Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PAH phenylalanine hydroxylase [Homo sapiens (human)]

Gene Symbol PAH
Entrez Gene ID 5053
Full Name phenylalanine hydroxylase
Synonyms PH, PKU, PKU1
General protein information
Preferred Names
phenylalanine 4-monooxygenase
Gene Type protein-coding
Organism Homo sapiens (human)



Summary PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Phenylketonuria, 261600 (3); [Hyperphenylalaninemia, non-PKU mild],
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu59464 XM_011538422 PREDICTED: Homo sapiens phenylalanine hydroxylase (PAH), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25787 NM_000277 Homo sapiens phenylalanine hydroxylase (PAH), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu59464D
Sequence Information ORF Nucleotide Sequence (Length: 1302bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product phenylalanine-4-hydroxylase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)173..1414(+)
Misc Feature(2)176..445(+)
Misc Feature(3)176..196(+)
Misc Feature(4)251..322(+)
Misc Feature(5)470..1330(+)
Misc Feature(6)527..1108(+)
Misc Feature(7)854..1033(+)
Misc Feature(8)968..1048(+)
Position Chain Variation Link
12 12 c, t dbSNP:767107144
35 35 c, t dbSNP:7954004
45 45 a, c dbSNP:2280615
47 47 a, g dbSNP:542307750
66 66 c, g dbSNP:772360697
68 68 -, g dbSNP:763402355
71 71 c, t dbSNP:746106548
77 77 g, t dbSNP:779160321
88 88 c, g dbSNP:771176183
94 94 a, g dbSNP:749365596
106 106 a, g dbSNP:777884173
107 107 c, g dbSNP:573703749
110 110 g, t dbSNP:185069853
115 115 c, t dbSNP:62507266
116 116 a, g, t dbSNP:62514891
117 117 c, g, t dbSNP:62508575
118 118 a, g dbSNP:62514893
121 121 c, t dbSNP:750239990
126 126 c, t dbSNP:765022724
127 127 a, g dbSNP:536605300
134 134 c, g dbSNP:753312947
137 137 a, g dbSNP:763623193
139 139 c, t dbSNP:761094025
145 145 c, g dbSNP:1801145
148 148 a, g dbSNP:772557951
157 157 a, g dbSNP:759956741
161 161 c, t dbSNP:62642946
162 162 -, ct dbSNP:62642906
166 166 c, g, t dbSNP:150366430
170 170 c, g dbSNP:771104344
173 173 c, t dbSNP:199475585
174 174 a, t dbSNP:199475662
175 175 c, g dbSNP:199475688
178 178 a, c dbSNP:753466976
180 180 a, c dbSNP:199565868
186 186 a, g, t dbSNP:539994406
220 220 a, c dbSNP:768048739
222 222 c, t dbSNP:760011862
223 223 a, g dbSNP:17852374
226 226 -, g dbSNP:199475674
230 230 -, ttc dbSNP:199475565
231 231 -, tct dbSNP:762462102
234 234 c, t dbSNP:62642938
236 236 c, t dbSNP:62642928
237 237 c, t dbSNP:62642916
240 240 a, g, t dbSNP:62635346
244 244 a, g dbSNP:763089464
245 245 -, gaa dbSNP:199475640
246 246 -, aag dbSNP:199475628
250 250 g, t dbSNP:773425620
251 251 a, g dbSNP:74603784
252 252 -, g dbSNP:199475591
255 255 a, c, t dbSNP:118203925
257 257 c, t dbSNP:547150887
258 258 c, t dbSNP:5030841
263 263 a, g dbSNP:776829633
266 266 a, g dbSNP:772159852
270 270 c, t dbSNP:199475630
270 270 -, t dbSNP:281865165
272 272 a, c, t dbSNP:199475619
273 273 a, g dbSNP:118092776
276 276 c, t dbSNP:199475677
277 277 a, g dbSNP:143358918
279 279 c, t dbSNP:281865438
280 280 g, t dbSNP:199475598
280 280 -, t dbSNP:199475566
283 283 a, g, t dbSNP:199475567
284 284 -, gagaatgatgtaaacctgacccacattgaatctagaccttctcgttta aagaaagatgagtatgaatttttcacccatttggataaacgtagcctgcctgctctga caaacatcatcaagatcttgaggcatgacattggtgccactgtccatgagctttcacg agataagaagaaagacacag dbSNP:199475570
284 284 -, gag dbSNP:199475665
284 284 a, g, t dbSNP:140945592
290 290 g, t dbSNP:199475635
291 291 a, g dbSNP:199475672
292 292 c, t dbSNP:768292157
296 296 a, g dbSNP:199475651
298 298 a, c, g dbSNP:199475634
301 301 a, g dbSNP:779383205
302 302 a, c dbSNP:199475568
305 305 a, c dbSNP:199475569
305 305 -, c dbSNP:672601294
308 308 a, g dbSNP:199475643
311 311 g, t dbSNP:281865454
313 313 a, g dbSNP:117308669
314 314 c, t dbSNP:5030842
317 317 a, g dbSNP:199475639
319 319 a, t dbSNP:76394784
320 320 c, t dbSNP:199475678
321 321 -, ctt dbSNP:199475687
322 322 -, ttc dbSNP:199475620
322 322 g, t dbSNP:550724569
323 323 -, tct dbSNP:62642094
323 323 c, t dbSNP:63048261
325 325 -, ccttct dbSNP:281865431
327 327 a, g dbSNP:62508695
328 328 c, t dbSNP:757727922
329 329 g, t dbSNP:760782775
337 337 a, g dbSNP:374797155
338 338 a, g dbSNP:767453024
341 341 c, g dbSNP:762949770
342 342 a, c, g dbSNP:62507347
346 346 c, g, t dbSNP:62507332
347 347 a, g dbSNP:62507326
356 356 -, acccatttggataaac dbSNP:63749677
356 356 a, c dbSNP:62509017
359 359 a, c dbSNP:769705809
365 365 g, t dbSNP:62514902
370 370 a, g dbSNP:776378866
371 371 c, t dbSNP:768320548
372 372 a, g dbSNP:746603180
375 375 a, g dbSNP:368152528
376 376 a, c dbSNP:62516151
379 379 -, c dbSNP:62506950
380 380 c, t dbSNP:62507270
381 381 -, c dbSNP:62517202
390 390 c, t dbSNP:62514903
395 395 a, g dbSNP:528078207
396 396 g, t dbSNP:62508677
398 398 -, atc dbSNP:62514904
398 398 a, t dbSNP:62508682
399 399 -, tca dbSNP:62508727
399 399 ca, tc dbSNP:281865432
404 404 a, c dbSNP:142516271
408 408 c, t dbSNP:62517167
411 411 c, g dbSNP:778230838
414 414 a, g dbSNP:148393887
420 420 c, t dbSNP:62508591
422 422 g, t dbSNP:752792040
425 425 -, gccactgtc dbSNP:398123291
426 426 a, c dbSNP:62642929
435 435 a, g dbSNP:542645236
444 444 c, t dbSNP:199475627
445 445 a, g dbSNP:573940903
446 446 c, t dbSNP:76296470
459 459 -, aaga dbSNP:199475648
465 465 -, c dbSNP:281865428
465 465 c, t dbSNP:281865439
467 467 a, g dbSNP:776442422
470 470 c, t dbSNP:398123292
471 471 c, g, t dbSNP:374999809
472 472 -, c dbSNP:794727619
473 473 c, t dbSNP:775327122
474 474 a, g dbSNP:199475586
480 480 a, c dbSNP:199475622
483 483 g, t dbSNP:199475681
486 486 c, t dbSNP:199475571
496 496 c, g dbSNP:767127989
500 500 g, t dbSNP:199475606
501 501 a, g, t dbSNP:199475623
513 513 -, atca dbSNP:199475605
514 514 c, t dbSNP:145692106
515 515 c, t dbSNP:199475680
526 526 c, t dbSNP:1801146
531 531 a, g dbSNP:375384973
534 534 a, c, t dbSNP:372657268
535 535 a, g dbSNP:200366386
539 539 c, t dbSNP:375364629
543 543 a, g dbSNP:199475572
549 549 a, t dbSNP:140175796
551 551 c, t dbSNP:199475599
553 553 c, t dbSNP:191142120
554 554 c, t dbSNP:199475624
555 555 c, t dbSNP:199475694
557 557 -, ggttttaaagatcctgtgtaccgtgcaagacggaagcagtttgctgac attgcctacaactaccgcca dbSNP:199475649
557 557 a, g dbSNP:80297647
562 562 c, t dbSNP:770990005
565 565 a, g dbSNP:749317892
566 566 c, g dbSNP:199475597
567 567 a, g dbSNP:199475625
571 571 c, t dbSNP:377244118
575 575 a, c, t dbSNP:199475587
578 578 c, t dbSNP:539743701
579 579 a, c, g dbSNP:199475663
581 581 c, g dbSNP:199475686
582 582 c, t dbSNP:570748767
585 585 a, g, t dbSNP:199475611
586 586 a, c dbSNP:199475612
587 587 c, t dbSNP:75166491
588 588 a, c, g dbSNP:5030843
594 594 a, c dbSNP:199475601
597 597 c, t dbSNP:79635844
599 599 g, t dbSNP:547566250
605 605 a, g dbSNP:199475647
606 606 c, t dbSNP:199475595
608 608 a, c, g dbSNP:199475626
612 612 a, g dbSNP:753254031
613 613 a, c dbSNP:199475645
615 615 a, g, t dbSNP:77554925
617 617 c, t dbSNP:199475646
618 618 -, a dbSNP:199475661
619 619 a, c dbSNP:281865455
620 620 -, cccccc dbSNP:144835074
620 620 c, t dbSNP:281865440
621 621 a, g dbSNP:199475679
623 623 c, g dbSNP:199475655
624 624 a, g dbSNP:199475573
625 625 a, g, t dbSNP:199475652
626 626 a, g, t dbSNP:199475613
627 627 c, g dbSNP:199475596
628 628 g, t dbSNP:143211522
629 629 c, t dbSNP:199475588
631 631 g, t dbSNP:192592111
632 632 a, c dbSNP:199475574
635 635 a, g dbSNP:199475632
636 636 a, c, t dbSNP:138809906
638 638 c, g dbSNP:199475604
641 641 c, t dbSNP:199475575
642 642 a, c, g, t dbSNP:74486803
644 644 a, c, g dbSNP:199475602
648 648 a, g, t dbSNP:77958223
650 650 a, c, t dbSNP:199475671
654 654 g, t dbSNP:745723155
660 660 a, g dbSNP:199475617
662 662 ga, tt dbSNP:281865433
662 662 a, c, g dbSNP:199475664
663 663 a, g dbSNP:17852373
671 671 -, a dbSNP:62507328
673 673 -, at dbSNP:62517207
674 674 c, t dbSNP:62507272
676 676 a, c, g dbSNP:62507336
678 678 a, c, g dbSNP:199475689
678 678 -, g dbSNP:62507260
679 679 c, t dbSNP:777274367
683 683 a, g dbSNP:281865441
684 684 c, t dbSNP:62514919
694 694 c, t dbSNP:752202371
695 695 -, ct dbSNP:62508587
696 696 c, t dbSNP:5030844
701 701 -, tccttgtataaaacccatgcttg dbSNP:62895363
703 703 c, t dbSNP:755420480
705 705 -, tgtataaaacccatgcttgctat dbSNP:63083561
706 706 c, g dbSNP:281865442
707 707 -, tataaaacccatgcttgctatg dbSNP:199475697
708 708 -, ataaaacccatgcttgctatga dbSNP:63749676
713 713 -, a dbSNP:62508643
716 716 c, t dbSNP:62517205
717 717 a, g dbSNP:62517180
718 718 c, t dbSNP:751977644
723 723 a, g dbSNP:62507271
724 724 c, g, t dbSNP:1801147
726 726 a, g dbSNP:62514927
727 727 c, g, t dbSNP:62514928
728 728 a, g dbSNP:63083560
729 729 a, c dbSNP:62508593
730 730 a, g dbSNP:765552494
731 731 g, t dbSNP:62517170
732 732 a, g dbSNP:62508728
733 733 a, c, g dbSNP:62517201
734 734 a, g dbSNP:62508572
735 735 a, g dbSNP:62508721
746 746 a, c dbSNP:62514931
747 747 -, c dbSNP:62514929
747 747 c, t dbSNP:281865443
750 750 c, t dbSNP:62517198
753 753 c, t dbSNP:62516109
757 757 a, g dbSNP:373782868
763 763 c, g dbSNP:62509013
764 764 c, g, t dbSNP:62508718
765 765 a, g dbSNP:62508617
768 768 g, t dbSNP:62514933
769 769 c, t dbSNP:777465976
777 777 a, g dbSNP:62514934
778 778 -, ag dbSNP:62514936
779 779 -, ga dbSNP:759154440
780 780 a, g, t dbSNP:62507319
783 783 a, g, t dbSNP:201245932
786 786 c, t dbSNP:62507323
787 787 g, t dbSNP:199475576
788 788 a, c, g dbSNP:199475589
789 789 c, g, t dbSNP:62517204
791 791 c, t dbSNP:62508696
793 793 c, g, t dbSNP:62508615
796 796 a, g dbSNP:182135145
797 797 a, g dbSNP:281865444
803 803 a, g dbSNP:62516152
804 804 g, t dbSNP:199475673
806 806 c, t dbSNP:5030845
807 807 c, t dbSNP:62508577
809 809 c, t dbSNP:62507348
811 811 a, c, g dbSNP:1126758
814 814 a, c dbSNP:62517208
819 819 a, c dbSNP:199475656
824 824 c, t dbSNP:372723640
827 827 a, c dbSNP:199475577
830 830 a, g dbSNP:62517178
831 831 a, c, g, t dbSNP:62507283
833 833 g, t dbSNP:62507337
834 834 c, t dbSNP:62508594
836 836 c, t dbSNP:76687508
837 837 a, g, t dbSNP:62508730
837 837 -, g dbSNP:199475657
839 839 c, t dbSNP:199475578
842 842 c, t dbSNP:5030846
843 843 a, g, t dbSNP:62508588
846 846 c, t dbSNP:118203923
848 848 a, c, g dbSNP:62508694
849 849 a, c, t dbSNP:76212747
850 850 a, g dbSNP:1042503
852 852 a, c, t dbSNP:199475610
852 852 -, c dbSNP:199475666
854 854 a, c, g dbSNP:62508731
855 855 a, g, t dbSNP:199475579
858 858 c, g, t dbSNP:62507340
860 860 c, t dbSNP:74503222
861 861 a, t dbSNP:62507338
867 867 c, t dbSNP:369646949
869 869 c, g, t dbSNP:5030847
870 870 a, g dbSNP:62644503
872 872 a, g dbSNP:765533320
875 875 a, t dbSNP:62642909
878 878 g, t dbSNP:62642931
879 879 c, t dbSNP:62642930
884 884 a, g, t dbSNP:5030848
885 885 a, g, t dbSNP:62642908
886 886 c, t dbSNP:544995045
887 887 c, t dbSNP:75065106
890 890 a, g dbSNP:62642932
891 891 c, t dbSNP:118203921
896 896 c, g, t dbSNP:5030850
897 897 a, c, g dbSNP:5030849
900 900 g, t dbSNP:281865445
901 901 c, t dbSNP:776860902
904 904 c, g dbSNP:62642944
905 905 c, t dbSNP:749668037
906 906 a, t dbSNP:199475580
908 908 g, t dbSNP:62517181
909 909 a, g dbSNP:62507335
911 911 a, c, g dbSNP:62508752
912 912 a, c dbSNP:62508753
914 914 c, g dbSNP:199475676
915 915 a, t dbSNP:778154939
916 916 c, g, t dbSNP:199475675
917 917 c, t dbSNP:62507263
919 919 c, t dbSNP:748337823
920 920 a, c, g dbSNP:62508692
921 921 a, t dbSNP:199475644
921 921 -, t dbSNP:62508687
923 923 a, g dbSNP:199475690
924 924 a, g dbSNP:62514950
925 925 -, acatg dbSNP:62507286
925 925 a, t dbSNP:62514951
926 926 c, t dbSNP:62517164
927 927 a, g, t dbSNP:199475692
929 929 g, t dbSNP:62514952
933 933 c, t dbSNP:62514953
935 935 a, g dbSNP:142934616
937 937 -, gcccatgtata dbSNP:199475581
938 938 c, t dbSNP:62508691
939 939 c, g, t dbSNP:62508715
941 941 a, g, t dbSNP:62516149
942 942 a, c, g, t dbSNP:62508722
943 943 g, t dbSNP:62514954
944 944 g, t dbSNP:78655458
945 945 a, g dbSNP:62516155
946 946 c, t dbSNP:773720549
947 947 a, g dbSNP:62516156
948 948 a, c, t dbSNP:62507262
952 952 -, c dbSNP:281865429
952 952 c, t dbSNP:138355741
953 953 a, c, g dbSNP:62508698
954 954 -, t dbSNP:199475653
954 954 a, g dbSNP:62508734
956 956 c, g, t dbSNP:199475654
957 957 c, t dbSNP:5030851
958 958 c, t dbSNP:772249197
959 959 a, g dbSNP:199475582
960 960 a, g dbSNP:199475660
962 962 a, t dbSNP:62517168
963 963 a, t dbSNP:62508693
965 965 c, t dbSNP:199475682
968 968 c, t dbSNP:199475636
971 971 a, g dbSNP:62508739
973 973 a, g dbSNP:556021587
974 974 c, g dbSNP:781096854
976 976 a, g dbSNP:754686336
979 979 c, g dbSNP:62507327
980 980 c, g dbSNP:199475693
984 984 a, g, t dbSNP:62642919
985 985 c, t dbSNP:751203209
999 999 c, g dbSNP:62642910
1001 1001 a, g dbSNP:765934604
1002 1002 a, g dbSNP:281865446
1004 1004 c, t dbSNP:62642945
1005 1005 a, g dbSNP:62642939
1009 1009 c, t dbSNP:765823928
1010 1010 -, ttt dbSNP:62507267
1011 1011 g, t dbSNP:62642933
1013 1013 g, t dbSNP:5030853
1014 1014 c, t dbSNP:199475609
1019 1019 -, t dbSNP:62642920
1022 1022 c, g, t dbSNP:199475608
1026 1026 a, g dbSNP:199475592
1027 1027 a, g dbSNP:199475583
1032 1032 a, g dbSNP:62508578
1033 1033 c, g dbSNP:62508573
1035 1035 a, g dbSNP:62514959
1038 1038 a, t dbSNP:535752872
1039 1039 g, t dbSNP:199475642
1040 1040 a, g dbSNP:199475616
1044 1044 c, t dbSNP:748816402
1048 1048 c, g dbSNP:62508580
1049 1049 c, t dbSNP:62517179
1050 1050 g, t dbSNP:199475614
1053 1053 a, g dbSNP:62508589
1055 1055 c, t dbSNP:62516060
1057 1057 c, t dbSNP:777221457
1059 1059 c, g dbSNP:62517174
1060 1060 c, t dbSNP:140243918
1062 1062 a, c dbSNP:281865434
1064 1064 c, g, t dbSNP:62516061
1065 1065 a, g dbSNP:62508735
1068 1068 a, g, t dbSNP:62517206
1070 1070 g, t dbSNP:62516150
1077 1077 c, t dbSNP:62508720
1079 1079 a, t dbSNP:62517200
1080 1080 a, c, g dbSNP:62516153
1081 1081 a, g dbSNP:550037937
1082 1082 a, c, g dbSNP:62507282
1082 1082 -, g dbSNP:63581460
1084 1084 a, c dbSNP:766756246
1085 1085 g, t dbSNP:62508651
1086 1086 a, g, t dbSNP:62507265
1088 1088 a, c, g dbSNP:62508679
1089 1089 a, g, t dbSNP:62508582
1090 1090 c, t dbSNP:758646909
1091 1091 a, g, t dbSNP:62516062
1094 1094 a, c, g dbSNP:62508688
1096 1096 -, g dbSNP:62516063
1097 1097 c, t dbSNP:62516154
1100 1100 c, g dbSNP:62516092
1101 1101 -, tgtcatccttt dbSNP:199475600
1103 1103 c, g, t dbSNP:62508646
1104 1104 a, c, t dbSNP:62507279
1105 1105 -, gtca dbSNP:62516157
1105 1105 a, t dbSNP:775356291
1106 1106 a, t dbSNP:62517183
1107 1107 a, c dbSNP:62508628
1112 1112 c, g, t dbSNP:62508686
1113 1113 -, g dbSNP:62516094
1114 1114 -, t dbSNP:62507350
1121 1121 c, t dbSNP:199475633
1124 1124 -, ta dbSNP:199475490
1124 1124 c, t dbSNP:62507320
1127 1127 g, t dbSNP:62508595
1129 1129 c, t dbSNP:766107583
1132 1132 a, t dbSNP:376480977
1134 1134 c, g dbSNP:5030854
1139 1139 a, t dbSNP:772918939
1142 1142 a, c, t dbSNP:62507329
1145 1145 -, aa dbSNP:199475667
1147 1147 -, g dbSNP:5030654
1147 1147 g, t dbSNP:63329263
1148 1148 -, cttctccccctggag dbSNP:62516097
1148 1148 -, ctt dbSNP:62516096
1150 1150 -, tctccccctggagct dbSNP:786200862
1150 1150 -, tct dbSNP:786200861
1153 1153 c, g dbSNP:747661840
1155 1155 a, c dbSNP:62516098
1156 1156 -, c dbSNP:62506951
1156 1156 a, c dbSNP:776159017
1157 1157 -, c dbSNP:62517203
1157 1157 -, c dbSNP:62508620
1158 1158 c, t dbSNP:62508574
1159 1159 a, g dbSNP:62508648
1170 1170 a, g dbSNP:62507268
1172 1172 a, t dbSNP:62517163
1175 1175 -, gc dbSNP:62516099
1175 1175 a, g dbSNP:62508717
1178 1178 a, g dbSNP:769076484
1181 1181 c, g dbSNP:184148104
1185 1185 -, a dbSNP:62642921
1187 1187 -, t dbSNP:62642941
1188 1188 a, g dbSNP:62642942
1190 1190 a, t dbSNP:62642911
1191 1191 c, t dbSNP:780691974
1193 1193 c, g dbSNP:772630527
1194 1194 c, t dbSNP:746203167
1195 1195 c, g dbSNP:779053558
1197 1197 c, t dbSNP:62642937
1198 1198 a, g, t dbSNP:373763334
1199 1199 a, g dbSNP:267603271
1210 1210 c, g dbSNP:281865458
1213 1213 a, c, g dbSNP:772897
1214 1214 g, t dbSNP:199475691
1215 1215 a, g dbSNP:62516141
1217 1217 c, t dbSNP:62517194
1219 1219 c, t dbSNP:149595475
1221 1221 -, tg dbSNP:199475629
1221 1221 c, t dbSNP:281865435
1224 1224 -, c dbSNP:62506949
1227 1227 a, g dbSNP:5030856
1229 1229 a, g dbSNP:281865453
1232 1232 a, t dbSNP:180819807
1233 1233 c, t dbSNP:199475695
1235 1235 a, c dbSNP:761487922
1238 1238 c, g, t dbSNP:62516142
1239 1239 a, c dbSNP:62516102
1241 1241 c, g dbSNP:62516103
1242 1242 a, c, g dbSNP:62508736
1243 1243 a, c dbSNP:760256025
1245 1245 a, g dbSNP:776178623
1246 1246 a, g dbSNP:772683682
1252 1252 a, g dbSNP:199475638
1254 1254 -, taag dbSNP:199475603
1254 1254 c, t dbSNP:281865436
1255 1255 a, t dbSNP:199475584
1256 1256 -, a dbSNP:199475590
1256 1256 a, c dbSNP:199475593
1257 1257 a, c, g dbSNP:199475658
1262 1262 c, t dbSNP:62508725
1266 1266 c, t dbSNP:5030857
1273 1273 a, g dbSNP:771382634
1274 1274 a, g dbSNP:749613899
1275 1275 c, t dbSNP:62644469
1276 1276 a, g dbSNP:773526027
1277 1277 c, t dbSNP:62644465
1278 1278 -, c dbSNP:62644489
1278 1278 c, t dbSNP:62644473
1280 1280 c, t dbSNP:5030858
1281 1281 a, g dbSNP:5030859
1287 1287 c, g, t dbSNP:62644475
1290 1290 a, c dbSNP:62644477
1295 1295 a, c, t dbSNP:62644467
1296 1296 a, c, g dbSNP:79931499
1298 1298 c, t dbSNP:281865437
1299 1299 a, g dbSNP:5030860
1300 1300 c, t dbSNP:1801152
1301 1301 a, g dbSNP:62644499
1307 1307 a, c, t dbSNP:62644471
1310 1310 a, c dbSNP:62644501
1312 1312 c, t dbSNP:755787172
1314 1314 a, g dbSNP:752255985
1317 1317 g, t dbSNP:767075719
1320 1320 c, t dbSNP:199475696
1322 1322 a, g dbSNP:199475621
1328 1328 c, t dbSNP:148041893
1329 1329 c, t dbSNP:199475670
1336 1336 c, t dbSNP:59326968
1340 1340 c, g dbSNP:567261857
1343 1343 a, c, t dbSNP:764974157
1344 1344 a, c dbSNP:794727047
1347 1347 c, t dbSNP:199475607
1357 1357 a, g dbSNP:770034263
1359 1359 a, c dbSNP:199475659
1363 1363 a, t dbSNP:748303375
1372 1372 c, t dbSNP:776064023
1374 1374 a, g dbSNP:775391163
1394 1394 a, g dbSNP:565686453
1395 1395 a, g dbSNP:770906256
1396 1396 c, t dbSNP:749175668
1398 1398 a, c dbSNP:76542238
1401 1401 a, t dbSNP:769777460
1402 1402 c, t dbSNP:747923532
1410 1410 -, taaag dbSNP:794727086
1410 1410 c, t dbSNP:781041737
1413 1413 -, a dbSNP:199475641
1415 1415 -, t dbSNP:199475669
1418 1418 a, c dbSNP:753390788
1421 1421 c, t dbSNP:754538733
1426 1426 a, g dbSNP:751112303
1428 1428 a, g dbSNP:549252036
1431 1431 a, c dbSNP:377262652
1436 1436 g, t dbSNP:372637021
1438 1438 c, t dbSNP:765731166
1439 1439 c, t dbSNP:368468051
1443 1443 a, g dbSNP:754149413
1444 1444 c, g dbSNP:375002761
1451 1451 a, t dbSNP:760738010
1455 1455 a, g dbSNP:775652203
1456 1456 c, t dbSNP:772101462
1458 1458 c, g dbSNP:371395498
1479 1479 c, t dbSNP:563478341
1484 1484 c, t dbSNP:779103782
1496 1496 a, g dbSNP:569495604
1526 1526 c, t dbSNP:1042517
1545 1545 a, g dbSNP:530983165
1558 1558 a, c dbSNP:565281224
1561 1561 a, g dbSNP:375319584
1604 1604 a, g dbSNP:1801153
1658 1658 a, t dbSNP:559828549
1703 1703 a, g dbSNP:773259521
1759 1759 c, t dbSNP:543283408
1778 1778 a, g dbSNP:763061595
1784 1784 a, g dbSNP:775532941
1785 1785 a, t dbSNP:189657033
1837 1837 a, g dbSNP:367935352
1882 1882 a, g dbSNP:184297770
1921 1921 a, g dbSNP:1042575
2007 2007 a, g dbSNP:536759523
2065 2065 g, t dbSNP:141177123
2067 2067 a, g dbSNP:180991851
2069 2069 c, g dbSNP:534358723
2116 2116 c, t dbSNP:189466448
2152 2152 c, t dbSNP:185081299
2189 2189 -, gtaa dbSNP:551502562
2201 2201 c, t dbSNP:571912294
2214 2214 a, c dbSNP:535715056

Target ORF information:

RefSeq Version XM_011538422
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens phenylalanine hydroxylase (PAH), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu25787D
Sequence Information ORF Nucleotide Sequence (Length: 1359bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product phenylalanine-4-hydroxylase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U49897.1. This sequence is a reference standard in the RefSeqGene project. Summary: PAH encodes the enzyme phenylalanine hydroxylase that is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U49897.1, K03020.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1968540 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)386..388(+)
Misc Feature(2)518..520(+)
Misc Feature(3)530..1828(+)
Misc Feature(4)533..802(+)
Misc Feature(5)533..553(+)
Misc Feature(6)608..679(+)
Misc Feature(7)827..1744(+)
Misc Feature(8)884..1522(+)
Misc Feature(9)1211..1447(+)
Misc Feature(10)1325..1462(+)
Exon (1)1..532
Gene Synonym:
Exon (2)533..640
Gene Synonym:
Exon (3)641..824
Gene Synonym:
Exon (4)825..913
Gene Synonym:
Exon (5)914..981
Gene Synonym:
Exon (6)982..1178
Gene Synonym:
Exon (7)1179..1314
Gene Synonym:
Exon (8)1315..1384
Gene Synonym:
Exon (9)1385..1441
Gene Synonym:
Exon (10)1442..1537
Gene Synonym:
Exon (11)1538..1671
Gene Synonym:
Exon (12)1672..1787
Gene Synonym:
Exon (13)1788..2680
Gene Synonym:
Position Chain Variation Link
14 14 -, g dbSNP:752233344
15 15 c, g dbSNP:758376327
19 19 -, g dbSNP:113191080
51 51 c, g dbSNP:535971161
79 79 c, t dbSNP:748429144
97 97 a, g dbSNP:369544823
100 100 a, t dbSNP:779300086
128 128 c, t dbSNP:555581153
133 133 a, g dbSNP:556724761
157 157 c, t dbSNP:537351089
158 158 c, t dbSNP:35465699
159 159 g, t dbSNP:185674882
227 227 c, t dbSNP:2280616
243 243 c, g dbSNP:181966604
246 246 c, g dbSNP:547091601
249 249 a, g dbSNP:199475594
251 251 a, g dbSNP:74820934
291 291 c, t dbSNP:189522790
299 299 a, g dbSNP:544326639
323 323 a, g dbSNP:372622473
326 326 c, t dbSNP:62517177
337 337 c, t dbSNP:565404802
352 352 c, g dbSNP:147266631
369 369 c, t dbSNP:767107144
392 392 c, t dbSNP:7954004
402 402 a, c dbSNP:2280615
404 404 a, g dbSNP:542307750
423 423 c, g dbSNP:772360697
425 425 -, g dbSNP:763402355
428 428 c, t dbSNP:746106548
434 434 g, t dbSNP:779160321
445 445 c, g dbSNP:771176183
451 451 a, g dbSNP:749365596
463 463 a, g dbSNP:777884173
464 464 c, g dbSNP:573703749
467 467 g, t dbSNP:185069853
472 472 c, t dbSNP:62507266
473 473 a, g, t dbSNP:62514891
474 474 c, g, t dbSNP:62508575
475 475 a, g dbSNP:62514893
478 478 c, t dbSNP:750239990
483 483 c, t dbSNP:765022724
484 484 a, g dbSNP:536605300
491 491 c, g dbSNP:753312947
494 494 a, g dbSNP:763623193
496 496 c, t dbSNP:761094025
502 502 c, g dbSNP:1801145
505 505 a, g dbSNP:772557951
514 514 a, g dbSNP:759956741
518 518 c, t dbSNP:62642946
519 519 -, ct dbSNP:62642906
523 523 c, g, t dbSNP:150366430
527 527 c, g dbSNP:771104344
530 530 c, t dbSNP:199475585
531 531 a, t dbSNP:199475662
532 532 c, g dbSNP:199475688
535 535 a, c dbSNP:753466976
537 537 a, c dbSNP:199565868
543 543 a, g, t dbSNP:539994406
577 577 a, c dbSNP:768048739
579 579 c, t dbSNP:760011862
580 580 a, g dbSNP:17852374
583 583 -, g dbSNP:199475674
587 587 -, ttc dbSNP:199475565
588 588 -, tct dbSNP:762462102
591 591 c, t dbSNP:62642938
593 593 c, t dbSNP:62642928
594 594 c, t dbSNP:62642916
597 597 a, g, t dbSNP:62635346
601 601 a, g dbSNP:763089464
602 602 -, gaa dbSNP:199475640
603 603 -, aag dbSNP:199475628
607 607 g, t dbSNP:773425620
608 608 a, g dbSNP:74603784
609 609 -, g dbSNP:199475591
612 612 a, c, t dbSNP:118203925
614 614 c, t dbSNP:547150887
615 615 c, t dbSNP:5030841
620 620 a, g dbSNP:776829633
623 623 a, g dbSNP:772159852
627 627 c, t dbSNP:199475630
627 627 -, t dbSNP:281865165
629 629 a, c, t dbSNP:199475619
630 630 a, g dbSNP:118092776
633 633 c, t dbSNP:199475677
634 634 a, g dbSNP:143358918
636 636 c, t dbSNP:281865438
637 637 g, t dbSNP:199475598
637 637 -, t dbSNP:199475566
640 640 a, g, t dbSNP:199475567
641 641 -, gagaatgatgtaaacctgacccacattgaatctagaccttctcgttta aagaaagatgagtatgaatttttcacccatttggataaacgtagcctgcctgctctga caaacatcatcaagatcttgaggcatgacattggtgccactgtccatgagctttcacg agataagaagaaagacacag dbSNP:199475570
641 641 -, gag dbSNP:199475665
641 641 a, g, t dbSNP:140945592
647 647 g, t dbSNP:199475635
648 648 a, g dbSNP:199475672
649 649 c, t dbSNP:768292157
653 653 a, g dbSNP:199475651
655 655 a, c, g dbSNP:199475634
658 658 a, g dbSNP:779383205
659 659 a, c dbSNP:199475568
662 662 a, c dbSNP:199475569
662 662 -, c dbSNP:672601294
665 665 a, g dbSNP:199475643
668 668 g, t dbSNP:281865454
670 670 a, g dbSNP:117308669
671 671 c, t dbSNP:5030842
674 674 a, g dbSNP:199475639
676 676 a, t dbSNP:76394784
677 677 c, t dbSNP:199475678
678 678 -, ctt dbSNP:199475687
679 679 -, ttc dbSNP:199475620
679 679 g, t dbSNP:550724569
680 680 -, tct dbSNP:62642094
680 680 c, t dbSNP:63048261
682 682 -, ccttct dbSNP:281865431
684 684 a, g dbSNP:62508695
685 685 c, t dbSNP:757727922
686 686 g, t dbSNP:760782775
694 694 a, g dbSNP:374797155
695 695 a, g dbSNP:767453024
698 698 c, g dbSNP:762949770
699 699 a, c, g dbSNP:62507347
703 703 c, g, t dbSNP:62507332
704 704 a, g dbSNP:62507326
713 713 -, acccatttggataaac dbSNP:63749677
713 713 a, c dbSNP:62509017
716 716 a, c dbSNP:769705809
722 722 g, t dbSNP:62514902
727 727 a, g dbSNP:776378866
728 728 c, t dbSNP:768320548
729 729 a, g dbSNP:746603180
732 732 a, g dbSNP:368152528
733 733 a, c dbSNP:62516151
736 736 -, c dbSNP:62506950
737 737 c, t dbSNP:62507270
738 738 -, c dbSNP:62517202
747 747 c, t dbSNP:62514903
752 752 a, g dbSNP:528078207
753 753 g, t dbSNP:62508677
755 755 -, atc dbSNP:62514904
755 755 a, t dbSNP:62508682
756 756 -, tca dbSNP:62508727
756 756 ca, tc dbSNP:281865432
761 761 a, c dbSNP:142516271
765 765 c, t dbSNP:62517167
768 768 c, g dbSNP:778230838
771 771 a, g dbSNP:148393887
777 777 c, t dbSNP:62508591
779 779 g, t dbSNP:752792040
782 782 -, gccactgtc dbSNP:398123291
783 783 a, c dbSNP:62642929
792 792 a, g dbSNP:542645236
801 801 c, t dbSNP:199475627
802 802 a, g dbSNP:573940903
803 803 c, t dbSNP:76296470
816 816 -, aaga dbSNP:199475648
822 822 -, c dbSNP:281865428
822 822 c, t dbSNP:281865439
824 824 a, g dbSNP:776442422
827 827 c, t dbSNP:398123292
828 828 c, g, t dbSNP:374999809
829 829 -, c dbSNP:794727619
830 830 c, t dbSNP:775327122
831 831 a, g dbSNP:199475586
837 837 a, c dbSNP:199475622
840 840 g, t dbSNP:199475681
843 843 c, t dbSNP:199475571
853 853 c, g dbSNP:767127989
857 857 g, t dbSNP:199475606
858 858 a, g, t dbSNP:199475623
870 870 -, atca dbSNP:199475605
871 871 c, t dbSNP:145692106
872 872 c, t dbSNP:199475680
883 883 c, t dbSNP:1801146
888 888 a, g dbSNP:375384973
891 891 a, c, t dbSNP:372657268
892 892 a, g dbSNP:200366386
896 896 c, t dbSNP:375364629
900 900 a, g dbSNP:199475572
906 906 a, t dbSNP:140175796
908 908 c, t dbSNP:199475599
910 910 c, t dbSNP:191142120
911 911 c, t dbSNP:199475624
912 912 c, t dbSNP:199475694
914 914 -, ggttttaaagatcctgtgtaccgtgcaagacggaagcagtttgctgac attgcctacaactaccgcca dbSNP:199475649
914 914 a, g dbSNP:80297647
919 919 c, t dbSNP:770990005
922 922 a, g dbSNP:749317892
923 923 c, g dbSNP:199475597
924 924 a, g dbSNP:199475625
928 928 c, t dbSNP:377244118
932 932 a, c, t dbSNP:199475587
935 935 c, t dbSNP:539743701
936 936 a, c, g dbSNP:199475663
938 938 c, g dbSNP:199475686
939 939 c, t dbSNP:570748767
942 942 a, g, t dbSNP:199475611
943 943 a, c dbSNP:199475612
944 944 c, t dbSNP:75166491
945 945 a, c, g dbSNP:5030843
951 951 a, c dbSNP:199475601
954 954 c, t dbSNP:79635844
956 956 g, t dbSNP:547566250
962 962 a, g dbSNP:199475647
963 963 c, t dbSNP:199475595
965 965 a, c, g dbSNP:199475626
969 969 a, g dbSNP:753254031
970 970 a, c dbSNP:199475645
972 972 a, g, t dbSNP:77554925
974 974 c, t dbSNP:199475646
975 975 -, a dbSNP:199475661
976 976 a, c dbSNP:281865455
977 977 -, cccccc dbSNP:144835074
977 977 c, t dbSNP:281865440
978 978 a, g dbSNP:199475679
980 980 c, g dbSNP:199475655
981 981 a, g dbSNP:199475573
982 982 a, g, t dbSNP:199475652
983 983 a, g, t dbSNP:199475613
984 984 c, g dbSNP:199475596
985 985 g, t dbSNP:143211522
986 986 c, t dbSNP:199475588
988 988 g, t dbSNP:192592111
989 989 a, c dbSNP:199475574
992 992 a, g dbSNP:199475632
993 993 a, c, t dbSNP:138809906
995 995 c, g dbSNP:199475604
998 998 c, t dbSNP:199475575
999 999 a, c, g, t dbSNP:74486803
1001 1001 a, c, g dbSNP:199475602
1005 1005 a, g, t dbSNP:77958223
1007 1007 a, c, t dbSNP:199475671
1011 1011 g, t dbSNP:745723155
1017 1017 a, g dbSNP:199475617
1019 1019 ga, tt dbSNP:281865433
1019 1019 a, c, g dbSNP:199475664
1020 1020 a, g dbSNP:17852373
1028 1028 -, a dbSNP:62507328
1030 1030 -, at dbSNP:62517207
1031 1031 c, t dbSNP:62507272
1033 1033 a, c, g dbSNP:62507336
1035 1035 a, c, g dbSNP:199475689
1035 1035 -, g dbSNP:62507260
1036 1036 c, t dbSNP:777274367
1040 1040 a, g dbSNP:281865441
1041 1041 c, t dbSNP:62514919
1051 1051 c, t dbSNP:752202371
1052 1052 -, ct dbSNP:62508587
1053 1053 c, t dbSNP:5030844
1058 1058 -, tccttgtataaaacccatgcttg dbSNP:62895363
1060 1060 c, t dbSNP:755420480
1062 1062 -, tgtataaaacccatgcttgctat dbSNP:63083561
1063 1063 c, g dbSNP:281865442
1064 1064 -, tataaaacccatgcttgctatg dbSNP:199475697
1065 1065 -, ataaaacccatgcttgctatga dbSNP:63749676
1070 1070 -, a dbSNP:62508643
1073 1073 c, t dbSNP:62517205
1074 1074 a, g dbSNP:62517180
1075 1075 c, t dbSNP:751977644
1080 1080 a, g dbSNP:62507271
1081 1081 c, g, t dbSNP:1801147
1083 1083 a, g dbSNP:62514927
1084 1084 c, g, t dbSNP:62514928
1085 1085 a, g dbSNP:63083560
1086 1086 a, c dbSNP:62508593
1087 1087 a, g dbSNP:765552494
1088 1088 g, t dbSNP:62517170
1089 1089 a, g dbSNP:62508728
1090 1090 a, c, g dbSNP:62517201
1091 1091 a, g dbSNP:62508572
1092 1092 a, g dbSNP:62508721
1103 1103 a, c dbSNP:62514931
1104 1104 -, c dbSNP:62514929
1104 1104 c, t dbSNP:281865443
1107 1107 c, t dbSNP:62517198
1110 1110 c, t dbSNP:62516109
1114 1114 a, g dbSNP:373782868
1120 1120 c, g dbSNP:62509013
1121 1121 c, g, t dbSNP:62508718
1122 1122 a, g dbSNP:62508617
1125 1125 g, t dbSNP:62514933
1126 1126 c, t dbSNP:777465976
1134 1134 a, g dbSNP:62514934
1135 1135 -, ag dbSNP:62514936
1136 1136 -, ga dbSNP:759154440
1137 1137 a, g, t dbSNP:62507319
1140 1140 a, g, t dbSNP:201245932
1143 1143 c, t dbSNP:62507323
1144 1144 g, t dbSNP:199475576
1145 1145 a, c, g dbSNP:199475589
1146 1146 c, g, t dbSNP:62517204
1148 1148 c, t dbSNP:62508696
1150 1150 c, g, t dbSNP:62508615
1153 1153 a, g dbSNP:182135145
1154 1154 a, g dbSNP:281865444
1160 1160 a, g dbSNP:62516152
1161 1161 g, t dbSNP:199475673
1163 1163 c, t dbSNP:5030845
1164 1164 c, t dbSNP:62508577
1166 1166 c, t dbSNP:62507348
1168 1168 a, c, g dbSNP:1126758
1171 1171 a, c dbSNP:62517208
1176 1176 a, c dbSNP:199475656
1181 1181 c, t dbSNP:372723640
1184 1184 a, c dbSNP:199475577
1187 1187 a, g dbSNP:62517178
1188 1188 a, c, g, t dbSNP:62507283
1190 1190 g, t dbSNP:62507337
1191 1191 c, t dbSNP:62508594
1193 1193 c, t dbSNP:76687508
1194 1194 a, g, t dbSNP:62508730
1194 1194 -, g dbSNP:199475657
1196 1196 c, t dbSNP:199475578
1199 1199 c, t dbSNP:5030846
1200 1200 a, g, t dbSNP:62508588
1203 1203 c, t dbSNP:118203923
1205 1205 a, c, g dbSNP:62508694
1206 1206 a, c, t dbSNP:76212747
1207 1207 a, g dbSNP:1042503
1209 1209 a, c, t dbSNP:199475610
1209 1209 -, c dbSNP:199475666
1211 1211 a, c, g dbSNP:62508731
1212 1212 a, g, t dbSNP:199475579
1215 1215 c, g, t dbSNP:62507340
1217 1217 c, t dbSNP:74503222
1218 1218 a, t dbSNP:62507338
1224 1224 c, t dbSNP:369646949
1226 1226 c, g, t dbSNP:5030847
1227 1227 a, g dbSNP:62644503
1229 1229 a, g dbSNP:765533320
1232 1232 a, t dbSNP:62642909
1235 1235 g, t dbSNP:62642931
1236 1236 c, t dbSNP:62642930
1241 1241 a, g, t dbSNP:5030848
1242 1242 a, g, t dbSNP:62642908
1243 1243 c, t dbSNP:544995045
1244 1244 c, t dbSNP:75065106
1247 1247 a, g dbSNP:62642932
1248 1248 c, t dbSNP:118203921
1253 1253 c, g, t dbSNP:5030850
1254 1254 a, c, g dbSNP:5030849
1257 1257 g, t dbSNP:281865445
1258 1258 c, t dbSNP:776860902
1261 1261 c, g dbSNP:62642944
1262 1262 c, t dbSNP:749668037
1263 1263 a, t dbSNP:199475580
1265 1265 g, t dbSNP:62517181
1266 1266 a, g dbSNP:62507335
1268 1268 a, c, g dbSNP:62508752
1269 1269 a, c dbSNP:62508753
1271 1271 c, g dbSNP:199475676
1272 1272 a, t dbSNP:778154939
1273 1273 c, g, t dbSNP:199475675
1274 1274 c, t dbSNP:62507263
1276 1276 c, t dbSNP:748337823
1277 1277 a, c, g dbSNP:62508692
1278 1278 a, t dbSNP:199475644
1278 1278 -, t dbSNP:62508687
1280 1280 a, g dbSNP:199475690
1281 1281 a, g dbSNP:62514950
1282 1282 -, acatg dbSNP:62507286
1282 1282 a, t dbSNP:62514951
1283 1283 c, t dbSNP:62517164
1284 1284 a, g, t dbSNP:199475692
1286 1286 g, t dbSNP:62514952
1290 1290 c, t dbSNP:62514953
1292 1292 a, g dbSNP:142934616
1294 1294 -, gcccatgtata dbSNP:199475581
1295 1295 c, t dbSNP:62508691
1296 1296 c, g, t dbSNP:62508715
1298 1298 a, g, t dbSNP:62516149
1299 1299 a, c, g, t dbSNP:62508722
1300 1300 g, t dbSNP:62514954
1301 1301 g, t dbSNP:78655458
1302 1302 a, g dbSNP:62516155
1303 1303 c, t dbSNP:773720549
1304 1304 a, g dbSNP:62516156
1305 1305 a, c, t dbSNP:62507262
1309 1309 -, c dbSNP:281865429
1309 1309 c, t dbSNP:138355741
1310 1310 a, c, g dbSNP:62508698
1311 1311 -, t dbSNP:199475653
1311 1311 a, g dbSNP:62508734
1313 1313 c, g, t dbSNP:199475654
1314 1314 c, t dbSNP:5030851
1315 1315 c, t dbSNP:772249197
1316 1316 a, g dbSNP:199475582
1317 1317 a, g dbSNP:199475660
1319 1319 a, t dbSNP:62517168
1320 1320 a, t dbSNP:62508693
1322 1322 c, t dbSNP:199475682
1325 1325 c, t dbSNP:199475636
1328 1328 a, g dbSNP:62508739
1330 1330 a, g dbSNP:556021587
1331 1331 c, g dbSNP:781096854
1333 1333 a, g dbSNP:754686336
1336 1336 c, g dbSNP:62507327
1337 1337 c, g dbSNP:199475693
1341 1341 a, g, t dbSNP:62642919
1342 1342 c, t dbSNP:751203209
1356 1356 c, g dbSNP:62642910
1358 1358 a, g dbSNP:765934604
1359 1359 a, g dbSNP:281865446
1361 1361 c, t dbSNP:62642945
1362 1362 a, g dbSNP:62642939
1366 1366 c, t dbSNP:765823928
1367 1367 -, ttt dbSNP:62507267
1368 1368 g, t dbSNP:62642933
1370 1370 g, t dbSNP:5030853
1371 1371 c, t dbSNP:199475609
1376 1376 -, t dbSNP:62642920
1379 1379 c, g, t dbSNP:199475608
1383 1383 a, g dbSNP:199475592
1384 1384 a, g dbSNP:199475583
1388 1388 -, a dbSNP:281865456
1388 1388 a, g dbSNP:62642934
1394 1394 c, g, t dbSNP:62642095
1398 1398 a, c, t dbSNP:62642935
1401 1401 -, ctctgggtgca dbSNP:62651568
1401 1401 a, c, t dbSNP:62642913
1403 1403 -, ct dbSNP:281865430
1404 1404 c, t dbSNP:62642936
1405 1405 g, t dbSNP:771080801
1406 1406 a, g dbSNP:763115697
1407 1407 a, g dbSNP:62642915
1408 1408 c, t dbSNP:776778122
1409 1409 a, g, t dbSNP:62642912
1410 1410 c, t dbSNP:62642914
1412 1412 a, c, t dbSNP:199475650
1412 1412 -, c dbSNP:62642907
1413 1413 a, c dbSNP:62642940
1415 1415 g, t dbSNP:62642917
1425 1425 c, t dbSNP:62642918
1427 1427 g, t dbSNP:398123294
1432 1432 c, g, t dbSNP:199475615
1435 1435 c, g, t dbSNP:61747292
1436 1436 a, g dbSNP:62514957
1437 1437 c, g dbSNP:62514958
1439 1439 -, aca dbSNP:199475618
1441 1441 a, g dbSNP:199475637
1446 1446 a, g dbSNP:62508578
1447 1447 c, g dbSNP:62508573
1449 1449 a, g dbSNP:62514959
1452 1452 a, t dbSNP:535752872
1453 1453 g, t dbSNP:199475642
1454 1454 a, g dbSNP:199475616
1458 1458 c, t dbSNP:748816402
1462 1462 c, g dbSNP:62508580
1463 1463 c, t dbSNP:62517179
1464 1464 g, t dbSNP:199475614
1467 1467 a, g dbSNP:62508589
1469 1469 c, t dbSNP:62516060
1471 1471 c, t dbSNP:777221457
1473 1473 c, g dbSNP:62517174
1474 1474 c, t dbSNP:140243918
1476 1476 a, c dbSNP:281865434
1478 1478 c, g, t dbSNP:62516061
1479 1479 a, g dbSNP:62508735
1482 1482 a, g, t dbSNP:62517206
1484 1484 g, t dbSNP:62516150
1491 1491 c, t dbSNP:62508720
1493 1493 a, t dbSNP:62517200
1494 1494 a, c, g dbSNP:62516153
1495 1495 a, g dbSNP:550037937
1496 1496 a, c, g dbSNP:62507282
1496 1496 -, g dbSNP:63581460
1498 1498 a, c dbSNP:766756246
1499 1499 g, t dbSNP:62508651
1500 1500 a, g, t dbSNP:62507265
1502 1502 a, c, g dbSNP:62508679
1503 1503 a, g, t dbSNP:62508582
1504 1504 c, t dbSNP:758646909
1505 1505 a, g, t dbSNP:62516062
1508 1508 a, c, g dbSNP:62508688
1510 1510 -, g dbSNP:62516063
1511 1511 c, t dbSNP:62516154
1514 1514 c, g dbSNP:62516092
1515 1515 -, tgtcatccttt dbSNP:199475600
1517 1517 c, g, t dbSNP:62508646
1518 1518 a, c, t dbSNP:62507279
1519 1519 -, gtca dbSNP:62516157
1519 1519 a, t dbSNP:775356291
1520 1520 a, t dbSNP:62517183
1521 1521 a, c dbSNP:62508628
1526 1526 c, g, t dbSNP:62508686
1527 1527 -, g dbSNP:62516094
1528 1528 -, t dbSNP:62507350
1535 1535 c, t dbSNP:199475633
1538 1538 -, ta dbSNP:199475490
1538 1538 c, t dbSNP:62507320
1541 1541 g, t dbSNP:62508595
1543 1543 c, t dbSNP:766107583
1546 1546 a, t dbSNP:376480977
1548 1548 c, g dbSNP:5030854
1553 1553 a, t dbSNP:772918939
1556 1556 a, c, t dbSNP:62507329
1559 1559 -, aa dbSNP:199475667
1561 1561 -, g dbSNP:5030654
1561 1561 g, t dbSNP:63329263
1562 1562 -, cttctccccctggag dbSNP:62516097
1562 1562 -, ctt dbSNP:62516096
1564 1564 -, tctccccctggagct dbSNP:786200862
1564 1564 -, tct dbSNP:786200861
1567 1567 c, g dbSNP:747661840
1569 1569 a, c dbSNP:62516098
1570 1570 -, c dbSNP:62506951
1570 1570 a, c dbSNP:776159017
1571 1571 -, c dbSNP:62517203
1571 1571 -, c dbSNP:62508620
1572 1572 c, t dbSNP:62508574
1573 1573 a, g dbSNP:62508648
1584 1584 a, g dbSNP:62507268
1586 1586 a, t dbSNP:62517163
1589 1589 -, gc dbSNP:62516099
1589 1589 a, g dbSNP:62508717
1592 1592 a, g dbSNP:769076484
1595 1595 c, g dbSNP:184148104
1599 1599 -, a dbSNP:62642921
1601 1601 -, t dbSNP:62642941
1602 1602 a, g dbSNP:62642942
1604 1604 a, t dbSNP:62642911
1605 1605 c, t dbSNP:780691974
1607 1607 c, g dbSNP:772630527
1608 1608 c, t dbSNP:746203167
1609 1609 c, g dbSNP:779053558
1611 1611 c, t dbSNP:62642937
1612 1612 a, g, t dbSNP:373763334
1613 1613 a, g dbSNP:267603271
1624 1624 c, g dbSNP:281865458
1627 1627 a, c, g dbSNP:772897
1628 1628 g, t dbSNP:199475691
1629 1629 a, g dbSNP:62516141
1631 1631 c, t dbSNP:62517194
1633 1633 c, t dbSNP:149595475
1635 1635 -, tg dbSNP:199475629
1635 1635 c, t dbSNP:281865435
1638 1638 -, c dbSNP:62506949
1641 1641 a, g dbSNP:5030856
1643 1643 a, g dbSNP:281865453
1646 1646 a, t dbSNP:180819807
1647 1647 c, t dbSNP:199475695
1649 1649 a, c dbSNP:761487922
1652 1652 c, g, t dbSNP:62516142
1653 1653 a, c dbSNP:62516102
1655 1655 c, g dbSNP:62516103
1656 1656 a, c, g dbSNP:62508736
1657 1657 a, c dbSNP:760256025
1659 1659 a, g dbSNP:776178623
1660 1660 a, g dbSNP:772683682
1666 1666 a, g dbSNP:199475638
1668 1668 -, taag dbSNP:199475603
1668 1668 c, t dbSNP:281865436
1669 1669 a, t dbSNP:199475584
1670 1670 -, a dbSNP:199475590
1670 1670 a, c dbSNP:199475593
1671 1671 a, c, g dbSNP:199475658
1676 1676 c, t dbSNP:62508725
1680 1680 c, t dbSNP:5030857
1687 1687 a, g dbSNP:771382634
1688 1688 a, g dbSNP:749613899
1689 1689 c, t dbSNP:62644469
1690 1690 a, g dbSNP:773526027
1691 1691 c, t dbSNP:62644465
1692 1692 -, c dbSNP:62644489
1692 1692 c, t dbSNP:62644473
1694 1694 c, t dbSNP:5030858
1695 1695 a, g dbSNP:5030859
1701 1701 c, g, t dbSNP:62644475
1704 1704 a, c dbSNP:62644477
1709 1709 a, c, t dbSNP:62644467
1710 1710 a, c, g dbSNP:79931499
1712 1712 c, t dbSNP:281865437
1713 1713 a, g dbSNP:5030860
1714 1714 c, t dbSNP:1801152
1715 1715 a, g dbSNP:62644499
1721 1721 a, c, t dbSNP:62644471
1724 1724 a, c dbSNP:62644501
1726 1726 c, t dbSNP:755787172
1728 1728 a, g dbSNP:752255985
1731 1731 g, t dbSNP:767075719
1734 1734 c, t dbSNP:199475696
1736 1736 a, g dbSNP:199475621
1742 1742 c, t dbSNP:148041893
1743 1743 c, t dbSNP:199475670
1750 1750 c, t dbSNP:59326968
1754 1754 c, g dbSNP:567261857
1757 1757 a, c, t dbSNP:764974157
1758 1758 a, c dbSNP:794727047
1761 1761 c, t dbSNP:199475607
1771 1771 a, g dbSNP:770034263
1773 1773 a, c dbSNP:199475659
1777 1777 a, t dbSNP:748303375
1786 1786 c, t dbSNP:776064023
1788 1788 a, g dbSNP:775391163
1808 1808 a, g dbSNP:565686453
1809 1809 a, g dbSNP:770906256
1810 1810 c, t dbSNP:749175668
1812 1812 a, c dbSNP:76542238
1815 1815 a, t dbSNP:769777460
1816 1816 c, t dbSNP:747923532
1824 1824 -, taaag dbSNP:794727086
1824 1824 c, t dbSNP:781041737
1827 1827 -, a dbSNP:199475641
1829 1829 -, t dbSNP:199475669
1832 1832 a, c dbSNP:753390788
1835 1835 c, t dbSNP:754538733
1840 1840 a, g dbSNP:751112303
1842 1842 a, g dbSNP:549252036
1845 1845 a, c dbSNP:377262652
1850 1850 g, t dbSNP:372637021
1852 1852 c, t dbSNP:765731166
1853 1853 c, t dbSNP:368468051
1857 1857 a, g dbSNP:754149413
1858 1858 c, g dbSNP:375002761
1865 1865 a, t dbSNP:760738010
1869 1869 a, g dbSNP:775652203
1870 1870 c, t dbSNP:772101462
1872 1872 c, g dbSNP:371395498
1893 1893 c, t dbSNP:563478341
1898 1898 c, t dbSNP:779103782
1910 1910 a, g dbSNP:569495604
1940 1940 c, t dbSNP:1042517
1959 1959 a, g dbSNP:530983165
1972 1972 a, c dbSNP:565281224
1975 1975 a, g dbSNP:375319584
2018 2018 a, g dbSNP:1801153
2072 2072 a, t dbSNP:559828549
2117 2117 a, g dbSNP:773259521
2173 2173 c, t dbSNP:543283408
2192 2192 a, g dbSNP:763061595
2198 2198 a, g dbSNP:775532941
2199 2199 a, t dbSNP:189657033
2251 2251 a, g dbSNP:367935352
2296 2296 a, g dbSNP:184297770
2335 2335 a, g dbSNP:1042575
2421 2421 a, g dbSNP:536759523
2479 2479 g, t dbSNP:141177123
2481 2481 a, g dbSNP:180991851
2483 2483 c, g dbSNP:534358723
2530 2530 c, t dbSNP:189466448
2566 2566 c, t dbSNP:185081299
2603 2603 -, gtaa dbSNP:551502562
2615 2615 c, t dbSNP:571912294
2628 2628 a, c dbSNP:535715056

Target ORF information:

RefSeq Version NM_000277
Organism Homo sapiens (human)
Definition Homo sapiens phenylalanine hydroxylase (PAH), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.