Email to GenScript

NBN nibrin [Homo sapiens (human)]

Gene Symbol NBN
Entrez Gene ID 4683
Full Name nibrin
Synonyms AT-V1, AT-V2, ATV, NBS, NBS1, P95
General protein information
Preferred Names
cell cycle regulatory protein p95
Nijmegen breakage syndrome 1 (nibrin)
p95 protein of the MRE11/RAD50 complex
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Nijmegen breakage syndrome, 251260 (3); Leukemia, acute

The following NBN gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the NBN gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59211 XM_011517044 PREDICTED: Homo sapiens nibrin (NBN), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu42449 XM_011517045 PREDICTED: Homo sapiens nibrin (NBN), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu59212 XM_011517046 PREDICTED: Homo sapiens nibrin (NBN), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu25559 NM_002485 Homo sapiens nibrin (NBN), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379
OHu42449 NM_001024688 Homo sapiens nibrin (NBN), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu59211
Accession Version XM_011517044.1
Sequence Information ORF Nucleotide Sequence (Length: 2241bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nibrin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008046.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)28..318(+)
Misc Feature(2)73..216(+)
Misc Feature(3)331..537(+)
Misc Feature(4)367..405(+)
Misc Feature(5)517..531(+)
Misc Feature(6)2035..2229(+)
Position Chain Variation Link
1 1 c, t dbSNP:780414215
3 3 a, g dbSNP:143768788
31 31 a, g dbSNP:745439506
36 36 a, g dbSNP:577332041
43 43 a, c dbSNP:587781939
47 47 g, t dbSNP:749263651
51 51 -, t dbSNP:758708229
55 55 a, g dbSNP:369910645
64 64 a, g dbSNP:587781748
67 67 c, g dbSNP:752964949
68 68 c, t dbSNP:781536675
71 71 g, t dbSNP:755171159
79 79 -, aa dbSNP:587781718
80 80 a, g dbSNP:587781450
93 93 a, g dbSNP:1063045
95 95 c, t dbSNP:587780773
96 96 -, tgaaaatgatcagtcgatcagccgaaatcat dbSNP:730881840
96 96 a, g, t dbSNP:78870221
105 105 -, t dbSNP:765299838
106 106 a, c, g dbSNP:377730553
107 107 a, g dbSNP:765551184
110 110 c, t dbSNP:587781530
111 111 g, t dbSNP:774989816
114 114 -, c dbSNP:587781891
118 118 c, t dbSNP:200287925
119 119 a, g dbSNP:759146120
124 124 c, t dbSNP:773865323
126 126 c, t dbSNP:770618624
132 132 -, gt dbSNP:750375741
138 138 a, t dbSNP:749206453
147 147 -, tt dbSNP:767454740
147 147 c, t dbSNP:777925415
152 152 a, t dbSNP:769700749
161 161 c, t dbSNP:747920256
168 168 a, g dbSNP:758457183
172 172 -, ga dbSNP:768378152
174 174 -, t dbSNP:587782147
181 181 c, t dbSNP:267602038
184 184 a, g dbSNP:778998026
189 189 a, g dbSNP:757735005
195 195 a, t dbSNP:786201800
198 198 a, g dbSNP:754352569
199 199 a, c, g dbSNP:560337591
201 201 -, ta dbSNP:786202494
202 202 -, ga dbSNP:762664474
211 211 c, t dbSNP:587780094
215 215 c, g dbSNP:587782179
218 218 a, c dbSNP:587781412
223 223 -, gtta dbSNP:775199696
226 226 a, g dbSNP:786202749
232 232 -, g dbSNP:769239902
233 233 a, g dbSNP:786202085
234 234 a, g dbSNP:786203921
235 235 a, g dbSNP:193921030
242 242 a, g dbSNP:762702597
245 245 a, g dbSNP:587780095
251 251 c, t dbSNP:786203573
257 257 a, c, g dbSNP:747315554
261 261 g, t dbSNP:776469548
269 269 c, t dbSNP:12721593
270 270 a, g dbSNP:587780781
274 274 a, g dbSNP:61753720
275 275 a, g dbSNP:545276922
277 277 a, g dbSNP:730882133
280 280 a, g dbSNP:730881855
292 292 a, g dbSNP:786202139
293 293 c, t dbSNP:185493105
297 297 -, t dbSNP:587781305
302 302 c, g dbSNP:778943002
306 306 a, t dbSNP:13312858
308 308 -, t dbSNP:745355767
314 314 c, t dbSNP:775217949
316 316 c, g dbSNP:587780096
324 324 a, g dbSNP:376455714
326 326 c, g dbSNP:759723870
330 330 a, g dbSNP:774622977
331 331 a, g dbSNP:771034958
344 344 -, ctt dbSNP:730881841
347 347 a, g dbSNP:749272832
352 352 c, g dbSNP:777916019
353 353 a, g dbSNP:770163751
355 355 a, g dbSNP:786203652
357 357 c, t dbSNP:748684665
358 358 g, t dbSNP:786203615
362 362 a, g dbSNP:781671474
372 372 c, t dbSNP:61754795
375 375 a, g dbSNP:587780782
381 381 a, g dbSNP:146150499
384 384 g, t dbSNP:372061224
385 385 a, g dbSNP:756946899
389 389 c, t dbSNP:111244949
398 398 -, g dbSNP:747462107
401 401 a, g dbSNP:753219054
406 406 a, g dbSNP:543852763
408 408 c, t dbSNP:760586161
410 410 c, t dbSNP:752672571
411 411 a, g dbSNP:767296279
416 416 a, g dbSNP:769414
417 417 c, t dbSNP:143070291
418 418 c, t dbSNP:770995856
432 432 c, t dbSNP:137857529
439 439 c, t dbSNP:773119929
442 442 g, t dbSNP:587781549
447 447 a, g dbSNP:201816949
450 450 a, c, g dbSNP:566630862
459 459 a, c dbSNP:730881858
466 466 a, t dbSNP:747319065
473 473 c, g dbSNP:766055272
474 474 a, g dbSNP:758276775
475 475 a, g dbSNP:750594114
481 481 g, t dbSNP:786201252
483 483 a, c dbSNP:765493509
484 484 c, g, t dbSNP:776810966
486 486 c, g dbSNP:764290829
496 496 c, t dbSNP:182756889
497 497 a, g dbSNP:776134250
500 500 c, t dbSNP:587782411
501 501 a, g dbSNP:772311947
502 502 a, g dbSNP:61754966
511 511 a, c dbSNP:587778546
514 514 a, g dbSNP:730881861
516 516 a, g dbSNP:769400631
538 538 a, g, t dbSNP:151070415
540 540 a, t dbSNP:780661058
544 544 c, g dbSNP:1805794
579 579 c, t dbSNP:745821999
586 586 c, t dbSNP:587780097
587 587 c, g dbSNP:730881844
592 592 a, g dbSNP:757186245
593 593 a, g, t dbSNP:587780098
594 594 -, tga dbSNP:755050499
600 600 a, g dbSNP:778083915
604 604 a, g dbSNP:730881845
605 605 c, t dbSNP:786203215
611 611 g, t dbSNP:587780099
618 618 c, t dbSNP:767520591
619 619 g, t dbSNP:61754796
622 622 a, g dbSNP:752104183
624 624 a, t dbSNP:377700348
633 633 a, g dbSNP:763363235
634 634 c, g, t dbSNP:34767364
635 635 a, g dbSNP:61753718
637 637 g, t dbSNP:769416
639 639 a, g dbSNP:786201883
640 640 c, g dbSNP:760275251
644 644 g, t dbSNP:786202250
646 646 a, c dbSNP:730881846
647 647 a, g dbSNP:376951288
648 648 -, acaaa dbSNP:587776650
648 648 a, g dbSNP:745768664
654 654 c, t dbSNP:372705975
655 655 c, t dbSNP:541992192
659 659 a, c dbSNP:530438634
662 662 a, g dbSNP:199845467
671 671 c, t dbSNP:749025721
674 674 g, t dbSNP:777460725
687 687 c, t dbSNP:566091759
689 689 -, aaca dbSNP:587780100
695 695 a, g dbSNP:769519885
703 703 c, t dbSNP:748400884
706 706 a, c dbSNP:587781868
711 711 c, t dbSNP:781323381
712 712 a, g dbSNP:587781333
718 718 g, t dbSNP:786203253
732 732 a, g dbSNP:747021126
738 738 g, t dbSNP:780134747
741 741 g, t dbSNP:758852942
745 745 a, g dbSNP:587782746
748 748 a, g dbSNP:765602971
749 749 c, t dbSNP:61754967
755 755 a, g dbSNP:754243946
764 764 a, g dbSNP:786203380
766 766 a, g dbSNP:201559159
769 769 a, c dbSNP:767013459
774 774 g, t dbSNP:375336614
777 777 a, c dbSNP:372159380
779 779 c, t dbSNP:147626427
785 785 c, t dbSNP:61612852
787 787 c, g dbSNP:762956906
788 788 c, t dbSNP:769420
789 789 a, g dbSNP:368786672
791 791 a, g dbSNP:747837246
794 794 -, c dbSNP:751497896
794 794 c, t dbSNP:535602436
795 795 a, g dbSNP:141443872
797 797 c, g dbSNP:768822147
799 799 -, gt dbSNP:786202490
806 806 a, g dbSNP:730881847
808 808 -, a dbSNP:730881839
810 810 a, t dbSNP:147660518
811 811 a, g dbSNP:540837864
833 833 g, t dbSNP:786205135
836 836 c, t dbSNP:786202604
842 842 a, g dbSNP:772176894
863 863 a, g dbSNP:587778547
864 864 a, g dbSNP:786202939
871 871 a, t dbSNP:746381477
872 872 c, t dbSNP:779346343
881 881 c, t dbSNP:757787958
885 885 a, g dbSNP:766482117
887 887 a, g dbSNP:754113612
888 888 a, g dbSNP:779798363
890 890 a, g dbSNP:758070132
893 893 a, g dbSNP:749857140
898 898 a, g dbSNP:764823411
902 902 c, t dbSNP:536965870
916 916 a, g dbSNP:587780101
920 920 c, t dbSNP:753812768
921 921 a, t dbSNP:142813526
926 926 c, t dbSNP:371480039
927 927 a, g dbSNP:148517156
929 929 c, t dbSNP:730881862
930 930 a, g dbSNP:145750430
931 931 a, g dbSNP:529845940
932 932 g, t dbSNP:771086262
933 933 a, g dbSNP:749757928
940 940 a, g dbSNP:587782502
956 956 a, g dbSNP:770441030
957 957 c, t dbSNP:748453607
959 959 a, g dbSNP:730881848
960 960 c, t dbSNP:773860553
962 962 a, g dbSNP:781711300
967 967 c, t dbSNP:121908973
969 969 a, g dbSNP:757936747
983 983 c, g, t dbSNP:587782905
999 999 -, aac dbSNP:770500095
999 999 a, t dbSNP:786201619
1001 1001 -, aac dbSNP:786202982
1014 1014 c, g dbSNP:756023239
1015 1015 c, t dbSNP:587782656
1018 1018 c, t dbSNP:530636519
1021 1021 c, t dbSNP:767215758
1025 1025 g, t dbSNP:587780089
1026 1026 c, t dbSNP:146605798
1027 1027 a, g dbSNP:200297914
1038 1038 c, t dbSNP:763296399
1047 1047 a, g dbSNP:369092711
1054 1054 a, g, t dbSNP:762376159
1057 1057 a, g dbSNP:777259845
1067 1067 a, g dbSNP:768886664
1071 1071 -, tac dbSNP:587782745
1074 1074 a, g dbSNP:761042468
1080 1080 a, c, t dbSNP:121908974
1081 1081 a, g dbSNP:765403660
1082 1082 c, t dbSNP:370229163
1095 1095 a, g dbSNP:777235726
1106 1106 c, g dbSNP:587781438
1114 1114 c, t dbSNP:769361806
1120 1120 g, t dbSNP:587780547
1131 1131 a, g dbSNP:762590883
1133 1133 -, c dbSNP:587781969
1138 1138 a, g dbSNP:772909239
1143 1143 c, g dbSNP:551802153
1145 1145 -, aa dbSNP:748513310
1145 1145 a, g dbSNP:769453547
1146 1146 -, a dbSNP:772612131
1151 1151 c, g dbSNP:747632184
1163 1163 a, g dbSNP:201958895
1164 1164 a, g dbSNP:780602705
1178 1178 c, t dbSNP:182030463
1184 1184 a, g dbSNP:746965070
1185 1185 a, c dbSNP:200046373
1188 1188 c, t dbSNP:709816
1189 1189 a, g dbSNP:551602980
1190 1190 c, t dbSNP:779218232
1193 1193 c, g, t dbSNP:104895033
1195 1195 a, g dbSNP:201373377
1201 1201 a, t dbSNP:761214266
1203 1203 a, g dbSNP:753212974
1213 1213 a, g dbSNP:34120922
1223 1223 c, g dbSNP:551032019
1229 1229 a, g dbSNP:529340553
1234 1234 -, tta dbSNP:587781532
1235 1235 a, g dbSNP:764832388
1236 1236 c, g, t dbSNP:776180689
1239 1239 g, t dbSNP:756572268
1240 1240 g, t dbSNP:768087330
1242 1242 a, g dbSNP:749316300
1246 1246 a, c, g dbSNP:730881849
1250 1250 c, g dbSNP:772147514
1253 1253 c, t dbSNP:104895032
1271 1271 c, g dbSNP:778881191
1273 1273 a, g dbSNP:786202302
1276 1276 g, t dbSNP:587782409
1277 1277 a, g dbSNP:370121348
1292 1292 a, c, t dbSNP:757452107
1294 1294 a, g dbSNP:749512960
1297 1297 c, t dbSNP:375885975
1299 1299 c, g dbSNP:756208277
1304 1304 g, t dbSNP:786203131
1306 1306 a, g dbSNP:752837508
1308 1308 a, g dbSNP:28538230
1311 1311 c, t dbSNP:755513646
1312 1312 a, c dbSNP:751876787
1334 1334 a, t dbSNP:146403088
1338 1338 a, g dbSNP:761492204
1340 1340 a, t dbSNP:776210901
1345 1345 a, c dbSNP:141137543
1352 1352 a, c dbSNP:587780774
1353 1353 c, t dbSNP:587780775
1362 1362 c, t dbSNP:760043998
1364 1364 a, g dbSNP:544909538
1373 1373 c, t dbSNP:367760321
1377 1377 c, t dbSNP:772094384
1378 1378 a, g dbSNP:745821964
1393 1393 a, g dbSNP:769862680
1394 1394 a, c, g dbSNP:781213350
1395 1395 a, g, t dbSNP:730881851
1396 1396 a, g, t dbSNP:148205441
1397 1397 a, c dbSNP:780365310
1399 1399 a, g dbSNP:758947240
1406 1406 a, g dbSNP:750711786
1407 1407 c, t dbSNP:779357587
1408 1408 a, c dbSNP:755805461
1410 1410 a, g dbSNP:587780535
1414 1414 a, c dbSNP:767106269
1421 1421 c, t dbSNP:767123014
1422 1422 a, g dbSNP:759060729
1427 1427 a, g dbSNP:786202028
1434 1434 a, g dbSNP:751121403
1436 1436 a, g dbSNP:775451862
1445 1445 a, c, t dbSNP:200891292
1446 1446 a, g dbSNP:772864909
1447 1447 c, t dbSNP:587781380
1448 1448 c, t dbSNP:572568222
1451 1451 a, g dbSNP:587782118
1456 1456 c, g dbSNP:143948240
1462 1462 a, g dbSNP:776900339
1465 1465 c, t dbSNP:587782130
1466 1466 a, g dbSNP:768883132
1471 1471 a, c dbSNP:587781557
1474 1474 a, cc dbSNP:786203180
1474 1474 a, c dbSNP:747027298
1475 1475 -, c dbSNP:764884516
1477 1477 a, g dbSNP:730881863
1480 1480 a, g dbSNP:3026268
1487 1487 c, t dbSNP:772411713
1488 1488 a, g dbSNP:774032674
1489 1489 c, t dbSNP:779116935
1502 1502 a, g dbSNP:757754183
1506 1506 -, g dbSNP:759232053
1511 1511 a, g dbSNP:587782520
1524 1524 g, t dbSNP:587780776
1527 1527 a, g dbSNP:754267250
1537 1537 a, g dbSNP:376653589
1538 1538 c, t dbSNP:754706758
1541 1541 -, a dbSNP:587782344
1546 1546 g, t dbSNP:111239312
1550 1550 a, g dbSNP:750981708
1554 1554 c, t dbSNP:765959451
1566 1566 a, t dbSNP:587782150
1570 1570 g, t dbSNP:104895031
1582 1582 a, g dbSNP:587782330
1585 1585 a, c, g, t dbSNP:545435120
1586 1586 a, t dbSNP:761541023
1607 1607 c, g dbSNP:768431216
1610 1610 a, g dbSNP:730881852
1615 1615 g, t dbSNP:764263689
1616 1616 c, t dbSNP:760911186
1619 1619 a, g dbSNP:587781624
1620 1620 a, g dbSNP:786201093
1631 1631 -, c dbSNP:776417262
1633 1633 a, g dbSNP:772234785
1642 1642 -, a dbSNP:766044684
1645 1645 -, g dbSNP:760237820
1648 1648 a, g dbSNP:746347634
1657 1657 a, g, t dbSNP:771567358
1658 1658 a, t dbSNP:558023830
1665 1665 a, g dbSNP:778302563
1675 1675 a, g dbSNP:754651655
1681 1681 a, g dbSNP:72550742
1686 1686 a, g dbSNP:557356152
1692 1692 c, g dbSNP:730881853
1699 1699 a, g dbSNP:730881854
1702 1702 a, g dbSNP:587780090
1705 1705 c, t dbSNP:749918573
1711 1711 a, t dbSNP:142334798
1714 1714 g, t dbSNP:786201745
1720 1720 g, t dbSNP:587781881
1728 1728 a, g dbSNP:753582962
1745 1745 a, g dbSNP:763926389
1747 1747 c, g dbSNP:786202588
1752 1752 c, t dbSNP:769773789
1768 1768 c, g dbSNP:146989944
1787 1787 c, g dbSNP:775848374
1793 1793 a, g dbSNP:553571469
1798 1798 g, t dbSNP:112524180
1800 1800 a, c dbSNP:192236678
1807 1807 a, g dbSNP:774324419
1815 1815 a, g dbSNP:771513989
1816 1816 a, c dbSNP:372012641
1817 1817 c, g dbSNP:773678006
1833 1833 a, g dbSNP:770345026
1834 1834 c, t dbSNP:746632073
1839 1839 a, g dbSNP:587782269
1840 1840 a, g dbSNP:766602873
1847 1847 a, c dbSNP:763546746
1854 1854 a, g dbSNP:773909162
1857 1857 c, g dbSNP:587782221
1862 1862 a, g dbSNP:587782297
1864 1864 a, g dbSNP:369049359
1871 1871 a, g dbSNP:762174459
1873 1873 a, g dbSNP:115321485
1875 1875 a, g dbSNP:771709611
1876 1876 a, g dbSNP:745559078
1879 1879 c, t dbSNP:377132067
1881 1881 a, c dbSNP:587780778
1884 1884 a, g dbSNP:778364604
1894 1894 a, t dbSNP:587782545
1902 1902 a, g dbSNP:372877871
1903 1903 c, t dbSNP:199657566
1904 1904 a, c dbSNP:756036331
1910 1910 a, g dbSNP:748073091
1916 1916 a, g dbSNP:587781547
1921 1921 a, c dbSNP:764050423
1923 1923 a, g dbSNP:754783870
1939 1939 c, t dbSNP:368703936
1945 1945 a, c, g dbSNP:780360772
1949 1949 -, a dbSNP:780235686
1952 1952 g, t dbSNP:758728938
1964 1964 a, g dbSNP:587782155
1970 1970 c, g dbSNP:201781110
1977 1977 -, ggtgattaaaaact dbSNP:587782653
1977 1977 a, g dbSNP:571803328
1980 1980 a, g dbSNP:757753217
1990 1990 c, g, t dbSNP:587780091
1991 1991 c, t dbSNP:374638426
1993 1993 a, g dbSNP:138913151
1998 1998 c, t dbSNP:200399787
2006 2006 a, g dbSNP:6413508
2007 2007 a, g dbSNP:1061302
2008 2008 g, t dbSNP:202198205
2020 2020 a, g dbSNP:730881856
2025 2025 c, t dbSNP:769252040
2027 2027 a, g dbSNP:370295427
2029 2029 a, g dbSNP:200564603
2044 2044 c, t dbSNP:768715280
2046 2046 c, t dbSNP:765458801
2047 2047 a, t dbSNP:786203920
2048 2048 a, g dbSNP:746764974
2051 2051 a, c dbSNP:186371605
2052 2052 a, g dbSNP:758675398
2053 2053 a, t dbSNP:746135009
2059 2059 a, c dbSNP:587780092
2060 2060 a, c dbSNP:779048193
2062 2062 a, g dbSNP:772059959
2072 2072 c, g dbSNP:746090959
2073 2073 c, g, t dbSNP:7823648
2077 2077 a, g dbSNP:749276965
2092 2092 c, t dbSNP:587781567
2094 2094 c, t dbSNP:753991062
2108 2108 c, g dbSNP:730881857
2113 2113 c, g dbSNP:756580887
2116 2116 a, t dbSNP:753269019
2122 2122 c, t dbSNP:780333168
2125 2125 -, cat dbSNP:786204096
2125 2125 a, c dbSNP:781520763
2130 2130 c, t dbSNP:755274971
2131 2131 c, g, t dbSNP:730881864
2132 2132 a, g, t dbSNP:753270166
2137 2137 a, g dbSNP:72563785
2140 2140 a, t dbSNP:587780093
2142 2142 a, g dbSNP:760687282
2154 2154 a, g dbSNP:786202747
2156 2156 a, g dbSNP:786204181
2158 2158 a, c dbSNP:759888769
2181 2181 a, g dbSNP:786203112
2182 2182 a, t dbSNP:369649307
2187 2187 a, g dbSNP:587780780
2191 2191 g, t dbSNP:755536922
2192 2192 c, t dbSNP:751824753
2193 2193 a, g dbSNP:200452212
2197 2197 g, t dbSNP:756831345
2201 2201 -, ag dbSNP:774508816
2202 2202 a, g dbSNP:753596803
2206 2206 c, g dbSNP:370058152
2208 2208 c, t dbSNP:760207156
2211 2211 c, t dbSNP:147494981
2215 2215 g, t dbSNP:746479577
2217 2217 a, t dbSNP:767523514
2226 2226 a, g dbSNP:754865465
2229 2229 a, c dbSNP:751570713
2231 2231 a, g dbSNP:766237464
2238 2238 c, t dbSNP:762740478
2249 2249 g, t dbSNP:773020664
2250 2250 a, g dbSNP:765391308
2258 2258 g, t dbSNP:762074357
2263 2263 -, a dbSNP:753592154
2267 2267 -, t dbSNP:766098004
2279 2279 a, g dbSNP:776664609
2292 2292 -, c dbSNP:760362522
2293 2293 c, t dbSNP:768851314
2313 2313 c, t dbSNP:559362302
2316 2316 a, g dbSNP:370246957
2321 2321 a, c, g dbSNP:371136272
2337 2337 a, g dbSNP:774084218
2348 2348 c, t dbSNP:13312975
2419 2419 a, g dbSNP:768441791
2432 2432 a, g dbSNP:565030924
2437 2437 a, g dbSNP:543547995
2510 2510 a, t dbSNP:576055352
2529 2529 a, g dbSNP:1063053
2564 2564 a, g dbSNP:779678982
2572 2572 a, g dbSNP:13312976
2606 2606 c, t dbSNP:13312977
2608 2608 c, g dbSNP:13312978
2657 2657 c, g dbSNP:104895030
2675 2675 c, t dbSNP:13312979
2699 2699 c, t dbSNP:536082052
2705 2705 a, g dbSNP:538374977
2745 2745 c, t dbSNP:13312980
2754 2754 c, t dbSNP:549386727
2760 2760 a, g dbSNP:3780123
2776 2776 g, t dbSNP:143335332
2790 2790 a, t dbSNP:567490517
2797 2797 c, g dbSNP:2735383
2827 2827 a, c dbSNP:565397049
2835 2835 c, g dbSNP:751670125
2841 2841 a, t dbSNP:565126379
2887 2887 a, t dbSNP:547194105
2934 2934 -, a dbSNP:755532733
2942 2942 a, g dbSNP:72561474
2943 2943 c, t dbSNP:532174652
2970 2970 a, g dbSNP:186378464
2980 2980 -, t dbSNP:564878448
2987 2987 a, g dbSNP:576123506
3013 3013 a, g dbSNP:13312981
3018 3018 c, t dbSNP:542679031
3046 3046 g, t dbSNP:11987887
3059 3059 a, g dbSNP:13312982
3085 3085 a, t dbSNP:752958453
3193 3193 c, t dbSNP:11987865
3238 3238 a, g dbSNP:531640209
3239 3239 a, g dbSNP:13312983
3243 3243 g, t dbSNP:78935210
3258 3258 c, t dbSNP:766917118
3269 3269 a, g dbSNP:13312984
3288 3288 c, g dbSNP:148398077
3319 3319 a, g dbSNP:567816134
3453 3453 c, g dbSNP:770422147
3457 3457 a, g dbSNP:116491182
3461 3461 c, t dbSNP:373449852
3465 3465 a, c dbSNP:1063054
3478 3478 a, c dbSNP:13312985
3553 3553 g, t dbSNP:547479870
3584 3584 c, t dbSNP:762686592
3620 3620 a, g dbSNP:150060153
3656 3656 c, t dbSNP:532490798
3789 3789 c, t dbSNP:560563374
3801 3801 c, t dbSNP:775267930
3839 3839 a, g dbSNP:139384734
3898 3898 a, g dbSNP:769415813
3901 3901 a, g dbSNP:549979435
3912 3912 a, t dbSNP:531428263
3937 3937 a, g dbSNP:561103577
3948 3948 a, g dbSNP:13312986
4010 4010 c, t dbSNP:9995
4021 4021 a, c dbSNP:550722012
4079 4079 c, t dbSNP:556606685
4109 4109 c, t dbSNP:544588009
4110 4110 a, c dbSNP:180734807
4115 4115 g, t dbSNP:3087624
4118 4118 g, t dbSNP:577945509
4181 4181 c, t dbSNP:746998810
4198 4198 a, g dbSNP:538552137
4217 4217 c, t dbSNP:13312987
4219 4219 a, t dbSNP:544852343
4233 4233 c, t dbSNP:14448
4270 4270 a, g dbSNP:555880522
4315 4315 a, c dbSNP:755199398
4317 4317 a, t dbSNP:547312108

Target ORF information:

RefSeq Version XM_011517044
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nibrin (NBN), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu42449
Accession Version XM_011517045.1
Sequence Information ORF Nucleotide Sequence (Length: 2019bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nibrin isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008046.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)383..589(+)
Misc Feature(2)419..457(+)
Misc Feature(3)569..583(+)
Misc Feature(4)2087..2281(+)
Position Chain Variation Link
9 9 g, t dbSNP:571828877
12 12 a, g dbSNP:772006075
33 33 a, g dbSNP:745439506
38 38 a, g dbSNP:577332041
45 45 a, c dbSNP:587781939
49 49 g, t dbSNP:749263651
53 53 -, t dbSNP:758708229
57 57 a, g dbSNP:369910645
66 66 a, g dbSNP:587781748
69 69 c, g dbSNP:752964949
70 70 c, t dbSNP:781536675
73 73 g, t dbSNP:755171159
81 81 -, aa dbSNP:587781718
82 82 a, g dbSNP:587781450
95 95 a, g dbSNP:1063045
97 97 c, t dbSNP:587780773
98 98 -, tgaaaatgatcagtcgatcagccgaaatcat dbSNP:730881840
98 98 a, g, t dbSNP:78870221
107 107 -, t dbSNP:765299838
108 108 a, c, g dbSNP:377730553
109 109 a, g dbSNP:765551184
112 112 c, t dbSNP:587781530
113 113 g, t dbSNP:774989816
116 116 -, c dbSNP:587781891
120 120 c, t dbSNP:200287925
121 121 a, g dbSNP:759146120
126 126 c, t dbSNP:773865323
128 128 c, t dbSNP:770618624
134 134 -, gt dbSNP:750375741
140 140 a, t dbSNP:749206453
149 149 -, tt dbSNP:767454740
149 149 c, t dbSNP:777925415
154 154 a, t dbSNP:769700749
163 163 c, t dbSNP:747920256
178 178 c, t dbSNP:574171178
196 196 a, g dbSNP:104895038
197 197 a, g dbSNP:764392109
220 220 a, g dbSNP:758457183
224 224 -, ga dbSNP:768378152
226 226 -, t dbSNP:587782147
233 233 c, t dbSNP:267602038
236 236 a, g dbSNP:778998026
241 241 a, g dbSNP:757735005
247 247 a, t dbSNP:786201800
250 250 a, g dbSNP:754352569
251 251 a, c, g dbSNP:560337591
253 253 -, ta dbSNP:786202494
254 254 -, ga dbSNP:762664474
263 263 c, t dbSNP:587780094
267 267 c, g dbSNP:587782179
270 270 a, c dbSNP:587781412
275 275 -, gtta dbSNP:775199696
278 278 a, g dbSNP:786202749
284 284 -, g dbSNP:769239902
285 285 a, g dbSNP:786202085
286 286 a, g dbSNP:786203921
287 287 a, g dbSNP:193921030
294 294 a, g dbSNP:762702597
297 297 a, g dbSNP:587780095
303 303 c, t dbSNP:786203573
309 309 a, c, g dbSNP:747315554
313 313 g, t dbSNP:776469548
321 321 c, t dbSNP:12721593
322 322 a, g dbSNP:587780781
326 326 a, g dbSNP:61753720
327 327 a, g dbSNP:545276922
329 329 a, g dbSNP:730882133
332 332 a, g dbSNP:730881855
344 344 a, g dbSNP:786202139
345 345 c, t dbSNP:185493105
349 349 -, t dbSNP:587781305
354 354 c, g dbSNP:778943002
358 358 a, t dbSNP:13312858
360 360 -, t dbSNP:745355767
366 366 c, t dbSNP:775217949
368 368 c, g dbSNP:587780096
376 376 a, g dbSNP:376455714
378 378 c, g dbSNP:759723870
382 382 a, g dbSNP:774622977
383 383 a, g dbSNP:771034958
396 396 -, ctt dbSNP:730881841
399 399 a, g dbSNP:749272832
404 404 c, g dbSNP:777916019
405 405 a, g dbSNP:770163751
407 407 a, g dbSNP:786203652
409 409 c, t dbSNP:748684665
410 410 g, t dbSNP:786203615
414 414 a, g dbSNP:781671474
424 424 c, t dbSNP:61754795
427 427 a, g dbSNP:587780782
433 433 a, g dbSNP:146150499
436 436 g, t dbSNP:372061224
437 437 a, g dbSNP:756946899
441 441 c, t dbSNP:111244949
450 450 -, g dbSNP:747462107
453 453 a, g dbSNP:753219054
458 458 a, g dbSNP:543852763
460 460 c, t dbSNP:760586161
462 462 c, t dbSNP:752672571
463 463 a, g dbSNP:767296279
468 468 a, g dbSNP:769414
469 469 c, t dbSNP:143070291
470 470 c, t dbSNP:770995856
484 484 c, t dbSNP:137857529
491 491 c, t dbSNP:773119929
494 494 g, t dbSNP:587781549
499 499 a, g dbSNP:201816949
502 502 a, c, g dbSNP:566630862
511 511 a, c dbSNP:730881858
518 518 a, t dbSNP:747319065
525 525 c, g dbSNP:766055272
526 526 a, g dbSNP:758276775
527 527 a, g dbSNP:750594114
533 533 g, t dbSNP:786201252
535 535 a, c dbSNP:765493509
536 536 c, g, t dbSNP:776810966
538 538 c, g dbSNP:764290829
548 548 c, t dbSNP:182756889
549 549 a, g dbSNP:776134250
552 552 c, t dbSNP:587782411
553 553 a, g dbSNP:772311947
554 554 a, g dbSNP:61754966
563 563 a, c dbSNP:587778546
566 566 a, g dbSNP:730881861
568 568 a, g dbSNP:769400631
590 590 a, g, t dbSNP:151070415
592 592 a, t dbSNP:780661058
596 596 c, g dbSNP:1805794
631 631 c, t dbSNP:745821999
638 638 c, t dbSNP:587780097
639 639 c, g dbSNP:730881844
644 644 a, g dbSNP:757186245
645 645 a, g, t dbSNP:587780098
646 646 -, tga dbSNP:755050499
652 652 a, g dbSNP:778083915
656 656 a, g dbSNP:730881845
657 657 c, t dbSNP:786203215
663 663 g, t dbSNP:587780099
670 670 c, t dbSNP:767520591
671 671 g, t dbSNP:61754796
674 674 a, g dbSNP:752104183
676 676 a, t dbSNP:377700348
685 685 a, g dbSNP:763363235
686 686 c, g, t dbSNP:34767364
687 687 a, g dbSNP:61753718
689 689 g, t dbSNP:769416
691 691 a, g dbSNP:786201883
692 692 c, g dbSNP:760275251
696 696 g, t dbSNP:786202250
698 698 a, c dbSNP:730881846
699 699 a, g dbSNP:376951288
700 700 -, acaaa dbSNP:587776650
700 700 a, g dbSNP:745768664
706 706 c, t dbSNP:372705975
707 707 c, t dbSNP:541992192
711 711 a, c dbSNP:530438634
714 714 a, g dbSNP:199845467
723 723 c, t dbSNP:749025721
726 726 g, t dbSNP:777460725
739 739 c, t dbSNP:566091759
741 741 -, aaca dbSNP:587780100
747 747 a, g dbSNP:769519885
755 755 c, t dbSNP:748400884
758 758 a, c dbSNP:587781868
763 763 c, t dbSNP:781323381
764 764 a, g dbSNP:587781333
770 770 g, t dbSNP:786203253
784 784 a, g dbSNP:747021126
790 790 g, t dbSNP:780134747
793 793 g, t dbSNP:758852942
797 797 a, g dbSNP:587782746
800 800 a, g dbSNP:765602971
801 801 c, t dbSNP:61754967
807 807 a, g dbSNP:754243946
816 816 a, g dbSNP:786203380
818 818 a, g dbSNP:201559159
821 821 a, c dbSNP:767013459
826 826 g, t dbSNP:375336614
829 829 a, c dbSNP:372159380
831 831 c, t dbSNP:147626427
837 837 c, t dbSNP:61612852
839 839 c, g dbSNP:762956906
840 840 c, t dbSNP:769420
841 841 a, g dbSNP:368786672
843 843 a, g dbSNP:747837246
846 846 -, c dbSNP:751497896
846 846 c, t dbSNP:535602436
847 847 a, g dbSNP:141443872
849 849 c, g dbSNP:768822147
851 851 -, gt dbSNP:786202490
858 858 a, g dbSNP:730881847
860 860 -, a dbSNP:730881839
862 862 a, t dbSNP:147660518
863 863 a, g dbSNP:540837864
885 885 g, t dbSNP:786205135
888 888 c, t dbSNP:786202604
894 894 a, g dbSNP:772176894
915 915 a, g dbSNP:587778547
916 916 a, g dbSNP:786202939
923 923 a, t dbSNP:746381477
924 924 c, t dbSNP:779346343
933 933 c, t dbSNP:757787958
937 937 a, g dbSNP:766482117
939 939 a, g dbSNP:754113612
940 940 a, g dbSNP:779798363
942 942 a, g dbSNP:758070132
945 945 a, g dbSNP:749857140
950 950 a, g dbSNP:764823411
954 954 c, t dbSNP:536965870
968 968 a, g dbSNP:587780101
972 972 c, t dbSNP:753812768
973 973 a, t dbSNP:142813526
978 978 c, t dbSNP:371480039
979 979 a, g dbSNP:148517156
981 981 c, t dbSNP:730881862
982 982 a, g dbSNP:145750430
983 983 a, g dbSNP:529845940
984 984 g, t dbSNP:771086262
985 985 a, g dbSNP:749757928
992 992 a, g dbSNP:587782502
1008 1008 a, g dbSNP:770441030
1009 1009 c, t dbSNP:748453607
1011 1011 a, g dbSNP:730881848
1012 1012 c, t dbSNP:773860553
1014 1014 a, g dbSNP:781711300
1019 1019 c, t dbSNP:121908973
1021 1021 a, g dbSNP:757936747
1035 1035 c, g, t dbSNP:587782905
1051 1051 -, aac dbSNP:770500095
1051 1051 a, t dbSNP:786201619
1053 1053 -, aac dbSNP:786202982
1066 1066 c, g dbSNP:756023239
1067 1067 c, t dbSNP:587782656
1070 1070 c, t dbSNP:530636519
1073 1073 c, t dbSNP:767215758
1077 1077 g, t dbSNP:587780089
1078 1078 c, t dbSNP:146605798
1079 1079 a, g dbSNP:200297914
1090 1090 c, t dbSNP:763296399
1099 1099 a, g dbSNP:369092711
1106 1106 a, g, t dbSNP:762376159
1109 1109 a, g dbSNP:777259845
1119 1119 a, g dbSNP:768886664
1123 1123 -, tac dbSNP:587782745
1126 1126 a, g dbSNP:761042468
1132 1132 a, c, t dbSNP:121908974
1133 1133 a, g dbSNP:765403660
1134 1134 c, t dbSNP:370229163
1147 1147 a, g dbSNP:777235726
1158 1158 c, g dbSNP:587781438
1166 1166 c, t dbSNP:769361806
1172 1172 g, t dbSNP:587780547
1183 1183 a, g dbSNP:762590883
1185 1185 -, c dbSNP:587781969
1190 1190 a, g dbSNP:772909239
1195 1195 c, g dbSNP:551802153
1197 1197 -, aa dbSNP:748513310
1197 1197 a, g dbSNP:769453547
1198 1198 -, a dbSNP:772612131
1203 1203 c, g dbSNP:747632184
1215 1215 a, g dbSNP:201958895
1216 1216 a, g dbSNP:780602705
1230 1230 c, t dbSNP:182030463
1236 1236 a, g dbSNP:746965070
1237 1237 a, c dbSNP:200046373
1240 1240 c, t dbSNP:709816
1241 1241 a, g dbSNP:551602980
1242 1242 c, t dbSNP:779218232
1245 1245 c, g, t dbSNP:104895033
1247 1247 a, g dbSNP:201373377
1253 1253 a, t dbSNP:761214266
1255 1255 a, g dbSNP:753212974
1265 1265 a, g dbSNP:34120922
1275 1275 c, g dbSNP:551032019
1281 1281 a, g dbSNP:529340553
1286 1286 -, tta dbSNP:587781532
1287 1287 a, g dbSNP:764832388
1288 1288 c, g, t dbSNP:776180689
1291 1291 g, t dbSNP:756572268
1292 1292 g, t dbSNP:768087330
1294 1294 a, g dbSNP:749316300
1298 1298 a, c, g dbSNP:730881849
1302 1302 c, g dbSNP:772147514
1305 1305 c, t dbSNP:104895032
1323 1323 c, g dbSNP:778881191
1325 1325 a, g dbSNP:786202302
1328 1328 g, t dbSNP:587782409
1329 1329 a, g dbSNP:370121348
1344 1344 a, c, t dbSNP:757452107
1346 1346 a, g dbSNP:749512960
1349 1349 c, t dbSNP:375885975
1351 1351 c, g dbSNP:756208277
1356 1356 g, t dbSNP:786203131
1358 1358 a, g dbSNP:752837508
1360 1360 a, g dbSNP:28538230
1363 1363 c, t dbSNP:755513646
1364 1364 a, c dbSNP:751876787
1386 1386 a, t dbSNP:146403088
1390 1390 a, g dbSNP:761492204
1392 1392 a, t dbSNP:776210901
1397 1397 a, c dbSNP:141137543
1404 1404 a, c dbSNP:587780774
1405 1405 c, t dbSNP:587780775
1414 1414 c, t dbSNP:760043998
1416 1416 a, g dbSNP:544909538
1425 1425 c, t dbSNP:367760321
1429 1429 c, t dbSNP:772094384
1430 1430 a, g dbSNP:745821964
1445 1445 a, g dbSNP:769862680
1446 1446 a, c, g dbSNP:781213350
1447 1447 a, g, t dbSNP:730881851
1448 1448 a, g, t dbSNP:148205441
1449 1449 a, c dbSNP:780365310
1451 1451 a, g dbSNP:758947240
1458 1458 a, g dbSNP:750711786
1459 1459 c, t dbSNP:779357587
1460 1460 a, c dbSNP:755805461
1462 1462 a, g dbSNP:587780535
1466 1466 a, c dbSNP:767106269
1473 1473 c, t dbSNP:767123014
1474 1474 a, g dbSNP:759060729
1479 1479 a, g dbSNP:786202028
1486 1486 a, g dbSNP:751121403
1488 1488 a, g dbSNP:775451862
1497 1497 a, c, t dbSNP:200891292
1498 1498 a, g dbSNP:772864909
1499 1499 c, t dbSNP:587781380
1500 1500 c, t dbSNP:572568222
1503 1503 a, g dbSNP:587782118
1508 1508 c, g dbSNP:143948240
1514 1514 a, g dbSNP:776900339
1517 1517 c, t dbSNP:587782130
1518 1518 a, g dbSNP:768883132
1523 1523 a, c dbSNP:587781557
1526 1526 a, cc dbSNP:786203180
1526 1526 a, c dbSNP:747027298
1527 1527 -, c dbSNP:764884516
1529 1529 a, g dbSNP:730881863
1532 1532 a, g dbSNP:3026268
1539 1539 c, t dbSNP:772411713
1540 1540 a, g dbSNP:774032674
1541 1541 c, t dbSNP:779116935
1554 1554 a, g dbSNP:757754183
1558 1558 -, g dbSNP:759232053
1563 1563 a, g dbSNP:587782520
1576 1576 g, t dbSNP:587780776
1579 1579 a, g dbSNP:754267250
1589 1589 a, g dbSNP:376653589
1590 1590 c, t dbSNP:754706758
1593 1593 -, a dbSNP:587782344
1598 1598 g, t dbSNP:111239312
1602 1602 a, g dbSNP:750981708
1606 1606 c, t dbSNP:765959451
1618 1618 a, t dbSNP:587782150
1622 1622 g, t dbSNP:104895031
1634 1634 a, g dbSNP:587782330
1637 1637 a, c, g, t dbSNP:545435120
1638 1638 a, t dbSNP:761541023
1659 1659 c, g dbSNP:768431216
1662 1662 a, g dbSNP:730881852
1667 1667 g, t dbSNP:764263689
1668 1668 c, t dbSNP:760911186
1671 1671 a, g dbSNP:587781624
1672 1672 a, g dbSNP:786201093
1683 1683 -, c dbSNP:776417262
1685 1685 a, g dbSNP:772234785
1694 1694 -, a dbSNP:766044684
1697 1697 -, g dbSNP:760237820
1700 1700 a, g dbSNP:746347634
1709 1709 a, g, t dbSNP:771567358
1710 1710 a, t dbSNP:558023830
1717 1717 a, g dbSNP:778302563
1727 1727 a, g dbSNP:754651655
1733 1733 a, g dbSNP:72550742
1738 1738 a, g dbSNP:557356152
1744 1744 c, g dbSNP:730881853
1751 1751 a, g dbSNP:730881854
1754 1754 a, g dbSNP:587780090
1757 1757 c, t dbSNP:749918573
1763 1763 a, t dbSNP:142334798
1766 1766 g, t dbSNP:786201745
1772 1772 g, t dbSNP:587781881
1780 1780 a, g dbSNP:753582962
1797 1797 a, g dbSNP:763926389
1799 1799 c, g dbSNP:786202588
1804 1804 c, t dbSNP:769773789
1820 1820 c, g dbSNP:146989944
1839 1839 c, g dbSNP:775848374
1845 1845 a, g dbSNP:553571469
1850 1850 g, t dbSNP:112524180
1852 1852 a, c dbSNP:192236678
1859 1859 a, g dbSNP:774324419
1867 1867 a, g dbSNP:771513989
1868 1868 a, c dbSNP:372012641
1869 1869 c, g dbSNP:773678006
1885 1885 a, g dbSNP:770345026
1886 1886 c, t dbSNP:746632073
1891 1891 a, g dbSNP:587782269
1892 1892 a, g dbSNP:766602873
1899 1899 a, c dbSNP:763546746
1906 1906 a, g dbSNP:773909162
1909 1909 c, g dbSNP:587782221
1914 1914 a, g dbSNP:587782297
1916 1916 a, g dbSNP:369049359
1923 1923 a, g dbSNP:762174459
1925 1925 a, g dbSNP:115321485
1927 1927 a, g dbSNP:771709611
1928 1928 a, g dbSNP:745559078
1931 1931 c, t dbSNP:377132067
1933 1933 a, c dbSNP:587780778
1936 1936 a, g dbSNP:778364604
1946 1946 a, t dbSNP:587782545
1954 1954 a, g dbSNP:372877871
1955 1955 c, t dbSNP:199657566
1956 1956 a, c dbSNP:756036331
1962 1962 a, g dbSNP:748073091
1968 1968 a, g dbSNP:587781547
1973 1973 a, c dbSNP:764050423
1975 1975 a, g dbSNP:754783870
1991 1991 c, t dbSNP:368703936
1997 1997 a, c, g dbSNP:780360772
2001 2001 -, a dbSNP:780235686
2004 2004 g, t dbSNP:758728938
2016 2016 a, g dbSNP:587782155
2022 2022 c, g dbSNP:201781110
2029 2029 -, ggtgattaaaaact dbSNP:587782653
2029 2029 a, g dbSNP:571803328
2032 2032 a, g dbSNP:757753217
2042 2042 c, g, t dbSNP:587780091
2043 2043 c, t dbSNP:374638426
2045 2045 a, g dbSNP:138913151
2050 2050 c, t dbSNP:200399787
2058 2058 a, g dbSNP:6413508
2059 2059 a, g dbSNP:1061302
2060 2060 g, t dbSNP:202198205
2072 2072 a, g dbSNP:730881856
2077 2077 c, t dbSNP:769252040
2079 2079 a, g dbSNP:370295427
2081 2081 a, g dbSNP:200564603
2096 2096 c, t dbSNP:768715280
2098 2098 c, t dbSNP:765458801
2099 2099 a, t dbSNP:786203920
2100 2100 a, g dbSNP:746764974
2103 2103 a, c dbSNP:186371605
2104 2104 a, g dbSNP:758675398
2105 2105 a, t dbSNP:746135009
2111 2111 a, c dbSNP:587780092
2112 2112 a, c dbSNP:779048193
2114 2114 a, g dbSNP:772059959
2124 2124 c, g dbSNP:746090959
2125 2125 c, g, t dbSNP:7823648
2129 2129 a, g dbSNP:749276965
2144 2144 c, t dbSNP:587781567
2146 2146 c, t dbSNP:753991062
2160 2160 c, g dbSNP:730881857
2165 2165 c, g dbSNP:756580887
2168 2168 a, t dbSNP:753269019
2174 2174 c, t dbSNP:780333168
2177 2177 -, cat dbSNP:786204096
2177 2177 a, c dbSNP:781520763
2182 2182 c, t dbSNP:755274971
2183 2183 c, g, t dbSNP:730881864
2184 2184 a, g, t dbSNP:753270166
2189 2189 a, g dbSNP:72563785
2192 2192 a, t dbSNP:587780093
2194 2194 a, g dbSNP:760687282
2206 2206 a, g dbSNP:786202747
2208 2208 a, g dbSNP:786204181
2210 2210 a, c dbSNP:759888769
2233 2233 a, g dbSNP:786203112
2234 2234 a, t dbSNP:369649307
2239 2239 a, g dbSNP:587780780
2243 2243 g, t dbSNP:755536922
2244 2244 c, t dbSNP:751824753
2245 2245 a, g dbSNP:200452212
2249 2249 g, t dbSNP:756831345
2253 2253 -, ag dbSNP:774508816
2254 2254 a, g dbSNP:753596803
2258 2258 c, g dbSNP:370058152
2260 2260 c, t dbSNP:760207156
2263 2263 c, t dbSNP:147494981
2267 2267 g, t dbSNP:746479577
2269 2269 a, t dbSNP:767523514
2278 2278 a, g dbSNP:754865465
2281 2281 a, c dbSNP:751570713
2283 2283 a, g dbSNP:766237464
2290 2290 c, t dbSNP:762740478
2301 2301 g, t dbSNP:773020664
2302 2302 a, g dbSNP:765391308
2310 2310 g, t dbSNP:762074357
2315 2315 -, a dbSNP:753592154
2319 2319 -, t dbSNP:766098004
2331 2331 a, g dbSNP:776664609
2344 2344 -, c dbSNP:760362522
2345 2345 c, t dbSNP:768851314
2365 2365 c, t dbSNP:559362302
2368 2368 a, g dbSNP:370246957
2373 2373 a, c, g dbSNP:371136272
2389 2389 a, g dbSNP:774084218
2400 2400 c, t dbSNP:13312975
2471 2471 a, g dbSNP:768441791
2484 2484 a, g dbSNP:565030924
2489 2489 a, g dbSNP:543547995
2562 2562 a, t dbSNP:576055352
2581 2581 a, g dbSNP:1063053
2616 2616 a, g dbSNP:779678982
2624 2624 a, g dbSNP:13312976
2658 2658 c, t dbSNP:13312977
2660 2660 c, g dbSNP:13312978
2709 2709 c, g dbSNP:104895030
2727 2727 c, t dbSNP:13312979
2751 2751 c, t dbSNP:536082052
2757 2757 a, g dbSNP:538374977
2797 2797 c, t dbSNP:13312980
2806 2806 c, t dbSNP:549386727
2812 2812 a, g dbSNP:3780123
2828 2828 g, t dbSNP:143335332
2842 2842 a, t dbSNP:567490517
2849 2849 c, g dbSNP:2735383
2879 2879 a, c dbSNP:565397049
2887 2887 c, g dbSNP:751670125
2893 2893 a, t dbSNP:565126379
2939 2939 a, t dbSNP:547194105
2986 2986 -, a dbSNP:755532733
2994 2994 a, g dbSNP:72561474
2995 2995 c, t dbSNP:532174652
3022 3022 a, g dbSNP:186378464
3032 3032 -, t dbSNP:564878448
3039 3039 a, g dbSNP:576123506
3065 3065 a, g dbSNP:13312981
3070 3070 c, t dbSNP:542679031
3098 3098 g, t dbSNP:11987887
3111 3111 a, g dbSNP:13312982
3137 3137 a, t dbSNP:752958453
3245 3245 c, t dbSNP:11987865
3290 3290 a, g dbSNP:531640209
3291 3291 a, g dbSNP:13312983
3295 3295 g, t dbSNP:78935210
3310 3310 c, t dbSNP:766917118
3321 3321 a, g dbSNP:13312984
3340 3340 c, g dbSNP:148398077
3371 3371 a, g dbSNP:567816134
3505 3505 c, g dbSNP:770422147
3509 3509 a, g dbSNP:116491182
3513 3513 c, t dbSNP:373449852
3517 3517 a, c dbSNP:1063054
3530 3530 a, c dbSNP:13312985
3605 3605 g, t dbSNP:547479870
3636 3636 c, t dbSNP:762686592
3672 3672 a, g dbSNP:150060153
3708 3708 c, t dbSNP:532490798
3841 3841 c, t dbSNP:560563374
3853 3853 c, t dbSNP:775267930
3891 3891 a, g dbSNP:139384734
3950 3950 a, g dbSNP:769415813
3953 3953 a, g dbSNP:549979435
3964 3964 a, t dbSNP:531428263
3989 3989 a, g dbSNP:561103577
4000 4000 a, g dbSNP:13312986
4062 4062 c, t dbSNP:9995
4073 4073 a, c dbSNP:550722012
4131 4131 c, t dbSNP:556606685
4161 4161 c, t dbSNP:544588009
4162 4162 a, c dbSNP:180734807
4167 4167 g, t dbSNP:3087624
4170 4170 g, t dbSNP:577945509
4233 4233 c, t dbSNP:746998810
4250 4250 a, g dbSNP:538552137
4269 4269 c, t dbSNP:13312987
4271 4271 a, t dbSNP:544852343
4285 4285 c, t dbSNP:14448
4322 4322 a, g dbSNP:555880522
4367 4367 a, c dbSNP:755199398
4369 4369 a, t dbSNP:547312108

Target ORF information:

RefSeq Version XM_011517045
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nibrin (NBN), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59212
Accession Version XM_011517046.1
Sequence Information ORF Nucleotide Sequence (Length: 1410bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nibrin isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008046.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)138..464(+)
Misc Feature(2)219..362(+)
Misc Feature(3)477..683(+)
Misc Feature(4)513..551(+)
Misc Feature(5)663..677(+)
Position Chain Variation Link
20 20 g, t dbSNP:13312847
47 47 a, c dbSNP:530299649
51 51 c, g, t dbSNP:764745963
65 65 g, t dbSNP:72563786
67 67 c, t dbSNP:566338801
77 77 c, t dbSNP:548042230
84 84 a, g dbSNP:532741222
90 90 c, t dbSNP:202115031
92 92 c, t dbSNP:751549166
93 93 a, g dbSNP:766132288
98 98 c, g, t dbSNP:730881843
101 101 a, g, t dbSNP:543890002
102 102 a, g dbSNP:762098812
107 107 a, t dbSNP:776530327
108 108 c, t dbSNP:768874866
109 109 g, t dbSNP:747493132
111 111 c, t dbSNP:780743318
112 112 a, g dbSNP:201392451
117 117 c, t dbSNP:746164250
119 119 a, g dbSNP:779343757
120 120 a, c, g, t dbSNP:780658881
121 121 a, c dbSNP:754525602
122 122 c, t dbSNP:751492107
123 123 a, t dbSNP:376360566
126 126 a, g dbSNP:375584006
127 127 a, g, t dbSNP:765108041
128 128 a, t dbSNP:759094270
130 130 c, t dbSNP:777040286
132 132 g, t dbSNP:768821741
136 136 a, c, t dbSNP:202104448
137 137 g, t dbSNP:199893749
139 139 c, t dbSNP:746422391
144 144 a, t dbSNP:779098734
145 145 a, g dbSNP:771376603
148 148 g, t dbSNP:748090667
153 153 c, g, t dbSNP:730881859
155 155 c, t dbSNP:786201394
156 156 a, g dbSNP:587780779
157 157 c, t dbSNP:781057669
158 158 c, g, t dbSNP:370050587
161 161 a, g dbSNP:779543740
165 165 a, c dbSNP:758228844
167 167 g, t dbSNP:750391983
168 168 a, g dbSNP:764914981
172 172 a, c, g dbSNP:730881860
174 174 a, g dbSNP:757112911
177 177 a, g dbSNP:745439506
182 182 a, g dbSNP:577332041
189 189 a, c dbSNP:587781939
193 193 g, t dbSNP:749263651
197 197 -, t dbSNP:758708229
201 201 a, g dbSNP:369910645
210 210 a, g dbSNP:587781748
213 213 c, g dbSNP:752964949
214 214 c, t dbSNP:781536675
217 217 g, t dbSNP:755171159
225 225 -, aa dbSNP:587781718
226 226 a, g dbSNP:587781450
239 239 a, g dbSNP:1063045
241 241 c, t dbSNP:587780773
242 242 -, tgaaaatgatcagtcgatcagccgaaatcat dbSNP:730881840
242 242 a, g, t dbSNP:78870221
251 251 -, t dbSNP:765299838
252 252 a, c, g dbSNP:377730553
253 253 a, g dbSNP:765551184
256 256 c, t dbSNP:587781530
257 257 g, t dbSNP:774989816
260 260 -, c dbSNP:587781891
264 264 c, t dbSNP:200287925
265 265 a, g dbSNP:759146120
270 270 c, t dbSNP:773865323
272 272 c, t dbSNP:770618624
278 278 -, gt dbSNP:750375741
284 284 a, t dbSNP:749206453
293 293 -, tt dbSNP:767454740
293 293 c, t dbSNP:777925415
298 298 a, t dbSNP:769700749
307 307 c, t dbSNP:747920256
314 314 a, g dbSNP:758457183
318 318 -, ga dbSNP:768378152
320 320 -, t dbSNP:587782147
327 327 c, t dbSNP:267602038
330 330 a, g dbSNP:778998026
335 335 a, g dbSNP:757735005
341 341 a, t dbSNP:786201800
344 344 a, g dbSNP:754352569
345 345 a, c, g dbSNP:560337591
347 347 -, ta dbSNP:786202494
348 348 -, ga dbSNP:762664474
357 357 c, t dbSNP:587780094
361 361 c, g dbSNP:587782179
364 364 a, c dbSNP:587781412
369 369 -, gtta dbSNP:775199696
372 372 a, g dbSNP:786202749
378 378 -, g dbSNP:769239902
379 379 a, g dbSNP:786202085
380 380 a, g dbSNP:786203921
381 381 a, g dbSNP:193921030
388 388 a, g dbSNP:762702597
391 391 a, g dbSNP:587780095
397 397 c, t dbSNP:786203573
403 403 a, c, g dbSNP:747315554
407 407 g, t dbSNP:776469548
415 415 c, t dbSNP:12721593
416 416 a, g dbSNP:587780781
420 420 a, g dbSNP:61753720
421 421 a, g dbSNP:545276922
423 423 a, g dbSNP:730882133
426 426 a, g dbSNP:730881855
438 438 a, g dbSNP:786202139
439 439 c, t dbSNP:185493105
443 443 -, t dbSNP:587781305
448 448 c, g dbSNP:778943002
452 452 a, t dbSNP:13312858
454 454 -, t dbSNP:745355767
460 460 c, t dbSNP:775217949
462 462 c, g dbSNP:587780096
470 470 a, g dbSNP:376455714
472 472 c, g dbSNP:759723870
476 476 a, g dbSNP:774622977
477 477 a, g dbSNP:771034958
490 490 -, ctt dbSNP:730881841
493 493 a, g dbSNP:749272832
498 498 c, g dbSNP:777916019
499 499 a, g dbSNP:770163751
501 501 a, g dbSNP:786203652
503 503 c, t dbSNP:748684665
504 504 g, t dbSNP:786203615
508 508 a, g dbSNP:781671474
518 518 c, t dbSNP:61754795
521 521 a, g dbSNP:587780782
527 527 a, g dbSNP:146150499
530 530 g, t dbSNP:372061224
531 531 a, g dbSNP:756946899
535 535 c, t dbSNP:111244949
544 544 -, g dbSNP:747462107
547 547 a, g dbSNP:753219054
552 552 a, g dbSNP:543852763
554 554 c, t dbSNP:760586161
556 556 c, t dbSNP:752672571
557 557 a, g dbSNP:767296279
562 562 a, g dbSNP:769414
563 563 c, t dbSNP:143070291
564 564 c, t dbSNP:770995856
578 578 c, t dbSNP:137857529
585 585 c, t dbSNP:773119929
588 588 g, t dbSNP:587781549
593 593 a, g dbSNP:201816949
596 596 a, c, g dbSNP:566630862
605 605 a, c dbSNP:730881858
612 612 a, t dbSNP:747319065
619 619 c, g dbSNP:766055272
620 620 a, g dbSNP:758276775
621 621 a, g dbSNP:750594114
627 627 g, t dbSNP:786201252
629 629 a, c dbSNP:765493509
630 630 c, g, t dbSNP:776810966
632 632 c, g dbSNP:764290829
642 642 c, t dbSNP:182756889
643 643 a, g dbSNP:776134250
646 646 c, t dbSNP:587782411
647 647 a, g dbSNP:772311947
648 648 a, g dbSNP:61754966
657 657 a, c dbSNP:587778546
660 660 a, g dbSNP:730881861
662 662 a, g dbSNP:769400631
684 684 a, g, t dbSNP:151070415
686 686 a, t dbSNP:780661058
690 690 c, g dbSNP:1805794
725 725 c, t dbSNP:745821999
732 732 c, t dbSNP:587780097
733 733 c, g dbSNP:730881844
738 738 a, g dbSNP:757186245
739 739 a, g, t dbSNP:587780098
740 740 -, tga dbSNP:755050499
746 746 a, g dbSNP:778083915
750 750 a, g dbSNP:730881845
751 751 c, t dbSNP:786203215
757 757 g, t dbSNP:587780099
764 764 c, t dbSNP:767520591
765 765 g, t dbSNP:61754796
768 768 a, g dbSNP:752104183
770 770 a, t dbSNP:377700348
779 779 a, g dbSNP:763363235
780 780 c, g, t dbSNP:34767364
781 781 a, g dbSNP:61753718
783 783 g, t dbSNP:769416
785 785 a, g dbSNP:786201883
786 786 c, g dbSNP:760275251
790 790 g, t dbSNP:786202250
792 792 a, c dbSNP:730881846
793 793 a, g dbSNP:376951288
794 794 -, acaaa dbSNP:587776650
794 794 a, g dbSNP:745768664
800 800 c, t dbSNP:372705975
801 801 c, t dbSNP:541992192
805 805 a, c dbSNP:530438634
808 808 a, g dbSNP:199845467
817 817 c, t dbSNP:749025721
820 820 g, t dbSNP:777460725
833 833 c, t dbSNP:566091759
835 835 -, aaca dbSNP:587780100
841 841 a, g dbSNP:769519885
849 849 c, t dbSNP:748400884
852 852 a, c dbSNP:587781868
857 857 c, t dbSNP:781323381
858 858 a, g dbSNP:587781333
864 864 g, t dbSNP:786203253
878 878 a, g dbSNP:747021126
884 884 g, t dbSNP:780134747
887 887 g, t dbSNP:758852942
891 891 a, g dbSNP:587782746
894 894 a, g dbSNP:765602971
895 895 c, t dbSNP:61754967
901 901 a, g dbSNP:754243946
910 910 a, g dbSNP:786203380
912 912 a, g dbSNP:201559159
915 915 a, c dbSNP:767013459
920 920 g, t dbSNP:375336614
923 923 a, c dbSNP:372159380
925 925 c, t dbSNP:147626427
931 931 c, t dbSNP:61612852
933 933 c, g dbSNP:762956906
934 934 c, t dbSNP:769420
935 935 a, g dbSNP:368786672
937 937 a, g dbSNP:747837246
940 940 -, c dbSNP:751497896
940 940 c, t dbSNP:535602436
941 941 a, g dbSNP:141443872
943 943 c, g dbSNP:768822147
945 945 -, gt dbSNP:786202490
952 952 a, g dbSNP:730881847
954 954 -, a dbSNP:730881839
956 956 a, t dbSNP:147660518
957 957 a, g dbSNP:540837864
979 979 g, t dbSNP:786205135
982 982 c, t dbSNP:786202604
988 988 a, g dbSNP:772176894
1009 1009 a, g dbSNP:587778547
1010 1010 a, g dbSNP:786202939
1017 1017 a, t dbSNP:746381477
1018 1018 c, t dbSNP:779346343
1027 1027 c, t dbSNP:757787958
1031 1031 a, g dbSNP:766482117
1033 1033 a, g dbSNP:754113612
1034 1034 a, g dbSNP:779798363
1036 1036 a, g dbSNP:758070132
1039 1039 a, g dbSNP:749857140
1044 1044 a, g dbSNP:764823411
1048 1048 c, t dbSNP:536965870
1062 1062 a, g dbSNP:587780101
1066 1066 c, t dbSNP:753812768
1067 1067 a, t dbSNP:142813526
1072 1072 c, t dbSNP:371480039
1073 1073 a, g dbSNP:148517156
1075 1075 c, t dbSNP:730881862
1076 1076 a, g dbSNP:145750430
1077 1077 a, g dbSNP:529845940
1078 1078 g, t dbSNP:771086262
1079 1079 a, g dbSNP:749757928
1086 1086 a, g dbSNP:587782502
1102 1102 a, g dbSNP:770441030
1103 1103 c, t dbSNP:748453607
1105 1105 a, g dbSNP:730881848
1106 1106 c, t dbSNP:773860553
1108 1108 a, g dbSNP:781711300
1113 1113 c, t dbSNP:121908973
1115 1115 a, g dbSNP:757936747
1129 1129 c, g, t dbSNP:587782905
1145 1145 -, aac dbSNP:770500095
1145 1145 a, t dbSNP:786201619
1147 1147 -, aac dbSNP:786202982
1160 1160 c, g dbSNP:756023239
1161 1161 c, t dbSNP:587782656
1164 1164 c, t dbSNP:530636519
1167 1167 c, t dbSNP:767215758
1171 1171 g, t dbSNP:587780089
1172 1172 c, t dbSNP:146605798
1173 1173 a, g dbSNP:200297914
1184 1184 c, t dbSNP:763296399
1193 1193 a, g dbSNP:369092711
1200 1200 a, g, t dbSNP:762376159
1203 1203 a, g dbSNP:777259845
1213 1213 a, g dbSNP:768886664
1217 1217 -, tac dbSNP:587782745
1220 1220 a, g dbSNP:761042468
1226 1226 a, c, t dbSNP:121908974
1227 1227 a, g dbSNP:765403660
1228 1228 c, t dbSNP:370229163
1241 1241 a, g dbSNP:777235726
1252 1252 c, g dbSNP:587781438
1260 1260 c, t dbSNP:769361806
1266 1266 g, t dbSNP:587780547
1277 1277 a, g dbSNP:762590883
1279 1279 -, c dbSNP:587781969
1284 1284 a, g dbSNP:772909239
1289 1289 c, g dbSNP:551802153
1291 1291 -, aa dbSNP:748513310
1291 1291 a, g dbSNP:769453547
1292 1292 -, a dbSNP:772612131
1297 1297 c, g dbSNP:747632184
1309 1309 a, g dbSNP:201958895
1310 1310 a, g dbSNP:780602705
1324 1324 c, t dbSNP:182030463
1330 1330 a, g dbSNP:746965070
1331 1331 a, c dbSNP:200046373
1334 1334 c, t dbSNP:709816
1335 1335 a, g dbSNP:551602980
1336 1336 c, t dbSNP:779218232
1339 1339 c, g, t dbSNP:104895033
1341 1341 a, g dbSNP:201373377
1347 1347 a, t dbSNP:761214266
1349 1349 a, g dbSNP:753212974
1359 1359 a, g dbSNP:34120922
1369 1369 c, g dbSNP:551032019
1375 1375 a, g dbSNP:529340553
1380 1380 -, tta dbSNP:587781532
1381 1381 a, g dbSNP:764832388
1382 1382 c, g, t dbSNP:776180689
1385 1385 g, t dbSNP:756572268
1386 1386 g, t dbSNP:768087330
1388 1388 a, g dbSNP:749316300
1392 1392 a, c, g dbSNP:730881849
1396 1396 c, g dbSNP:772147514
1399 1399 c, t dbSNP:104895032
1417 1417 c, g dbSNP:778881191
1419 1419 a, g dbSNP:786202302
1422 1422 g, t dbSNP:587782409
1423 1423 a, g dbSNP:370121348
1438 1438 a, c, t dbSNP:757452107
1440 1440 a, g dbSNP:749512960
1443 1443 c, t dbSNP:375885975
1445 1445 c, g dbSNP:756208277
1450 1450 g, t dbSNP:786203131
1452 1452 a, g dbSNP:752837508
1454 1454 a, g dbSNP:28538230
1457 1457 c, t dbSNP:755513646
1458 1458 a, c dbSNP:751876787
1480 1480 a, t dbSNP:146403088
1484 1484 a, g dbSNP:761492204
1486 1486 a, t dbSNP:776210901
1491 1491 a, c dbSNP:141137543
1498 1498 a, c dbSNP:587780774
1499 1499 c, t dbSNP:587780775
1508 1508 c, t dbSNP:760043998
1510 1510 a, g dbSNP:544909538
1519 1519 c, t dbSNP:367760321
1523 1523 c, t dbSNP:772094384
1524 1524 a, g dbSNP:745821964
1540 1540 a, g dbSNP:769862680
1541 1541 a, c, g dbSNP:781213350
1542 1542 a, g, t dbSNP:730881851
1543 1543 a, g, t dbSNP:148205441
1544 1544 a, c dbSNP:780365310
1546 1546 a, g dbSNP:758947240
1553 1553 a, g dbSNP:750711786
1554 1554 c, t dbSNP:779357587
1555 1555 a, c dbSNP:755805461
1557 1557 a, g dbSNP:587780535
1561 1561 a, c dbSNP:767106269
1568 1568 c, t dbSNP:767123014
1569 1569 a, g dbSNP:759060729
1574 1574 a, g dbSNP:786202028

Target ORF information:

RefSeq Version XM_011517046
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nibrin (NBN), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25559
Accession Version NM_002485.4
Sequence Information ORF Nucleotide Sequence (Length: 2265bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product nibrin
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BX640816.1, BC071590.1 and BC040519.1. This sequence is a reference standard in the RefSeqGene project. On Jun 9, 2005 this sequence version replaced gi:33356171. Summary: Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC146797.1, AF051334.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)96..98(+)
Misc Feature(2)111..437(+)
Misc Feature(3)192..335(+)
Misc Feature(4)441..1094(+)
Misc Feature(5)450..656(+)
Misc Feature(6)486..524(+)
Misc Feature(7)636..650(+)
Misc Feature(8)771..1316(+)
Misc Feature(9)942..944(+)
Misc Feature(10)942..944(+)
Misc Feature(11)1137..1139(+)
Misc Feature(12)1137..1139(+)
Misc Feature(13)1299..1301(+)
Misc Feature(14)1299..1301(+)
Misc Feature(15)1314..1316(+)
Misc Feature(16)1395..1397(+)
Misc Feature(17)1404..1406(+)
Misc Feature(18)1404..1406(+)
Misc Feature(19)1491..1511(+)
Misc Feature(20)1953..1955(+)
Misc Feature(21)2154..2348(+)
Misc Feature(22)2316..2339(+)
Exon (1)1..147
Gene Synonym:
Exon (2)148..281
Gene Synonym:
Exon (3)282..430
Gene Synonym:
Exon (4)431..590
Gene Synonym:
Exon (5)591..694
Gene Synonym:
Exon (6)695..812
Gene Synonym:
Exon (7)813..1006
Gene Synonym:
Exon (8)1007..1104
Gene Synonym:
Exon (9)1105..1234
Gene Synonym:
Exon (10)1235..1507
Gene Synonym:
Exon (11)1508..1955
Gene Synonym:
Exon (12)1956..2024
Gene Synonym:
Exon (13)2025..2180
Gene Synonym:
Exon (14)2181..2294
Gene Synonym:
Exon (15)2295..2344
Gene Synonym:
Exon (16)2345..4621
Gene Synonym:
Position Chain Variation Link
20 20 a, c dbSNP:530299649
24 24 c, g, t dbSNP:764745963
38 38 g, t dbSNP:72563786
40 40 c, t dbSNP:566338801
50 50 c, t dbSNP:548042230
57 57 a, g dbSNP:532741222
63 63 c, t dbSNP:202115031
65 65 c, t dbSNP:751549166
66 66 a, g dbSNP:766132288
71 71 c, g, t dbSNP:730881843
74 74 a, g, t dbSNP:543890002
75 75 a, g dbSNP:762098812
80 80 a, t dbSNP:776530327
81 81 c, t dbSNP:768874866
82 82 g, t dbSNP:747493132
84 84 c, t dbSNP:780743318
85 85 a, g dbSNP:201392451
90 90 c, t dbSNP:746164250
92 92 a, g dbSNP:779343757
93 93 a, c, g, t dbSNP:780658881
94 94 a, c dbSNP:754525602
95 95 c, t dbSNP:751492107
96 96 a, t dbSNP:376360566
99 99 a, g dbSNP:375584006
100 100 a, g, t dbSNP:765108041
101 101 a, t dbSNP:759094270
103 103 c, t dbSNP:777040286
105 105 g, t dbSNP:768821741
109 109 a, c, t dbSNP:202104448
110 110 g, t dbSNP:199893749
112 112 c, t dbSNP:746422391
117 117 a, t dbSNP:779098734
118 118 a, g dbSNP:771376603
121 121 g, t dbSNP:748090667
126 126 c, g, t dbSNP:730881859
128 128 c, t dbSNP:786201394
129 129 a, g dbSNP:587780779
130 130 c, t dbSNP:781057669
131 131 c, g, t dbSNP:370050587
134 134 a, g dbSNP:779543740
138 138 a, c dbSNP:758228844
140 140 g, t dbSNP:750391983
141 141 a, g dbSNP:764914981
145 145 a, c, g dbSNP:730881860
147 147 a, g dbSNP:757112911
150 150 a, g dbSNP:745439506
155 155 a, g dbSNP:577332041
162 162 a, c dbSNP:587781939
166 166 g, t dbSNP:749263651
170 170 -, t dbSNP:758708229
174 174 a, g dbSNP:369910645
183 183 a, g dbSNP:587781748
186 186 c, g dbSNP:752964949
187 187 c, t dbSNP:781536675
190 190 g, t dbSNP:755171159
198 198 -, aa dbSNP:587781718
199 199 a, g dbSNP:587781450
212 212 a, g dbSNP:1063045
214 214 c, t dbSNP:587780773
215 215 -, tgaaaatgatcagtcgatcagccgaaatcat dbSNP:730881840
215 215 a, g, t dbSNP:78870221
224 224 -, t dbSNP:765299838
225 225 a, c, g dbSNP:377730553
226 226 a, g dbSNP:765551184
229 229 c, t dbSNP:587781530
230 230 g, t dbSNP:774989816
233 233 -, c dbSNP:587781891
237 237 c, t dbSNP:200287925
238 238 a, g dbSNP:759146120
243 243 c, t dbSNP:773865323
245 245 c, t dbSNP:770618624
251 251 -, gt dbSNP:750375741
257 257 a, t dbSNP:749206453
266 266 -, tt dbSNP:767454740
266 266 c, t dbSNP:777925415
271 271 a, t dbSNP:769700749
280 280 c, t dbSNP:747920256
287 287 a, g dbSNP:758457183
291 291 -, ga dbSNP:768378152
293 293 -, t dbSNP:587782147
300 300 c, t dbSNP:267602038
303 303 a, g dbSNP:778998026
308 308 a, g dbSNP:757735005
314 314 a, t dbSNP:786201800
317 317 a, g dbSNP:754352569
318 318 a, c, g dbSNP:560337591
320 320 -, ta dbSNP:786202494
321 321 -, ga dbSNP:762664474
330 330 c, t dbSNP:587780094
334 334 c, g dbSNP:587782179
337 337 a, c dbSNP:587781412
342 342 -, gtta dbSNP:775199696
345 345 a, g dbSNP:786202749
351 351 -, g dbSNP:769239902
352 352 a, g dbSNP:786202085
353 353 a, g dbSNP:786203921
354 354 a, g dbSNP:193921030
361 361 a, g dbSNP:762702597
364 364 a, g dbSNP:587780095
370 370 c, t dbSNP:786203573
376 376 a, c, g dbSNP:747315554
380 380 g, t dbSNP:776469548
388 388 c, t dbSNP:12721593
389 389 a, g dbSNP:587780781
393 393 a, g dbSNP:61753720
394 394 a, g dbSNP:545276922
396 396 a, g dbSNP:730882133
399 399 a, g dbSNP:730881855
411 411 a, g dbSNP:786202139
412 412 c, t dbSNP:185493105
416 416 -, t dbSNP:587781305
421 421 c, g dbSNP:778943002
425 425 a, t dbSNP:13312858
427 427 -, t dbSNP:745355767
433 433 c, t dbSNP:775217949
435 435 c, g dbSNP:587780096
443 443 a, g dbSNP:376455714
445 445 c, g dbSNP:759723870
449 449 a, g dbSNP:774622977
450 450 a, g dbSNP:771034958
463 463 -, ctt dbSNP:730881841
466 466 a, g dbSNP:749272832
471 471 c, g dbSNP:777916019
472 472 a, g dbSNP:770163751
474 474 a, g dbSNP:786203652
476 476 c, t dbSNP:748684665
477 477 g, t dbSNP:786203615
481 481 a, g dbSNP:781671474
491 491 c, t dbSNP:61754795
494 494 a, g dbSNP:587780782
500 500 a, g dbSNP:146150499
503 503 g, t dbSNP:372061224
504 504 a, g dbSNP:756946899
508 508 c, t dbSNP:111244949
517 517 -, g dbSNP:747462107
520 520 a, g dbSNP:753219054
525 525 a, g dbSNP:543852763
527 527 c, t dbSNP:760586161
529 529 c, t dbSNP:752672571
530 530 a, g dbSNP:767296279
535 535 a, g dbSNP:769414
536 536 c, t dbSNP:143070291
537 537 c, t dbSNP:770995856
551 551 c, t dbSNP:137857529
558 558 c, t dbSNP:773119929
561 561 g, t dbSNP:587781549
566 566 a, g dbSNP:201816949
569 569 a, c, g dbSNP:566630862
578 578 a, c dbSNP:730881858
585 585 a, t dbSNP:747319065
592 592 c, g dbSNP:766055272
593 593 a, g dbSNP:758276775
594 594 a, g dbSNP:750594114
600 600 g, t dbSNP:786201252
602 602 a, c dbSNP:765493509
603 603 c, g, t dbSNP:776810966
605 605 c, g dbSNP:764290829
615 615 c, t dbSNP:182756889
616 616 a, g dbSNP:776134250
619 619 c, t dbSNP:587782411
620 620 a, g dbSNP:772311947
621 621 a, g dbSNP:61754966
630 630 a, c dbSNP:587778546
633 633 a, g dbSNP:730881861
635 635 a, g dbSNP:769400631
657 657 a, g, t dbSNP:151070415
659 659 a, t dbSNP:780661058
663 663 c, g dbSNP:1805794
698 698 c, t dbSNP:745821999
705 705 c, t dbSNP:587780097
706 706 c, g dbSNP:730881844
711 711 a, g dbSNP:757186245
712 712 a, g, t dbSNP:587780098
713 713 -, tga dbSNP:755050499
719 719 a, g dbSNP:778083915
723 723 a, g dbSNP:730881845
724 724 c, t dbSNP:786203215
730 730 g, t dbSNP:587780099
737 737 c, t dbSNP:767520591
738 738 g, t dbSNP:61754796
741 741 a, g dbSNP:752104183
743 743 a, t dbSNP:377700348
752 752 a, g dbSNP:763363235
753 753 c, g, t dbSNP:34767364
754 754 a, g dbSNP:61753718
756 756 g, t dbSNP:769416
758 758 a, g dbSNP:786201883
759 759 c, g dbSNP:760275251
763 763 g, t dbSNP:786202250
765 765 a, c dbSNP:730881846
766 766 a, g dbSNP:376951288
767 767 -, acaaa dbSNP:587776650
767 767 a, g dbSNP:745768664
773 773 c, t dbSNP:372705975
774 774 c, t dbSNP:541992192
778 778 a, c dbSNP:530438634
781 781 a, g dbSNP:199845467
790 790 c, t dbSNP:749025721
793 793 g, t dbSNP:777460725
806 806 c, t dbSNP:566091759
808 808 -, aaca dbSNP:587780100
814 814 a, g dbSNP:769519885
822 822 c, t dbSNP:748400884
825 825 a, c dbSNP:587781868
830 830 c, t dbSNP:781323381
831 831 a, g dbSNP:587781333
837 837 g, t dbSNP:786203253
851 851 a, g dbSNP:747021126
857 857 g, t dbSNP:780134747
860 860 g, t dbSNP:758852942
864 864 a, g dbSNP:587782746
867 867 a, g dbSNP:765602971
868 868 c, t dbSNP:61754967
874 874 a, g dbSNP:754243946
883 883 a, g dbSNP:786203380
885 885 a, g dbSNP:201559159
888 888 a, c dbSNP:767013459
893 893 g, t dbSNP:375336614
896 896 a, c dbSNP:372159380
898 898 c, t dbSNP:147626427
904 904 c, t dbSNP:61612852
906 906 c, g dbSNP:762956906
907 907 c, t dbSNP:769420
908 908 a, g dbSNP:368786672
910 910 a, g dbSNP:747837246
913 913 -, c dbSNP:751497896
913 913 c, t dbSNP:535602436
914 914 a, g dbSNP:141443872
916 916 c, g dbSNP:768822147
918 918 -, gt dbSNP:786202490
925 925 a, g dbSNP:730881847
927 927 -, a dbSNP:730881839
929 929 a, t dbSNP:147660518
930 930 a, g dbSNP:540837864
952 952 g, t dbSNP:786205135
955 955 c, t dbSNP:786202604
961 961 a, g dbSNP:772176894
982 982 a, g dbSNP:587778547
983 983 a, g dbSNP:786202939
990 990 a, t dbSNP:746381477
991 991 c, t dbSNP:779346343
1000 1000 c, t dbSNP:757787958
1004 1004 a, g dbSNP:766482117
1006 1006 a, g dbSNP:754113612
1007 1007 a, g dbSNP:779798363
1009 1009 a, g dbSNP:758070132
1012 1012 a, g dbSNP:749857140
1017 1017 a, g dbSNP:764823411
1021 1021 c, t dbSNP:536965870
1035 1035 a, g dbSNP:587780101
1039 1039 c, t dbSNP:753812768
1040 1040 a, t dbSNP:142813526
1045 1045 c, t dbSNP:371480039
1046 1046 a, g dbSNP:148517156
1048 1048 c, t dbSNP:730881862
1049 1049 a, g dbSNP:145750430
1050 1050 a, g dbSNP:529845940
1051 1051 g, t dbSNP:771086262
1052 1052 a, g dbSNP:749757928
1059 1059 a, g dbSNP:587782502
1075 1075 a, g dbSNP:770441030
1076 1076 c, t dbSNP:748453607
1078 1078 a, g dbSNP:730881848
1079 1079 c, t dbSNP:773860553
1081 1081 a, g dbSNP:781711300
1086 1086 c, t dbSNP:121908973
1088 1088 a, g dbSNP:757936747
1102 1102 c, g, t dbSNP:587782905
1118 1118 -, aac dbSNP:770500095
1118 1118 a, t dbSNP:786201619
1120 1120 -, aac dbSNP:786202982
1133 1133 c, g dbSNP:756023239
1134 1134 c, t dbSNP:587782656
1137 1137 c, t dbSNP:530636519
1140 1140 c, t dbSNP:767215758
1144 1144 g, t dbSNP:587780089
1145 1145 c, t dbSNP:146605798
1146 1146 a, g dbSNP:200297914
1157 1157 c, t dbSNP:763296399
1166 1166 a, g dbSNP:369092711
1173 1173 a, g, t dbSNP:762376159
1176 1176 a, g dbSNP:777259845
1186 1186 a, g dbSNP:768886664
1190 1190 -, tac dbSNP:587782745
1193 1193 a, g dbSNP:761042468
1199 1199 a, c, t dbSNP:121908974
1200 1200 a, g dbSNP:765403660
1201 1201 c, t dbSNP:370229163
1214 1214 a, g dbSNP:777235726
1225 1225 c, g dbSNP:587781438
1233 1233 c, t dbSNP:769361806
1239 1239 g, t dbSNP:587780547
1250 1250 a, g dbSNP:762590883
1252 1252 -, c dbSNP:587781969
1257 1257 a, g dbSNP:772909239
1262 1262 c, g dbSNP:551802153
1264 1264 -, aa dbSNP:748513310
1264 1264 a, g dbSNP:769453547
1265 1265 -, a dbSNP:772612131
1270 1270 c, g dbSNP:747632184
1282 1282 a, g dbSNP:201958895
1283 1283 a, g dbSNP:780602705
1297 1297 c, t dbSNP:182030463
1303 1303 a, g dbSNP:746965070
1304 1304 a, c dbSNP:200046373
1307 1307 c, t dbSNP:709816
1308 1308 a, g dbSNP:551602980
1309 1309 c, t dbSNP:779218232
1312 1312 c, g, t dbSNP:104895033
1314 1314 a, g dbSNP:201373377
1320 1320 a, t dbSNP:761214266
1322 1322 a, g dbSNP:753212974
1332 1332 a, g dbSNP:34120922
1342 1342 c, g dbSNP:551032019
1348 1348 a, g dbSNP:529340553
1353 1353 -, tta dbSNP:587781532
1354 1354 a, g dbSNP:764832388
1355 1355 c, g, t dbSNP:776180689
1358 1358 g, t dbSNP:756572268
1359 1359 g, t dbSNP:768087330
1361 1361 a, g dbSNP:749316300
1365 1365 a, c, g dbSNP:730881849
1369 1369 c, g dbSNP:772147514
1372 1372 c, t dbSNP:104895032
1390 1390 c, g dbSNP:778881191
1392 1392 a, g dbSNP:786202302
1395 1395 g, t dbSNP:587782409
1396 1396 a, g dbSNP:370121348
1411 1411 a, c, t dbSNP:757452107
1413 1413 a, g dbSNP:749512960
1416 1416 c, t dbSNP:375885975
1418 1418 c, g dbSNP:756208277
1423 1423 g, t dbSNP:786203131
1425 1425 a, g dbSNP:752837508
1427 1427 a, g dbSNP:28538230
1430 1430 c, t dbSNP:755513646
1431 1431 a, c dbSNP:751876787
1453 1453 a, t dbSNP:146403088
1457 1457 a, g dbSNP:761492204
1459 1459 a, t dbSNP:776210901
1464 1464 a, c dbSNP:141137543
1471 1471 a, c dbSNP:587780774
1472 1472 c, t dbSNP:587780775
1481 1481 c, t dbSNP:760043998
1483 1483 a, g dbSNP:544909538
1492 1492 c, t dbSNP:367760321
1496 1496 c, t dbSNP:772094384
1497 1497 a, g dbSNP:745821964
1512 1512 a, g dbSNP:769862680
1513 1513 a, c, g dbSNP:781213350
1514 1514 a, g, t dbSNP:730881851
1515 1515 a, g, t dbSNP:148205441
1516 1516 a, c dbSNP:780365310
1518 1518 a, g dbSNP:758947240
1525 1525 a, g dbSNP:750711786
1526 1526 c, t dbSNP:779357587
1527 1527 a, c dbSNP:755805461
1529 1529 a, g dbSNP:587780535
1533 1533 a, c dbSNP:767106269
1540 1540 c, t dbSNP:767123014
1541 1541 a, g dbSNP:759060729
1546 1546 a, g dbSNP:786202028
1553 1553 a, g dbSNP:751121403
1555 1555 a, g dbSNP:775451862
1564 1564 a, c, t dbSNP:200891292
1565 1565 a, g dbSNP:772864909
1566 1566 c, t dbSNP:587781380
1567 1567 c, t dbSNP:572568222
1570 1570 a, g dbSNP:587782118
1575 1575 c, g dbSNP:143948240
1581 1581 a, g dbSNP:776900339
1584 1584 c, t dbSNP:587782130
1585 1585 a, g dbSNP:768883132
1590 1590 a, c dbSNP:587781557
1593 1593 a, cc dbSNP:786203180
1593 1593 a, c dbSNP:747027298
1594 1594 -, c dbSNP:764884516
1596 1596 a, g dbSNP:730881863
1599 1599 a, g dbSNP:3026268
1606 1606 c, t dbSNP:772411713
1607 1607 a, g dbSNP:774032674
1608 1608 c, t dbSNP:779116935
1621 1621 a, g dbSNP:757754183
1625 1625 -, g dbSNP:759232053
1630 1630 a, g dbSNP:587782520
1643 1643 g, t dbSNP:587780776
1646 1646 a, g dbSNP:754267250
1656 1656 a, g dbSNP:376653589
1657 1657 c, t dbSNP:754706758
1660 1660 -, a dbSNP:587782344
1665 1665 g, t dbSNP:111239312
1669 1669 a, g dbSNP:750981708
1673 1673 c, t dbSNP:765959451
1685 1685 a, t dbSNP:587782150
1689 1689 g, t dbSNP:104895031
1701 1701 a, g dbSNP:587782330
1704 1704 a, c, g, t dbSNP:545435120
1705 1705 a, t dbSNP:761541023
1726 1726 c, g dbSNP:768431216
1729 1729 a, g dbSNP:730881852
1734 1734 g, t dbSNP:764263689
1735 1735 c, t dbSNP:760911186
1738 1738 a, g dbSNP:587781624
1739 1739 a, g dbSNP:786201093
1750 1750 -, c dbSNP:776417262
1752 1752 a, g dbSNP:772234785
1761 1761 -, a dbSNP:766044684
1764 1764 -, g dbSNP:760237820
1767 1767 a, g dbSNP:746347634
1776 1776 a, g, t dbSNP:771567358
1777 1777 a, t dbSNP:558023830
1784 1784 a, g dbSNP:778302563
1794 1794 a, g dbSNP:754651655
1800 1800 a, g dbSNP:72550742
1805 1805 a, g dbSNP:557356152
1811 1811 c, g dbSNP:730881853
1818 1818 a, g dbSNP:730881854
1821 1821 a, g dbSNP:587780090
1824 1824 c, t dbSNP:749918573
1830 1830 a, t dbSNP:142334798
1833 1833 g, t dbSNP:786201745
1839 1839 g, t dbSNP:587781881
1847 1847 a, g dbSNP:753582962
1864 1864 a, g dbSNP:763926389
1866 1866 c, g dbSNP:786202588
1871 1871 c, t dbSNP:769773789
1887 1887 c, g dbSNP:146989944
1906 1906 c, g dbSNP:775848374
1912 1912 a, g dbSNP:553571469
1917 1917 g, t dbSNP:112524180
1919 1919 a, c dbSNP:192236678
1926 1926 a, g dbSNP:7