Email to GenScript

PAH phenylalanine hydroxylase [Homo sapiens (human)]

Gene Symbol PAH
Entrez Gene ID 5053
Full Name phenylalanine hydroxylase
Synonyms PH, PKU, PKU1
General protein information
Preferred Names
phenylalanine 4-monooxygenase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Phenylketonuria, 261600 (3); [Hyperphenylalaninemia, non-PKU mild],

The following PAH gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PAH gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59464 XM_011538422 PREDICTED: Homo sapiens phenylalanine hydroxylase (PAH), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu25787 NM_000277 Homo sapiens phenylalanine hydroxylase (PAH), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu59464
Accession Version XM_011538422.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1302bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product phenylalanine-4-hydroxylase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)173..1414(+)
Misc Feature(2)176..445(+)
Misc Feature(3)176..196(+)
Misc Feature(4)251..322(+)
Misc Feature(5)470..1330(+)
Misc Feature(6)527..1108(+)
Misc Feature(7)854..1033(+)
Misc Feature(8)968..1048(+)
Position Chain Variation Link
12 12 c, t dbSNP:767107144
35 35 c, t dbSNP:7954004
45 45 a, c dbSNP:2280615
47 47 a, g dbSNP:542307750
66 66 c, g dbSNP:772360697
68 68 -, g dbSNP:763402355
71 71 c, t dbSNP:746106548
77 77 g, t dbSNP:779160321
88 88 c, g dbSNP:771176183
94 94 a, g dbSNP:749365596
106 106 a, g dbSNP:777884173
107 107 c, g dbSNP:573703749
110 110 g, t dbSNP:185069853
115 115 c, t dbSNP:62507266
116 116 a, g, t dbSNP:62514891
117 117 c, g, t dbSNP:62508575
118 118 a, g dbSNP:62514893
121 121 c, t dbSNP:750239990
126 126 c, t dbSNP:765022724
127 127 a, g dbSNP:536605300
134 134 c, g dbSNP:753312947
137 137 a, g dbSNP:763623193
139 139 c, t dbSNP:761094025
145 145 c, g dbSNP:1801145
148 148 a, g dbSNP:772557951
157 157 a, g dbSNP:759956741
161 161 c, t dbSNP:62642946
162 162 -, ct dbSNP:62642906
166 166 c, g, t dbSNP:150366430
170 170 c, g dbSNP:771104344
173 173 c, t dbSNP:199475585
174 174 a, t dbSNP:199475662
175 175 c, g dbSNP:199475688
178 178 a, c dbSNP:753466976
180 180 a, c dbSNP:199565868
186 186 a, g, t dbSNP:539994406
220 220 a, c dbSNP:768048739
222 222 c, t dbSNP:760011862
223 223 a, g dbSNP:17852374
226 226 -, g dbSNP:199475674
230 230 -, ttc dbSNP:199475565
231 231 -, tct dbSNP:762462102
234 234 c, t dbSNP:62642938
236 236 c, t dbSNP:62642928
237 237 c, t dbSNP:62642916
240 240 a, g, t dbSNP:62635346
244 244 a, g dbSNP:763089464
245 245 -, gaa dbSNP:199475640
246 246 -, aag dbSNP:199475628
250 250 g, t dbSNP:773425620
251 251 a, g dbSNP:74603784
252 252 -, g dbSNP:199475591
255 255 a, c, t dbSNP:118203925
257 257 c, t dbSNP:547150887
258 258 c, t dbSNP:5030841
263 263 a, g dbSNP:776829633
266 266 a, g dbSNP:772159852
270 270 c, t dbSNP:199475630
270 270 -, t dbSNP:281865165
272 272 a, c, t dbSNP:199475619
273 273 a, g dbSNP:118092776
276 276 c, t dbSNP:199475677
277 277 a, g dbSNP:143358918
279 279 c, t dbSNP:281865438
280 280 g, t dbSNP:199475598
280 280 -, t dbSNP:199475566
283 283 a, g, t dbSNP:199475567
284 284 -, gagaatgatgtaaacctgacccacattgaatctagaccttctcgttta aagaaagatgagtatgaatttttcacccatttggataaacgtagcctgcctgctctga caaacatcatcaagatcttgaggcatgacattggtgccactgtccatgagctttcacg agataagaagaaagacacag dbSNP:199475570
284 284 -, gag dbSNP:199475665
284 284 a, g, t dbSNP:140945592
290 290 g, t dbSNP:199475635
291 291 a, g dbSNP:199475672
292 292 c, t dbSNP:768292157
296 296 a, g dbSNP:199475651
298 298 a, c, g dbSNP:199475634
301 301 a, g dbSNP:779383205
302 302 a, c dbSNP:199475568
305 305 a, c dbSNP:199475569
305 305 -, c dbSNP:672601294
308 308 a, g dbSNP:199475643
311 311 g, t dbSNP:281865454
313 313 a, g dbSNP:117308669
314 314 c, t dbSNP:5030842
317 317 a, g dbSNP:199475639
319 319 a, t dbSNP:76394784
320 320 c, t dbSNP:199475678
321 321 -, ctt dbSNP:199475687
322 322 -, ttc dbSNP:199475620
322 322 g, t dbSNP:550724569
323 323 -, tct dbSNP:62642094
323 323 c, t dbSNP:63048261
325 325 -, ccttct dbSNP:281865431
327 327 a, g dbSNP:62508695
328 328 c, t dbSNP:757727922
329 329 g, t dbSNP:760782775
337 337 a, g dbSNP:374797155
338 338 a, g dbSNP:767453024
341 341 c, g dbSNP:762949770
342 342 a, c, g dbSNP:62507347
346 346 c, g, t dbSNP:62507332
347 347 a, g dbSNP:62507326
356 356 -, acccatttggataaac dbSNP:63749677
356 356 a, c dbSNP:62509017
359 359 a, c dbSNP:769705809
365 365 g, t dbSNP:62514902
370 370 a, g dbSNP:776378866
371 371 c, t dbSNP:768320548
372 372 a, g dbSNP:746603180
375 375 a, g dbSNP:368152528
376 376 a, c dbSNP:62516151
379 379 -, c dbSNP:62506950
380 380 c, t dbSNP:62507270
381 381 -, c dbSNP:62517202
390 390 c, t dbSNP:62514903
395 395 a, g dbSNP:528078207
396 396 g, t dbSNP:62508677
398 398 -, atc dbSNP:62514904
398 398 a, t dbSNP:62508682
399 399 -, tca dbSNP:62508727
399 399 ca, tc dbSNP:281865432
404 404 a, c dbSNP:142516271
408 408 c, t dbSNP:62517167
411 411 c, g dbSNP:778230838
414 414 a, g dbSNP:148393887
420 420 c, t dbSNP:62508591
422 422 g, t dbSNP:752792040
425 425 -, gccactgtc dbSNP:398123291
426 426 a, c dbSNP:62642929
435 435 a, g dbSNP:542645236
444 444 c, t dbSNP:199475627
445 445 a, g dbSNP:573940903
446 446 c, t dbSNP:76296470
459 459 -, aaga dbSNP:199475648
465 465 -, c dbSNP:281865428
465 465 c, t dbSNP:281865439
467 467 a, g dbSNP:776442422
470 470 c, t dbSNP:398123292
471 471 c, g, t dbSNP:374999809
472 472 -, c dbSNP:794727619
473 473 c, t dbSNP:775327122
474 474 a, g dbSNP:199475586
480 480 a, c dbSNP:199475622
483 483 g, t dbSNP:199475681
486 486 c, t dbSNP:199475571
496 496 c, g dbSNP:767127989
500 500 g, t dbSNP:199475606
501 501 a, g, t dbSNP:199475623
513 513 -, atca dbSNP:199475605
514 514 c, t dbSNP:145692106
515 515 c, t dbSNP:199475680
526 526 c, t dbSNP:1801146
531 531 a, g dbSNP:375384973
534 534 a, c, t dbSNP:372657268
535 535 a, g dbSNP:200366386
539 539 c, t dbSNP:375364629
543 543 a, g dbSNP:199475572
549 549 a, t dbSNP:140175796
551 551 c, t dbSNP:199475599
553 553 c, t dbSNP:191142120
554 554 c, t dbSNP:199475624
555 555 c, t dbSNP:199475694
557 557 -, ggttttaaagatcctgtgtaccgtgcaagacggaagcagtttgctgac attgcctacaactaccgcca dbSNP:199475649
557 557 a, g dbSNP:80297647
562 562 c, t dbSNP:770990005
565 565 a, g dbSNP:749317892
566 566 c, g dbSNP:199475597
567 567 a, g dbSNP:199475625
571 571 c, t dbSNP:377244118
575 575 a, c, t dbSNP:199475587
578 578 c, t dbSNP:539743701
579 579 a, c, g dbSNP:199475663
581 581 c, g dbSNP:199475686
582 582 c, t dbSNP:570748767
585 585 a, g, t dbSNP:199475611
586 586 a, c dbSNP:199475612
587 587 c, t dbSNP:75166491
588 588 a, c, g dbSNP:5030843
594 594 a, c dbSNP:199475601
597 597 c, t dbSNP:79635844
599 599 g, t dbSNP:547566250
605 605 a, g dbSNP:199475647
606 606 c, t dbSNP:199475595
608 608 a, c, g dbSNP:199475626
612 612 a, g dbSNP:753254031
613 613 a, c dbSNP:199475645
615 615 a, g, t dbSNP:77554925
617 617 c, t dbSNP:199475646
618 618 -, a dbSNP:199475661
619 619 a, c dbSNP:281865455
620 620 -, cccccc dbSNP:144835074
620 620 c, t dbSNP:281865440
621 621 a, g dbSNP:199475679
623 623 c, g dbSNP:199475655
624 624 a, g dbSNP:199475573
625 625 a, g, t dbSNP:199475652
626 626 a, g, t dbSNP:199475613
627 627 c, g dbSNP:199475596
628 628 g, t dbSNP:143211522
629 629 c, t dbSNP:199475588
631 631 g, t dbSNP:192592111
632 632 a, c dbSNP:199475574
635 635 a, g dbSNP:199475632
636 636 a, c, t dbSNP:138809906
638 638 c, g dbSNP:199475604
641 641 c, t dbSNP:199475575
642 642 a, c, g, t dbSNP:74486803
644 644 a, c, g dbSNP:199475602
648 648 a, g, t dbSNP:77958223
650 650 a, c, t dbSNP:199475671
654 654 g, t dbSNP:745723155
660 660 a, g dbSNP:199475617
662 662 ga, tt dbSNP:281865433
662 662 a, c, g dbSNP:199475664
663 663 a, g dbSNP:17852373
671 671 -, a dbSNP:62507328
673 673 -, at dbSNP:62517207
674 674 c, t dbSNP:62507272
676 676 a, c, g dbSNP:62507336
678 678 a, c, g dbSNP:199475689
678 678 -, g dbSNP:62507260
679 679 c, t dbSNP:777274367
683 683 a, g dbSNP:281865441
684 684 c, t dbSNP:62514919
694 694 c, t dbSNP:752202371
695 695 -, ct dbSNP:62508587
696 696 c, t dbSNP:5030844
701 701 -, tccttgtataaaacccatgcttg dbSNP:62895363
703 703 c, t dbSNP:755420480
705 705 -, tgtataaaacccatgcttgctat dbSNP:63083561
706 706 c, g dbSNP:281865442
707 707 -, tataaaacccatgcttgctatg dbSNP:199475697
708 708 -, ataaaacccatgcttgctatga dbSNP:63749676
713 713 -, a dbSNP:62508643
716 716 c, t dbSNP:62517205
717 717 a, g dbSNP:62517180
718 718 c, t dbSNP:751977644
723 723 a, g dbSNP:62507271
724 724 c, g, t dbSNP:1801147
726 726 a, g dbSNP:62514927
727 727 c, g, t dbSNP:62514928
728 728 a, g dbSNP:63083560
729 729 a, c dbSNP:62508593
730 730 a, g dbSNP:765552494
731 731 g, t dbSNP:62517170
732 732 a, g dbSNP:62508728
733 733 a, c, g dbSNP:62517201
734 734 a, g dbSNP:62508572
735 735 a, g dbSNP:62508721
746 746 a, c dbSNP:62514931
747 747 -, c dbSNP:62514929
747 747 c, t dbSNP:281865443
750 750 c, t dbSNP:62517198
753 753 c, t dbSNP:62516109
757 757 a, g dbSNP:373782868
763 763 c, g dbSNP:62509013
764 764 c, g, t dbSNP:62508718
765 765 a, g dbSNP:62508617
768 768 g, t dbSNP:62514933
769 769 c, t dbSNP:777465976
777 777 a, g dbSNP:62514934
778 778 -, ag dbSNP:62514936
779 779 -, ga dbSNP:759154440
780 780 a, g, t dbSNP:62507319
783 783 a, g, t dbSNP:201245932
786 786 c, t dbSNP:62507323
787 787 g, t dbSNP:199475576
788 788 a, c, g dbSNP:199475589
789 789 c, g, t dbSNP:62517204
791 791 c, t dbSNP:62508696
793 793 c, g, t dbSNP:62508615
796 796 a, g dbSNP:182135145
797 797 a, g dbSNP:281865444
803 803 a, g dbSNP:62516152
804 804 g, t dbSNP:199475673
806 806 c, t dbSNP:5030845
807 807 c, t dbSNP:62508577
809 809 c, t dbSNP:62507348
811 811 a, c, g dbSNP:1126758
814 814 a, c dbSNP:62517208
819 819 a, c dbSNP:199475656
824 824 c, t dbSNP:372723640
827 827 a, c dbSNP:199475577
830 830 a, g dbSNP:62517178
831 831 a, c, g, t dbSNP:62507283
833 833 g, t dbSNP:62507337
834 834 c, t dbSNP:62508594
836 836 c, t dbSNP:76687508
837 837 a, g, t dbSNP:62508730
837 837 -, g dbSNP:199475657
839 839 c, t dbSNP:199475578
842 842 c, t dbSNP:5030846
843 843 a, g, t dbSNP:62508588
846 846 c, t dbSNP:118203923
848 848 a, c, g dbSNP:62508694
849 849 a, c, t dbSNP:76212747
850 850 a, g dbSNP:1042503
852 852 a, c, t dbSNP:199475610
852 852 -, c dbSNP:199475666
854 854 a, c, g dbSNP:62508731
855 855 a, g, t dbSNP:199475579
858 858 c, g, t dbSNP:62507340
860 860 c, t dbSNP:74503222
861 861 a, t dbSNP:62507338
867 867 c, t dbSNP:369646949
869 869 c, g, t dbSNP:5030847
870 870 a, g dbSNP:62644503
872 872 a, g dbSNP:765533320
875 875 a, t dbSNP:62642909
878 878 g, t dbSNP:62642931
879 879 c, t dbSNP:62642930
884 884 a, g, t dbSNP:5030848
885 885 a, g, t dbSNP:62642908
886 886 c, t dbSNP:544995045
887 887 c, t dbSNP:75065106
890 890 a, g dbSNP:62642932
891 891 c, t dbSNP:118203921
896 896 c, g, t dbSNP:5030850
897 897 a, c, g dbSNP:5030849
900 900 g, t dbSNP:281865445
901 901 c, t dbSNP:776860902
904 904 c, g dbSNP:62642944
905 905 c, t dbSNP:749668037
906 906 a, t dbSNP:199475580
908 908 g, t dbSNP:62517181
909 909 a, g dbSNP:62507335
911 911 a, c, g dbSNP:62508752
912 912 a, c dbSNP:62508753
914 914 c, g dbSNP:199475676
915 915 a, t dbSNP:778154939
916 916 c, g, t dbSNP:199475675
917 917 c, t dbSNP:62507263
919 919 c, t dbSNP:748337823
920 920 a, c, g dbSNP:62508692
921 921 a, t dbSNP:199475644
921 921 -, t dbSNP:62508687
923 923 a, g dbSNP:199475690
924 924 a, g dbSNP:62514950
925 925 -, acatg dbSNP:62507286
925 925 a, t dbSNP:62514951
926 926 c, t dbSNP:62517164
927 927 a, g, t dbSNP:199475692
929 929 g, t dbSNP:62514952
933 933 c, t dbSNP:62514953
935 935 a, g dbSNP:142934616
937 937 -, gcccatgtata dbSNP:199475581
938 938 c, t dbSNP:62508691
939 939 c, g, t dbSNP:62508715
941 941 a, g, t dbSNP:62516149
942 942 a, c, g, t dbSNP:62508722
943 943 g, t dbSNP:62514954
944 944 g, t dbSNP:78655458
945 945 a, g dbSNP:62516155
946 946 c, t dbSNP:773720549
947 947 a, g dbSNP:62516156
948 948 a, c, t dbSNP:62507262
952 952 -, c dbSNP:281865429
952 952 c, t dbSNP:138355741
953 953 a, c, g dbSNP:62508698
954 954 -, t dbSNP:199475653
954 954 a, g dbSNP:62508734
956 956 c, g, t dbSNP:199475654
957 957 c, t dbSNP:5030851
958 958 c, t dbSNP:772249197
959 959 a, g dbSNP:199475582
960 960 a, g dbSNP:199475660
962 962 a, t dbSNP:62517168
963 963 a, t dbSNP:62508693
965 965 c, t dbSNP:199475682
968 968 c, t dbSNP:199475636
971 971 a, g dbSNP:62508739
973 973 a, g dbSNP:556021587
974 974 c, g dbSNP:781096854
976 976 a, g dbSNP:754686336
979 979 c, g dbSNP:62507327
980 980 c, g dbSNP:199475693
984 984 a, g, t dbSNP:62642919
985 985 c, t dbSNP:751203209
999 999 c, g dbSNP:62642910
1001 1001 a, g dbSNP:765934604
1002 1002 a, g dbSNP:281865446
1004 1004 c, t dbSNP:62642945
1005 1005 a, g dbSNP:62642939
1009 1009 c, t dbSNP:765823928
1010 1010 -, ttt dbSNP:62507267
1011 1011 g, t dbSNP:62642933
1013 1013 g, t dbSNP:5030853
1014 1014 c, t dbSNP:199475609
1019 1019 -, t dbSNP:62642920
1022 1022 c, g, t dbSNP:199475608
1026 1026 a, g dbSNP:199475592
1027 1027 a, g dbSNP:199475583
1032 1032 a, g dbSNP:62508578
1033 1033 c, g dbSNP:62508573
1035 1035 a, g dbSNP:62514959
1038 1038 a, t dbSNP:535752872
1039 1039 g, t dbSNP:199475642
1040 1040 a, g dbSNP:199475616
1044 1044 c, t dbSNP:748816402
1048 1048 c, g dbSNP:62508580
1049 1049 c, t dbSNP:62517179
1050 1050 g, t dbSNP:199475614
1053 1053 a, g dbSNP:62508589
1055 1055 c, t dbSNP:62516060
1057 1057 c, t dbSNP:777221457
1059 1059 c, g dbSNP:62517174
1060 1060 c, t dbSNP:140243918
1062 1062 a, c dbSNP:281865434
1064 1064 c, g, t dbSNP:62516061
1065 1065 a, g dbSNP:62508735
1068 1068 a, g, t dbSNP:62517206
1070 1070 g, t dbSNP:62516150
1077 1077 c, t dbSNP:62508720
1079 1079 a, t dbSNP:62517200
1080 1080 a, c, g dbSNP:62516153
1081 1081 a, g dbSNP:550037937
1082 1082 a, c, g dbSNP:62507282
1082 1082 -, g dbSNP:63581460
1084 1084 a, c dbSNP:766756246
1085 1085 g, t dbSNP:62508651
1086 1086 a, g, t dbSNP:62507265
1088 1088 a, c, g dbSNP:62508679
1089 1089 a, g, t dbSNP:62508582
1090 1090 c, t dbSNP:758646909
1091 1091 a, g, t dbSNP:62516062
1094 1094 a, c, g dbSNP:62508688
1096 1096 -, g dbSNP:62516063
1097 1097 c, t dbSNP:62516154
1100 1100 c, g dbSNP:62516092
1101 1101 -, tgtcatccttt dbSNP:199475600
1103 1103 c, g, t dbSNP:62508646
1104 1104 a, c, t dbSNP:62507279
1105 1105 -, gtca dbSNP:62516157
1105 1105 a, t dbSNP:775356291
1106 1106 a, t dbSNP:62517183
1107 1107 a, c dbSNP:62508628
1112 1112 c, g, t dbSNP:62508686
1113 1113 -, g dbSNP:62516094
1114 1114 -, t dbSNP:62507350
1121 1121 c, t dbSNP:199475633
1124 1124 -, ta dbSNP:199475490
1124 1124 c, t dbSNP:62507320
1127 1127 g, t dbSNP:62508595
1129 1129 c, t dbSNP:766107583
1132 1132 a, t dbSNP:376480977
1134 1134 c, g dbSNP:5030854
1139 1139 a, t dbSNP:772918939
1142 1142 a, c, t dbSNP:62507329
1145 1145 -, aa dbSNP:199475667
1147 1147 -, g dbSNP:5030654
1147 1147 g, t dbSNP:63329263
1148 1148 -, cttctccccctggag dbSNP:62516097
1148 1148 -, ctt dbSNP:62516096
1150 1150 -, tctccccctggagct dbSNP:786200862
1150 1150 -, tct dbSNP:786200861
1153 1153 c, g dbSNP:747661840
1155 1155 a, c dbSNP:62516098
1156 1156 -, c dbSNP:62506951
1156 1156 a, c dbSNP:776159017
1157 1157 -, c dbSNP:62517203
1157 1157 -, c dbSNP:62508620
1158 1158 c, t dbSNP:62508574
1159 1159 a, g dbSNP:62508648
1170 1170 a, g dbSNP:62507268
1172 1172 a, t dbSNP:62517163
1175 1175 -, gc dbSNP:62516099
1175 1175 a, g dbSNP:62508717
1178 1178 a, g dbSNP:769076484
1181 1181 c, g dbSNP:184148104
1185 1185 -, a dbSNP:62642921
1187 1187 -, t dbSNP:62642941
1188 1188 a, g dbSNP:62642942
1190 1190 a, t dbSNP:62642911
1191 1191 c, t dbSNP:780691974
1193 1193 c, g dbSNP:772630527
1194 1194 c, t dbSNP:746203167
1195 1195 c, g dbSNP:779053558
1197 1197 c, t dbSNP:62642937
1198 1198 a, g, t dbSNP:373763334
1199 1199 a, g dbSNP:267603271
1210 1210 c, g dbSNP:281865458
1213 1213 a, c, g dbSNP:772897
1214 1214 g, t dbSNP:199475691
1215 1215 a, g dbSNP:62516141
1217 1217 c, t dbSNP:62517194
1219 1219 c, t dbSNP:149595475
1221 1221 -, tg dbSNP:199475629
1221 1221 c, t dbSNP:281865435
1224 1224 -, c dbSNP:62506949
1227 1227 a, g dbSNP:5030856
1229 1229 a, g dbSNP:281865453
1232 1232 a, t dbSNP:180819807
1233 1233 c, t dbSNP:199475695
1235 1235 a, c dbSNP:761487922
1238 1238 c, g, t dbSNP:62516142
1239 1239 a, c dbSNP:62516102
1241 1241 c, g dbSNP:62516103
1242 1242 a, c, g dbSNP:62508736
1243 1243 a, c dbSNP:760256025
1245 1245 a, g dbSNP:776178623
1246 1246 a, g dbSNP:772683682
1252 1252 a, g dbSNP:199475638
1254 1254 -, taag dbSNP:199475603
1254 1254 c, t dbSNP:281865436
1255 1255 a, t dbSNP:199475584
1256 1256 -, a dbSNP:199475590
1256 1256 a, c dbSNP:199475593
1257 1257 a, c, g dbSNP:199475658
1262 1262 c, t dbSNP:62508725
1266 1266 c, t dbSNP:5030857
1273 1273 a, g dbSNP:771382634
1274 1274 a, g dbSNP:749613899
1275 1275 c, t dbSNP:62644469
1276 1276 a, g dbSNP:773526027
1277 1277 c, t dbSNP:62644465
1278 1278 -, c dbSNP:62644489
1278 1278 c, t dbSNP:62644473
1280 1280 c, t dbSNP:5030858
1281 1281 a, g dbSNP:5030859
1287 1287 c, g, t dbSNP:62644475
1290 1290 a, c dbSNP:62644477
1295 1295 a, c, t dbSNP:62644467
1296 1296 a, c, g dbSNP:79931499
1298 1298 c, t dbSNP:281865437
1299 1299 a, g dbSNP:5030860
1300 1300 c, t dbSNP:1801152
1301 1301 a, g dbSNP:62644499
1307 1307 a, c, t dbSNP:62644471
1310 1310 a, c dbSNP:62644501
1312 1312 c, t dbSNP:755787172
1314 1314 a, g dbSNP:752255985
1317 1317 g, t dbSNP:767075719
1320 1320 c, t dbSNP:199475696
1322 1322 a, g dbSNP:199475621
1328 1328 c, t dbSNP:148041893
1329 1329 c, t dbSNP:199475670
1336 1336 c, t dbSNP:59326968
1340 1340 c, g dbSNP:567261857
1343 1343 a, c, t dbSNP:764974157
1344 1344 a, c dbSNP:794727047
1347 1347 c, t dbSNP:199475607
1357 1357 a, g dbSNP:770034263
1359 1359 a, c dbSNP:199475659
1363 1363 a, t dbSNP:748303375
1372 1372 c, t dbSNP:776064023
1374 1374 a, g dbSNP:775391163
1394 1394 a, g dbSNP:565686453
1395 1395 a, g dbSNP:770906256
1396 1396 c, t dbSNP:749175668
1398 1398 a, c dbSNP:76542238
1401 1401 a, t dbSNP:769777460
1402 1402 c, t dbSNP:747923532
1410 1410 -, taaag dbSNP:794727086
1410 1410 c, t dbSNP:781041737
1413 1413 -, a dbSNP:199475641
1415 1415 -, t dbSNP:199475669
1418 1418 a, c dbSNP:753390788
1421 1421 c, t dbSNP:754538733
1426 1426 a, g dbSNP:751112303
1428 1428 a, g dbSNP:549252036
1431 1431 a, c dbSNP:377262652
1436 1436 g, t dbSNP:372637021
1438 1438 c, t dbSNP:765731166
1439 1439 c, t dbSNP:368468051
1443 1443 a, g dbSNP:754149413
1444 1444 c, g dbSNP:375002761
1451 1451 a, t dbSNP:760738010
1455 1455 a, g dbSNP:775652203
1456 1456 c, t dbSNP:772101462
1458 1458 c, g dbSNP:371395498
1479 1479 c, t dbSNP:563478341
1484 1484 c, t dbSNP:779103782
1496 1496 a, g dbSNP:569495604
1526 1526 c, t dbSNP:1042517
1545 1545 a, g dbSNP:530983165
1558 1558 a, c dbSNP:565281224
1561 1561 a, g dbSNP:375319584
1604 1604 a, g dbSNP:1801153
1658 1658 a, t dbSNP:559828549
1703 1703 a, g dbSNP:773259521
1759 1759 c, t dbSNP:543283408
1778 1778 a, g dbSNP:763061595
1784 1784 a, g dbSNP:775532941
1785 1785 a, t dbSNP:189657033
1837 1837 a, g dbSNP:367935352
1882 1882 a, g dbSNP:184297770
1921 1921 a, g dbSNP:1042575
2007 2007 a, g dbSNP:536759523
2065 2065 g, t dbSNP:141177123
2067 2067 a, g dbSNP:180991851
2069 2069 c, g dbSNP:534358723
2116 2116 c, t dbSNP:189466448
2152 2152 c, t dbSNP:185081299
2189 2189 -, gtaa dbSNP:551502562
2201 2201 c, t dbSNP:571912294
2214 2214 a, c dbSNP:535715056

Target ORF information:

RefSeq Version XM_011538422
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens phenylalanine hydroxylase (PAH), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25787
Accession Version NM_000277.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1359bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu25787D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product phenylalanine-4-hydroxylase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U49897.1. This sequence is a reference standard in the RefSeqGene project. Summary: PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U49897.1, K03020.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1968540 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)386..388(+)
Misc Feature(2)518..520(+)
Misc Feature(3)530..1828(+)
Misc Feature(4)533..802(+)
Misc Feature(5)533..553(+)
Misc Feature(6)608..679(+)
Misc Feature(7)827..1744(+)
Misc Feature(8)884..1522(+)
Misc Feature(9)1211..1447(+)
Misc Feature(10)1325..1462(+)
Exon (1)1..532
Gene Synonym:
Exon (2)533..640
Gene Synonym:
Exon (3)641..824
Gene Synonym:
Exon (4)825..913
Gene Synonym:
Exon (5)914..981
Gene Synonym:
Exon (6)982..1178
Gene Synonym:
Exon (7)1179..1314
Gene Synonym:
Exon (8)1315..1384
Gene Synonym:
Exon (9)1385..1441
Gene Synonym:
Exon (10)1442..1537
Gene Synonym:
Exon (11)1538..1671
Gene Synonym:
Exon (12)1672..1787
Gene Synonym:
Exon (13)1788..2680
Gene Synonym:
Position Chain Variation Link
14 14 -, g dbSNP:752233344
15 15 c, g dbSNP:758376327
19 19 -, g dbSNP:113191080
51 51 c, g dbSNP:535971161
79 79 c, t dbSNP:748429144
97 97 a, g dbSNP:369544823
100 100 a, t dbSNP:779300086
128 128 c, t dbSNP:555581153
133 133 a, g dbSNP:556724761
157 157 c, t dbSNP:537351089
158 158 c, t dbSNP:35465699
159 159 g, t dbSNP:185674882
227 227 c, t dbSNP:2280616
243 243 c, g dbSNP:181966604
246 246 c, g dbSNP:547091601
249 249 a, g dbSNP:199475594
251 251 a, g dbSNP:74820934
291 291 c, t dbSNP:189522790
299 299 a, g dbSNP:544326639
323 323 a, g dbSNP:372622473
326 326 c, t dbSNP:62517177
337 337 c, t dbSNP:565404802
352 352 c, g dbSNP:147266631
369 369 c, t dbSNP:767107144
392 392 c, t dbSNP:7954004
402 402 a, c dbSNP:2280615
404 404 a, g dbSNP:542307750
423 423 c, g dbSNP:772360697
425 425 -, g dbSNP:763402355
428 428 c, t dbSNP:746106548
434 434 g, t dbSNP:779160321
445 445 c, g dbSNP:771176183
451 451 a, g dbSNP:749365596
463 463 a, g dbSNP:777884173
464 464 c, g dbSNP:573703749
467 467 g, t dbSNP:185069853
472 472 c, t dbSNP:62507266
473 473 a, g, t dbSNP:62514891
474 474 c, g, t dbSNP:62508575
475 475 a, g dbSNP:62514893
478 478 c, t dbSNP:750239990
483 483 c, t dbSNP:765022724
484 484 a, g dbSNP:536605300
491 491 c, g dbSNP:753312947
494 494 a, g dbSNP:763623193
496 496 c, t dbSNP:761094025
502 502 c, g dbSNP:1801145
505 505 a, g dbSNP:772557951
514 514 a, g dbSNP:759956741
518 518 c, t dbSNP:62642946
519 519 -, ct dbSNP:62642906
523 523 c, g, t dbSNP:150366430
527 527 c, g dbSNP:771104344
530 530 c, t dbSNP:199475585
531 531 a, t dbSNP:199475662
532 532 c, g dbSNP:199475688
535 535 a, c dbSNP:753466976
537 537 a, c dbSNP:199565868
543 543 a, g, t dbSNP:539994406
577 577 a, c dbSNP:768048739
579 579 c, t dbSNP:760011862
580 580 a, g dbSNP:17852374
583 583 -, g dbSNP:199475674
587 587 -, ttc dbSNP:199475565
588 588 -, tct dbSNP:762462102
591 591 c, t dbSNP:62642938
593 593 c, t dbSNP:62642928
594 594 c, t dbSNP:62642916
597 597 a, g, t dbSNP:62635346
601 601 a, g dbSNP:763089464
602 602 -, gaa dbSNP:199475640
603 603 -, aag dbSNP:199475628
607 607 g, t dbSNP:773425620
608 608 a, g dbSNP:74603784
609 609 -, g dbSNP:199475591
612 612 a, c, t dbSNP:118203925
614 614 c, t dbSNP:547150887
615 615 c, t dbSNP:5030841
620 620 a, g dbSNP:776829633
623 623 a, g dbSNP:772159852
627 627 c, t dbSNP:199475630
627 627 -, t dbSNP:281865165
629 629 a, c, t dbSNP:199475619
630 630 a, g dbSNP:118092776
633 633 c, t dbSNP:199475677
634 634 a, g dbSNP:143358918
636 636 c, t dbSNP:281865438
637 637 g, t dbSNP:199475598
637 637 -, t dbSNP:199475566
640 640 a, g, t dbSNP:199475567
641 641 -, gagaatgatgtaaacctgacccacattgaatctagaccttctcgttta aagaaagatgagtatgaatttttcacccatttggataaacgtagcctgcctgctctga caaacatcatcaagatcttgaggcatgacattggtgccactgtccatgagctttcacg agataagaagaaagacacag dbSNP:199475570
641 641 -, gag dbSNP:199475665
641 641 a, g, t dbSNP:140945592
647 647 g, t dbSNP:199475635
648 648 a, g dbSNP:199475672
649 649 c, t dbSNP:768292157
653 653 a, g dbSNP:199475651
655 655 a, c, g dbSNP:199475634
658 658 a, g dbSNP:779383205
659 659 a, c dbSNP:199475568
662 662 a, c dbSNP:199475569
662 662 -, c dbSNP:672601294
665 665 a, g dbSNP:199475643
668 668 g, t dbSNP:281865454
670 670 a, g dbSNP:117308669
671 671 c, t dbSNP:5030842
674 674 a, g dbSNP:199475639
676 676 a, t dbSNP:76394784
677 677 c, t dbSNP:199475678
678 678 -, ctt dbSNP:199475687
679 679 -, ttc dbSNP:199475620
679 679 g, t dbSNP:550724569
680 680 -, tct dbSNP:62642094
680 680 c, t dbSNP:63048261
682 682 -, ccttct dbSNP:281865431
684 684 a, g dbSNP:62508695
685 685 c, t dbSNP:757727922
686 686 g, t dbSNP:760782775
694 694 a, g dbSNP:374797155
695 695 a, g dbSNP:767453024
698 698 c, g dbSNP:762949770
699 699 a, c, g dbSNP:62507347
703 703 c, g, t dbSNP:62507332
704 704 a, g dbSNP:62507326
713 713 -, acccatttggataaac dbSNP:63749677
713 713 a, c dbSNP:62509017
716 716 a, c dbSNP:769705809
722 722 g, t dbSNP:62514902
727 727 a, g dbSNP:776378866
728 728 c, t dbSNP:768320548
729 729 a, g dbSNP:746603180
732 732 a, g dbSNP:368152528
733 733 a, c dbSNP:62516151
736 736 -, c dbSNP:62506950
737 737 c, t dbSNP:62507270
738 738 -, c dbSNP:62517202
747 747 c, t dbSNP:62514903
752 752 a, g dbSNP:528078207
753 753 g, t dbSNP:62508677
755 755 -, atc dbSNP:62514904
755 755 a, t dbSNP:62508682
756 756 -, tca dbSNP:62508727
756 756 ca, tc dbSNP:281865432
761 761 a, c dbSNP:142516271
765 765 c, t dbSNP:62517167
768 768 c, g dbSNP:778230838
771 771 a, g dbSNP:148393887
777 777 c, t dbSNP:62508591
779 779 g, t dbSNP:752792040
782 782 -, gccactgtc dbSNP:398123291
783 783 a, c dbSNP:62642929
792 792 a, g dbSNP:542645236
801 801 c, t dbSNP:199475627
802 802 a, g dbSNP:573940903
803 803 c, t dbSNP:76296470
816 816 -, aaga dbSNP:199475648
822 822 -, c dbSNP:281865428
822 822 c, t dbSNP:281865439
824 824 a, g dbSNP:776442422
827 827 c, t dbSNP:398123292
828 828 c, g, t dbSNP:374999809
829 829 -, c dbSNP:794727619
830 830 c, t dbSNP:775327122
831 831 a, g dbSNP:199475586
837 837 a, c dbSNP:199475622
840 840 g, t dbSNP:199475681
843 843 c, t dbSNP:199475571
853 853 c, g dbSNP:767127989
857 857 g, t dbSNP:199475606
858 858 a, g, t dbSNP:199475623
870 870 -, atca dbSNP:199475605
871 871 c, t dbSNP:145692106
872 872 c, t dbSNP:199475680
883 883 c, t dbSNP:1801146
888 888 a, g dbSNP:375384973
891 891 a, c, t dbSNP:372657268
892 892 a, g dbSNP:200366386
896 896 c, t dbSNP:375364629
900 900 a, g dbSNP:199475572
906 906 a, t dbSNP:140175796
908 908 c, t dbSNP:199475599
910 910 c, t dbSNP:191142120
911 911 c, t dbSNP:199475624
912 912 c, t dbSNP:199475694
914 914 -, ggttttaaagatcctgtgtaccgtgcaagacggaagcagtttgctgac attgcctacaactaccgcca dbSNP:199475649
914 914 a, g dbSNP:80297647
919 919 c, t dbSNP:770990005
922 922 a, g dbSNP:749317892
923 923 c, g dbSNP:199475597
924 924 a, g dbSNP:199475625
928 928 c, t dbSNP:377244118
932 932 a, c, t dbSNP:199475587
935 935 c, t dbSNP:539743701
936 936 a, c, g dbSNP:199475663
938 938 c, g dbSNP:199475686
939 939 c, t dbSNP:570748767
942 942 a, g, t dbSNP:199475611
943 943 a, c dbSNP:199475612
944 944 c, t dbSNP:75166491
945 945 a, c, g dbSNP:5030843
951 951 a, c dbSNP:199475601
954 954 c, t dbSNP:79635844
956 956 g, t dbSNP:547566250
962 962 a, g dbSNP:199475647
963 963 c, t dbSNP:199475595
965 965 a, c, g dbSNP:199475626
969 969 a, g dbSNP:753254031
970 970 a, c dbSNP:199475645
972 972 a, g, t dbSNP:77554925
974 974 c, t dbSNP:199475646
975 975 -, a dbSNP:199475661
976 976 a, c dbSNP:281865455
977 977 -, cccccc dbSNP:144835074
977 977 c, t dbSNP:281865440
978 978 a, g dbSNP:199475679
980 980 c, g dbSNP:199475655
981 981 a, g dbSNP:199475573
982 982 a, g, t dbSNP:199475652
983 983 a, g, t dbSNP:199475613
984 984 c, g dbSNP:199475596
985 985 g, t dbSNP:143211522
986 986 c, t dbSNP:199475588
988 988 g, t dbSNP:192592111
989 989 a, c dbSNP:199475574
992 992 a, g dbSNP:199475632
993 993 a, c, t dbSNP:138809906
995 995 c, g dbSNP:199475604
998 998 c, t dbSNP:199475575
999 999 a, c, g, t dbSNP:74486803
1001 1001 a, c, g dbSNP:199475602
1005 1005 a, g, t dbSNP:77958223
1007 1007 a, c, t dbSNP:199475671
1011 1011 g, t dbSNP:745723155
1017 1017 a, g dbSNP:199475617
1019 1019 ga, tt dbSNP:281865433
1019 1019 a, c, g dbSNP:199475664
1020 1020 a, g dbSNP:17852373
1028 1028 -, a dbSNP:62507328
1030 1030 -, at dbSNP:62517207
1031 1031 c, t dbSNP:62507272
1033 1033 a, c, g dbSNP:62507336
1035 1035 a, c, g dbSNP:199475689
1035 1035 -, g dbSNP:62507260
1036 1036 c, t dbSNP:777274367
1040 1040 a, g dbSNP:281865441
1041 1041 c, t dbSNP:62514919
1051 1051 c, t dbSNP:752202371
1052 1052 -, ct dbSNP:62508587
1053 1053 c, t dbSNP:5030844
1058 1058 -, tccttgtataaaacccatgcttg dbSNP:62895363
1060 1060 c, t dbSNP:755420480
1062 1062 -, tgtataaaacccatgcttgctat dbSNP:63083561
1063 1063 c, g dbSNP:281865442
1064 1064 -, tataaaacccatgcttgctatg dbSNP:199475697
1065 1065 -, ataaaacccatgcttgctatga dbSNP:63749676
1070 1070 -, a dbSNP:62508643
1073 1073 c, t dbSNP:62517205
1074 1074 a, g dbSNP:62517180
1075 1075 c, t dbSNP:751977644
1080 1080 a, g dbSNP:62507271
1081 1081 c, g, t dbSNP:1801147
1083 1083 a, g dbSNP:62514927
1084 1084 c, g, t dbSNP:62514928
1085 1085 a, g dbSNP:63083560
1086 1086 a, c dbSNP:62508593
1087 1087 a, g dbSNP:765552494
1088 1088 g, t dbSNP:62517170
1089 1089 a, g dbSNP:62508728
1090 1090 a, c, g dbSNP:62517201
1091 1091 a, g dbSNP:62508572
1092 1092 a, g dbSNP:62508721
1103 1103 a, c dbSNP:62514931
1104 1104 -, c dbSNP:62514929
1104 1104 c, t dbSNP:281865443
1107 1107 c, t dbSNP:62517198
1110 1110 c, t dbSNP:62516109
1114 1114 a, g dbSNP:373782868
1120 1120 c, g dbSNP:62509013
1121 1121 c, g, t dbSNP:62508718
1122 1122 a, g dbSNP:62508617
1125 1125 g, t dbSNP:62514933
1126 1126 c, t dbSNP:777465976
1134 1134 a, g dbSNP:62514934
1135 1135 -, ag dbSNP:62514936
1136 1136 -, ga dbSNP:759154440
1137 1137 a, g, t dbSNP:62507319
1140 1140 a, g, t dbSNP:201245932
1143 1143 c, t dbSNP:62507323
1144 1144 g, t dbSNP:199475576
1145 1145 a, c, g dbSNP:199475589
1146 1146 c, g, t dbSNP:62517204
1148 1148 c, t dbSNP:62508696
1150 1150 c, g, t dbSNP:62508615
1153 1153 a, g dbSNP:182135145
1154 1154 a, g dbSNP:281865444
1160 1160 a, g dbSNP:62516152
1161 1161 g, t dbSNP:199475673
1163 1163 c, t dbSNP:5030845
1164 1164 c, t dbSNP:62508577
1166 1166 c, t dbSNP:62507348
1168 1168 a, c, g dbSNP:1126758
1171 1171 a, c dbSNP:62517208
1176 1176 a, c dbSNP:199475656
1181 1181 c, t dbSNP:372723640
1184 1184 a, c dbSNP:199475577
1187 1187 a, g dbSNP:62517178
1188 1188 a, c, g, t dbSNP:62507283
1190 1190 g, t dbSNP:62507337
1191 1191 c, t dbSNP:62508594
1193 1193 c, t dbSNP:76687508
1194 1194 a, g, t dbSNP:62508730
1194 1194 -, g dbSNP:199475657
1196 1196 c, t dbSNP:199475578
1199 1199 c, t dbSNP:5030846
1200 1200 a, g, t dbSNP:62508588
1203 1203 c, t dbSNP:118203923
1205 1205 a, c, g dbSNP:62508694
1206 1206 a, c, t dbSNP:76212747
1207 1207 a, g dbSNP:1042503
1209 1209 a, c, t dbSNP:199475610
1209 1209 -, c dbSNP:199475666
1211 1211 a, c, g dbSNP:62508731
1212 1212 a, g, t dbSNP:199475579
1215 1215 c, g, t dbSNP:62507340
1217 1217 c, t dbSNP:74503222
1218 1218 a, t dbSNP:62507338
1224 1224 c, t dbSNP:369646949
1226 1226 c, g, t dbSNP:5030847
1227 1227 a, g dbSNP:62644503
1229 1229 a, g dbSNP:765533320
1232 1232 a, t dbSNP:62642909
1235 1235 g, t dbSNP:62642931
1236 1236 c, t dbSNP:62642930
1241 1241 a, g, t dbSNP:5030848
1242 1242 a, g, t dbSNP:62642908
1243 1243 c, t dbSNP:544995045
1244 1244 c, t dbSNP:75065106
1247 1247 a, g dbSNP:62642932
1248 1248 c, t dbSNP:118203921
1253 1253 c, g, t dbSNP:5030850
1254 1254 a, c, g dbSNP:5030849
1257 1257 g, t dbSNP:281865445
1258 1258 c, t dbSNP:776860902
1261 1261 c, g dbSNP:62642944
1262 1262 c, t dbSNP:749668037
1263 1263 a, t dbSNP:199475580
1265 1265 g, t dbSNP:62517181
1266 1266 a, g dbSNP:62507335
1268 1268 a, c, g dbSNP:62508752
1269 1269 a, c dbSNP:62508753
1271 1271 c, g dbSNP:199475676
1272 1272 a, t dbSNP:778154939
1273 1273 c, g, t dbSNP:199475675
1274 1274 c, t dbSNP:62507263
1276 1276 c, t dbSNP:748337823
1277 1277 a, c, g dbSNP:62508692
1278 1278 a, t dbSNP:199475644
1278 1278 -, t dbSNP:62508687
1280 1280 a, g dbSNP:199475690
1281 1281 a, g dbSNP:62514950
1282 1282 -, acatg dbSNP:62507286
1282 1282 a, t dbSNP:62514951
1283 1283 c, t dbSNP:62517164
1284 1284 a, g, t dbSNP:199475692
1286 1286 g, t dbSNP:62514952
1290 1290 c, t dbSNP:62514953
1292 1292 a, g dbSNP:142934616
1294 1294 -, gcccatgtata dbSNP:199475581
1295 1295 c, t dbSNP:62508691
1296 1296 c, g, t dbSNP:62508715
1298 1298 a, g, t dbSNP:62516149
1299 1299 a, c, g, t dbSNP:62508722
1300 1300 g, t dbSNP:62514954
1301 1301 g, t dbSNP:78655458
1302 1302 a, g dbSNP:62516155
1303 1303 c, t dbSNP:773720549
1304 1304 a, g dbSNP:62516156
1305 1305 a, c, t dbSNP:62507262
1309 1309 -, c dbSNP:281865429
1309 1309 c, t dbSNP:138355741
1310 1310 a, c, g dbSNP:62508698
1311 1311 -, t dbSNP:199475653
1311 1311 a, g dbSNP:62508734
1313 1313 c, g, t dbSNP:199475654
1314 1314 c, t dbSNP:5030851
1315 1315 c, t dbSNP:772249197
1316 1316 a, g dbSNP:199475582
1317 1317 a, g dbSNP:199475660
1319 1319 a, t dbSNP:62517168
1320 1320 a, t dbSNP:62508693
1322 1322 c, t dbSNP:199475682
1325 1325 c, t dbSNP:199475636
1328 1328 a, g dbSNP:62508739
1330 1330 a, g dbSNP:556021587
1331 1331 c, g dbSNP:781096854
1333 1333 a, g dbSNP:754686336
1336 1336 c, g dbSNP:62507327
1337 1337 c, g dbSNP:199475693
1341 1341 a, g, t dbSNP:62642919
1342 1342 c, t dbSNP:751203209
1356 1356 c, g dbSNP:62642910
1358 1358 a, g dbSNP:765934604
1359 1359 a, g dbSNP:281865446
1361 1361 c, t dbSNP:62642945
1362 1362 a, g dbSNP:62642939
1366 1366 c, t dbSNP:765823928
1367 1367 -, ttt dbSNP:62507267
1368 1368 g, t dbSNP:62642933
1370 1370 g, t dbSNP:5030853
1371 1371 c, t dbSNP:199475609
1376 1376 -, t dbSNP:62642920
1379 1379 c, g, t dbSNP:199475608
1383 1383 a, g dbSNP:199475592
1384 1384 a, g dbSNP:199475583
1388 1388 -, a dbSNP:281865456
1388 1388 a, g dbSNP:62642934
1394 1394 c, g, t dbSNP:62642095
1398 1398 a, c, t dbSNP:62642935
1401 1401 -, ctctgggtgca dbSNP:62651568
1401 1401 a, c, t dbSNP:62642913
1403 1403 -, ct dbSNP:281865430
1404 1404 c, t dbSNP:62642936
1405 1405 g, t dbSNP:771080801
1406 1406 a, g dbSNP:763115697
1407 1407 a, g dbSNP:62642915
1408 1408 c, t dbSNP:776778122
1409 1409 a, g, t dbSNP:62642912
1410 1410 c, t dbSNP:62642914
1412 1412 a, c, t dbSNP:199475650
1412 1412 -, c dbSNP:62642907
1413 1413 a, c dbSNP:62642940
1415 1415 g, t dbSNP:62642917
1425 1425 c, t dbSNP:62642918
1427 1427 g, t dbSNP:398123294
1432 1432 c, g, t dbSNP:199475615
1435 1435 c, g, t dbSNP:61747292
1436 1436 a, g dbSNP:62514957
1437 1437 c, g dbSNP:62514958
1439 1439 -, aca dbSNP:199475618
1441 1441 a, g dbSNP:199475637
1446 1446 a, g dbSNP:62508578
1447 1447 c, g dbSNP:62508573
1449 1449 a, g dbSNP:62514959
1452 1452 a, t dbSNP:535752872
1453 1453 g, t dbSNP:199475642
1454 1454 a, g dbSNP:199475616
1458 1458 c, t dbSNP:748816402
1462 1462 c, g dbSNP:62508580
1463 1463 c, t dbSNP:62517179
1464 1464 g, t dbSNP:199475614
1467 1467 a, g dbSNP:62508589
1469 1469 c, t dbSNP:62516060
1471 1471 c, t dbSNP:777221457
1473 1473 c, g dbSNP:62517174
1474 1474 c, t dbSNP:140243918
1476 1476 a, c dbSNP:281865434
1478 1478 c, g, t dbSNP:62516061
1479 1479 a, g dbSNP:62508735
1482 1482 a, g, t dbSNP:62517206
1484 1484 g, t dbSNP:62516150
1491 1491 c, t dbSNP:62508720
1493 1493 a, t dbSNP:62517200
1494 1494 a, c, g dbSNP:62516153
1495 1495 a, g dbSNP:550037937
1496 1496 a, c, g dbSNP:62507282
1496 1496 -, g dbSNP:63581460
1498 1498 a, c dbSNP:766756246
1499 1499 g, t dbSNP:62508651
1500 1500 a, g, t dbSNP:62507265
1502 1502 a, c, g dbSNP:62508679
1503 1503 a, g, t dbSNP:62508582
1504 1504 c, t dbSNP:758646909
1505 1505 a, g, t dbSNP:62516062
1508 1508 a, c, g dbSNP:62508688
1510 1510 -, g dbSNP:62516063
1511 1511 c, t dbSNP:62516154
1514 1514 c, g dbSNP:62516092
1515 1515 -, tgtcatccttt dbSNP:199475600
1517 1517 c, g, t dbSNP:62508646
1518 1518 a, c, t dbSNP:62507279
1519 1519 -, gtca dbSNP:62516157
1519 1519 a, t dbSNP:775356291
1520 1520 a, t dbSNP:62517183
1521 1521 a, c dbSNP:62508628
1526 1526 c, g, t dbSNP:62508686
1527 1527 -, g dbSNP:62516094
1528 1528 -, t dbSNP:62507350
1535 1535 c, t dbSNP:199475633
1538 1538 -, ta dbSNP:199475490
1538 1538 c, t dbSNP:62507320
1541 1541 g, t dbSNP:62508595
1543 1543 c, t dbSNP:766107583
1546 1546 a, t dbSNP:376480977
1548 1548 c, g dbSNP:5030854
1553 1553 a, t dbSNP:772918939
1556 1556 a, c, t dbSNP:62507329
1559 1559 -, aa dbSNP:199475667
1561 1561 -, g dbSNP:5030654
1561 1561 g, t dbSNP:63329263
1562 1562 -, cttctccccctggag dbSNP:62516097
1562 1562 -, ctt dbSNP:62516096
1564 1564 -, tctccccctggagct dbSNP:786200862
1564 1564 -, tct dbSNP:786200861
1567 1567 c, g dbSNP:747661840
1569 1569 a, c dbSNP:62516098
1570 1570 -, c dbSNP:62506951
1570 1570 a, c dbSNP:776159017
1571 1571 -, c dbSNP:62517203
1571 1571 -, c dbSNP:62508620
1572 1572 c, t dbSNP:62508574
1573 1573 a, g dbSNP:62508648
1584 1584 a, g dbSNP:62507268
1586 1586 a, t dbSNP:62517163
1589 1589 -, gc dbSNP:62516099
1589 1589 a, g dbSNP:62508717
1592 1592 a, g dbSNP:769076484
1595 1595 c, g dbSNP:184148104
1599 1599 -, a dbSNP:62642921
1601 1601 -, t dbSNP:62642941
1602 1602 a, g dbSNP:62642942
1604 1604 a, t dbSNP:62642911
1605 1605 c, t dbSNP:780691974
1607 1607 c, g dbSNP:772630527
1608 1608 c, t dbSNP:746203167
1609 1609 c, g dbSNP:779053558
1611 1611 c, t dbSNP:62642937
1612 1612 a, g, t dbSNP:373763334
1613 1613 a, g dbSNP:267603271
1624 1624 c, g dbSNP:281865458
1627 1627 a, c, g dbSNP:772897
1628 1628 g, t dbSNP:199475691
1629 1629 a, g dbSNP:62516141
1631 1631 c, t dbSNP:62517194
1633 1633 c, t dbSNP:149595475
1635 1635 -, tg dbSNP:199475629
1635 1635 c, t dbSNP:281865435
1638 1638 -, c dbSNP:62506949
1641 1641 a, g dbSNP:5030856
1643 1643 a, g dbSNP:281865453
1646 1646 a, t dbSNP:180819807
1647 1647 c, t dbSNP:199475695
1649 1649 a, c dbSNP:761487922
1652 1652 c, g, t dbSNP:62516142
1653 1653 a, c dbSNP:62516102
1655 1655 c, g dbSNP:62516103
1656 1656 a, c, g dbSNP:62508736
1657 1657 a, c dbSNP:760256025
1659 1659 a, g dbSNP:776178623
1660 1660 a, g dbSNP:772683682
1666 1666 a, g dbSNP:199475638
1668 1668 -, taag dbSNP:199475603
1668 1668 c, t dbSNP:281865436
1669 1669 a, t dbSNP:199475584
1670 1670 -, a dbSNP:199475590
1670 1670 a, c dbSNP:199475593
1671 1671 a, c, g dbSNP:199475658
1676 1676 c, t dbSNP:62508725
1680 1680 c, t dbSNP:5030857
1687 1687 a, g dbSNP:771382634
1688 1688 a, g dbSNP:749613899
1689 1689 c, t dbSNP:62644469
1690 1690 a, g dbSNP:773526027
1691 1691 c, t dbSNP:62644465
1692 1692 -, c dbSNP:62644489
1692 1692 c, t dbSNP:62644473
1694 1694 c, t dbSNP:5030858
1695 1695 a, g dbSNP:5030859
1701 1701 c, g, t dbSNP:62644475
1704 1704 a, c dbSNP:62644477
1709 1709 a, c, t dbSNP:62644467
1710 1710 a, c, g dbSNP:79931499
1712 1712 c, t dbSNP:281865437
1713 1713 a, g dbSNP:5030860
1714 1714 c, t dbSNP:1801152
1715 1715 a, g dbSNP:62644499
1721 1721 a, c, t dbSNP:62644471
1724 1724 a, c dbSNP:62644501
1726 1726 c, t dbSNP:755787172
1728 1728 a, g dbSNP:752255985
1731 1731 g, t dbSNP:767075719
1734 1734 c, t dbSNP:199475696
1736 1736 a, g dbSNP:199475621
1742 1742 c, t dbSNP:148041893
1743 1743 c, t dbSNP:199475670
1750 1750 c, t dbSNP:59326968
1754 1754 c, g dbSNP:567261857
1757 1757 a, c, t dbSNP:764974157
1758 1758 a, c dbSNP:794727047
1761 1761 c, t dbSNP:199475607
1771 1771 a, g dbSNP:770034263
1773 1773 a, c dbSNP:199475659
1777 1777 a, t dbSNP:748303375
1786 1786 c, t dbSNP:776064023
1788 1788 a, g dbSNP:775391163
1808 1808 a, g dbSNP:565686453
1809 1809 a, g dbSNP:770906256
1810 1810 c, t dbSNP:749175668
1812 1812 a, c dbSNP:76542238
1815 1815 a, t dbSNP:769777460
1816 1816 c, t dbSNP:747923532
1824 1824 -, taaag dbSNP:794727086
1824 1824 c, t dbSNP:781041737
1827 1827 -, a dbSNP:199475641
1829 1829 -, t dbSNP:199475669
1832 1832 a, c dbSNP:753390788
1835 1835 c, t dbSNP:754538733
1840 1840 a, g dbSNP:751112303
1842 1842 a, g dbSNP:549252036
1845 1845 a, c dbSNP:377262652
1850 1850 g, t dbSNP:372637021
1852 1852 c, t dbSNP:765731166
1853 1853 c, t dbSNP:368468051
1857 1857 a, g dbSNP:754149413
1858 1858 c, g dbSNP:375002761
1865 1865 a, t dbSNP:760738010
1869 1869 a, g dbSNP:775652203
1870 1870 c, t dbSNP:772101462
1872 1872 c, g dbSNP:371395498
1893 1893 c, t dbSNP:563478341
1898 1898 c, t dbSNP:779103782
1910 1910 a, g dbSNP:569495604
1940 1940 c, t dbSNP:1042517
1959 1959 a, g dbSNP:530983165
1972 1972 a, c dbSNP:565281224
1975 1975 a, g dbSNP:375319584
2018 2018 a, g dbSNP:1801153
2072 2072 a, t dbSNP:559828549
2117 2117 a, g dbSNP:773259521
2173 2173 c, t dbSNP:543283408
2192 2192 a, g dbSNP:763061595
2198 2198 a, g dbSNP:775532941
2199 2199 a, t dbSNP:189657033
2251 2251 a, g dbSNP:367935352
2296 2296 a, g dbSNP:184297770
2335 2335 a, g dbSNP:1042575
2421 2421 a, g dbSNP:536759523
2479 2479 g, t dbSNP:141177123
2481 2481 a, g dbSNP:180991851
2483 2483 c, g dbSNP:534358723
2530 2530 c, t dbSNP:189466448
2566 2566 c, t dbSNP:185081299
2603 2603 -, gtaa dbSNP:551502562
2615 2615 c, t dbSNP:571912294
2628 2628 a, c dbSNP:535715056

Target ORF information:

RefSeq Version NM_000277
Organism Homo sapiens (human)
Definition Homo sapiens phenylalanine hydroxylase (PAH), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.