747407752
2517 2517 -, c dbSNP:730880715
2517 2517 c, g, t dbSNP:730880569
2518 2518 a, g dbSNP:369904619
2520 2520 c, t dbSNP:745922957
2521 2521 c, t dbSNP:3729953
2523 2523 a, t dbSNP:730880570
2525 2525 a, g dbSNP:730880571
2526 2526 c, t dbSNP:774172488
2529 2529 -, t dbSNP:752104988
2530 2530 cg, tct dbSNP:397515975
2530 2530 -, c dbSNP:727503186
2530 2530 c, t dbSNP:754062873
2531 2531 a, g, t dbSNP:397515976
2532 2532 -, g dbSNP:397515977
2534 2534 a, g, t dbSNP:373171036
2536 2536 a, g dbSNP:730880572
2539 2539 c, g dbSNP:763010875
2542 2542 g, t dbSNP:773032022
2544 2544 c, t dbSNP:764750484
2547 2547 a, g dbSNP:727503185
2550 2550 c, t dbSNP:761338253
2560 2560 a, g dbSNP:776229039
2572 2572 c, t dbSNP:767998170
2573 2573 a, g dbSNP:768339148
2575 2575 c, t dbSNP:11570097
2576 2576 a, g dbSNP:775890771
2578 2578 a, tc dbSNP:727504371
2578 2578 -, t dbSNP:730880655
2584 2584 -, c dbSNP:397515979
2584 2584 -, c dbSNP:730880656
2587 2587 c, t dbSNP:531228202
2588 2588 a, g dbSNP:190765116
2592 2592 a, c, t dbSNP:371401403
2595 2595 c, t dbSNP:759847861
2598 2598 a, t dbSNP:774889182
2606 2606 a, g dbSNP:730880574
2614 2614 c, t dbSNP:397515980
2615 2615 a, g dbSNP:727504360
2628 2628 c, t dbSNP:397515981
2629 2629 a, g dbSNP:769996102
2642 2642 g, t dbSNP:748326848
2644 2644 a, g dbSNP:397515982
2645 2645 c, t dbSNP:727504418
2646 2646 a, g dbSNP:727504378
2650 2650 a, c, g dbSNP:559961809
2656 2656 g, t dbSNP:369289966
2657 2657 c, t dbSNP:374976635
2658 2658 a, g dbSNP:372628478
2660 2660 a, g dbSNP:35078470
2667 2667 c, t dbSNP:752354801
2676 2676 c, t dbSNP:767113733
2683 2683 -, ctacagcgtgg dbSNP:730880657
2688 2688 a, g dbSNP:397515983
2689 2689 c, t dbSNP:759920601
2690 2690 a, g dbSNP:774634021
2697 2697 a, g dbSNP:397515984
2702 2702 a, c dbSNP:397515985
2711 2711 -, t dbSNP:730880658
2713 2713 -, c dbSNP:730880660
2718 2718 -, a dbSNP:730880661
2721 2721 a, g dbSNP:727504349
2722 2722 a, g dbSNP:730880576
2727 2727 -, g dbSNP:34114081
2732 2732 c, t dbSNP:767182632
2735 2735 c, g dbSNP:367729718
2739 2739 a, g dbSNP:751224775
2743 2743 a, g dbSNP:577575638
2745 2745 c, t dbSNP:200406864
2754 2754 -, ca dbSNP:727504265
2757 2757 c, t dbSNP:773819168
2758 2758 a, c, g dbSNP:372510974
2766 2766 -, t dbSNP:730880716
2774 2774 c, g, t dbSNP:367980215
2781 2781 a, c, t dbSNP:374946555
2782 2782 a, g dbSNP:370530334
2786 2786 g, t dbSNP:556390274
2789 2789 c, t dbSNP:534366414
2796 2796 c, t dbSNP:575117255
2801 2801 c, t dbSNP:387907267
2802 2802 a, g dbSNP:397515986
2807 2807 -, cg dbSNP:397515987
2807 2807 c, t dbSNP:727503183
2812 2812 a, g dbSNP:376858768
2813 2813 a, c dbSNP:397515988
2814 2814 a, g dbSNP:754525416
2815 2815 a, c dbSNP:751120827
2817 2817 a, c dbSNP:121909376
2820 2820 -, t dbSNP:786204352
2820 2820 c, t dbSNP:766165160
2823 2823 c, t dbSNP:730880577
2828 2828 c, g dbSNP:554694434
2830 2830 g, t dbSNP:397515989
2834 2834 a, g dbSNP:373744177
2838 2838 -, ct dbSNP:397515990
2844 2844 c, g dbSNP:193922380