
ATM cDNA ORF clone, Homo sapiens (human)

Gene Symbol ATM
Entrez Gene ID 472
Full Name ATM serine/threonine kinase
General protein information
Preferred Names
serine-protein kinase ATM
serine-protein kinase ATM
AT mutated
A-T mutated
TEL1, telomere maintenance 1, homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]. lac of sum
Disorder MIM:


Disorder Html: Ataxia-telangiectasia, 208900 (3); Lymphoma, B-cell non-Hodgkin,

mRNA and Protein(s)

mRNA Protein Name
XM_005271561 XP_005271618 serine-protein kinase ATM isoform X1
XM_011542840 XP_011541142 serine-protein kinase ATM isoform X1
XM_011542841 XP_011541143 serine-protein kinase ATM isoform X1
XM_005271562 XP_005271619 serine-protein kinase ATM isoform X1
XM_006718843 XP_006718906 serine-protein kinase ATM isoform X1
XM_011542842 XP_011541144 serine-protein kinase ATM isoform X2
XM_011542843 XP_011541145 serine-protein kinase ATM isoform X3
XM_011542844 XP_011541146 serine-protein kinase ATM isoform X4
XM_011542845 XP_011541147 serine-protein kinase ATM isoform X5
XM_011542846 XP_011541148 serine-protein kinase ATM isoform X6
XM_006718845 XP_006718908 serine-protein kinase ATM isoform X7
XM_011542847 XP_011541149 serine-protein kinase ATM isoform X8
NM_000051 NP_000042 serine-protein kinase ATM

hsa04110 Cell cycle
hsa04210 Apoptosis
hsa04115 p53 signaling pathway
hsa05166 HTLV-I infection
hsa_M00295 BRCA1-associated genome surveillance complex (BASC)
hsa05202 Transcriptional misregulation in cancer
hsa04064 NF-kappa B signaling pathway
hsa04068 FoxO signaling pathway
hsa05206 MicroRNAs in cancer
hsa_M00691 DNA damage-induced cell cycle checkpoints
R-HSA-1640170 Cell Cycle
R-HSA-69615 G1/S DNA Damage Checkpoints
R-HSA-69563 p53-Dependent G1 DNA Damage Response
R-HSA-69580 p53-Dependent G1/S DNA damage checkpoint
R-HSA-69541 Stabilization of p53
R-HSA-69620 Cell Cycle Checkpoints
R-HSA-349425 Autodegradation of the E3 ubiquitin ligase COP1
R-HSA-69610 p53-Independent DNA Damage Response
R-HSA-69601 Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
R-HSA-69613 p53-Independent G1/S DNA damage checkpoint
R-HSA-69481 G2/M Checkpoints
R-HSA-69473 G2/M DNA damage checkpoint
R-HSA-1500620 Meiosis
R-HSA-912446 Meiotic recombination
R-HSA-2262752 Cellular responses to stress
R-HSA-73894 DNA Repair
R-HSA-2559583 Cellular Senescence
R-HSA-3371556 Cellular response to heat stress
R-HSA-2559586 DNA Damage/Telomere Stress Induced Senescence
R-HSA-3371453 Regulation of HSF1-mediated heat shock response
Pathway Interaction Database
p38_mkk3_6pathway p38 MAPK signaling pathway
e2f_pathway E2F transcription factor network
bard1pathway BARD1 signaling events
telomerasepathway Regulation of Telomerase
nfkappabcanonicalpathway Canonical NF-kappaB pathway
p53regulationpathway p53 pathway
WP179 Cell cycle
WP707 DNA damage response
WP45 G1 to S cell cycle control
WP34 Ovarian Infertility Genes
WP710 DNA damage response (only ATM dependent)
WP186 Homologous recombination
WP1545 miRNAs involved in DDR
WP1742 TP53 network
WP1984 Integrated Breast Cancer Pathway
WP2377 Integrated Pancreatic Cancer Pathway
WP2263 Prostate Cancer
WP2261 Signaling Pathways in Glioblastoma
WP1971 Integrated Cancer pathway

Homo sapiens (human) ATM NP_000042.3
Pan troglodytes (chimpanzee) ATM XP_001139405.2
Macaca mulatta (Rhesus monkey) ATM XP_002799825.1
Canis lupus familiaris (dog) ATM NP_001124300.1
Bos taurus (cattle) ATM NP_001192864.1
Mus musculus (house mouse) Atm NP_031525.2
Rattus norvegicus (Norway rat) Atm NP_001100291.1
Gallus gallus (chicken) ATM NP_001155872.1
Danio rerio (zebrafish) atm XP_002664603.2
Xenopus (Silurana) tropicalis (western clawed frog) atm XP_002934974.2


ID Name Evidence
GO:0000781 chromosome, telomeric region IDA
GO:0005634 nucleus IEA
GO:0005654 nucleoplasm EXP
GO:0005654 nucleoplasm TAS
GO:0005819 spindle IEA
GO:0016023 cytoplasmic membrane-bounded vesicle IEA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0003677 DNA binding IEA
GO:0004674 protein serine/threonine kinase activity EXP
GO:0004674 protein serine/threonine kinase activity IDA
GO:0004677 DNA-dependent protein kinase activity IDA
GO:0005515 protein binding IPI
GO:0005524 ATP binding IEA
GO:0016301 kinase activity EXP
GO:0016301 kinase activity TAS
GO:0016303 1-phosphatidylinositol-3-kinase activity IMP
GO:0032403 protein complex binding IDA
GO:0042802 identical protein binding IPI
GO:0046983 protein dimerization activity IDA
GO:0047485 protein N-terminus binding IDA


ID Name Evidence
GO:0000075 cell cycle checkpoint TAS
GO:0000724 double-strand break repair via homologous recombination TAS
GO:0001756 somitogenesis IEA
GO:0002331 pre-B cell allelic exclusion ISS
GO:0006281 DNA repair TAS
GO:0006302 double-strand break repair TAS
GO:0006974 response to DNA damage stimulus IMP
GO:0006975 DNA damage induced protein phosphorylation IDA
GO:0006977 DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest TAS
GO:0007049 cell cycle IEA
GO:0007050 cell cycle arrest IMP
GO:0007094 mitotic cell cycle spindle assembly checkpoint IMP
GO:0007131 reciprocal meiotic recombination TAS
GO:0007165 signal transduction TAS
GO:0007292 female gamete generation IEA
GO:0007420 brain development IEA
GO:0007507 heart development IEA
GO:0008219 cell death IEA
GO:0008630 DNA damage response, signal transduction resulting in induction of apoptosis IEA
GO:0010212 response to ionizing radiation IDA
GO:0016310 phosphorylation EXP
GO:0016310 phosphorylation TAS
GO:0018105 peptidyl-serine phosphorylation IDA
GO:0030889 negative regulation of B cell proliferation IMP
GO:0031572 G2/M transition DNA damage checkpoint IMP
GO:0042159 lipoprotein catabolic process IEA
GO:0043065 positive regulation of apoptosis IMP
GO:0043066 negative regulation of apoptosis IEA
GO:0043517 positive regulation of DNA damage response, signal transduction by p53 class mediator IMP
GO:0043525 positive regulation of neuron apoptosis IEA
GO:0046777 protein autophosphorylation IDA
GO:0071044 histone mRNA catabolic process IDA
GO:0071480 cellular response to gamma radiation IDA
GO:0090399 replicative senescence IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ATM gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ATM cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu28299 XM_005271561 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $923.30
OHu28299 XM_011542840 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $923.30
OHu28299 XM_011542841 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $923.30
OHu28299 XM_005271562 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $923.30
OHu28299 XM_006718843 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $923.30
OHu56396 XM_011542842 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $1721.30
OHu56397 XM_011542843 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $1511.30
OHu45776 XM_011542844 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $1511.30
OHu56398 XM_011542845 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 24 $1301.30
OHu56399 XM_011542846 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 $951.30
OHu45777 XM_006718845 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 22 $951.30
OHu56400 XM_011542847 PREDICTED: Homo sapiens ATM serine/threonine kinase (ATM), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 $727.30
OHu28299 NM_000051 Homo sapiens ATM serine/threonine kinase (ATM), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $923.30

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu28299
Accession Version XM_005271561.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 9171bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product serine-protein kinase ATM isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_033899.9) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578822202. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)227..703(+)
Misc Feature(2)6497..7675(+)
Misc Feature(3)8255..9094(+)
Misc Feature(4)8285..8875(+)
Misc Feature(5)8807..8833(+)
Misc Feature(6)8873..8941(+)
Misc Feature(7)9284..9376(+)
Position Chain Variation Link
8 8 c, t dbSNP:541720375
10 10 a, g dbSNP:189037
27 27 a, g dbSNP:766115348
41 41 a, g dbSNP:530603679
47 47 a, g dbSNP:3205808
48 48 c, t dbSNP:545900211
87 87 a, g dbSNP:563999137
152 152 c, g dbSNP:775835177
170 170 c, t dbSNP:549089297
180 180 c, t dbSNP:761415893
187 187 a, g dbSNP:765229257
191 191 a, c, g dbSNP:374303671
195 195 c, t dbSNP:766166610
201 201 g, t dbSNP:751378494
207 207 c, t dbSNP:755213267
209 209 a, c, g dbSNP:730881359
210 210 c, t dbSNP:786203606
211 211 a, g dbSNP:781404312
213 213 c, g dbSNP:730881360
214 214 g, t dbSNP:748158168
215 215 c, g dbSNP:7112053
220 220 a, g dbSNP:786201365
245 245 c, t dbSNP:141586345
246 246 a, g dbSNP:778201041
249 249 a, g dbSNP:749776879
250 250 a, g dbSNP:771378101
251 251 -, c dbSNP:771887195
256 256 a, g dbSNP:774768437
258 258 -, at dbSNP:775561876
262 262 c, t dbSNP:786203926
271 271 a, g dbSNP:199853729
275 275 c, t dbSNP:746235533
276 276 a, g dbSNP:587779858
282 282 a, g dbSNP:751310537
284 284 c, g dbSNP:730881361
286 286 a, t dbSNP:786202953
287 287 a, g dbSNP:754770960
294 294 a, c dbSNP:147009251
302 302 c, t dbSNP:148061139
303 303 a, g, t dbSNP:368161489
311 311 a, c, t dbSNP:55861249
323 323 a, g dbSNP:779297339
333 333 a, g dbSNP:201773026
334 334 g, t dbSNP:587781661
335 335 c, g dbSNP:772591447
337 337 a, g dbSNP:780616292
339 339 a, g dbSNP:150143957
341 341 a, c, t dbSNP:3218684
342 342 a, g dbSNP:762382111
346 346 -, ttca dbSNP:786203370
346 346 c, t dbSNP:770834907
348 348 c, g dbSNP:774185390
354 354 c, g, t dbSNP:1800054
359 359 c, t dbSNP:786203888
362 362 g, t dbSNP:730881362
370 370 c, t dbSNP:3218690
378 378 a, g dbSNP:587779818
383 383 g, t dbSNP:752527112
384 384 c, t dbSNP:760880388
388 388 g, t dbSNP:786201375
390 390 c, t dbSNP:786203063
400 400 a, g dbSNP:587780616
401 401 c, g dbSNP:775248597
402 402 a, g dbSNP:760471526
406 406 a, g dbSNP:540920248
408 408 a, g dbSNP:754033733
410 410 a, g dbSNP:35389822
424 424 -, ag dbSNP:762089971
424 424 a, g dbSNP:765201447
445 445 -, a dbSNP:730881303
446 446 c, t dbSNP:750597831
449 449 a, g dbSNP:758962678
454 454 a, g dbSNP:757944864
459 459 c, t dbSNP:587781937
465 465 c, t dbSNP:755326770
466 466 a, g dbSNP:777434093
474 474 c, t dbSNP:375605135
482 482 a, g dbSNP:756969590
483 483 a, c dbSNP:200151849
484 484 a, g dbSNP:786201137
487 487 a, g dbSNP:368196317
491 491 a, c, t dbSNP:587781545
498 498 c, t dbSNP:786203011
499 499 c, t dbSNP:746762110
500 500 a, c dbSNP:768318076
503 503 a, g dbSNP:137882485
507 507 c, t dbSNP:761936549
509 509 a, g dbSNP:758483894
517 517 c, g dbSNP:777499935
528 528 a, g dbSNP:142358238
530 530 a, g dbSNP:730881370
531 531 c, g dbSNP:766951228
542 542 a, g dbSNP:146382972
544 544 a, g dbSNP:777759909
549 549 a, g dbSNP:1442730
563 563 a, g dbSNP:552870679
568 568 c, g dbSNP:749489010
569 569 a, t dbSNP:587782178
570 570 a, t dbSNP:771342315
571 571 a, t dbSNP:774555120
576 576 -, a dbSNP:730881296
576 576 a, g dbSNP:759673348
578 578 a, g dbSNP:148590073
580 580 a, c dbSNP:773495195
581 581 a, g dbSNP:761137313
586 586 a, t dbSNP:2234997
586 586 -, t dbSNP:587781449
587 587 a, g, t dbSNP:587781741
589 589 -, a dbSNP:587781831
589 589 a, g dbSNP:762582522
590 590 a, g dbSNP:587779835
593 593 -, a dbSNP:745642834
597 597 a, g dbSNP:766034066
602 602 c, t dbSNP:786203851
603 603 c, t dbSNP:750969764
606 606 a, t dbSNP:730881330
608 608 a, c, g, t dbSNP:2234998
609 609 a, g dbSNP:771166271
614 614 a, g dbSNP:780941782
617 617 g, t dbSNP:786204177
618 618 a, t dbSNP:547082881
619 619 c, t dbSNP:756160533
620 620 a, g dbSNP:150661813
626 626 c, g, t dbSNP:55633650
627 627 a, g dbSNP:779198364
630 630 a, g dbSNP:745890227
633 633 a, g dbSNP:755618506
635 635 a, g dbSNP:587781688
640 640 a, g dbSNP:772173522
641 641 a, c dbSNP:587782328
643 643 a, g dbSNP:775476710
647 647 a, g dbSNP:587782509
654 654 -, ttct dbSNP:771936821
654 654 a, t dbSNP:587782353
685 685 -, atctc dbSNP:587780624
685 685 a, g dbSNP:786202644
686 686 -, tctca dbSNP:786202225
686 686 c, t dbSNP:761170769
687 687 c, t dbSNP:35858242
690 690 a, c dbSNP:587780625
706 706 a, c, t dbSNP:587779842
714 714 c, g dbSNP:587779843
715 715 c, t dbSNP:758619186
716 716 g, t dbSNP:786202781
718 718 a, g dbSNP:375682557
721 721 c, g dbSNP:786201693
722 722 c, t dbSNP:786201608
726 726 g, t dbSNP:372694758
727 727 g, t dbSNP:587781391
730 730 c, t dbSNP:780173724
734 734 c, g dbSNP:375798802
740 740 c, t dbSNP:786201807
746 746 a, c, t dbSNP:730881333
747 747 a, g dbSNP:730881334
752 752 c, g dbSNP:3218707
756 756 a, c dbSNP:786204219
757 757 -, ta dbSNP:730881297
762 762 c, t dbSNP:730881335
774 774 a, c, g dbSNP:79075295
777 777 a, t dbSNP:201159454
780 780 -, ttcatgctgttacc dbSNP:762000109
780 780 a, t dbSNP:767132334
781 781 a, t dbSNP:775003417
782 782 a, c, g dbSNP:587780629
797 797 a, g dbSNP:764080545
798 798 a, g dbSNP:753806542
799 799 a, t dbSNP:587780630
817 817 c, t dbSNP:144709948
818 818 a, g, t dbSNP:147915571
824 824 a, c dbSNP:587781829
848 848 c, t dbSNP:747053710
848 848 -, t dbSNP:786204543
852 852 a, g dbSNP:755074633
854 854 c, g, t dbSNP:2235002
856 856 c, t dbSNP:770270310
857 857 a, g, t dbSNP:547045780
863 863 c, t dbSNP:771685059
865 865 c, t dbSNP:2235003
867 867 c, t dbSNP:145355104
868 868 a, g dbSNP:763669136
870 870 c, g dbSNP:776349773
876 876 a, g dbSNP:776227830
878 878 a, g dbSNP:145053092
880 880 c, g, t dbSNP:769731317
888 888 c, t dbSNP:762998620
889 889 a, g dbSNP:766129865
895 895 a, g, t dbSNP:3218706
900 900 a, c, g dbSNP:587782229
902 902 a, g dbSNP:767739747
903 903 c, t dbSNP:786203502
910 910 a, g dbSNP:752751588
911 911 a, g dbSNP:76379269
913 913 c, t dbSNP:756175724
917 917 a, g dbSNP:376529329
920 920 a, g dbSNP:754275014
921 921 c, t dbSNP:149116878
924 924 c, t dbSNP:143198946
925 925 -, cctc dbSNP:587782660
925 925 c, t dbSNP:779410490
935 935 c, t dbSNP:746252144
936 936 c, t dbSNP:786202096
943 943 c, t dbSNP:3218674
945 945 a, g dbSNP:781023264
950 950 c, t dbSNP:730881336
951 951 a, g dbSNP:769166447
956 956 c, t dbSNP:772821016
957 957 a, g dbSNP:56123940
969 969 c, t dbSNP:776428526
970 970 -, agg dbSNP:766716803
971 971 a, g dbSNP:770911662
979 979 a, g dbSNP:786201068
981 981 g, t dbSNP:730881337
989 989 a, t dbSNP:786203410
996 996 -, t dbSNP:774609577
998 998 -, t dbSNP:587781978
999 999 a, g dbSNP:730881338
1001 1001 a, g dbSNP:587781973
1010 1010 c, t dbSNP:557012154
1017 1017 a, g dbSNP:587781857
1019 1019 a, c dbSNP:730881339
1034 1034 a, g dbSNP:587782902
1035 1035 a, c dbSNP:767686512
1039 1039 a, g dbSNP:775595591
1040 1040 g, t dbSNP:761005590
1046 1046 a, g dbSNP:764048041
1047 1047 c, t dbSNP:587782080
1054 1054 a, t dbSNP:754008850
1058 1058 c, t dbSNP:757782702
1060 1060 a, g dbSNP:140367473
1066 1066 a, g dbSNP:145301478
1069 1069 c, t dbSNP:55849405
1074 1074 c, t dbSNP:35261362
1078 1078 a, t dbSNP:780618264
1083 1083 c, t dbSNP:747727055
1084 1084 a, g dbSNP:755860432
1099 1099 c, t dbSNP:575285986
1104 1104 a, g dbSNP:587779876
1110 1110 a, g, t dbSNP:202208861
1113 1113 c, t dbSNP:778442248
1136 1136 a, g dbSNP:745773225
1144 1144 a, c, g dbSNP:587782257
1151 1151 -, tt dbSNP:768024233
1154 1154 c, t dbSNP:142317485
1156 1156 c, t dbSNP:775091961
1175 1175 a, g dbSNP:587781511
1183 1183 c, t dbSNP:746825207
1185 1185 g, t dbSNP:768720856
1194 1194 a, g dbSNP:776938735
1197 1197 c, g dbSNP:762179829
1201 1201 a, g dbSNP:786202048
1204 1204 -, ttc dbSNP:753330963
1206 1206 c, t dbSNP:28904919
1217 1217 a, c, t dbSNP:138398778
1218 1218 a, g dbSNP:202160435
1220 1220 a, g dbSNP:751800302
1227 1227 c, g dbSNP:730881387
1228 1228 a, c, t dbSNP:546927781
1229 1229 a, g dbSNP:200601781
1231 1231 c, g, t dbSNP:35728619
1232 1232 -, aaag dbSNP:587780612
1235 1235 -, gaaa dbSNP:587781717
1237 1237 a, g dbSNP:778388800
1238 1238 a, t dbSNP:587782526
1246 1246 a, t dbSNP:749950833
1247 1247 g, t dbSNP:529202615
1248 1248 a, t dbSNP:550825251
1250 1250 a, t dbSNP:746733866
1255 1255 a, g dbSNP:768480943
1256 1256 c, g dbSNP:371713984
1257 1257 c, t dbSNP:375049090
1261 1261 -, t dbSNP:587781984
1262 1262 a, g dbSNP:748380019
1263 1263 c, t dbSNP:369203092
1270 1270 c, t dbSNP:773365379
1281 1281 a, g dbSNP:149636614
1287 1287 a, g, t dbSNP:775767808
1288 1288 c, g, t dbSNP:199869975
1294 1294 a, g dbSNP:142591268
1298 1298 g, t dbSNP:764821887
1312 1312 a, g dbSNP:560691658
1314 1314 c, t dbSNP:762557654
1318 1318 c, g, t dbSNP:376170600
1323 1323 c, g dbSNP:765912563
1324 1324 g, t dbSNP:371985921
1325 1325 a, g dbSNP:751092163
1327 1327 a, t dbSNP:754889105
1335 1335 a, c dbSNP:767564470
1340 1340 a, g dbSNP:587779811
1346 1346 a, t dbSNP:34083085
1347 1347 a, g dbSNP:786203855
1349 1349 a, g dbSNP:786203602
1351 1351 a, t dbSNP:755991658
1354 1354 c, t dbSNP:786201150
1357 1357 c, t dbSNP:786201409
1360 1360 c, g dbSNP:777755997
1363 1363 a, t dbSNP:369957715
1366 1366 -, g dbSNP:587782085
1367 1367 a, c dbSNP:786202686
1369 1369 a, g dbSNP:786202369
1374 1374 c, t dbSNP:757486696
1383 1383 g, t dbSNP:779035681
1384 1384 c, g dbSNP:1800727
1402 1402 c, t dbSNP:551872656
1405 1405 c, t dbSNP:786201131
1409 1409 c, t dbSNP:772529339
1414 1414 a, g dbSNP:776001057
1416 1416 c, t dbSNP:747563556
1418 1418 c, g dbSNP:730881340
1420 1420 a, g dbSNP:786201519
1431 1431 a, g dbSNP:587781582
1433 1433 c, t dbSNP:786203815
1437 1437 c, t dbSNP:56128736
1442 1442 c, t dbSNP:587779812
1443 1443 a, g dbSNP:587779813
1444 1444 g, t dbSNP:79220522
1450 1450 g, t dbSNP:786203667
1457 1457 -, a dbSNP:786203166
1462 1462 a, g dbSNP:4987943
1465 1465 a, g dbSNP:779037197
1468 1468 a, c dbSNP:750468699
1469 1469 c, t dbSNP:376196220
1470 1470 -, caaagtatcctg dbSNP:749937005
1479 1479 a, c dbSNP:147472613
1480 1480 c, t dbSNP:35578748
1481 1481 a, g dbSNP:769214234
1498 1498 -, tg dbSNP:587781598
1503 1503 a, t dbSNP:546621356
1511 1511 c, t dbSNP:748469311
1518 1518 c, t dbSNP:587779814
1522 1522 a, g dbSNP:770573462
1527 1527 c, t dbSNP:773895161
1537 1537 -, a dbSNP:587782844
1537 1537 a, c dbSNP:201460863
1540 1540 a, c dbSNP:763361384
1544 1544 a, c dbSNP:587782121
1546 1546 a, g dbSNP:771673512
1547 1547 c, t dbSNP:587779815
1548 1548 a, g dbSNP:760676955
1553 1553 -, g dbSNP:758004668
1559 1559 c, t dbSNP:201719927
1560 1560 a, g dbSNP:554805703
1563 1563 -, c dbSNP:587781776
1563 1563 c, t dbSNP:201333862
1566 1566 c, t dbSNP:786204124
1567 1567 a, g dbSNP:786203693
1571 1571 a, g dbSNP:368879876
1573 1573 c, g dbSNP:765130666
1576 1576 a, g dbSNP:750579940
1577 1577 c, g, t dbSNP:749036865
1578 1578 a, g dbSNP:780097986
1586 1586 a, c dbSNP:587782729
1587 1587 c, t dbSNP:587781841
1588 1588 a, c, g dbSNP:145333518
1589 1589 a, g dbSNP:781578507
1591 1591 a, g dbSNP:748493136
1600 1600 a, g dbSNP:760191806
1605 1605 a, g dbSNP:770028453
1610 1610 -, aa dbSNP:587781347
1616 1616 c, t dbSNP:778236647
1624 1624 a, g dbSNP:786201691
1632 1632 c, g dbSNP:786203550
1636 1636 a, c, g dbSNP:745509434
1648 1648 a, c dbSNP:370240037
1649 1649 g, t dbSNP:775080283
1651 1651 a, c dbSNP:753808755
1652 1652 a, c dbSNP:202173660
1672 1672 g, t dbSNP:377597949
1674 1674 g, t dbSNP:776412334
1676 1676 a, g dbSNP:761850075
1681 1681 c, g dbSNP:764937436
1685 1685 c, t dbSNP:750280306
1689 1689 a, g dbSNP:786202233
1691 1691 a, g dbSNP:786201969
1695 1695 a, g dbSNP:778890679
1696 1696 c, t dbSNP:1800737
1702 1702 a, g dbSNP:763108858
1711 1711 a, g dbSNP:786203736
1713 1713 c, g dbSNP:766595156
1719 1719 a, g dbSNP:56365018
1724 1724 g, t dbSNP:587779816
1725 1725 g, t dbSNP:767683273
1732 1732 c, t dbSNP:559095379
1732 1732 -, t dbSNP:786204737
1746 1746 a, c dbSNP:753109010
1749 1749 a, g dbSNP:2235000
1750 1750 c, t dbSNP:572567674
1755 1755 c, t dbSNP:786202195
1758 1758 a, t dbSNP:777986229
1759 1759 c, t dbSNP:553020161
1763 1763 g, t dbSNP:758056561
1764 1764 c, t dbSNP:574458765
1769 1769 -, ag dbSNP:751357509
1772 1772 -, ga dbSNP:587779817
1776 1776 g, t dbSNP:768038315
1783 1783 a, c, g dbSNP:587780613
1803 1803 a, g dbSNP:35963548
1804 1804 a, c, t dbSNP:564050785
1809 1809 c, g dbSNP:587782212
1815 1815 a, g dbSNP:769788188
1818 1818 a, c dbSNP:587782463
1826 1826 g, t dbSNP:759661681
1832 1832 g, t dbSNP:587781366
1836 1836 c, t dbSNP:772874616
1837 1837 g, t dbSNP:760285673
1839 1839 c, t dbSNP:375754332
1844 1844 c, g dbSNP:2227924
1848 1848 c, t dbSNP:786203572
1856 1856 a, g dbSNP:202144949
1868 1868 a, g dbSNP:1060788
1870 1870 a, g dbSNP:764646531
1873 1873 a, g dbSNP:754367168
1878 1878 c, t dbSNP:786202770
1879 1879 a, g dbSNP:730881341
1887 1887 a, g dbSNP:762476611
1893 1893 a, g dbSNP:368209025
1896 1896 g, t dbSNP:750815208
1897 1897 a, g dbSNP:786202469
1898 1898 c, t dbSNP:754524029
1903 1903 a, g dbSNP:780932013
1908 1908 a, g dbSNP:786203230
1911 1911 a, g, t dbSNP:200381392
1917 1917 c, t dbSNP:777301065
1922 1922 g, t dbSNP:749216212
1928 1928 c, g dbSNP:770911276
1930 1930 a, g dbSNP:372334891
1935 1935 c, t dbSNP:730881342
1945 1945 a, g dbSNP:786201689
1951 1951 a, g dbSNP:745678414
1952 1952 c, t dbSNP:2235006
1954 1954 c, t dbSNP:145629926
1956 1956 a, c, g dbSNP:587780614
1957 1957 c, t dbSNP:140321514
1965 1965 a, t dbSNP:587781907
1981 1981 c, t dbSNP:61734356
1983 1983 a, g, t dbSNP:776911505
1998 1998 c, t dbSNP:765847854
2000 2000 a, g dbSNP:730881343
2002 2002 c, t dbSNP:786201830
2008 2008 c, t dbSNP:750715942
2010 2010 a, g dbSNP:763402339
2018 2018 c, t dbSNP:2227922
2021 2021 c, t dbSNP:786202928
2022 2022 a, g dbSNP:771877351
2033 2033 c, g dbSNP:779780896
2042 2042 a, c, t dbSNP:747242300
2045 2045 g, t dbSNP:200124136
2046 2046 c, t dbSNP:762018538
2049 2049 c, g dbSNP:770377706
2052 2052 c, t dbSNP:786203783
2054 2054 a, g dbSNP:587780615
2055 2055 c, g dbSNP:533129312
2063 2063 a, c dbSNP:140882609
2082 2082 -, t dbSNP:746197897
2082 2082 a, t dbSNP:766757573
2088 2088 -, t dbSNP:786202474
2088 2088 g, t dbSNP:546087885
2095 2095 c, t dbSNP:143097772
2096 2096 a, c, g dbSNP:148191382
2097 2097 c, t dbSNP:587782226
2100 2100 c, t dbSNP:756782634
2101 2101 a, g dbSNP:764702196
2106 2106 a, g dbSNP:750371239
2111 2111 c, t dbSNP:761491947
2113 2113 -, ccacca dbSNP:587781635
2114 2114 c, t dbSNP:786203654
2119 2119 a, g dbSNP:764790965
2122 2122 a, c dbSNP:587781753
2134 2134 a, g dbSNP:786201469
2139 2139 a, c dbSNP:768362387
2151 2151 c, t dbSNP:141175037
2153 2153 a, g dbSNP:786202511
2161 2161 a, g dbSNP:730881283
2163 2163 c, t dbSNP:766259936
2164 2164 g, t dbSNP:587782544
2168 2168 a, c dbSNP:528165789
2175 2175 c, t dbSNP:754800755
2194 2194 c, t dbSNP:1800055
2197 2197 a, g dbSNP:786202748
2206 2206 a, g dbSNP:748380150
2213 2213 c, t dbSNP:587782141
2217 2217 -, ta dbSNP:772470025
2219 2219 a, g dbSNP:730881344
2220 2220 a, t dbSNP:750897021
2227 2227 a, g dbSNP:786203021
2229 2229 a, g dbSNP:201762714
2231 2231 c, t dbSNP:777849257
2236 2236 -, tg dbSNP:775851720
2236 2236 c, t dbSNP:375196053
2237 2237 a, g dbSNP:568026188
2238 2238 -, cccaggagttcaagaccagcctgggcaacatggcgaaaccccgtc dbSNP:761134097
2244 2244 g, t dbSNP:544123518
2248 2248 c, t dbSNP:587780855
2251 2251 c, t dbSNP:746422877
2259 2259 a, g dbSNP:772393149
2260 2260 c, g dbSNP:775890872
2266 2266 c, t dbSNP:761397203
2270 2270 a, g dbSNP:769338089
2272 2272 a, g dbSNP:772739433
2279 2279 c, g dbSNP:762394404
2282 2282 c, t dbSNP:765965513
2283 2283 a, g dbSNP:751515818
2288 2288 c, t dbSNP:759617968
2290 2290 c, t dbSNP:369642243
2293 2293 a, g dbSNP:786202229
2295 2295 a, g dbSNP:752550257
2304 2304 a, g dbSNP:147934285
2305 2305 a, g dbSNP:777887012
2306 2306 c, t dbSNP:786202743
2316 2316 a, g dbSNP:587781304
2319 2319 a, c dbSNP:753903558
2321 2321 a, t dbSNP:757260641
2324 2324 c, t dbSNP:536609092
2325 2325 c, t dbSNP:779004090
2327 2327 c, t dbSNP:4986761
2330 2330 a, g dbSNP:183202787
2335 2335 c, t dbSNP:56252953
2336 2336 a, g dbSNP:750506930
2337 2337 -, c dbSNP:786203807
2339 2339 a, g dbSNP:587781654
2351 2351 c, g dbSNP:758864982
2356 2356 c, g, t dbSNP:1800701
2357 2357 c, t dbSNP:147515380
2358 2358 a, c, g dbSNP:768874297
2363 2363 c, t dbSNP:748884220
2366 2366 c, t dbSNP:565622131
2367 2367 a, g dbSNP:55830714
2376 2376 c, t dbSNP:745399310
2383 2383 -, c dbSNP:767380441
2383 2383 c, t dbSNP:140110298
2384 2384 a, c dbSNP:775266056
2395 2395 c, t dbSNP:373430058
2397 2397 a, g dbSNP:587781595
2400 2400 a, t dbSNP:730881345
2401 2401 c, t dbSNP:2229019
2415 2415 c, t dbSNP:587780617
2416 2416 c, t dbSNP:761874856
2426 2426 a, g dbSNP:786201866
2427 2427 c, t dbSNP:765475495
2428 2428 a, g dbSNP:56353517
2437 2437 a, g dbSNP:758453118
2446 2446 c, t dbSNP:786203595
2458 2458 a, c, g dbSNP:1137887
2462 2462 c, g dbSNP:756522395
2466 2466 c, t dbSNP:587781607
2468 2468 a, c dbSNP:3205809
2470 2470 a, g dbSNP:778320952
2477 2477 a, g dbSNP:587779819
2478 2478 a, g dbSNP:375091571
2483 2483 a, g dbSNP:148705269
2484 2484 a, g dbSNP:786202270
2489 2489 a, t dbSNP:2235011
2490 2490 c, g dbSNP:768430443
2492 2492 -, ct dbSNP:587781658
2497 2497 a, t dbSNP:34231402
2504 2504 a, c dbSNP:748125666
2530 2530 c, t dbSNP:769575297
2534 2534 c, t dbSNP:762937809
2541 2541 a, g dbSNP:587779820
2544 2544 c, t dbSNP:587778066
2546 2546 a, t dbSNP:587781446
2554 2554 a, g dbSNP:730881285
2560 2560 a, c dbSNP:759679953
2561 2561 c, t dbSNP:587778065
2562 2562 a, g dbSNP:587782128
2566 2566 -, ct dbSNP:753944855
2570 2570 a, c dbSNP:641252
2577 2577 c, g dbSNP:764538548
2584 2584 c, g dbSNP:754267376
2585 2585 a, g dbSNP:587781583
2594 2594 a, c, t dbSNP:201793499
2604 2604 c, t dbSNP:199954262
2616 2616 c, t dbSNP:751218526
2619 2619 g, t dbSNP:754642674
2621 2621 c, t dbSNP:780619951
2622 2622 a, g dbSNP:587782255
2626 2626 g, t dbSNP:587781296
2634 2634 a, c, t dbSNP:730881348
2636 2636 a, g dbSNP:201909756
2641 2641 a, t dbSNP:749275455
2642 2642 a, g dbSNP:112357985
2650 2650 a, c, t dbSNP:3218695
2651 2651 a, g dbSNP:746090916
2654 2654 ct, gc dbSNP:587781956
2657 2657 c, g dbSNP:587778067
2658 2658 a, g, t dbSNP:587779821
2663 2663 c, t dbSNP:775644968
2674 2674 a, g dbSNP:747108452
2675 2675 g, t dbSNP:786202895
2680 2680 c, t dbSNP:786203289
2683 2683 c, t dbSNP:776907383
2684 2684 a, c dbSNP:587782397
2688 2688 a, g dbSNP:372230498
2697 2697 c, t dbSNP:773582901
2700 2700 a, g, t dbSNP:587781352
2702 2702 a, c, t dbSNP:2229022
2703 2703 a, g, t dbSNP:199875915
2706 2706 c, g dbSNP:552010421
2709 2709 a, g, t dbSNP:730881349
2710 2710 -, a dbSNP:587779822
2711 2711 g, t dbSNP:757151992
2712 2712 c, t dbSNP:765118015
2714 2714 -, a dbSNP:770396940
2714 2714 a, g dbSNP:141054982
2727 2727 a, t dbSNP:786202605
2730 2730 a, c, g dbSNP:587781812
2731 2731 c, t dbSNP:758234872
2739 2739 a, c, g dbSNP:587781808
2740 2740 a, g dbSNP:755261743
2746 2746 a, g dbSNP:567045160
2747 2747 a, g dbSNP:587779823
2756 2756 g, t dbSNP:587782280
2760 2760 a, g dbSNP:748203812
2762 2762 c, t dbSNP:758081262
2769 2769 a, c dbSNP:778123895
2771 2771 a, t dbSNP:749844591
2772 2772 -, t dbSNP:730881299
2772 2772 c, t dbSNP:587779824
2774 2774 a, g dbSNP:774757757
2780 2780 c, t dbSNP:1800056
2781 2781 -, t dbSNP:587778068
2785 2785 c, t dbSNP:730881286
2786 2786 a, g dbSNP:587779825
2787 2787 a, t dbSNP:761251711
2798 2798 a, g dbSNP:764842086
2806 2806 g, t dbSNP:730881350
2811 2811 a, g dbSNP:750322758
2814 2814 a, c, g, t dbSNP:145513717
2816 2816 a, g dbSNP:61734354
2818 2818 c, t dbSNP:587780618
2822 2822 a, c, t dbSNP:3218673
2823 2823 c, t dbSNP:786202977
2827 2827 a, g dbSNP:777979257
2838 2838 c, g dbSNP:370269552
2842 2842 c, g dbSNP:771444818
2843 2843 a, g dbSNP:556598169
2844 2844 c, t dbSNP:746265230
2852 2852 a, g dbSNP:746424711
2855 2855 a, g dbSNP:587782382
2863 2863 a, t dbSNP:730881351
2864 2864 g, t dbSNP:575762025
2868 2868 a, g dbSNP:3205810
2887 2887 a, g dbSNP:139316519
2889 2889 a, g dbSNP:113482790
2893 2893 a, g dbSNP:3218687
2894 2894 c, g dbSNP:747696133
2895 2895 -, t dbSNP:764059261
2896 2896 c, t dbSNP:769490863
2897 2897 a, c, t dbSNP:147122522
2901 2901 c, t dbSNP:770610463
2902 2902 a, c dbSNP:774395596
2905 2905 c, t dbSNP:786202978
2906 2906 a, g dbSNP:138468963
2913 2913 a, c, g dbSNP:730881352
2921 2921 -, tgt dbSNP:753766352
2924 2924 c, t dbSNP:368047468
2926 2926 a, g dbSNP:767207624
2928 2928 -, gtgt dbSNP:786202695
2928 2928 a, g, t dbSNP:775371838
2931 2931 c, t dbSNP:754738085
2933 2933 a, t dbSNP:786203175
2942 2942 c, g, t dbSNP:764409952
2943 2943 a, g dbSNP:730881353
2944 2944 a, g dbSNP:757305928
2949 2949 a, g dbSNP:141947469
2951 2951 a, g dbSNP:786203106
2957 2957 c, t dbSNP:750916886
2962 2962 a, t dbSNP:758955717
2962 2962 -, t dbSNP:786202608
2967 2967 a, c dbSNP:780216086
2972 2972 c, g dbSNP:786201670
2978 2978 c, t dbSNP:55723361
2979 2979 a, g dbSNP:587782298
2980 2980 a, g dbSNP:777541280
2986 2986 a, g dbSNP:372569168
2989 2989 g, t dbSNP:770565353
2993 2993 a, t dbSNP:774067793
2994 2994 c, t dbSNP:745737218
2997 2997 g, t dbSNP:786203309
3006 3006 c, g dbSNP:56087610
3008 3008 a, g dbSNP:772054979
3011 3011 a, g dbSNP:35813135
3012 3012 -, gcta dbSNP:757237504
3012 3012 c, g, t dbSNP:3218708
3013 3013 c, g, t dbSNP:55934812
3016 3016 a, g dbSNP:547791214
3027 3027 a, g, t dbSNP:762078586
3031 3031 a, c dbSNP:750504746
3032 3032 c, t dbSNP:3218688
3039 3039 g, t dbSNP:565886680
3042 3042 a, g dbSNP:752053874
3044 3044 a, g dbSNP:587781992
3048 3048 a, g dbSNP:587779827
3056 3056 c, t dbSNP:763064034
3057 3057 g, t dbSNP:786203054
3060 3060 c, t dbSNP:766405101
3067 3067 a, g dbSNP:569489729
3075 3075 a, g dbSNP:752099312
3081 3081 a, g dbSNP:587778069
3085 3085 -, c dbSNP:758561876
3087 3087 a, c, t dbSNP:587779828
3088 3088 -, c dbSNP:730881300
3090 3090 -, t dbSNP:587781805
3095 3095 a, g dbSNP:374353016
3097 3097 a, g dbSNP:35098825
3105 3105 gccaa, ttc dbSNP:730881301
3109 3109 g, t dbSNP:778731866
3117 3117 a, t dbSNP:587782521
3120 3120 -, aacca dbSNP:587781656
3120 3120 a, t dbSNP:587781855
3123 3123 c, t dbSNP:750093937
3125 3125 c, g dbSNP:535646511
3127 3127 a, g dbSNP:587779829
3129 3129 c, g, t dbSNP:538105098
3130 3130 a, c dbSNP:758045139
3132 3132 a, g dbSNP:730881354
3133 3133 c, t dbSNP:765848319
3135 3135 c, t dbSNP:146145357
3140 3140 c, t dbSNP:139552233
3142 3142 g, t dbSNP:368678134
3148 3148 c, t dbSNP:748119565
3149 3149 c, t dbSNP:587780619
3150 3150 a, g dbSNP:755896387
3152 3152 c, t dbSNP:587779830
3153 3153 a, g dbSNP:749471737
3164 3164 a, g dbSNP:771065430
3165 3165 c, t dbSNP:373225328
3166 3166 g, t dbSNP:745971584
3170 3170 a, g dbSNP:772327699
3173 3173 -, a dbSNP:786203539
3175 3175 c, t dbSNP:144145128
3177 3177 c, t dbSNP:761333794
3190 3190 c, t dbSNP:200541844
3191 3191 c, t dbSNP:587779831
3196 3196 g, t dbSNP:559676197
3200 3200 a, g dbSNP:199635238
3209 3209 c, g dbSNP:377244521
3211 3211 a, g dbSNP:765969190
3216 3216 a, t dbSNP:1064815
3220 3220 c, t dbSNP:751260996
3221 3221 a, c dbSNP:745954659
3222 3222 a, g dbSNP:146531614
3224 3224 a, g dbSNP:139893395
3242 3242 a, t dbSNP:752615128
3246 3246 a, c dbSNP:756015891
3248 3248 a, g dbSNP:587782163
3252 3252 a, g dbSNP:587778070
3256 3256 a, g dbSNP:786203820
3257 3257 c, t dbSNP:730881388
3267 3267 a, c, t dbSNP:186626274
3270 3270 g, t dbSNP:786202399
3272 3272 a, g dbSNP:786202470
3275 3275 a, g dbSNP:730882129
3277 3277 a, g dbSNP:778984289
3279 3279 c, t dbSNP:746133264
3280 3280 a, g dbSNP:772274328
3285 3285 a, g dbSNP:587782103
3288 3288 a, g dbSNP:786204217
3293 3293 a, t dbSNP:730881355
3300 3300 a, g dbSNP:758708495
3310 3310 c, t dbSNP:780240314
3314 3314 c, t dbSNP:747079458
3322 3322 a, t dbSNP:374451781
3325 3325 a, g dbSNP:55784207
3326 3326 a, g dbSNP:3092857
3328 3328 c, g dbSNP:781519408
3329 3329 g, t dbSNP:748752687
3334 3334 a, g dbSNP:770038542
3336 3336 g, t dbSNP:730881356
3343 3343 c, t dbSNP:773577455
3345 3345 c, t dbSNP:568461905
3346 3346 c, g, t dbSNP:3092858
3347 3347 a, g dbSNP:587778071
3358 3358 c, t dbSNP:3092859
3359 3359 c, g dbSNP:774935453
3368 3368 c, t dbSNP:775095314
3369 3369 c, g dbSNP:1800057
3373 3373 c, t dbSNP:768038217
3383 3383 a, g, t dbSNP:370282831
3384 3384 c, t dbSNP:761590782
3393 3393 a, g dbSNP:756292232
3394 3394 g, t dbSNP:765286461
3397 3397 a, c dbSNP:76122065
3398 3398 a, g, t dbSNP:79431304
3402 3402 a, g dbSNP:762810180
3407 3407 g, t dbSNP:766342338
3413 3413 c, t dbSNP:751714261
3416 3416 a, g dbSNP:587780620
3420 3420 a, g dbSNP:755237639
3421 3421 c, t dbSNP:786203221
3424 3424 a, g dbSNP:373699194
3427 3427 a, g dbSNP:752849892
3432 3432 c, t dbSNP:756568555
3444 3444 c, g dbSNP:778233602
3445 3445 c, t dbSNP:564238520
3447 3447 a, t dbSNP:757617016
3448 3448 a, c dbSNP:149911447
3450 3450 a, g dbSNP:368111672
3452 3452 -, tg dbSNP:761486324
3453 3453 atc, tgat dbSNP:587776549
3455 3455 -, c dbSNP:767099464
3455 3455 c, t dbSNP:768362411
3464 3464 c, t dbSNP:201780199
3465 3465 a, g, t dbSNP:769857066
3466 3466 c, t dbSNP:773277362
3467 3467 a, g dbSNP:750140469
3473 3473 g, t dbSNP:730881358
3474 3474 c, t dbSNP:1142018
3475 3475 c, t dbSNP:766215530
3481 3481 a, g dbSNP:762860946
3483 3483 c, t dbSNP:774197372
3488 3488 -, a dbSNP:776516754
3489 3489 a, g dbSNP:199883473
3492 3492 a, g dbSNP:587781815
3500 3500 c, t dbSNP:773964990
3503 3503 a, g dbSNP:372966951
3504 3504 a, g dbSNP:587778072
3507 3507 c, g, t dbSNP:189445371
3508 3508 a, g dbSNP:587780621
3512 3512 a, g, t dbSNP:147557621
3517 3517 a, t dbSNP:764102178
3522 3522 c, t dbSNP:141999815
3532 3532 a, g dbSNP:762269034
3536 3536 a, g dbSNP:147112946
3539 3539 c, g dbSNP:587779832
3541 3541 g, t dbSNP:750932338
3544 3544 a, t dbSNP:758784434
3549 3549 a, g dbSNP:777705500
3550 3550 a, g dbSNP:138393322
3551 3551 c, t dbSNP:752339681
3557 3557 c, t dbSNP:786201957
3558 3558 a, g dbSNP:755828033
3559 3559 a, g dbSNP:777375945
3560 3560 a, g dbSNP:572564322
3561 3561 c, t dbSNP:539847847
3562 3562 a, g dbSNP:377316982
3563 3563 g, t dbSNP:786201956
3564 3564 c, t dbSNP:778882461
3573 3573 a, g dbSNP:745863765
3577 3577 -, a dbSNP:587781752
3577 3577 a, g dbSNP:587780543
3580 3580 c, g dbSNP:587779833
3581 3581 c, t dbSNP:775277598
3583 3583 a, g dbSNP:760821273
3586 3586 a, g dbSNP:149182949
3589 3589 -, tcag dbSNP:587781971
3591 3591 a, g dbSNP:2229020
3596 3596 g, t dbSNP:587781911
3613 3613 c, t dbSNP:746829748
3615 3615 a, g dbSNP:768490475
3619 3619 c, t dbSNP:369518512
3623 3623 c, g dbSNP:786203048
3636 3636 c, t dbSNP:748375410
3647 3647 a, g dbSNP:769853739
3651 3651 a, g dbSNP:773169285
3655 3655 c, t dbSNP:763473729
3656 3656 a, c dbSNP:786201209
3657 3657 c, g dbSNP:555219189
3663 3663 c, g dbSNP:775045299
3666 3666 g, t dbSNP:12788418
3675 3675 c, t dbSNP:759951393
3676 3676 a, g dbSNP:148358896
3683 3683 -, g dbSNP:775160037
3686 3686 a, c, g dbSNP:567344545
3687 3687 g, t dbSNP:12788427
3690 3690 g, t dbSNP:12788429
3696 3696 a, c dbSNP:372766122
3710 3710 c, t dbSNP:749933079
3713 3713 a, g dbSNP:200765255
3721 3721 a, g dbSNP:757201878
3722 3722 c, g, t dbSNP:779946941
3725 3725 c, t dbSNP:141460670
3728 3728 g, t dbSNP:547400704
3734 3734 -, c dbSNP:730881302
3735 3735 g, t dbSNP:587782762
3736 3736 g, t dbSNP:748335454
3738 3738 c, g dbSNP:587782470
3749 3749 -, aa dbSNP:746598992
3751 3751 -, ag dbSNP:768356403
3752 3752 c, g dbSNP:377349886
3755 3755 a, g dbSNP:773290999
3757 3757 c, t dbSNP:767377764
3766 3766 a, c dbSNP:12786957
3771 3771 a, c dbSNP:12786960
3772 3772 c, t dbSNP:771172636
3773 3773 c, g, t dbSNP:370602633
3780 3780 a, g dbSNP:767939082
3784 3784 a, g dbSNP:587776551
3785 3785 a, g dbSNP:779148780
3796 3796 a, g dbSNP:376524625
3806 3806 a, g dbSNP:772741084
3808 3808 c, t dbSNP:56342865
3809 3809 a, t dbSNP:576884305
3812 3812 a, g dbSNP:536110861
3819 3819 a, g dbSNP:786203066
3821 3821 c, t dbSNP:760928285
3822 3822 a, g dbSNP:769106895
3826 3826 a, g dbSNP:786201151
3827 3827 c, g dbSNP:772724024
3833 3833 -, t dbSNP:587782861
3834 3834 -, tt dbSNP:786203817
3835 3835 c, t dbSNP:762605020
3836 3836 a, g dbSNP:138212452
3837 3837 c, t dbSNP:192572042
3838 3838 a, g, t dbSNP:587778073
3839 3839 g, t dbSNP:745467552
3847 3847 c, t dbSNP:142766756
3880 3880 c, t dbSNP:3205813
3884 3884 c, g dbSNP:370974808
3897 3897 a, g dbSNP:587782195
3901 3901 -, atc dbSNP:786203389
3902 3902 c, t dbSNP:183532834
3903 3903 c, g, t dbSNP:367603277
3911 3911 c, t dbSNP:779095853
3913 3913 a, t dbSNP:745971646
3918 3918 g, t dbSNP:786202897
3920 3920 -, ttatt dbSNP:786201675
3930 3930 a, t dbSNP:587782688
3931 3931 c, t dbSNP:772331389
3936 3936 a, t dbSNP:730881363
3949 3949 c, t dbSNP:780396420
3951 3951 a, g, t dbSNP:766226370
3959 3959 c, t dbSNP:763730862
3962 3962 ca, tat dbSNP:786201886
3968 3968 a, g dbSNP:753717865
3968 3968 -, g dbSNP:786203507
3975 3975 g, t dbSNP:757510349
3976 3976 a, g, t dbSNP:765538231
3978 3978 c, t dbSNP:758405529
3980 3980 a, c dbSNP:587782741
3982 3982 a, t dbSNP:786203114
3985 3985 a, g dbSNP:780192529
3986 3986 a, g dbSNP:587782035
3988 3988 -, g dbSNP:786202694
3993 3993 g, t dbSNP:786203618
4001 4001 c, g, t dbSNP:371526361
4003 4003 g, t dbSNP:755536924
4008 4008 a, t dbSNP:781357995
4009 4009 -, g dbSNP:765158119
4010 4010 -, g dbSNP:587779834
4014 4014 a, g dbSNP:146017595
4035 4035 a, c dbSNP:770183693
4039 4039 a, c, g dbSNP:587781787
4040 4040 a, g dbSNP:730881365
4042 4042 a, c, t dbSNP:534864280
4044 4044 a, g dbSNP:587779836
4049 4049 a, t dbSNP:370785959
4056 4056 c, t dbSNP:730881389
4097 4097 c, t dbSNP:775071209
4102 4102 -, t dbSNP:587781823
4103 4103 -, g dbSNP:786203501
4104 4104 c, t dbSNP:786203287
4105 4105 c, g dbSNP:760491475
4107 4107 a, g dbSNP:183263185
4110 4110 a, g dbSNP:776762178
4113 4113 g, t dbSNP:761673223
4126 4126 c, t dbSNP:139632347
4127 4127 a, g dbSNP:568451087
4133 4133 a, g dbSNP:149711770
4139 4139 c, t dbSNP:200976093
4145 4145 c, g dbSNP:3092841
4149 4149 c, t dbSNP:751678973
4150 4150 c, t dbSNP:558360643
4160 4160 g, t dbSNP:587778074
4169 4169 a, g dbSNP:730881366
4171 4171 a, g dbSNP:35184530
4172 4172 a, c dbSNP:144535256
4173 4173 a, t dbSNP:786203306
4186 4186 a, c dbSNP:778123057
4188 4188 g, t dbSNP:587782192
4206 4206 a, t dbSNP:746709782
4208 4208 c, g dbSNP:768270289
4209 4209 a, g dbSNP:780865776
4216 4216 c, t dbSNP:748055132
4240 4240 c, g dbSNP:769871715
4250 4250 -, ttg dbSNP:766396546
4250 4250 c, t dbSNP:56355831
4254 4254 -, tgacgttacatgagccagc dbSNP:751693355
4257 4257 c, t dbSNP:587781785
4258 4258 a, g dbSNP:770697446
4260 4260 -, t dbSNP:786202350
4264 4264 c, t dbSNP:587780622
4268 4268 a, c dbSNP:145119475
4274 4274 a, g dbSNP:147600485
4278 4278 c, g dbSNP:730881390
4279 4279 c, t dbSNP:767516955
4285 4285 c, g dbSNP:375606854
4286 4286 a, t dbSNP:761123780
4287 4287 a, g, t dbSNP:764564211
4289 4289 c, t dbSNP:121434222
4290 4290 a, g dbSNP:141921797
4295 4295 a, g dbSNP:587779837
4299 4299 a, g dbSNP:751169467
4309 4309 c, t dbSNP:587780623
4312 4312 c, t dbSNP:569614591
4322 4322 c, t dbSNP:762242838
4328 4328 c, t dbSNP:749215545
4335 4335 c, g dbSNP:786202406
4341 4341 c, t dbSNP:750771205
4346 4346 c, t dbSNP:3092856
4351 4351 -, t dbSNP:730881309
4352 4352 c, t dbSNP:55859590
4353 4353 c, t dbSNP:752460436
4354 4354 a, g dbSNP:147738621
4356 4356 c, t dbSNP:141087784
4357 4357 a, g dbSNP:749180334
4359 4359 a, g dbSNP:757172522
4372 4372 a, g dbSNP:778721327
4375 4375 a, g dbSNP:183214437
4384 4384 a, t dbSNP:771894720
4387 4387 a, c dbSNP:775688446
4392 4392 a, g dbSNP:375396787
4399 4399 a, t dbSNP:747293175
4404 4404 a, c dbSNP:786203761
4406 4406 a, t dbSNP:587781950
4409 4409 a, t dbSNP:587779838
4415 4415 a, t dbSNP:768726324
4418 4418 a, g dbSNP:786201832
4434 4434 a, c dbSNP:730881368
4435 4435 -, c dbSNP:587782054
4443 4443 c, t dbSNP:776581499
4455 4455 a, g dbSNP:758180727
4466 4466 c, t dbSNP:1800058
4472 4472 a, g dbSNP:562445932
4474 4474 a, g dbSNP:768794637
4475 4475 c, t dbSNP:587782442
4487 4487 a, g dbSNP:2229021
4499 4499 a, c dbSNP:748144169
4500 4500 a, g dbSNP:201356803
4512 4512 a, c, g dbSNP:769980220
4513 4513 a, g dbSNP:763567469
4514 4514 c, t dbSNP:544891616
4529 4529 a, c dbSNP:774886013
4531 4531 a, g dbSNP:587779839
4532 4532 c, t dbSNP:201666889
4537 4537 a, c dbSNP:377065665
4540 4540 a, c, g dbSNP:753570046
4543 4543 g, t dbSNP:761225071
4553 4553 c, t dbSNP:786201555
4555 4555 a, c dbSNP:764787081
4557 4557 c, t dbSNP:750306932
4566 4566 g, t dbSNP:587782126
4567 4567 -, aaaaa dbSNP:587782863
4570 4570 a, c dbSNP:148993589
4573 4573 a, t dbSNP:527471560
4578 4578 c, g, t dbSNP:373226793
4579 4579 a, g dbSNP:765713557
4581 4581 -, g dbSNP:587781653
4583 4583 a, g dbSNP:145667735
4587 4587 c, t dbSNP:376165779
4595 4595 a, c, t dbSNP:549106928
4596 4596 g, t dbSNP:138327406
4602 4602 c, t dbSNP:730881391
4604 4604 c, g, t dbSNP:730881369
4605 4605 a, g dbSNP:749770110
4606 4606 a, g dbSNP:142728382
4608 4608 a, g dbSNP:730881392
4610 4610 a, g dbSNP:369903995
4615 4615 g, t dbSNP:775047783
4622 4622 g, t dbSNP:539676759
4623 4623 c, t dbSNP:772555314
4624 4624 a, g dbSNP:201526888
4628 4628 c, g dbSNP:587779840
4632 4632 a, g dbSNP:34640941
4639 4639 c, g dbSNP:571989748
4647 4647 c, t dbSNP:200456625
4650 4650 -, ctt dbSNP:786202338
4652 4652 c, t dbSNP:752559455
4653 4653 a, g dbSNP:201277352
4657 4657 c, t dbSNP:786203726
4659 4659 c, t dbSNP:786203785
4664 4664 c, g dbSNP:786203352
4665 4665 c, t dbSNP:764381044
4673 4673 c, t dbSNP:754181173
4674 4674 a, g, t dbSNP:201594549
4675 4675 c, t dbSNP:746296827
4679 4679 c, t dbSNP:587781944
4681 4681 c, t dbSNP:4988008
4684 4684 c, t dbSNP:780236656
4685 4685 c, t dbSNP:377595814
4690 4690 c, t dbSNP:769071554
4696 4696 c, g dbSNP:772833802
4700 4700 c, t dbSNP:748949478
4707 4707 a, g dbSNP:786203789
4709 4709 a, g, t dbSNP:370574283
4713 4713 g, t dbSNP:759340881
4718 4718 a, g dbSNP:767466937
4723 4723 c, t dbSNP:540798997
4724 4724 g, t dbSNP:760542469
4753 4753 c, t dbSNP:764039368
4757 4757 c, t dbSNP:754058482
4761 4761 a, c dbSNP:762132832
4766 4766 a, c, t dbSNP:765195241
4767 4767 c, t dbSNP:375654664
4769 4769 c, g dbSNP:141329176
4770 4770 c, t dbSNP:786202673
4775 4775 a, g dbSNP:113854991
4778 4778 a, c, t dbSNP:780603110
4782 4782 c, t dbSNP:755274980
4783 4783 a, t dbSNP:781539071
4784 4784 a, c dbSNP:748898098
4785 4785 c, t dbSNP:770590652
4786 4786 c, t dbSNP:1800889
4806 4806 -, aggttc dbSNP:768183241
4808 4808 g, t dbSNP:745351684
4811 4811 c, t dbSNP:771549673
4814 4814 a, g dbSNP:587779841
4826 4826 g, t dbSNP:778622948
4831 4831 g, t dbSNP:3092849
4833 4833 -, t dbSNP:730881304
4834 4834 a, g dbSNP:786202784
4837 4837 a, g dbSNP:745565564
4838 4838 c, t dbSNP:771554153
4839 4839 a, g dbSNP:779718362
4847 4847 a, g dbSNP:537377433
4866 4866 a, c dbSNP:587778075
4870 4870 a, c dbSNP:776761757
4873 4873 c, g, t dbSNP:374431061
4874 4874 c, t dbSNP:587781320
4875 4875 a, g dbSNP:587782037
4876 4876 g, t dbSNP:766438805
4881 4881 c, t dbSNP:587781712
4885 4885 c, t dbSNP:759660081
4886 4886 a, c dbSNP:767981230
4910 4910 c, t dbSNP:753269143
4911 4911 a, g dbSNP:368830730
4917 4917 c, t dbSNP:140856217
4921 4921 c, t dbSNP:750027746
4924 4924 c, g dbSNP:786203953
4932 4932 a, g dbSNP:550552791
4939 4939 c, t dbSNP:145236132
4940 4940 c, t dbSNP:746499337
4942 4942 a, g dbSNP:754579737
4961 4961 a, g dbSNP:781275128
4967 4967 c, g dbSNP:786202473
4968 4968 a, c dbSNP:748044422
4969 4969 c, t dbSNP:769562370
4976 4976 c, t dbSNP:35962982
4978 4978 c, t dbSNP:749475519
4984 4984 c, g dbSNP:786202973
4987 4987 a, g dbSNP:587778076
4992 4992 a, g dbSNP:777812804
4997 4997 c, t dbSNP:749004718
5000 5000 a, c dbSNP:375190373
5010 5010 a, g dbSNP:587782506
5022 5022 c, t dbSNP:786203520
5024 5024 c, g dbSNP:746103632
5026 5026 c, t dbSNP:772074468
5029 5029 a, g dbSNP:786203559
5030 5030 c, t dbSNP:775464644
5033 5033 a, g dbSNP:761197886
5035 5035 a, c dbSNP:681479
5041 5041 c, g, t dbSNP:769025179
5048 5048 c, t dbSNP:777239020
5050 5050 -, ct dbSNP:753011366
5052 5052 -, aggat dbSNP:760996616
5060 5060 c, t dbSNP:762083530
5061 5061 a, g dbSNP:765759912
5064 5064 a, g dbSNP:730881393
5067 5067 a, c dbSNP:681518
5069 5069 c, t dbSNP:759289039
5076 5076 c, t dbSNP:786203017
5077 5077 a, g dbSNP:767084038
5079 5079 a, g dbSNP:56354559
5086 5086 c, t dbSNP:755687834
5088 5088 a, t dbSNP:786203857
5111 5111 g, t dbSNP:535266558
5117 5117 a, g dbSNP:753870656
5118 5118 a, g dbSNP:763457172
5119 5119 c, t dbSNP:551497234
5124 5124 c, t dbSNP:752459491
5125 5125 a, g, t dbSNP:140425622
5129 5129 c, g dbSNP:587782896
5139 5139 c, t dbSNP:55843558
5140 5140 c, g dbSNP:730881371
5141 5141 g, t dbSNP:757381170
5146 5146 -, a dbSNP:587781754
5148 5148 -, a dbSNP:757778614
5149 5149 a, g dbSNP:786201667
5157 5157 a, g dbSNP:55870064
5161 5161 a, g dbSNP:786201297
5169 5169 c, t dbSNP:587781679
5172 5172 a, c dbSNP:786201215
5180 5180 a, g dbSNP:372679141
5183 5183 a, g dbSNP:778632065
5185 5185 a, t dbSNP:199888434
5188 5188 a, c, t dbSNP:144338238
5207 5207 a, g dbSNP:780137734
5210 5210 c, t dbSNP:747317946
5212 5212 a, g dbSNP:768565424
5217 5217 c, t dbSNP:375131360
5247 5247 c, t dbSNP:587782153
5252 5252 c, g dbSNP:121434217
5263 5263 c, t dbSNP:587780551
5264 5264 a, g dbSNP:145453814
5270 5270 a, g dbSNP:766053182
5271 5271 c, t dbSNP:199836342
5279 5279 a, c dbSNP:1800059
5284 5284 a, c dbSNP:767841041
5287 5287 c, t dbSNP:753036834
5288 5288 a, g dbSNP:756197350
5289 5289 c, g dbSNP:587782551
5290 5290 a, g dbSNP:778014234
5291 5291 c, t dbSNP:749763863
5296 5296 c, t dbSNP:786203476
5297 5297 a, g dbSNP:142455912
5300 5300 a, g dbSNP:779328045
5309 5309 a, g dbSNP:746220021
5316 5316 c, t dbSNP:772376652
5326 5326 a, g dbSNP:3218672
5334 5334 a, g dbSNP:587780627
5338 5338 g, t dbSNP:780816003
5344 5344 c, t dbSNP:786203371
5352 5352 c, t dbSNP:747800057
5353 5353 a, g dbSNP:786202765
5355 5355 a, c dbSNP:769232698
5364 5364 a, c, g dbSNP:183531638
5365 5365 c, t dbSNP:786203254
5370 5370 c, t dbSNP:786203910
5384 5384 g, t dbSNP:770882126
5389 5389 c, g dbSNP:771945159
5393 5393 c, g, t dbSNP:3092907
5396 5396 c, t dbSNP:764389018
5397 5397 a, g dbSNP:373789346
5398 5398 a, g dbSNP:786201609
5402 5402 a, g dbSNP:730881372
5407 5407 c, t dbSNP:761946128
5409 5409 -, at dbSNP:730881305
5427 5427 g, t dbSNP:367585465
5430 5430 c, t dbSNP:750896881
5434 5434 c, t dbSNP:750881004
5435 5435 a, c, g dbSNP:758924620
5436 5436 c, t dbSNP:587779844
5441 5441 a, c dbSNP:587782532
5458 5458 g, t dbSNP:587779845
5459 5459 c, g dbSNP:755397489
5466 5466 a, g dbSNP:777481236
5470 5470 g, t dbSNP:748900588
5475 5475 c, g dbSNP:786203369
5478 5478 c, t dbSNP:587781575
5486 5486 a, g dbSNP:151327241
5498 5498 -, c dbSNP:587779846
5500 5500 a, g dbSNP:786201703
5502 5502 a, c dbSNP:35556390
5504 5504 c, t dbSNP:778309703
5517 5517 c, g dbSNP:121434223
5531 5531 g, t dbSNP:768820804
5541 5541 c, t dbSNP:756892492
5545 5545 a, t dbSNP:369351803
5557 5557 -, gtacccagatttgacaaagaa dbSNP:587779847
5560 5560 c, t dbSNP:140641762
5561 5561 c, g dbSNP:587779848
5570 5570 a, g dbSNP:730881373
5572 5572 c, t dbSNP:780134093
5577 5577 a, g dbSNP:746945284
5580 5580 a, g dbSNP:367987632
5583 5583 c, t dbSNP:776309355
5585 5585 a, c dbSNP:730881374
5590 5590 c, g dbSNP:188362115
5597 5597 c, g dbSNP:748358106
5604 5604 -, g dbSNP:587782812
5618 5618 a, t dbSNP:769872474
5625 5625 c, t dbSNP:773546064
5626 5626 a, g dbSNP:763020528
5640 5640 a, g dbSNP:149569091
5643 5643 c, t dbSNP:199885813
5650 5650 -, g dbSNP:772138812
5656 5656 c, t dbSNP:766455425
5660 5660 a, g dbSNP:774784546
5664 5664 a, c, t dbSNP:760060843
5669 5669 c, t dbSNP:562930561
5671 5671 a, t dbSNP:756549545
5672 5672 -, tataac dbSNP:775458639
5678 5678 c, t dbSNP:764784077
5682 5682 a, c dbSNP:587782655
5693 5693 -, taaata dbSNP:760910464
5696 5696 a, g dbSNP:587781622
5697 5697 c, t dbSNP:145812395
5698 5698 a, g dbSNP:779720793
5709 5709 a, g dbSNP:776122081
5720 5720 c, t dbSNP:587781390
5723 5723 c, t dbSNP:786204751
5725 5725 g, t dbSNP:760942541
5736 5736 c, t dbSNP:764522350
5737 5737 a, t dbSNP:750037588
5744 5744 a, g dbSNP:587779849
5752 5752 c, t dbSNP:146568734
5754 5754 -, t dbSNP:750992549
5758 5758 a, g dbSNP:35850088
5759 5759 c, g, t dbSNP:200842502
5761 5761 c, g dbSNP:786201126
5762 5762 c, t dbSNP:754562056
5765 5765 a, g dbSNP:1801516
5766 5766 a, t dbSNP:1801673
5769 5769 c, g dbSNP:138710254
5779 5779 a, t dbSNP:777570286
5791 5791 a, g dbSNP:781383087
5792 5792 c, t dbSNP:149362482
5797 5797 c, t dbSNP:786203902
5799 5799 c, t dbSNP:779156037
5801 5801 a, c, t dbSNP:567908537
5803 5803 c, t dbSNP:772261410
5820 5820 c, t dbSNP:538452060
5823 5823 c, g dbSNP:761257154
5826 5826 g, t dbSNP:587782239
5831 5831 c, t dbSNP:376603775
5832 5832 a, c, g dbSNP:762304746
5838 5838 a, c, t dbSNP:202028401
5839 5839 -, ctcg dbSNP:758852420
5839 5839 a, c dbSNP:751327903
5841 5841 c, t dbSNP:758908522
5842 5842 a, g, t dbSNP:767070325
5843 5843 a, c dbSNP:756109905
5844 5844 a, g dbSNP:786203086
5845 5845 a, c dbSNP:587781993
5846 5846 a, g dbSNP:764061022
5847 5847 -, g dbSNP:374376614
5847 5847 c, g, t dbSNP:587780628
5848 5848 a, g dbSNP:757103582
5852 5852 c, t dbSNP:786204433
5853 5853 a, g dbSNP:587782236
5860 5860 -, a dbSNP:587778077
5861 5861 a, t dbSNP:587779850
5873 5873 g, t dbSNP:746106249
5882 5882 a, g dbSNP:730881375
5885 5885 a, t dbSNP:730881376
5891 5891 c, t dbSNP:766901049
5898 5898 g, t dbSNP:587782516
5900 5900 c, t dbSNP:775036118
5901 5901 a, g dbSNP:370680798
5903 5903 c, t dbSNP:373213507
5905 5905 a, c dbSNP:753839301
5911 5911 a, g dbSNP:756979112
5915 5915 a, g dbSNP:765027485
5920 5920 -, a dbSNP:587781730
5933 5933 a, g dbSNP:750561317
5934 5934 c, t dbSNP:542378165
5936 5936 a, c dbSNP:143577586
5949 5949 a, g dbSNP:747085104
5958 5958 c, g dbSNP:377289524
5961 5961 c, g dbSNP:148064985
5972 5972 c, t dbSNP:587781865
5973 5973 a, c dbSNP:751792004
5973 5973 -, c dbSNP:786202814
5982 5982 a, g dbSNP:755055090
5984 5984 -, acaatttttaatgat dbSNP:786203678
5984 5984 a, g dbSNP:781448339
5987 5987 a, g dbSNP:753218533
5994 5994 a, g dbSNP:756661278
5999 5999 cct, g dbSNP:587779851
6001 6001 c, t dbSNP:3092910
6020 6020 a, t dbSNP:786203668
6025 6025 a, g dbSNP:749652134
6029 6029 c, g dbSNP:147187700
6033 6033 c, t dbSNP:730881394
6035 6035 a, g dbSNP:779692309
6036 6036 a, g dbSNP:746676271
6043 6043 g, t dbSNP:768106055
6052 6052 c, t dbSNP:776150043
6061 6061 a, c dbSNP:376169886
6066 6066 c, t dbSNP:587781963
6076 6076 c, t dbSNP:540054724
6087 6087 a, t dbSNP:587782503
6090 6090 a, g dbSNP:56399311
6098 6098 a, g, t dbSNP:201963507
6100 6100 c, g dbSNP:786202728
6101 6101 -, aaaag dbSNP:587781727
6116 6116 c, t dbSNP:587781722
6118 6118 -, a dbSNP:587782198
6123 6123 a, c dbSNP:730881377
6125 6125 a, g dbSNP:786202089
6136 6136 a, g dbSNP:573776535
6138 6138 c, t dbSNP:780867575
6140 6140 g, t dbSNP:587779852
6146 6146 a, g dbSNP:786203765
6151 6151 c, t dbSNP:769252226
6153 6153 a, g, t dbSNP:543980602
6156 6156 a, g dbSNP:659243
6159 6159 a, c dbSNP:770722380
6172 6172 c, t dbSNP:774260725
6179 6179 a, g dbSNP:786203404
6181 6181 a, c dbSNP:587782274
6183 6183 -, aaagt dbSNP:749049519
6183 6183 a, c dbSNP:150757822
6202 6202 a, t dbSNP:56046250
6207 6207 a, g dbSNP:775921052
6208 6208 -, cac dbSNP:757125026
6212 6212 c, t dbSNP:201136510
6215 6215 a, g dbSNP:730881378
6228 6228 a, c, g dbSNP:762001297
6233 6233 c, t dbSNP:199586999
6248 6248 a, c, g dbSNP:375783941
6250 6250 a, g dbSNP:138987778
6255 6255 a, g dbSNP:587781302
6261 6261 g, t dbSNP:755694394
6265 6265 c, t dbSNP:777534711
6271 6271 g, t dbSNP:535165324
6272 6272 a, g dbSNP:35991214
6274 6274 c, t dbSNP:748738992
6275 6275 a, g dbSNP:11212587
6286 6286 a, g dbSNP:369349023
6296 6296 a, g dbSNP:145847315
6301 6301 g, t dbSNP:771945366
6303 6303 a, g dbSNP:139770721
6305 6305 c, t dbSNP:769813736
6308 6308 a, c, t dbSNP:532480170
6309 6309 a, g dbSNP:3218670
6315 6315 a, g dbSNP:786204141
6316 6316 c, t dbSNP:3092826
6322 6322 c, t dbSNP:774993357
6329 6329 a, g dbSNP:759753186
6335 6335 a, g dbSNP:767939328
6336 6336 g, t dbSNP:753384717
6353 6353 g, t dbSNP:786203767
6355 6355 c, t dbSNP:369940136
6362 6362 a, g dbSNP:202206540
6368 6368 g, t dbSNP:587779853
6371 6371 a, g dbSNP:758038580
6373 6373 a, c dbSNP:779848229
6384 6384 c, t dbSNP:144761622
6386 6386 c, t dbSNP:587778078
6387 6387 a, c, g dbSNP:376521407
6402 6402 c, t dbSNP:372838622
6403 6403 c, t dbSNP:756309395
6406 6406 c, g dbSNP:786203341
6408 6408 a, c dbSNP:397514577
6415 6415 -, a dbSNP:765592353
6425 6425 c, g dbSNP:767406075
6427 6427 c, g dbSNP:752478345
6434 6434 a, g dbSNP:755973863
6436 6436 -, t dbSNP:786203008
6440 6440 c, t dbSNP:587779854
6441 6441 c, t dbSNP:786204173
6442 6442 c, t dbSNP:569483748
6443 6443 a, g dbSNP:1800060
6444 6444 c, t dbSNP:779082836
6447 6447 a, g dbSNP:587779855
6454 6454 a, g dbSNP:745977589
6458 6458 c, t dbSNP:772608345
6461 6461 g, t dbSNP:730881379
6463 6463 a, t dbSNP:376898203
6465 6465 a, t dbSNP:730881380
6472 6472 c, t dbSNP:747372417
6487 6487 c, t dbSNP:141370828
6501 6501 c, t dbSNP:587780631
6504 6504 a, g dbSNP:587782802
6523 6523 c, g dbSNP:587780632
6525 6525 a, c, t dbSNP:587780633
6529 6529 a, g dbSNP:765763407
6531 6531 a, g dbSNP:773891864
6534 6534 a, g dbSNP:587782114
6538 6538 c, g, t dbSNP:759029705
6541 6541 c, t dbSNP:55756349
6544 6544 c, t dbSNP:755845798
6546 6546 c, g dbSNP:573290117
6550 6550 c, t dbSNP:754020535
6551 6551 a, c, g dbSNP:587780634
6582 6582 a, g dbSNP:730881381
6590 6590 c, t dbSNP:753646931
6602 6602 c, t dbSNP:551408889
6604 6604 a, g dbSNP:370537345
6607 6607 a, g dbSNP:750614487
6608 6608 c, t dbSNP:758446561
6611 6611 -, ct, tt dbSNP:587782554
6619 6619 c, g dbSNP:780299607
6620 6620 a, g dbSNP:752069869
6628 6628 a, c dbSNP:587780635
6631 6631 c, t dbSNP:755507979
6641 6641 -, gaaagtctcaaat dbSNP:786202264
6644 6644 -, a dbSNP:786202323
6645 6645 c, g dbSNP:56815840
6646 6646 a, t dbSNP:748544160
6651 6651 a, c, g, t dbSNP:730881382
6662 6662 a, g dbSNP:753158040
6670 6670 a, g dbSNP:756453090
6673 6673 a, g dbSNP:140423883
6683 6683 g, t dbSNP:150408832
6685 6685 g, t dbSNP:587781789
6690 6690 a, g dbSNP:756626462
6694 6694 c, t dbSNP:138166710
6696 6696 g, t dbSNP:779742477
6706 6706 a, g dbSNP:746514937
6708 6708 a, g dbSNP:768155385
6711 6711 c, t dbSNP:200431631
6712 6712 a, g dbSNP:786203522
6714 6714 g, t dbSNP:748054311
6716 6716 c, t dbSNP:587782327
6724 6724 a, g dbSNP:576254168
6730 6730 a, c, t dbSNP:772850740
6734 6734 c, t dbSNP:143715818
6737 6737 c, t dbSNP:766706861
6745 6745 g, t dbSNP:146243469
6747 6747 g, t dbSNP:199587409
6748 6748 a, g dbSNP:767516615
6750 6750 -, g dbSNP:754518628
6751 6751 g, t dbSNP:138828590
6754 6754 a, g dbSNP:756551824
6758 6758 a, g dbSNP:764713766
6759 6759 c, g dbSNP:374551964
6760 6760 c, t dbSNP:565124064
6762 6762 c, t dbSNP:779611511
6779 6779 a, g dbSNP:587781861
6785 6785 a, g dbSNP:754555043
6791 6791 c, t dbSNP:780946471
6793 6793 c, t dbSNP:786203401
6800 6800 -, ct dbSNP:747057367
6812 6812 g, t dbSNP:730881311
6821 6821 g, t dbSNP:755656958
6838 6838 a, g dbSNP:777515589
6841 6841 -, tc dbSNP:768909644
6851 6851 a, g dbSNP:730881312
6856 6856 -, ttttagtt dbSNP:776876893
6860 6860 a, c dbSNP:749261367
6878 6878 a, g dbSNP:545873723
6879 6879 c, t dbSNP:730881313
6881 6881 -, g dbSNP:587781872
6884 6884 c, g dbSNP:745709682
6886 6886 a, g dbSNP:772173373
6887 6887 c, t dbSNP:564652222
6889 6889 c, t dbSNP:775850434
6897 6897 c, t dbSNP:587781562
6908 6908 c, t dbSNP:760602228
6911 6911 a, g dbSNP:768791795
6918 6918 a, c, t dbSNP:35118109
6919 6919 a, g dbSNP:762334460
6926 6926 c, g dbSNP:587782478
6930 6930 a, g dbSNP:786202583
6931 6931 c, t dbSNP:750763671
6937 6937 a, g dbSNP:763431129
6944 6944 g, t dbSNP:767070729
6947 6947 a, g dbSNP:587781521
6960 6960 c, t dbSNP:752410101
6963 6963 c, g dbSNP:755531586
6966 6966 a, c dbSNP:786203332
6970 6970 c, t dbSNP:563933875
6973 6973 c, t dbSNP:587780637
6984 6984 c, g dbSNP:786202094
6989 6989 c, t dbSNP:757243222
6992 6992 c, g dbSNP:587781674
6997 6997 a, c dbSNP:368596499
7003 7003 c, g, t dbSNP:3218699
7004 7004 a, c dbSNP:45481995
7015 7015 a, g dbSNP:587780638
7028 7028 a, g dbSNP:567060474
7031 7031 a, c, g dbSNP:587779857
7035 7035 g, t dbSNP:753389616
7043 7043 a, g dbSNP:756898113
7054 7054 c, t dbSNP:541718119
7060 7060 c, t dbSNP:750385518
7065 7065 a, g dbSNP:786203052
7068 7068 a, c, g dbSNP:1800061
7079 7079 c, t dbSNP:746815819
7085 7085 c, g dbSNP:755170556
7089 7089 a, g dbSNP:781449586
7093 7093 a, g dbSNP:748221367
7096 7096 a, t dbSNP:200735689
7099 7099 a, g dbSNP:773545588
7105 7105 c, t dbSNP:777164914
7110 7110 -, a dbSNP:773570504
7120 7120 a, g dbSNP:771382172
7127 7127 c, t dbSNP:56009889
7132 7132 a, c dbSNP:759878732
7133 7133 c, t dbSNP:763839047
7136 7136 a, t dbSNP:572301723
7139 7139 a, g dbSNP:776429506
7143 7143 c, t dbSNP:761352263
7150 7150 a, c dbSNP:764859160
7158 7158 a, c dbSNP:750285816
7182 7182 c, t dbSNP:200940211
7183 7183 a, g dbSNP:556778314
7188 7188 a, t dbSNP:761587154
7190 7190 c, t dbSNP:769606850
7191 7191 c, t dbSNP:786202730
7196 7196 c, g dbSNP:148432863
7202 7202 c, t dbSNP:762427092
7203 7203 c, t dbSNP:4988111
7204 7204 -, taca dbSNP:763554569
7204 7204 -, a dbSNP:775539486
7205 7205 -, a dbSNP:587781299
7206 7206 a, c, t dbSNP:150503164
7207 7207 a, g dbSNP:759267807
7208 7208 -, taca dbSNP:786203421
7212 7212 a, c, t dbSNP:3092831
7223 7223 a, c dbSNP:752531255
7244 7244 a, g dbSNP:144497088
7246 7246 a, t dbSNP:146167034
7252 7252 a, g dbSNP:140104789
7270 7270 a, g dbSNP:143489373
7279 7279 a, g dbSNP:753951063
7284 7284 c, t dbSNP:730881314
7286 7286 c, t dbSNP:587779860
7296 7296 a, t dbSNP:757293178
7298 7298 c, g dbSNP:759439613
7304 7304 g, t dbSNP:587781672
7316 7316 a, g dbSNP:767494363
7318 7318 c, t dbSNP:752476328
7321 7321 c, t dbSNP:760534895
7324 7324 c, t dbSNP:3218675
7329 7329 a, c dbSNP:587782225
7330 7330 a, c dbSNP:376159946
7339 7339 c, t dbSNP:373309822
7342 7342 a, c, g dbSNP:376185463
7343 7343 c, g dbSNP:778888033
7348 7348 a, g dbSNP:750569023
7365 7365 a, c dbSNP:786203697
7382 7382 c, t dbSNP:149827260
7389 7389 c, t dbSNP:587779861
7395 7395 c, g dbSNP:370559102
7397 7397 c, g dbSNP:747372355
7399 7399 a, g dbSNP:768906734
7406 7406 a, c dbSNP:777423778
7407 7407 a, g dbSNP:567457294
7411 7411 a, t dbSNP:770658919
7417 7417 c, t dbSNP:373662499
7421 7421 a, g dbSNP:587781323
7422 7422 c, t dbSNP:745440761
7425 7425 a, g dbSNP:771994581
7429 7429 a, g dbSNP:786201881
7431 7431 a, c, t dbSNP:730881315
7432 7432 a, g dbSNP:145747513
7436 7436 c, t dbSNP:193302874
7437 7437 c, t dbSNP:758351633
7443 7443 a, g dbSNP:786203311
7450 7450 a, t dbSNP:761907546
7452 7452 c, g dbSNP:370567994
7456 7456 c, t dbSNP:750513866
7473 7473 a, g dbSNP:758614348
7476 7476 a, g dbSNP:121434221
7479 7479 g, t dbSNP:28904921
7482 7482 g, t dbSNP:148949644
7497 7497 a, g dbSNP:786202856
7502 7502 a, t dbSNP:587781838
7510 7510 a, t dbSNP:752125292
7515 7515 a, g dbSNP:786203394
7516 7516 a, c dbSNP:730881317
7519 7519 a, c dbSNP:763470424
7521 7521 c, t dbSNP:147604227
7522 7522 a, c, t dbSNP:199909913
7524 7524 c, t dbSNP:776266049
7528 7528 c, g dbSNP:751537332
7530 7530 c, t dbSNP:765548443
7535 7535 c, t dbSNP:121434220
7536 7536 a, g dbSNP:587782310
7541 7541 a, c dbSNP:763068664
7544 7544 a, g dbSNP:730881318
7556 7556 g, t dbSNP:766586514
7559 7559 c, g dbSNP:587779862
7562 7562 c, g dbSNP:587779863
7565 7565 c, t dbSNP:755418571
7566 7566 a, g dbSNP:587781361
7567 7567 g, t dbSNP:786201541
7571 7571 c, t dbSNP:147665149
7573 7573 c, g dbSNP:756506590
7578 7578 a, c dbSNP:778482902
7583 7583 c, g, t dbSNP:730881383
7589 7589 a, c, t dbSNP:201314561
7590 7590 a, g dbSNP:768461085
7595 7595 g, t dbSNP:781255503
7598 7598 c, t dbSNP:55801750
7607 7607 a, g dbSNP:769722643
7637 7637 a, g dbSNP:778550056
7657 7657 a, g dbSNP:773516672
7658 7658 a, g dbSNP:587779864
7659 7659 c, t dbSNP:771317764
7664 7664 c, t dbSNP:587779865
7665 7665 a, g dbSNP:773944604
7666 7666 a, g dbSNP:1060793
7671 7671 a, g dbSNP:774281788
7673 7673 -, tc dbSNP:786203734
7674 7674 c, t dbSNP:759728261
7675 7675 c, t dbSNP:767846264
7676 7676 c, t dbSNP:753262623
7683 7683 g, t dbSNP:56399857
7695 7695 a, g dbSNP:764478418
7700 7700 c, t dbSNP:754245181
7702 7702 c, t dbSNP:34393781
7707 7707 c, t dbSNP:779810877
7710 7710 a, g dbSNP:531617441
7713 7713 g, t dbSNP:754517317
7715 7715 a, t dbSNP:780931855
7724 7724 a, g dbSNP:200441272
7725 7725 -, gaga dbSNP:587781905
7729 7729 c, t dbSNP:751234924
7730 7730 a, g dbSNP:754395517
7739 7739 a, t dbSNP:146069748
7741 7741 c, t dbSNP:786201279
7744 7744 a, g dbSNP:786202802
7747 7747 a, c, g dbSNP:752294923
7750 7750 c, g, t dbSNP:777925486
7755 7755 g, t dbSNP:774312539
7760 7760 c, t dbSNP:374876799
7767 7767 g, t dbSNP:587782692
7771 7771 c, t dbSNP:772228129
7774 7774 a, g dbSNP:775621333
7776 7776 g, t dbSNP:747145967
7778 7778 c, g dbSNP:769142993
7799 7799 a, g dbSNP:777125155
7800 7800 c, t dbSNP:587781365
7801 7801 a, g dbSNP:786203764
7803 7803 c, t dbSNP:765654550
7804 7804 a, g dbSNP:587781854
7810 7810 c, t dbSNP:562264493
7826 7826 a, g dbSNP:35203200
7837 7837 c, t dbSNP:767123895
7844 7844 -, tctagaatt dbSNP:587776547
7846 7846 -, tagaatttc dbSNP:587782444
7862 7862 a, c dbSNP:786202174
7871 7871 a, c dbSNP:786203651
7899 7899 c, g dbSNP:775295535
7909 7909 c, t dbSNP:786201637
7910 7910 -, ag dbSNP:759965045
7917 7917 a, g dbSNP:28904920
7918 7918 a, g dbSNP:760215505
7924 7924 c, g dbSNP:763730344
7942 7942 c, t dbSNP:753442840
7947 7947 a, g dbSNP:761790685
7948 7948 a, c dbSNP:199915459
7952 7952 a, g dbSNP:750224234
7953 7953 a, g dbSNP:758128730
7965 7965 a, g dbSNP:587778079
7970 7970 c, t dbSNP:186666661
7980 7980 a, g dbSNP:730881319
7982 7982 c, t dbSNP:786202025
7983 7983 c, g dbSNP:755009196
7985 7985 c, t dbSNP:781215442
7986 7986 a, g dbSNP:587779867
7987 7987 a, g dbSNP:770321620
7993 7993 c, t dbSNP:34838175
7996 7996 a, g dbSNP:587780639
8000 8000 c, t dbSNP:138941496
8001 8001 a, g dbSNP:140263969
8016 8016 a, g dbSNP:150355232
8024 8024 -, ata dbSNP:786203830
8024 8024 a, g dbSNP:376824528
8029 8029 c, t dbSNP:771607956
8033 8033 a, g dbSNP:779400418
8034 8034 c, t dbSNP:369846067
8035 8035 c, t dbSNP:768423205
8043 8043 a, g dbSNP:138048269
8044 8044 a, g dbSNP:761324887
8045 8045 a, g dbSNP:113798048
8047 8047 -, ga dbSNP:730881293
8049 8049 c, t dbSNP:769207177
8051 8051 c, g dbSNP:773159296
8055 8055 c, t dbSNP:762765902
8073 8073 c, g dbSNP:766351395
8075 8075 c, g dbSNP:774118570
8079 8079 c, g dbSNP:759392666
8083 8083 gc, tg dbSNP:267606668
8084 8084 c, g dbSNP:267606669
8088 8088 a, g dbSNP:767670019
8090 8090 a, g dbSNP:587781370
8091 8091 -, ttata dbSNP:587776548
8095 8095 a, g dbSNP:752886000
8098 8098 a, g dbSNP:756181210
8105 8105 g, t dbSNP:587779868
8110 8110 g, t dbSNP:373147078
8112 8112 a, c dbSNP:754002355
8113 8113 c, t dbSNP:757829783
8120 8120 g, t dbSNP:563137460
8121 8121 a, g dbSNP:377349459
8122 8122 g, t dbSNP:758843096
8124 8124 a, g dbSNP:780844407
8127 8127 c, t dbSNP:4988125
8129 8129 c, t dbSNP:769523686
8135 8135 a, g dbSNP:587782487
8137 8137 a, t dbSNP:780247224
8138 8138 c, g dbSNP:587781897
8156 8156 a, g dbSNP:786202219
8159 8159 c, t dbSNP:587781994
8165 8165 a, g dbSNP:747448699
8169 8169 c, t dbSNP:786203621
8175 8175 c, t dbSNP:121434218
8177 8177 a, c dbSNP:755706903
8182 8182 c, t dbSNP:777548685
8191 8191 c, t dbSNP:143972422
8195 8195 a, g dbSNP:773157963
8196 8196 -, ttgt dbSNP:587776550
8196 8196 c, t dbSNP:377648506
8197 8197 c, t dbSNP:774232968
8204 8204 a, g dbSNP:745775382
8205 8205 a, c dbSNP:730881384
8206 8206 -, t dbSNP:587779869
8207 8207 a, g dbSNP:34099398
8210 8210 c, g dbSNP:772097933
8223 8223 a, c dbSNP:763161651
8234 8234 a, g dbSNP:786202859
8238 8238 a, g dbSNP:28942103
8240 8240 a, g dbSNP:766730487
8243 8243 -, aatctggtgactatac dbSNP:587780640
8244 8244 -, atctggtgactataca dbSNP:786202463
8252 8252 a, c dbSNP:730881320
8255 8255 a, t dbSNP:587781344
8260 8260 c, g dbSNP:752121828
8274 8274 a, g dbSNP:759779781
8279 8279 c, t dbSNP:531980488
8290 8290 a, c dbSNP:540266635
8299 8299 c, t dbSNP:756887364
8302 8302 a, g dbSNP:786203569
8306 8306 a, t dbSNP:758588019
8308 8308 a, c, g dbSNP:778601472
8309 8309 a, t dbSNP:757935358
8311 8311 a, g dbSNP:779803253
8317 8317 c, t dbSNP:201689025
8320 8320 c, t dbSNP:786201543
8321 8321 a, g, t dbSNP:587779870
8328 8328 c, g dbSNP:748016261
8329 8329 c, t dbSNP:770138283
8330 8330 a, g dbSNP:587782719
8332 8332 a, c, t dbSNP:587781990
8333 8333 a, g dbSNP:3218680
8337 8337 a, g dbSNP:587782001
8354 8354 g, t dbSNP:730881385
8355 8355 c, t dbSNP:587782652
8357 8357 a, c dbSNP:774334667
8362 8362 c, t dbSNP:371021126
8363 8363 c, t dbSNP:138526014
8364 8364 a, g dbSNP:55982963
8367 8367 a, g dbSNP:745901025
8372 8372 c, g, t dbSNP:587782399
8377 8377 a, g dbSNP:780495319
8381 8381 c, g dbSNP:587782049
8386 8386 c, t dbSNP:367575159
8393 8393 c, t dbSNP:587781967
8395 8395 a, c, t dbSNP:587781946
8396 8396 a, c dbSNP:587782317
8397 8397 a, g dbSNP:762154857
8407 8407 a, g dbSNP:770552705
8413 8413 -, aa dbSNP:587782525
8421 8421 g, t dbSNP:773889320
8425 8425 a, g, t dbSNP:759069006
8436 8436 c, t dbSNP:730881321
8437 8437 a, g dbSNP:150603052
8439 8439 a, c dbSNP:764003317
8440 8440 a, g dbSNP:753600692
8442 8442 c, t dbSNP:786203094
8451 8451 c, g dbSNP:75305387
8454 8454 a, g, t dbSNP:779145081
8456 8456 -, ttaactatctgtacttataag dbSNP:771146489
8459 8459 -, acta dbSNP:786202120
8468 8468 a, g dbSNP:587781414
8469 8469 c, t dbSNP:587779871
8472 8472 -, ataag dbSNP:730881294
8473 8473 c, t dbSNP:758654836
8474 8474 a, t dbSNP:371638537
8477 8477 a, g dbSNP:761625350
8478 8478 g, t dbSNP:201216427
8483 8483 c, g, t dbSNP:764906663
8486 8486 -, ctct dbSNP:775899653
8486 8486 c, g dbSNP:758609900
8488 8488 c, g dbSNP:780325546
8492 8492 c, t dbSNP:751574257
8496 8496 a, g dbSNP:551411717
8500 8500 c, t dbSNP:781690523
8501 8501 a, g