Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

GPR143 G protein-coupled receptor 143 [Homo sapiens (human)]

Gene Symbol GPR143
Entrez Gene ID 4935
Full Name G protein-coupled receptor 143
Synonyms NYS6, OA1
General protein information
Preferred Names
G-protein coupled receptor 143
G-protein coupled receptor 143
ocular albinism type 1 protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]. lac of sum
Disorder MIM:


Disorder Html: Ocular albinism, type I, Nettleship-Falls type, 300500 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu53925 XM_005274541 PREDICTED: Homo sapiens G protein-coupled receptor 143 (GPR143), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu18715 NM_000273 Homo sapiens G protein-coupled receptor 143 (GPR143), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu53925D
Sequence Information ORF Nucleotide Sequence (Length: 1161bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product G-protein coupled receptor 143 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530421153. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)38..1159(+)
Position Chain Variation Link
24 24 c, t dbSNP:762485306
25 25 a, g dbSNP:756913425
26 26 c, t dbSNP:753538602
46 46 c, t dbSNP:545561150
50 50 c, t dbSNP:62635289
60 60 a, c dbSNP:755646295
63 63 g, t dbSNP:769431807
82 82 a, c dbSNP:768055272
84 84 a, c dbSNP:759893573
118 118 a, g dbSNP:751927343
141 141 a, g dbSNP:62635018
153 153 g, t dbSNP:62635019
186 186 c, g dbSNP:747340998
188 188 -, ggccgcc dbSNP:281865176
202 202 -, gggccccgggtcccccgcgacgtccccgc dbSNP:63749126
211 211 -, c dbSNP:62635022
212 212 -, t dbSNP:62635023
229 229 a, g dbSNP:766780297
239 239 g, t dbSNP:763020179
243 243 g, t dbSNP:773515821
248 248 c, t dbSNP:769943337
252 252 -, gcgctgccgctgcctgc dbSNP:62645741
254 254 g, t dbSNP:762032647
260 260 -, g dbSNP:672601353
269 269 a, g dbSNP:62635024
270 270 a, t dbSNP:62635025
287 287 c, g dbSNP:62635026
288 288 a, g dbSNP:62635027
288 288 -, g dbSNP:34876833
293 293 a, g dbSNP:771774135
299 299 c, t dbSNP:144066077
301 301 a, g dbSNP:147369809
303 303 c, t dbSNP:137852298
305 305 a, g dbSNP:766614115
307 307 c, t dbSNP:191663680
308 308 a, g dbSNP:368303218
310 310 a, g dbSNP:374398304
313 313 g, t dbSNP:750922415
318 318 c, g dbSNP:200574016
326 326 a, g dbSNP:764282609
340 340 c, t dbSNP:759324340
345 345 c, t dbSNP:144226732
346 346 a, g dbSNP:770611660
347 347 a, g dbSNP:749150001
347 347 -, g dbSNP:62635028
350 350 a, g dbSNP:772848145
358 358 c, t dbSNP:376337278
360 360 c, t dbSNP:747816338
362 362 a, g dbSNP:780617900
370 370 c, g, t dbSNP:781690423
378 378 c, t dbSNP:747427187
380 380 c, t dbSNP:373467758
383 383 c, t dbSNP:62635030
384 384 c, g dbSNP:62635029
386 386 a, g dbSNP:137938780
390 390 a, g dbSNP:62635031
391 391 a, g dbSNP:750881659
393 393 a, g dbSNP:150915415
396 396 c, t dbSNP:751622915
397 397 a, g dbSNP:281865178
398 398 a, g dbSNP:772688504
400 400 a, g dbSNP:141573793
408 408 a, g dbSNP:62635032
433 433 g, t dbSNP:148358078
434 434 a, c, t dbSNP:137852296
436 436 -, g dbSNP:35528779
439 439 -, g dbSNP:62635034
448 448 c, t dbSNP:754062843
450 450 c, t dbSNP:62635762
452 452 a, g dbSNP:778099606
467 467 c, g dbSNP:756145241
473 473 c, t dbSNP:201830411
474 474 a, g dbSNP:767508273
477 477 a, g dbSNP:58068096
480 480 c, t dbSNP:762815553
481 481 -, agatcgg dbSNP:281865180
481 481 a, c, g dbSNP:186055724
484 484 a, c dbSNP:761647216
492 492 a, g dbSNP:58933950
496 496 c, t dbSNP:755076405
501 501 a, t dbSNP:750341493
507 507 a, g dbSNP:374270221
508 508 c, t dbSNP:761588030
513 513 c, t dbSNP:764180282
518 518 a, g dbSNP:763806428
519 519 c, t dbSNP:780953300
520 520 a, g dbSNP:369582310
533 533 a, g dbSNP:754693386
536 536 -, c dbSNP:747084500
541 541 c, g, t dbSNP:774996374
555 555 a, c dbSNP:62635035
559 559 c, t dbSNP:377171083
569 569 c, t dbSNP:749827169
577 577 c, t dbSNP:185069727
578 578 a, g dbSNP:200870584
587 587 g, t dbSNP:757124449
593 593 c, t dbSNP:199899645
598 598 c, t dbSNP:763910093
607 607 c, t dbSNP:61733440
608 608 a, g dbSNP:752371416
630 630 g, t dbSNP:767317051
637 637 a, g dbSNP:759105932
641 641 c, t dbSNP:773941935
655 655 c, t dbSNP:765992761
656 656 a, g dbSNP:374765532
660 660 c, t dbSNP:761860018
661 661 a, g dbSNP:770176722
667 667 c, t dbSNP:748504125
671 671 c, g dbSNP:370624819
692 692 a, g dbSNP:201596200
693 693 c, t dbSNP:374482621
699 699 c, t dbSNP:369465889
701 701 c, t dbSNP:149605054
713 713 -, g dbSNP:281865182
714 714 a, g dbSNP:775710879
723 723 g, t dbSNP:62635037
725 725 a, g dbSNP:772169542
732 732 a, c, t dbSNP:137852297
734 734 a, g dbSNP:62635038
739 739 c, t dbSNP:138339667
742 742 a, g dbSNP:62635039
760 760 a, g dbSNP:145665834
767 767 a, g dbSNP:62635040
787 787 g, t dbSNP:781094686
788 788 c, g dbSNP:199528158
791 791 -, gttttaattatttg dbSNP:281865183
814 814 a, g dbSNP:367731111
816 816 a, t dbSNP:62635042
821 821 a, g dbSNP:748050915
831 831 a, g dbSNP:781331799
845 845 c, t dbSNP:768545371
849 849 a, g dbSNP:62635043
854 854 a, c dbSNP:746869718
861 861 a, g dbSNP:374879794
873 873 a, g dbSNP:562071375
905 905 -, acc dbSNP:62635044
910 910 a, g dbSNP:745535490
911 911 g, t dbSNP:62635045
913 913 a, g, t dbSNP:62635046
943 943 a, g dbSNP:759639368
950 950 a, c dbSNP:774656143
962 962 c, g dbSNP:766347844
968 968 -, cg dbSNP:62635047
970 970 c, t dbSNP:763168997
971 971 a, g dbSNP:776710609
977 977 a, g dbSNP:768774548
982 982 a, g dbSNP:746959492
987 987 g, t dbSNP:759315924
988 988 c, g dbSNP:771928397
1009 1009 a, g dbSNP:745458128
1042 1042 a, g dbSNP:776550135
1060 1060 a, c dbSNP:756728406
1061 1061 c, t dbSNP:748861491
1068 1068 c, t dbSNP:771056170
1071 1071 c, t dbSNP:756548263
1073 1073 a, g dbSNP:34324958
1082 1082 a, g dbSNP:138809166
1087 1087 c, t dbSNP:755421333
1088 1088 c, g dbSNP:751704023
1092 1092 c, t dbSNP:777471473
1096 1096 c, t dbSNP:763113825
1097 1097 g, t dbSNP:773371296
1112 1112 a, g dbSNP:374388815
1115 1115 a, g dbSNP:150179962
1116 1116 a, g dbSNP:140873054
1132 1132 c, t dbSNP:778572122
1145 1145 a, t dbSNP:745715129
1150 1150 c, g dbSNP:773870720
1162 1162 a, g dbSNP:148614195
1165 1165 g, t dbSNP:745435931
1169 1169 a, g dbSNP:184521924
1193 1193 c, t dbSNP:770661346
1214 1214 a, g dbSNP:111942697
1242 1242 -, tga dbSNP:767161702
1250 1250 g, t dbSNP:780581771
1255 1255 a, g dbSNP:59194172
1262 1262 -, acacag dbSNP:756933345
1263 1263 c, t dbSNP:758630544
1265 1265 c, t dbSNP:192912901

Target ORF information:

RefSeq Version XM_005274541
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens G protein-coupled receptor 143 (GPR143), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu18715D
Sequence Information ORF Nucleotide Sequence (Length: 1215bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product G-protein coupled receptor 143
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC068977.1, Z48804.1 and BU188283.1. This sequence is a reference standard in the RefSeqGene project. On Dec 4, 2009 this sequence version replaced gi:4557806. Summary: This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## CDS uses downstream in-frame AUG :: community standard (PMID:11793467) ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: BC068977.1, Z48804.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142853 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)62..64(+)
Misc Feature(2)149..1360(+)
Misc Feature(3)233..295(+)
Misc Feature(4)383..445(+)
Misc Feature(5)521..583(+)
Misc Feature(6)596..658(+)
Misc Feature(7)722..784(+)
Misc Feature(8)809..862(+)
Misc Feature(9)812..841(+)
Misc Feature(10)893..955(+)
Misc Feature(11)1025..1087(+)
Misc Feature(12)1133..1138(+)
Exon (1)1..398
Gene Synonym:
Exon (2)399..508
Gene Synonym:
Exon (3)509..603
Gene Synonym:
Exon (4)604..696
Gene Synonym:
Exon (5)697..806
Gene Synonym:
Exon (6)807..915
Gene Synonym:
Exon (7)916..1033
Gene Synonym:
Exon (8)1034..1268
Gene Synonym:
Exon (9)1269..1696
Gene Synonym:
Position Chain Variation Link
41 41 c, g dbSNP:770000435
46 46 -, a dbSNP:761800156
57 57 a, g dbSNP:3810741
70 70 c, t dbSNP:774253615
99 99 c, t dbSNP:780160800
105 105 g, t dbSNP:771969783
108 108 a, g dbSNP:180998522
135 135 c, t dbSNP:762485306
136 136 a, g dbSNP:756913425
137 137 c, t dbSNP:753538602
157 157 c, t dbSNP:545561150
161 161 c, t dbSNP:62635289
171 171 a, c dbSNP:755646295
174 174 g, t dbSNP:769431807
193 193 a, c dbSNP:768055272
195 195 a, c dbSNP:759893573
229 229 a, g dbSNP:751927343
252 252 a, g dbSNP:62635018
264 264 g, t dbSNP:62635019
297 297 c, g dbSNP:747340998
299 299 -, ggccgcc dbSNP:281865176
313 313 -, gggccccgggtcccccgcgacgtccccgc dbSNP:63749126
322 322 -, c dbSNP:62635022
323 323 -, t dbSNP:62635023
340 340 a, g dbSNP:766780297
350 350 g, t dbSNP:763020179
354 354 g, t dbSNP:773515821
359 359 c, t dbSNP:769943337
363 363 -, gcgctgccgctgcctgc dbSNP:62645741
365 365 g, t dbSNP:762032647
371 371 -, g dbSNP:672601353
380 380 a, g dbSNP:62635024
381 381 a, t dbSNP:62635025
398 398 c, g dbSNP:62635026
399 399 a, g dbSNP:62635027
399 399 -, g dbSNP:34876833
404 404 a, g dbSNP:771774135
410 410 c, t dbSNP:144066077
412 412 a, g dbSNP:147369809
414 414 c, t dbSNP:137852298
416 416 a, g dbSNP:766614115
418 418 c, t dbSNP:191663680
419 419 a, g dbSNP:368303218
421 421 a, g dbSNP:374398304
424 424 g, t dbSNP:750922415
429 429 c, g dbSNP:200574016
437 437 a, g dbSNP:764282609
451 451 c, t dbSNP:759324340
456 456 c, t dbSNP:144226732
457 457 a, g dbSNP:770611660
458 458 a, g dbSNP:749150001
458 458 -, g dbSNP:62635028
461 461 a, g dbSNP:772848145
469 469 c, t dbSNP:376337278
471 471 c, t dbSNP:747816338
473 473 a, g dbSNP:780617900
481 481 c, g, t dbSNP:781690423
489 489 c, t dbSNP:747427187
491 491 c, t dbSNP:373467758
494 494 c, t dbSNP:62635030
495 495 c, g dbSNP:62635029
497 497 a, g dbSNP:137938780
501 501 a, g dbSNP:62635031
502 502 a, g dbSNP:750881659
504 504 a, g dbSNP:150915415
507 507 c, t dbSNP:751622915
508 508 a, g dbSNP:281865178
509 509 a, g dbSNP:772688504
511 511 a, g dbSNP:141573793
519 519 a, g dbSNP:62635032
544 544 g, t dbSNP:148358078
545 545 a, c, t dbSNP:137852296
547 547 -, g dbSNP:35528779
550 550 -, g dbSNP:62635034
559 559 c, t dbSNP:754062843
561 561 c, t dbSNP:62635762
563 563 a, g dbSNP:778099606
578 578 c, g dbSNP:756145241
584 584 c, t dbSNP:201830411
585 585 a, g dbSNP:767508273
588 588 a, g dbSNP:58068096
591 591 c, t dbSNP:762815553
592 592 -, agatcgg dbSNP:281865180
592 592 a, c, g dbSNP:186055724
595 595 a, c dbSNP:761647216
603 603 a, g dbSNP:58933950
607 607 c, t dbSNP:755076405
612 612 a, t dbSNP:750341493
618 618 a, g dbSNP:374270221
619 619 c, t dbSNP:761588030
624 624 c, t dbSNP:764180282
629 629 a, g dbSNP:763806428
630 630 c, t dbSNP:780953300
631 631 a, g dbSNP:369582310
644 644 a, g dbSNP:754693386
647 647 -, c dbSNP:747084500
652 652 c, g, t dbSNP:774996374
666 666 a, c dbSNP:62635035
670 670 c, t dbSNP:377171083
680 680 c, t dbSNP:749827169
688 688 c, t dbSNP:185069727
689 689 a, g dbSNP:200870584
698 698 g, t dbSNP:757124449
704 704 c, t dbSNP:199899645
709 709 c, t dbSNP:763910093
718 718 c, t dbSNP:61733440
719 719 a, g dbSNP:752371416
741 741 g, t dbSNP:767317051
748 748 a, g dbSNP:759105932
752 752 c, t dbSNP:773941935
766 766 c, t dbSNP:765992761
767 767 a, g dbSNP:374765532
771 771 c, t dbSNP:761860018
772 772 a, g dbSNP:770176722
778 778 c, t dbSNP:748504125
782 782 c, g dbSNP:370624819
803 803 a, g dbSNP:201596200
804 804 c, t dbSNP:374482621
810 810 c, t dbSNP:369465889
812 812 c, t dbSNP:149605054
824 824 -, g dbSNP:281865182
825 825 a, g dbSNP:775710879
834 834 g, t dbSNP:62635037
836 836 a, g dbSNP:772169542
843 843 a, c, t dbSNP:137852297
845 845 a, g dbSNP:62635038
850 850 c, t dbSNP:138339667
853 853 a, g dbSNP:62635039
871 871 a, g dbSNP:145665834
878 878 a, g dbSNP:62635040
898 898 g, t dbSNP:781094686
899 899 c, g dbSNP:199528158
902 902 -, gttttaattatttg dbSNP:281865183
925 925 a, g dbSNP:367731111
927 927 a, t dbSNP:62635042
932 932 a, g dbSNP:748050915
942 942 a, g dbSNP:781331799
956 956 c, t dbSNP:768545371
960 960 a, g dbSNP:62635043
965 965 a, c dbSNP:746869718
972 972 a, g dbSNP:374879794
984 984 a, g dbSNP:562071375
1016 1016 -, acc dbSNP:62635044
1021 1021 a, g dbSNP:745535490
1022 1022 g, t dbSNP:62635045
1024 1024 a, g, t dbSNP:62635046
1054 1054 a, g dbSNP:759639368
1061 1061 a, c dbSNP:774656143
1073 1073 c, g dbSNP:766347844
1079 1079 -, cg dbSNP:62635047
1081 1081 c, t dbSNP:763168997
1082 1082 a, g dbSNP:776710609
1088 1088 a, g dbSNP:768774548
1093 1093 a, g dbSNP:746959492
1098 1098 g, t dbSNP:759315924
1099 1099 c, g dbSNP:771928397
1120 1120 a, g dbSNP:745458128
1153 1153 a, g dbSNP:776550135
1171 1171 a, c dbSNP:756728406
1172 1172 c, t dbSNP:748861491
1179 1179 c, t dbSNP:771056170
1182 1182 c, t dbSNP:756548263
1184 1184 a, g dbSNP:34324958
1193 1193 a, g dbSNP:138809166
1198 1198 c, t dbSNP:755421333
1199 1199 c, g dbSNP:751704023
1203 1203 c, t dbSNP:777471473
1207 1207 c, t dbSNP:763113825
1208 1208 g, t dbSNP:773371296
1223 1223 a, g dbSNP:374388815
1226 1226 a, g dbSNP:150179962
1227 1227 a, g dbSNP:140873054
1243 1243 c, t dbSNP:778572122
1256 1256 a, t dbSNP:745715129
1261 1261 c, g dbSNP:773870720
1281 1281 a, g dbSNP:150992924
1283 1283 a, g dbSNP:752544660
1284 1284 a, c dbSNP:749808145
1287 1287 c, t dbSNP:370069153
1303 1303 a, c dbSNP:377013842
1304 1304 a, g dbSNP:142625084
1305 1305 a, g dbSNP:770745735
1311 1311 a, c dbSNP:762544799
1323 1323 a, t dbSNP:772902759
1326 1326 a, c dbSNP:769263747
1330 1330 c, t dbSNP:766142830
1334 1334 c, t dbSNP:781539839
1341 1341 c, t dbSNP:148263276
1350 1350 a, g dbSNP:756584912
1351 1351 g, t dbSNP:780522481
1352 1352 a, g dbSNP:375135554
1373 1373 a, g dbSNP:758851581
1374 1374 c, t dbSNP:370743553
1380 1380 -, g dbSNP:751266431
1381 1381 c, t dbSNP:779314543
1407 1407 a, c dbSNP:757278922
1413 1413 c, g dbSNP:377633602
1424 1424 a, g dbSNP:145923021
1469 1469 a, g dbSNP:750551632
1478 1478 a, g dbSNP:781084845
1494 1494 c, g dbSNP:1859002
1497 1497 c, t dbSNP:3044
1512 1512 a, g dbSNP:749941339
1517 1517 g, t dbSNP:764783159
1538 1538 a, g dbSNP:73484540
1545 1545 a, c dbSNP:762895639
1551 1551 c, t dbSNP:761181876
1565 1565 a, g dbSNP:776097825
1578 1578 a, g dbSNP:182842357
1590 1590 a, g dbSNP:759911546
1593 1593 g, t dbSNP:73484539
1629 1629 a, g dbSNP:759520024
1630 1630 c, t dbSNP:749478926
1638 1638 a, g dbSNP:192175598
1641 1641 -, g dbSNP:202208682
1695 1695 a, g dbSNP:141287135

Target ORF information:

RefSeq Version NM_000273
Organism Homo sapiens (human)
Definition Homo sapiens G protein-coupled receptor 143 (GPR143), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.