
PDHA1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol PDHA1
Entrez Gene ID 5160
Full Name pyruvate dehydrogenase (lipoamide) alpha 1
General protein information
Preferred Names
pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
PDHE1-A type I
pyruvate dehydrogenase complex, E1-alpha polypeptide 1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. lac of sum
Disorder MIM:


Disorder Html: Pyruvate dehydrogenase deficiency, 312170 (3); Leigh syndrome,

mRNA and Protein(s)

mRNA Protein Name
XM_011545531 XP_011543833 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X1
XM_011545532 XP_011543834 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X2
NM_001173456 NP_001166927 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 4 precursor
NM_001173454 NP_001166925 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 2 precursor
NM_001173455 NP_001166926 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 3 precursor
NM_000284 NP_000275 pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 1 precursor

hsa00020 Citrate cycle (TCA cycle)
hsa00010 Glycolysis / Gluconeogenesis
hsa00620 Pyruvate metabolism
hsa01100 Metabolic pathways
hsa_M00307 Pyruvate oxidation, pyruvate => acetyl-CoA
hsa04066 HIF-1 signaling pathway
hsa05230 Central carbon metabolism in cancer
hsa01130 Biosynthesis of antibiotics
hsa04922 Glucagon signaling pathway
hsa01200 Carbon metabolism
R-HSA-162582 Signal Transduction
R-HSA-5362517 Signaling by Retinoic Acid
R-HSA-1430728 Metabolism
R-HSA-204174 Regulation of pyruvate dehydrogenase (PDH) complex
R-HSA-70268 Pyruvate metabolism
R-HSA-71406 Pyruvate metabolism and Citric Acid (TCA) cycle
WP528 Acetylcholine Synthesis
WP534 Glycolysis and Gluconeogenesis
HUMAN_PYRUVDEHYD-PWY pyruvate decarboxylation to acetyl CoA
META_PYRUVDEHYD-PWY pyruvate decarboxylation to acetyl CoA
HUMAN_PWY66-407 superpathway of conversion of glucose to acetyl CoA and entry into the TCA cycle

Homo sapiens (human) PDHA1 NP_001166926.1
Pan troglodytes (chimpanzee) PDHA1 NP_001104283.1
Macaca mulatta (Rhesus monkey) LOC719277 XP_001113273.2
Canis lupus familiaris (dog) PDHA1 XP_003435519.1
Bos taurus (cattle) PDHA1 NP_001094516.1
Mus musculus (house mouse) Pdha1 NP_032836.1
Rattus norvegicus (Norway rat) Pdha1 NP_001004072.2
Gallus gallus (chicken) PDHA1 NP_001012562.1
Danio rerio (zebrafish) pdha1b NP_001002399.1
Danio rerio (zebrafish) pdha1a NP_998558.1
Caenorhabditis elegans pdha-1 NP_871953.1
Arabidopsis thaliana (thale cress) IAR4 NP_173828.1
Arabidopsis thaliana (thale cress) E1 ALPHA NP_176198.1
Xenopus (Silurana) tropicalis (western clawed frog) pdha1 NP_001017072.1


ID Name Evidence
GO:0005739 mitochondrion IEA
GO:0005759 mitochondrial matrix TAS


ID Name Evidence
GO:0004739 pyruvate dehydrogenase (acetyl-transferring) activity IEA
GO:0005515 protein binding IPI
GO:0016491 oxidoreductase activity IEA


ID Name Evidence
GO:0006090 pyruvate metabolic process TAS
GO:0006096 glycolysis IEA
GO:0010510 regulation of acetyl-CoA biosynthetic process from pyruvate EXP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following PDHA1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PDHA1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59599 XM_011545531 PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu59600 XM_011545532 PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
NM_001173456 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu11172 NM_001173454 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $359.00
OHu11667 NM_001173455 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $339.00
NM_000284 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu59599
Accession Version XM_011545531.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1308bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)436..1326(+)
Misc Feature(2)508..1167(+)
Misc Feature(3)619..1143(+)
Misc Feature(4)745..906(+)
Misc Feature(5)1126..1215(+)
Position Chain Variation Link
22 22 g, t dbSNP:781441358
35 35 c, t dbSNP:192773464
45 45 a, g dbSNP:5955751
61 61 a, g dbSNP:778593749
75 75 c, t dbSNP:775567462
82 82 c, g, t dbSNP:745758119
83 83 g, t dbSNP:771905403
87 87 c, t dbSNP:778551493
89 89 a, c dbSNP:745761659
91 91 g, t dbSNP:772091896
92 92 c, g dbSNP:779608230
107 107 a, g dbSNP:746757266
109 109 c, t dbSNP:768574096
110 110 c, g dbSNP:773557576
113 113 g, t dbSNP:763337765
116 116 a, g dbSNP:770889326
118 118 c, t dbSNP:774543652
123 123 c, t dbSNP:746571233
124 124 c, t dbSNP:76809608
128 128 a, g dbSNP:768029512
140 140 a, g dbSNP:753208097
148 148 a, g dbSNP:768396832
149 149 c, t dbSNP:764498937
160 160 a, c dbSNP:753484182
161 161 c, g dbSNP:137853257
163 163 a, g dbSNP:756973583
174 174 c, t dbSNP:778260543
190 190 -, g dbSNP:753113002
194 194 a, g dbSNP:750462643
206 206 c, t dbSNP:7883320
238 238 a, g dbSNP:780276301
255 255 c, t dbSNP:182962186
256 256 a, g dbSNP:145749914
268 268 a, t dbSNP:766213373
279 279 c, g dbSNP:747051654
287 287 c, g dbSNP:751469147
304 304 g, t dbSNP:773500511
310 310 a, g dbSNP:763398358
315 315 a, g dbSNP:770667770
320 320 c, t dbSNP:774155734
328 328 c, t dbSNP:759062849
343 343 c, g dbSNP:150318528
344 344 a, t dbSNP:752678074
351 351 a, g dbSNP:746867841
372 372 c, g dbSNP:759331650
380 380 a, g dbSNP:144967854
385 385 a, g dbSNP:745312079
391 391 g, t dbSNP:760251445
398 398 c, g dbSNP:771734567
400 400 a, g dbSNP:376746290
416 416 c, g, t dbSNP:149083818
463 463 a, c dbSNP:761538559
464 464 a, g dbSNP:765074163
498 498 a, g dbSNP:144828838
540 540 c, t dbSNP:768225634
548 548 c, t dbSNP:776535833
550 550 c, g dbSNP:371532584
554 554 c, t dbSNP:191666624
585 585 c, t dbSNP:764516370
586 586 a, g dbSNP:764996618
594 594 c, t dbSNP:772943333
604 604 c, t dbSNP:11554111
605 605 a, g dbSNP:762839069
624 624 a, g dbSNP:767569398
630 630 c, t dbSNP:183170654
646 646 c, t dbSNP:199959402
657 657 c, t dbSNP:756138817
658 658 a, g dbSNP:764303926
663 663 a, c dbSNP:757654963
673 673 a, g dbSNP:138727886
714 714 a, g dbSNP:773139249
750 750 c, t dbSNP:398123300
753 753 g, t dbSNP:762598184
774 774 a, g dbSNP:141862527
789 789 c, t dbSNP:769308417
817 817 a, g dbSNP:777678490
831 831 g, t dbSNP:749319044
838 838 c, g dbSNP:770603511
882 882 c, g, t dbSNP:137853254
915 915 a, c dbSNP:121917898
924 924 c, t dbSNP:778744930
927 927 c, t dbSNP:745607005
960 960 a, g dbSNP:138237215
963 963 c, t dbSNP:764871850
964 964 a, g dbSNP:372505888
975 975 a, g dbSNP:750307419
984 984 c, t dbSNP:769963488
994 994 a, t dbSNP:137853255
1023 1023 c, g dbSNP:768600287
1027 1027 c, g dbSNP:749333596
1029 1029 a, g dbSNP:770975182
1031 1031 a, g dbSNP:774917952
1040 1040 a, c dbSNP:137853253
1051 1051 a, g dbSNP:202166915
1054 1054 c, g dbSNP:137853259
1057 1057 c, g dbSNP:767850573
1062 1062 a, c, g dbSNP:1126565
1065 1065 a, g dbSNP:35752213
1077 1077 g, t dbSNP:763733376
1082 1082 a, g dbSNP:752225588
1104 1104 c, g dbSNP:775978359
1111 1111 a, c dbSNP:2229137
1116 1116 a, g dbSNP:768957853
1119 1119 g, t dbSNP:776339048
1121 1121 a, g dbSNP:373275701
1128 1128 -, t dbSNP:606231190
1130 1130 a, g dbSNP:137853258
1137 1137 c, t dbSNP:761411007
1146 1146 c, t dbSNP:764780830
1171 1171 c, t dbSNP:137853252
1178 1178 a, g dbSNP:766055203
1179 1179 a, c dbSNP:751513713
1184 1184 -, tagttaccgtacacgagaaga dbSNP:606231188
1194 1194 a, c dbSNP:200088791
1201 1201 -, agtaaga dbSNP:606231185
1204 1204 -, aag dbSNP:137853251
1206 1206 a, g dbSNP:374649412
1210 1210 a, g dbSNP:137853256
1215 1215 a, t dbSNP:759443348
1222 1222 c, g dbSNP:767515770
1229 1229 a, g dbSNP:752399277
1239 1239 a, g dbSNP:755945768
1245 1245 c, g, t dbSNP:779045292
1250 1250 a, g dbSNP:758465753
1251 1251 c, t dbSNP:767503319
1266 1266 a, c dbSNP:2228067
1284 1284 -, ttttaggaaattgat dbSNP:367658754
1288 1288 a, c, g dbSNP:755090271
1328 1328 c, t dbSNP:375167721
1329 1329 a, g, t dbSNP:147510382
1332 1332 c, t dbSNP:749696135
1333 1333 a, g dbSNP:770669838
1335 1335 c, t dbSNP:369185042
1340 1340 -, agccacctttggaagagctg dbSNP:606231187
1350 1350 a, g dbSNP:745312753
1369 1369 a, c dbSNP:771666787
1376 1376 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1377 1377 a, c dbSNP:775280711
1380 1380 c, t dbSNP:773338429
1381 1381 a, g dbSNP:199879809
1384 1384 c, t dbSNP:776360150
1385 1385 c, t dbSNP:761624839
1395 1395 a, c dbSNP:766521439
1400 1400 a, g dbSNP:137853250
1404 1404 c, t dbSNP:766631999
1412 1412 -, atca dbSNP:606231189
1413 1413 c, g dbSNP:767675495
1417 1417 a, c dbSNP:753124944
1419 1419 c, g dbSNP:756641063
1426 1426 -, aa dbSNP:606231186
1426 1426 a, c dbSNP:201156613
1427 1427 -, agtc dbSNP:774877318
1432 1432 c, g dbSNP:778458134
1434 1434 -, cagt dbSNP:606231184
1437 1437 c, t dbSNP:369973813
1439 1439 -, aaggggaggag dbSNP:764728647
1439 1439 -, aagggg dbSNP:762505127
1443 1443 a, g dbSNP:757713583
1448 1448 -, aga dbSNP:752082232
1450 1450 a, g dbSNP:778420248
1451 1451 a, g dbSNP:745596782
1452 1452 a, g dbSNP:771447698
1455 1455 c, g dbSNP:200547574
1456 1456 a, c dbSNP:373318863
1459 1459 g, t dbSNP:781632629
1460 1460 c, t dbSNP:768539902
1461 1461 -, taccttc, taccttcagggggctac dbSNP:762321006
1474 1474 c, g dbSNP:776552491
1479 1479 c, g, t dbSNP:111666443
1487 1487 a, g dbSNP:769687352
1489 1489 -, tc dbSNP:750727352
1496 1496 -, tggtta dbSNP:756298361
1501 1501 a, t dbSNP:774406317
1504 1504 a, g dbSNP:759852734
1509 1509 -, a dbSNP:780261890
1517 1517 a, c dbSNP:767657538
1522 1522 c, t dbSNP:11554112
1530 1530 a, c, t dbSNP:147338122
1534 1534 a, g dbSNP:778549806
1535 1535 c, t dbSNP:748689790
1540 1540 g, t dbSNP:757688624
1549 1549 -, ctt, cttc dbSNP:771171560
1550 1550 c, t dbSNP:709610
1553 1553 c, g, t dbSNP:182754597
1556 1556 -, taag dbSNP:779812493
1558 1558 -, aa dbSNP:746696047
1562 1562 a, g dbSNP:779602555
1566 1566 -, tc, tctattt, tctattttat dbSNP:745608853
1567 1567 g, t dbSNP:746449195
1571 1571 a, g dbSNP:768167537
1574 1574 a, c dbSNP:187360934
1576 1576 c, g dbSNP:781094210
1580 1580 a, g dbSNP:748123688
1584 1584 c, t dbSNP:781670523
1673 1673 a, g dbSNP:566285470
1674 1674 -, tactc dbSNP:748590147
1729 1729 -, ccagcca dbSNP:200632554
1731 1731 -, agccacc dbSNP:376636279
1741 1741 c, t dbSNP:773249692
1759 1759 g, t dbSNP:1042449
1762 1762 a, g dbSNP:1042450
1766 1766 c, g dbSNP:774381598
1770 1770 c, t dbSNP:759806053
1772 1772 a, c dbSNP:763789986
1803 1803 a, g dbSNP:372658162
1807 1807 a, g dbSNP:375225163
1810 1810 a, g dbSNP:753720613
1830 1830 a, g dbSNP:761629687
1831 1831 c, t dbSNP:765304960
1832 1832 a, g dbSNP:56318063
1837 1837 -, cat dbSNP:144356124
1838 1838 -, atc, cat dbSNP:72116174
1840 1840 -, ca, cat dbSNP:199685000
1849 1849 -, agat dbSNP:764801500
1851 1851 -, ataca dbSNP:779722514
1866 1866 a, t dbSNP:369332453
1872 1872 c, t dbSNP:754719295
1889 1889 -, tttaaaataagac dbSNP:201758797
1892 1892 -, aaaataagacttt dbSNP:375651955
1906 1906 g, t dbSNP:183744566
1915 1915 -, ccaattttgtaatcatt dbSNP:372190247
1945 1945 -, a dbSNP:763688379
1947 1947 -, tt, ttagt dbSNP:113050549
1950 1950 -, gttt dbSNP:770179781
1965 1965 c, g dbSNP:778207227
1971 1971 c, t dbSNP:749812407
1987 1987 -, tat dbSNP:770933958
1989 1989 a, g dbSNP:187525386
2003 2003 -, caaa dbSNP:746061580
2015 2015 c, t dbSNP:191995452
2029 2029 a, g dbSNP:776254250
2054 2054 g, t dbSNP:5955761
2061 2061 c, t dbSNP:537446476
2147 2147 a, g dbSNP:150945967
2165 2165 a, g dbSNP:773225586
2168 2168 c, t dbSNP:1042452
2169 2169 a, g dbSNP:376808450
2227 2227 c, t dbSNP:751130904
2278 2278 a, c dbSNP:754555154
2284 2284 a, g dbSNP:1042453
2297 2297 a, g dbSNP:182836908
2303 2303 c, t dbSNP:187083263
2304 2304 a, g dbSNP:192450087
2351 2351 -, tgtt dbSNP:749787977
2358 2358 -, a dbSNP:760736313
2362 2362 -, aaca dbSNP:757815346
2363 2363 a, g dbSNP:542108895
2377 2377 a, g dbSNP:778832973
2378 2378 a, t dbSNP:184532061
2396 2396 -, aag dbSNP:772075136
2400 2400 -, t dbSNP:775731731
2400 2400 c, t dbSNP:374396566
2453 2453 a, c dbSNP:1042456
2454 2454 a, g dbSNP:769643820
2461 2461 a, g dbSNP:140383712
2468 2468 c, t dbSNP:781582453
2471 2471 -, aaca dbSNP:776627726
2493 2493 c, t dbSNP:773012317
2495 2495 c, g, t dbSNP:762963142
2499 2499 a, g dbSNP:15816
2501 2501 a, g, t dbSNP:760828301
2510 2510 -, ct dbSNP:762592504
2510 2510 c, t dbSNP:754361374
2514 2514 c, g dbSNP:762427939
2525 2525 a, g dbSNP:765681576
2526 2526 -, tgat dbSNP:748635462
2542 2542 -, cttgt dbSNP:775059849
2542 2542 c, t dbSNP:750757959
2545 2545 c, g dbSNP:758692867
2547 2547 -, tt dbSNP:762409221
2558 2558 c, g dbSNP:779698506
2569 2569 a, g dbSNP:140145114
2572 2572 c, g dbSNP:145675672
2573 2573 c, t dbSNP:61744590
2578 2578 a, g dbSNP:756645339
2581 2581 c, t dbSNP:56021619
2582 2582 c, t dbSNP:778346850
2590 2590 c, t dbSNP:747680098
2591 2591 a, g dbSNP:756039907
2592 2592 c, t dbSNP:147753175
2594 2594 c, t dbSNP:759041463
2597 2597 c, t dbSNP:766954168
2599 2599 a, g, t dbSNP:557102951
2602 2602 -, tc dbSNP:750762941
2606 2606 c, t dbSNP:747270244
2607 2607 -, a dbSNP:761048720
2611 2611 g, t dbSNP:768831534
2617 2617 a, g dbSNP:776800732
2626 2626 -, aaac dbSNP:766536396
2628 2628 a, g dbSNP:761827915
2632 2632 -, ac dbSNP:202102403
2638 2638 -, ctgt dbSNP:755834416
2644 2644 c, t dbSNP:765707363
2648 2648 a, c dbSNP:369499936
2649 2649 a, g dbSNP:373390286
2654 2654 a, t dbSNP:770495684
2661 2661 a, g dbSNP:766795601
2669 2669 c, g dbSNP:751191482
2734 2734 g, t dbSNP:369068280
2737 2737 a, g dbSNP:778678656
2745 2745 c, t dbSNP:754247336
2746 2746 a, g dbSNP:745566169
2751 2751 c, t dbSNP:189054591
2785 2785 a, g dbSNP:193253848
2817 2817 a, g dbSNP:56039350
2834 2834 c, t dbSNP:55856360
2864 2864 a, g dbSNP:760525544
2873 2873 c, t dbSNP:779999826
2874 2874 a, g dbSNP:768422526
2890 2890 c, t dbSNP:747229060
2907 2907 a, g dbSNP:769050360
3003 3003 c, g dbSNP:7883708
3010 3010 a, t dbSNP:770658441
3025 3025 c, t dbSNP:5955550
3038 3038 c, g dbSNP:11094770
3041 3041 a, g dbSNP:771609750
3042 3042 c, g dbSNP:762905278
3087 3087 a, g dbSNP:201259816
3088 3088 a, g, t dbSNP:376593530
3098 3098 -, cttata dbSNP:760296050
3100 3100 a, t dbSNP:755594888
3102 3102 c, t dbSNP:370565981
3118 3118 g, t dbSNP:749254470
3122 3122 c, t dbSNP:55744630
3125 3125 c, g, t dbSNP:377382652
3126 3126 a, c, t dbSNP:753516995
3127 3127 a, g dbSNP:748198804
3129 3129 -, a dbSNP:762188631
3133 3133 a, g, t dbSNP:148399187
3137 3137 g, t dbSNP:763409232
3144 3144 a, g dbSNP:142533585
3151 3151 a, c dbSNP:766893716
3156 3156 a, g dbSNP:774659644
3157 3157 g, t dbSNP:150957359
3158 3158 c, g dbSNP:370651623
3175 3175 a, c dbSNP:750874490
3176 3176 c, t dbSNP:140779387
3178 3178 a, g dbSNP:752352625
3182 3182 g, t dbSNP:371285733
3190 3190 c, t dbSNP:144734730
3192 3192 -, t dbSNP:751563348
3198 3198 a, g dbSNP:763556279
3203 3203 a, c, t dbSNP:780260798
3217 3217 a, c dbSNP:373779094
3218 3218 a, c, g dbSNP:779022123
3219 3219 a, t dbSNP:758279534
3232 3232 c, g dbSNP:781550393
3235 3235 c, t dbSNP:374494282
3249 3249 c, g dbSNP:769886359
3252 3252 c, t dbSNP:777666685
3253 3253 a, g dbSNP:755016325
3254 3254 c, t dbSNP:749418204
3255 3255 a, g dbSNP:771363028
3259 3259 -, tttc dbSNP:757189654
3280 3280 c, g dbSNP:781517592
3287 3287 a, g dbSNP:759883184
3298 3298 a, c dbSNP:772494786
3309 3309 c, g dbSNP:15943
3314 3314 c, t dbSNP:760297711
3315 3315 a, g dbSNP:763826263
3335 3335 c, t dbSNP:753243729
3339 3339 c, t dbSNP:761409953
3348 3348 g, t dbSNP:770697702
3351 3351 c, g, t dbSNP:368526609
3352 3352 a, g, t dbSNP:372102191
3356 3356 c, g dbSNP:140380348
3364 3364 g, t dbSNP:752937000
3366 3366 c, g dbSNP:778062708
3370 3370 c, g dbSNP:749306111
3387 3387 -, g dbSNP:781136595
3387 3387 c, t dbSNP:771054574
3388 3388 a, g dbSNP:779385101
3390 3390 c, t dbSNP:756514533
3393 3393 a, g dbSNP:746410710
3399 3399 c, t dbSNP:778642797
3404 3404 -, tatat dbSNP:745681893
3411 3411 g, t dbSNP:375095104
3422 3422 a, c dbSNP:368185128
3425 3425 -, ct dbSNP:755908979
3428 3428 c, t dbSNP:745807211
3432 3432 a, g dbSNP:776362774

Target ORF information:

RefSeq Version XM_011545531
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59600
Accession Version XM_011545532.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1215bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)436..1233(+)
Misc Feature(2)508..1074(+)
Misc Feature(3)619..1050(+)
Misc Feature(4)745..813(+)
Misc Feature(5)1033..1122(+)
Position Chain Variation Link
22 22 g, t dbSNP:781441358
35 35 c, t dbSNP:192773464
45 45 a, g dbSNP:5955751
61 61 a, g dbSNP:778593749
75 75 c, t dbSNP:775567462
82 82 c, g, t dbSNP:745758119
83 83 g, t dbSNP:771905403
87 87 c, t dbSNP:778551493
89 89 a, c dbSNP:745761659
91 91 g, t dbSNP:772091896
92 92 c, g dbSNP:779608230
107 107 a, g dbSNP:746757266
109 109 c, t dbSNP:768574096
110 110 c, g dbSNP:773557576
113 113 g, t dbSNP:763337765
116 116 a, g dbSNP:770889326
118 118 c, t dbSNP:774543652
123 123 c, t dbSNP:746571233
124 124 c, t dbSNP:76809608
128 128 a, g dbSNP:768029512
140 140 a, g dbSNP:753208097
148 148 a, g dbSNP:768396832
149 149 c, t dbSNP:764498937
160 160 a, c dbSNP:753484182
161 161 c, g dbSNP:137853257
163 163 a, g dbSNP:756973583
174 174 c, t dbSNP:778260543
190 190 -, g dbSNP:753113002
194 194 a, g dbSNP:750462643
206 206 c, t dbSNP:7883320
238 238 a, g dbSNP:780276301
255 255 c, t dbSNP:182962186
256 256 a, g dbSNP:145749914
268 268 a, t dbSNP:766213373
279 279 c, g dbSNP:747051654
287 287 c, g dbSNP:751469147
304 304 g, t dbSNP:773500511
310 310 a, g dbSNP:763398358
315 315 a, g dbSNP:770667770
320 320 c, t dbSNP:774155734
328 328 c, t dbSNP:759062849
343 343 c, g dbSNP:150318528
344 344 a, t dbSNP:752678074
351 351 a, g dbSNP:746867841
372 372 c, g dbSNP:759331650
380 380 a, g dbSNP:144967854
385 385 a, g dbSNP:745312079
391 391 g, t dbSNP:760251445
398 398 c, g dbSNP:771734567
400 400 a, g dbSNP:376746290
416 416 c, g, t dbSNP:149083818
463 463 a, c dbSNP:761538559
464 464 a, g dbSNP:765074163
498 498 a, g dbSNP:144828838
540 540 c, t dbSNP:768225634
548 548 c, t dbSNP:776535833
550 550 c, g dbSNP:371532584
554 554 c, t dbSNP:191666624
585 585 c, t dbSNP:764516370
586 586 a, g dbSNP:764996618
594 594 c, t dbSNP:772943333
604 604 c, t dbSNP:11554111
605 605 a, g dbSNP:762839069
624 624 a, g dbSNP:767569398
630 630 c, t dbSNP:183170654
646 646 c, t dbSNP:199959402
657 657 c, t dbSNP:756138817
658 658 a, g dbSNP:764303926
663 663 a, c dbSNP:757654963
673 673 a, g dbSNP:138727886
714 714 a, g dbSNP:773139249
750 750 c, t dbSNP:398123300
753 753 g, t dbSNP:762598184
774 774 a, g dbSNP:141862527
789 789 c, g, t dbSNP:137853254
822 822 a, c dbSNP:121917898
831 831 c, t dbSNP:778744930
834 834 c, t dbSNP:745607005
867 867 a, g dbSNP:138237215
870 870 c, t dbSNP:764871850
871 871 a, g dbSNP:372505888
882 882 a, g dbSNP:750307419
891 891 c, t dbSNP:769963488
901 901 a, t dbSNP:137853255
930 930 c, g dbSNP:768600287
934 934 c, g dbSNP:749333596
936 936 a, g dbSNP:770975182
938 938 a, g dbSNP:774917952
947 947 a, c dbSNP:137853253
958 958 a, g dbSNP:202166915
961 961 c, g dbSNP:137853259
964 964 c, g dbSNP:767850573
969 969 a, c, g dbSNP:1126565
972 972 a, g dbSNP:35752213
984 984 g, t dbSNP:763733376
989 989 a, g dbSNP:752225588
1011 1011 c, g dbSNP:775978359
1018 1018 a, c dbSNP:2229137
1023 1023 a, g dbSNP:768957853
1026 1026 g, t dbSNP:776339048
1028 1028 a, g dbSNP:373275701
1035 1035 -, t dbSNP:606231190
1037 1037 a, g dbSNP:137853258
1044 1044 c, t dbSNP:761411007
1053 1053 c, t dbSNP:764780830
1078 1078 c, t dbSNP:137853252
1085 1085 a, g dbSNP:766055203
1086 1086 a, c dbSNP:751513713
1091 1091 -, tagttaccgtacacgagaaga dbSNP:606231188
1101 1101 a, c dbSNP:200088791
1108 1108 -, agtaaga dbSNP:606231185
1111 1111 -, aag dbSNP:137853251
1113 1113 a, g dbSNP:374649412
1117 1117 a, g dbSNP:137853256
1122 1122 a, t dbSNP:759443348
1129 1129 c, g dbSNP:767515770
1136 1136 a, g dbSNP:752399277
1146 1146 a, g dbSNP:755945768
1152 1152 c, g, t dbSNP:779045292
1157 1157 a, g dbSNP:758465753
1158 1158 c, t dbSNP:767503319
1173 1173 a, c dbSNP:2228067
1191 1191 -, ttttaggaaattgat dbSNP:367658754
1195 1195 a, c, g dbSNP:755090271
1235 1235 c, t dbSNP:375167721
1236 1236 a, g, t dbSNP:147510382
1239 1239 c, t dbSNP:749696135
1240 1240 a, g dbSNP:770669838
1242 1242 c, t dbSNP:369185042
1247 1247 -, agccacctttggaagagctg dbSNP:606231187
1257 1257 a, g dbSNP:745312753
1276 1276 a, c dbSNP:771666787
1283 1283 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1284 1284 a, c dbSNP:775280711
1287 1287 c, t dbSNP:773338429
1288 1288 a, g dbSNP:199879809
1291 1291 c, t dbSNP:776360150
1292 1292 c, t dbSNP:761624839
1302 1302 a, c dbSNP:766521439
1307 1307 a, g dbSNP:137853250
1311 1311 c, t dbSNP:766631999
1319 1319 -, atca dbSNP:606231189
1320 1320 c, g dbSNP:767675495
1324 1324 a, c dbSNP:753124944
1326 1326 c, g dbSNP:756641063
1333 1333 -, aa dbSNP:606231186
1333 1333 a, c dbSNP:201156613
1334 1334 -, agtc dbSNP:774877318
1339 1339 c, g dbSNP:778458134
1341 1341 -, cagt dbSNP:606231184
1344 1344 c, t dbSNP:369973813
1346 1346 -, aaggggaggag dbSNP:764728647
1346 1346 -, aagggg dbSNP:762505127
1350 1350 a, g dbSNP:757713583
1355 1355 -, aga dbSNP:752082232
1357 1357 a, g dbSNP:778420248
1358 1358 a, g dbSNP:745596782
1359 1359 a, g dbSNP:771447698
1362 1362 c, g dbSNP:200547574
1363 1363 a, c dbSNP:373318863
1366 1366 g, t dbSNP:781632629
1367 1367 c, t dbSNP:768539902
1368 1368 -, taccttc, taccttcagggggctac dbSNP:762321006
1381 1381 c, g dbSNP:776552491
1386 1386 c, g, t dbSNP:111666443
1394 1394 a, g dbSNP:769687352
1396 1396 -, tc dbSNP:750727352
1403 1403 -, tggtta dbSNP:756298361
1408 1408 a, t dbSNP:774406317
1411 1411 a, g dbSNP:759852734
1416 1416 -, a dbSNP:780261890
1424 1424 a, c dbSNP:767657538
1429 1429 c, t dbSNP:11554112
1437 1437 a, c, t dbSNP:147338122
1441 1441 a, g dbSNP:778549806
1442 1442 c, t dbSNP:748689790
1447 1447 g, t dbSNP:757688624
1456 1456 -, ctt, cttc dbSNP:771171560
1457 1457 c, t dbSNP:709610
1460 1460 c, g, t dbSNP:182754597
1463 1463 -, taag dbSNP:779812493
1465 1465 -, aa dbSNP:746696047
1469 1469 a, g dbSNP:779602555
1473 1473 -, tc, tctattt, tctattttat dbSNP:745608853
1474 1474 g, t dbSNP:746449195
1478 1478 a, g dbSNP:768167537
1481 1481 a, c dbSNP:187360934
1483 1483 c, g dbSNP:781094210
1487 1487 a, g dbSNP:748123688
1491 1491 c, t dbSNP:781670523
1580 1580 a, g dbSNP:566285470
1581 1581 -, tactc dbSNP:748590147
1636 1636 -, ccagcca dbSNP:200632554
1638 1638 -, agccacc dbSNP:376636279
1648 1648 c, t dbSNP:773249692
1666 1666 g, t dbSNP:1042449
1669 1669 a, g dbSNP:1042450
1673 1673 c, g dbSNP:774381598
1677 1677 c, t dbSNP:759806053
1679 1679 a, c dbSNP:763789986
1710 1710 a, g dbSNP:372658162
1714 1714 a, g dbSNP:375225163
1717 1717 a, g dbSNP:753720613
1737 1737 a, g dbSNP:761629687
1738 1738 c, t dbSNP:765304960
1739 1739 a, g dbSNP:56318063
1744 1744 -, cat dbSNP:144356124
1745 1745 -, atc, cat dbSNP:72116174
1747 1747 -, ca, cat dbSNP:199685000
1756 1756 -, agat dbSNP:764801500
1758 1758 -, ataca dbSNP:779722514
1773 1773 a, t dbSNP:369332453
1779 1779 c, t dbSNP:754719295
1796 1796 -, tttaaaataagac dbSNP:201758797
1799 1799 -, aaaataagacttt dbSNP:375651955
1813 1813 g, t dbSNP:183744566
1822 1822 -, ccaattttgtaatcatt dbSNP:372190247
1852 1852 -, a dbSNP:763688379
1854 1854 -, tt, ttagt dbSNP:113050549
1857 1857 -, gttt dbSNP:770179781
1872 1872 c, g dbSNP:778207227
1878 1878 c, t dbSNP:749812407
1894 1894 -, tat dbSNP:770933958
1896 1896 a, g dbSNP:187525386
1910 1910 -, caaa dbSNP:746061580
1922 1922 c, t dbSNP:191995452
1936 1936 a, g dbSNP:776254250
1961 1961 g, t dbSNP:5955761
1968 1968 c, t dbSNP:537446476
2054 2054 a, g dbSNP:150945967
2072 2072 a, g dbSNP:773225586
2075 2075 c, t dbSNP:1042452
2076 2076 a, g dbSNP:376808450
2134 2134 c, t dbSNP:751130904
2185 2185 a, c dbSNP:754555154
2191 2191 a, g dbSNP:1042453
2204 2204 a, g dbSNP:182836908
2210 2210 c, t dbSNP:187083263
2211 2211 a, g dbSNP:192450087
2258 2258 -, tgtt dbSNP:749787977
2265 2265 -, a dbSNP:760736313
2269 2269 -, aaca dbSNP:757815346
2270 2270 a, g dbSNP:542108895
2284 2284 a, g dbSNP:778832973
2285 2285 a, t dbSNP:184532061
2303 2303 -, aag dbSNP:772075136
2307 2307 -, t dbSNP:775731731
2307 2307 c, t dbSNP:374396566
2360 2360 a, c dbSNP:1042456
2361 2361 a, g dbSNP:769643820
2368 2368 a, g dbSNP:140383712
2375 2375 c, t dbSNP:781582453
2378 2378 -, aaca dbSNP:776627726
2400 2400 c, t dbSNP:773012317
2402 2402 c, g, t dbSNP:762963142
2406 2406 a, g dbSNP:15816
2408 2408 a, g, t dbSNP:760828301
2417 2417 -, ct dbSNP:762592504
2417 2417 c, t dbSNP:754361374
2421 2421 c, g dbSNP:762427939
2432 2432 a, g dbSNP:765681576
2433 2433 -, tgat dbSNP:748635462
2449 2449 -, cttgt dbSNP:775059849
2449 2449 c, t dbSNP:750757959
2452 2452 c, g dbSNP:758692867
2454 2454 -, tt dbSNP:762409221
2465 2465 c, g dbSNP:779698506
2476 2476 a, g dbSNP:140145114
2479 2479 c, g dbSNP:145675672
2480 2480 c, t dbSNP:61744590
2485 2485 a, g dbSNP:756645339
2488 2488 c, t dbSNP:56021619
2489 2489 c, t dbSNP:778346850
2497 2497 c, t dbSNP:747680098
2498 2498 a, g dbSNP:756039907
2499 2499 c, t dbSNP:147753175
2501 2501 c, t dbSNP:759041463
2504 2504 c, t dbSNP:766954168
2506 2506 a, g, t dbSNP:557102951
2509 2509 -, tc dbSNP:750762941
2513 2513 c, t dbSNP:747270244
2514 2514 -, a dbSNP:761048720
2518 2518 g, t dbSNP:768831534
2524 2524 a, g dbSNP:776800732
2533 2533 -, aaac dbSNP:766536396
2535 2535 a, g dbSNP:761827915
2539 2539 -, ac dbSNP:202102403
2545 2545 -, ctgt dbSNP:755834416
2551 2551 c, t dbSNP:765707363
2555 2555 a, c dbSNP:369499936
2556 2556 a, g dbSNP:373390286
2561 2561 a, t dbSNP:770495684
2568 2568 a, g dbSNP:766795601
2576 2576 c, g dbSNP:751191482
2641 2641 g, t dbSNP:369068280
2644 2644 a, g dbSNP:778678656
2652 2652 c, t dbSNP:754247336
2653 2653 a, g dbSNP:745566169
2658 2658 c, t dbSNP:189054591
2692 2692 a, g dbSNP:193253848
2724 2724 a, g dbSNP:56039350
2741 2741 c, t dbSNP:55856360
2771 2771 a, g dbSNP:760525544
2780 2780 c, t dbSNP:779999826
2781 2781 a, g dbSNP:768422526
2797 2797 c, t dbSNP:747229060
2814 2814 a, g dbSNP:769050360
2910 2910 c, g dbSNP:7883708
2917 2917 a, t dbSNP:770658441
2932 2932 c, t dbSNP:5955550
2945 2945 c, g dbSNP:11094770
2948 2948 a, g dbSNP:771609750
2949 2949 c, g dbSNP:762905278
2994 2994 a, g dbSNP:201259816
2995 2995 a, g, t dbSNP:376593530
3005 3005 -, cttata dbSNP:760296050
3007 3007 a, t dbSNP:755594888
3009 3009 c, t dbSNP:370565981
3025 3025 g, t dbSNP:749254470
3029 3029 c, t dbSNP:55744630
3032 3032 c, g, t dbSNP:377382652
3033 3033 a, c, t dbSNP:753516995
3034 3034 a, g dbSNP:748198804
3036 3036 -, a dbSNP:762188631
3040 3040 a, g, t dbSNP:148399187
3044 3044 g, t dbSNP:763409232
3051 3051 a, g dbSNP:142533585
3058 3058 a, c dbSNP:766893716
3063 3063 a, g dbSNP:774659644
3064 3064 g, t dbSNP:150957359
3065 3065 c, g dbSNP:370651623
3082 3082 a, c dbSNP:750874490
3083 3083 c, t dbSNP:140779387
3085 3085 a, g dbSNP:752352625
3089 3089 g, t dbSNP:371285733
3097 3097 c, t dbSNP:144734730
3099 3099 -, t dbSNP:751563348
3105 3105 a, g dbSNP:763556279
3110 3110 a, c, t dbSNP:780260798
3124 3124 a, c dbSNP:373779094
3125 3125 a, c, g dbSNP:779022123
3126 3126 a, t dbSNP:758279534
3139 3139 c, g dbSNP:781550393
3142 3142 c, t dbSNP:374494282
3156 3156 c, g dbSNP:769886359
3159 3159 c, t dbSNP:777666685
3160 3160 a, g dbSNP:755016325
3161 3161 c, t dbSNP:749418204
3162 3162 a, g dbSNP:771363028
3166 3166 -, tttc dbSNP:757189654
3187 3187 c, g dbSNP:781517592
3194 3194 a, g dbSNP:759883184
3205 3205 a, c dbSNP:772494786
3216 3216 c, g dbSNP:15943
3221 3221 c, t dbSNP:760297711
3222 3222 a, g dbSNP:763826263
3242 3242 c, t dbSNP:753243729
3246 3246 c, t dbSNP:761409953
3255 3255 g, t dbSNP:770697702
3258 3258 c, g, t dbSNP:368526609
3259 3259 a, g, t dbSNP:372102191
3263 3263 c, g dbSNP:140380348
3271 3271 g, t dbSNP:752937000
3273 3273 c, g dbSNP:778062708
3277 3277 c, g dbSNP:749306111
3294 3294 -, g dbSNP:781136595
3294 3294 c, t dbSNP:771054574
3295 3295 a, g dbSNP:779385101
3297 3297 c, t dbSNP:756514533
3300 3300 a, g dbSNP:746410710
3306 3306 c, t dbSNP:778642797
3311 3311 -, tatat dbSNP:745681893
3318 3318 g, t dbSNP:375095104
3329 3329 a, c dbSNP:368185128
3332 3332 -, ct dbSNP:755908979
3335 3335 c, t dbSNP:745807211
3339 3339 a, g dbSNP:776362774

Target ORF information:

RefSeq Version XM_011545532
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu10616
Accession Version NM_001173456.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1080bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 4 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK296457.1, AK296341.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (4) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (4) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296457.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)335..1111(+)
Misc Feature(2)407..952(+)
Misc Feature(3)497..928(+)
Misc Feature(4)623..691(+)
Misc Feature(5)911..1000(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..262
Gene Synonym:
Exon (3)263..436
Gene Synonym:
Exon (4)437..563
Gene Synonym:
Exon (5)564..655
Gene Synonym:
Exon (6)656..811
Gene Synonym:
Exon (7)812..883
Gene Synonym:
Exon (8)884..951
Gene Synonym:
Exon (9)952..1060
Gene Synonym:
Exon (10)1061..3279
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 g, t dbSNP:773500511
209 209 a, g dbSNP:763398358
214 214 a, g dbSNP:770667770
219 219 c, t dbSNP:774155734
227 227 c, t dbSNP:759062849
242 242 c, g dbSNP:150318528
243 243 a, t dbSNP:752678074
250 250 a, g dbSNP:746867841
271 271 c, g dbSNP:759331650
279 279 a, g dbSNP:144967854
284 284 a, g dbSNP:745312079
290 290 g, t dbSNP:760251445
297 297 c, g dbSNP:771734567
299 299 a, g dbSNP:376746290
315 315 c, g, t dbSNP:149083818
362 362 a, c dbSNP:761538559
363 363 a, g dbSNP:765074163
397 397 a, g dbSNP:144828838
463 463 c, t dbSNP:764516370
464 464 a, g dbSNP:764996618
472 472 c, t dbSNP:772943333
482 482 c, t dbSNP:11554111
483 483 a, g dbSNP:762839069
502 502 a, g dbSNP:767569398
508 508 c, t dbSNP:183170654
524 524 c, t dbSNP:199959402
535 535 c, t dbSNP:756138817
536 536 a, g dbSNP:764303926
541 541 a, c dbSNP:757654963
551 551 a, g dbSNP:138727886
592 592 a, g dbSNP:773139249
628 628 c, t dbSNP:398123300
631 631 g, t dbSNP:762598184
652 652 a, g dbSNP:141862527
667 667 c, g, t dbSNP:137853254
700 700 a, c dbSNP:121917898
709 709 c, t dbSNP:778744930
712 712 c, t dbSNP:745607005
745 745 a, g dbSNP:138237215
748 748 c, t dbSNP:764871850
749 749 a, g dbSNP:372505888
760 760 a, g dbSNP:750307419
769 769 c, t dbSNP:769963488
779 779 a, t dbSNP:137853255
808 808 c, g dbSNP:768600287
812 812 c, g dbSNP:749333596
814 814 a, g dbSNP:770975182
816 816 a, g dbSNP:774917952
825 825 a, c dbSNP:137853253
836 836 a, g dbSNP:202166915
839 839 c, g dbSNP:137853259
842 842 c, g dbSNP:767850573
847 847 a, c, g dbSNP:1126565
850 850 a, g dbSNP:35752213
862 862 g, t dbSNP:763733376
867 867 a, g dbSNP:752225588
889 889 c, g dbSNP:775978359
896 896 a, c dbSNP:2229137
901 901 a, g dbSNP:768957853
904 904 g, t dbSNP:776339048
906 906 a, g dbSNP:373275701
913 913 -, t dbSNP:606231190
915 915 a, g dbSNP:137853258
922 922 c, t dbSNP:761411007
931 931 c, t dbSNP:764780830
956 956 c, t dbSNP:137853252
963 963 a, g dbSNP:766055203
964 964 a, c dbSNP:751513713
969 969 -, tagttaccgtacacgagaaga dbSNP:606231188
979 979 a, c dbSNP:200088791
986 986 -, agtaaga dbSNP:606231185
989 989 -, aag dbSNP:137853251
991 991 a, g dbSNP:374649412
995 995 a, g dbSNP:137853256
1000 1000 a, t dbSNP:759443348
1007 1007 c, g dbSNP:767515770
1014 1014 a, g dbSNP:752399277
1024 1024 a, g dbSNP:755945768
1030 1030 c, g, t dbSNP:779045292
1035 1035 a, g dbSNP:758465753
1036 1036 c, t dbSNP:767503319
1051 1051 a, c dbSNP:2228067
1069 1069 -, ttttaggaaattgat dbSNP:367658754
1073 1073 a, c, g dbSNP:755090271
1113 1113 c, t dbSNP:375167721
1114 1114 a, g, t dbSNP:147510382
1117 1117 c, t dbSNP:749696135
1118 1118 a, g dbSNP:770669838
1120 1120 c, t dbSNP:369185042
1125 1125 -, agccacctttggaagagctg dbSNP:606231187
1135 1135 a, g dbSNP:745312753
1154 1154 a, c dbSNP:771666787
1161 1161 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1162 1162 a, c dbSNP:775280711
1165 1165 c, t dbSNP:773338429
1166 1166 a, g dbSNP:199879809
1169 1169 c, t dbSNP:776360150
1170 1170 c, t dbSNP:761624839
1180 1180 a, c dbSNP:766521439
1185 1185 a, g dbSNP:137853250
1189 1189 c, t dbSNP:766631999
1197 1197 -, atca dbSNP:606231189
1198 1198 c, g dbSNP:767675495
1202 1202 a, c dbSNP:753124944
1204 1204 c, g dbSNP:756641063
1211 1211 -, aa dbSNP:606231186
1211 1211 a, c dbSNP:201156613
1212 1212 -, agtc dbSNP:774877318
1217 1217 c, g dbSNP:778458134
1219 1219 -, cagt dbSNP:606231184
1222 1222 c, t dbSNP:369973813
1224 1224 -, aaggggaggag dbSNP:764728647
1224 1224 -, aagggg dbSNP:762505127
1228 1228 a, g dbSNP:757713583
1233 1233 -, aga dbSNP:752082232
1235 1235 a, g dbSNP:778420248
1236 1236 a, g dbSNP:745596782
1237 1237 a, g dbSNP:771447698
1240 1240 c, g dbSNP:200547574
1241 1241 a, c dbSNP:373318863
1244 1244 g, t dbSNP:781632629
1245 1245 c, t dbSNP:768539902
1246 1246 -, taccttc, taccttcagggggctac dbSNP:762321006
1259 1259 c, g dbSNP:776552491
1264 1264 c, g, t dbSNP:111666443
1272 1272 a, g dbSNP:769687352
1274 1274 -, tc dbSNP:750727352
1281 1281 -, tggtta dbSNP:756298361
1286 1286 a, t dbSNP:774406317
1289 1289 a, g dbSNP:759852734
1294 1294 -, a dbSNP:780261890
1302 1302 a, c dbSNP:767657538
1307 1307 c, t dbSNP:11554112
1315 1315 a, c, t dbSNP:147338122
1319 1319 a, g dbSNP:778549806
1320 1320 c, t dbSNP:748689790
1325 1325 g, t dbSNP:757688624
1334 1334 -, ctt, cttc dbSNP:771171560
1335 1335 c, t dbSNP:709610
1338 1338 c, g, t dbSNP:182754597
1341 1341 -, taag dbSNP:779812493
1343 1343 -, aa dbSNP:746696047
1347 1347 a, g dbSNP:779602555
1351 1351 -, tc, tctattt, tctattttat dbSNP:745608853
1352 1352 g, t dbSNP:746449195
1356 1356 a, g dbSNP:768167537
1359 1359 a, c dbSNP:187360934
1361 1361 c, g dbSNP:781094210
1365 1365 a, g dbSNP:748123688
1369 1369 c, t dbSNP:781670523
1458 1458 a, g dbSNP:566285470
1459 1459 -, tactc dbSNP:748590147
1514 1514 -, ccagcca dbSNP:200632554
1516 1516 -, agccacc dbSNP:376636279
1526 1526 c, t dbSNP:773249692
1544 1544 g, t dbSNP:1042449
1547 1547 a, g dbSNP:1042450
1551 1551 c, g dbSNP:774381598
1555 1555 c, t dbSNP:759806053
1557 1557 a, c dbSNP:763789986
1588 1588 a, g dbSNP:372658162
1592 1592 a, g dbSNP:375225163
1595 1595 a, g dbSNP:753720613
1615 1615 a, g dbSNP:761629687
1616 1616 c, t dbSNP:765304960
1617 1617 a, g dbSNP:56318063
1622 1622 -, cat dbSNP:144356124
1623 1623 -, atc, cat dbSNP:72116174
1625 1625 -, ca, cat dbSNP:199685000
1634 1634 -, agat dbSNP:764801500
1636 1636 -, ataca dbSNP:779722514
1651 1651 a, t dbSNP:369332453
1657 1657 c, t dbSNP:754719295
1674 1674 -, tttaaaataagac dbSNP:201758797
1677 1677 -, aaaataagacttt dbSNP:375651955
1691 1691 g, t dbSNP:183744566
1700 1700 -, ccaattttgtaatcatt dbSNP:372190247
1730 1730 -, a dbSNP:763688379
1732 1732 -, tt, ttagt dbSNP:113050549
1735 1735 -, gttt dbSNP:770179781
1750 1750 c, g dbSNP:778207227
1756 1756 c, t dbSNP:749812407
1772 1772 -, tat dbSNP:770933958
1774 1774 a, g dbSNP:187525386
1788 1788 -, caaa dbSNP:746061580
1800 1800 c, t dbSNP:191995452
1814 1814 a, g dbSNP:776254250
1839 1839 g, t dbSNP:5955761
1846 1846 c, t dbSNP:537446476
1932 1932 a, g dbSNP:150945967
1950 1950 a, g dbSNP:773225586
1953 1953 c, t dbSNP:1042452
1954 1954 a, g dbSNP:376808450
2012 2012 c, t dbSNP:751130904
2063 2063 a, c dbSNP:754555154
2069 2069 a, g dbSNP:1042453
2082 2082 a, g dbSNP:182836908
2088 2088 c, t dbSNP:187083263
2089 2089 a, g dbSNP:192450087
2136 2136 -, tgtt dbSNP:749787977
2143 2143 -, a dbSNP:760736313
2147 2147 -, aaca dbSNP:757815346
2148 2148 a, g dbSNP:542108895
2162 2162 a, g dbSNP:778832973
2163 2163 a, t dbSNP:184532061
2181 2181 -, aag dbSNP:772075136
2185 2185 -, t dbSNP:775731731
2185 2185 c, t dbSNP:374396566
2238 2238 a, c dbSNP:1042456
2239 2239 a, g dbSNP:769643820
2246 2246 a, g dbSNP:140383712
2253 2253 c, t dbSNP:781582453
2256 2256 -, aaca dbSNP:776627726
2278 2278 c, t dbSNP:773012317
2280 2280 c, g, t dbSNP:762963142
2284 2284 a, g dbSNP:15816
2286 2286 a, g, t dbSNP:760828301
2295 2295 -, ct dbSNP:762592504
2295 2295 c, t dbSNP:754361374
2299 2299 c, g dbSNP:762427939
2310 2310 a, g dbSNP:765681576
2311 2311 -, tgat dbSNP:748635462
2327 2327 -, cttgt dbSNP:775059849
2327 2327 c, t dbSNP:750757959
2330 2330 c, g dbSNP:758692867
2332 2332 -, tt dbSNP:762409221
2343 2343 c, g dbSNP:779698506
2354 2354 a, g dbSNP:140145114
2357 2357 c, g dbSNP:145675672
2358 2358 c, t dbSNP:61744590
2363 2363 a, g dbSNP:756645339
2366 2366 c, t dbSNP:56021619
2367 2367 c, t dbSNP:778346850
2375 2375 c, t dbSNP:747680098
2376 2376 a, g dbSNP:756039907
2377 2377 c, t dbSNP:147753175
2379 2379 c, t dbSNP:759041463
2382 2382 c, t dbSNP:766954168
2384 2384 a, g, t dbSNP:557102951
2387 2387 -, tc dbSNP:750762941
2391 2391 c, t dbSNP:747270244
2392 2392 -, a dbSNP:761048720
2396 2396 g, t dbSNP:768831534
2402 2402 a, g dbSNP:776800732
2411 2411 -, aaac dbSNP:766536396
2413 2413 a, g dbSNP:761827915
2417 2417 -, ac dbSNP:202102403
2423 2423 -, ctgt dbSNP:755834416
2429 2429 c, t dbSNP:765707363
2433 2433 a, c dbSNP:369499936
2434 2434 a, g dbSNP:373390286
2439 2439 a, t dbSNP:770495684
2446 2446 a, g dbSNP:766795601
2454 2454 c, g dbSNP:751191482
2519 2519 g, t dbSNP:369068280
2522 2522 a, g dbSNP:778678656
2530 2530 c, t dbSNP:754247336
2531 2531 a, g dbSNP:745566169
2536 2536 c, t dbSNP:189054591
2570 2570 a, g dbSNP:193253848
2602 2602 a, g dbSNP:56039350
2619 2619 c, t dbSNP:55856360
2649 2649 a, g dbSNP:760525544
2658 2658 c, t dbSNP:779999826
2659 2659 a, g dbSNP:768422526
2675 2675 c, t dbSNP:747229060
2692 2692 a, g dbSNP:769050360
2788 2788 c, g dbSNP:7883708
2795 2795 a, t dbSNP:770658441
2810 2810 c, t dbSNP:5955550
2823 2823 c, g dbSNP:11094770
2826 2826 a, g dbSNP:771609750
2827 2827 c, g dbSNP:762905278
2872 2872 a, g dbSNP:201259816
2873 2873 a, g, t dbSNP:376593530
2883 2883 -, cttata dbSNP:760296050
2885 2885 a, t dbSNP:755594888
2887 2887 c, t dbSNP:370565981
2903 2903 g, t dbSNP:749254470
2907 2907 c, t dbSNP:55744630
2910 2910 c, g, t dbSNP:377382652
2911 2911 a, c, t dbSNP:753516995
2912 2912 a, g dbSNP:748198804
2914 2914 -, a dbSNP:762188631
2918 2918 a, g, t dbSNP:148399187
2922 2922 g, t dbSNP:763409232
2929 2929 a, g dbSNP:142533585
2936 2936 a, c dbSNP:766893716
2941 2941 a, g dbSNP:774659644
2942 2942 g, t dbSNP:150957359
2943 2943 c, g dbSNP:370651623
2960 2960 a, c dbSNP:750874490
2961 2961 c, t dbSNP:140779387
2963 2963 a, g dbSNP:752352625
2967 2967 g, t dbSNP:371285733
2975 2975 c, t dbSNP:144734730
2977 2977 -, t dbSNP:751563348
2983 2983 a, g dbSNP:763556279
2988 2988 a, c, t dbSNP:780260798
3002 3002 a, c dbSNP:373779094
3003 3003 a, c, g dbSNP:779022123
3004 3004 a, t dbSNP:758279534
3017 3017 c, g dbSNP:781550393
3020 3020 c, t dbSNP:374494282
3034 3034 c, g dbSNP:769886359
3037 3037 c, t dbSNP:777666685
3038 3038 a, g dbSNP:755016325
3039 3039 c, t dbSNP:749418204
3040 3040 a, g dbSNP:771363028
3044 3044 -, tttc dbSNP:757189654
3065 3065 c, g dbSNP:781517592
3072 3072 a, g dbSNP:759883184
3083 3083 a, c dbSNP:772494786
3094 3094 c, g dbSNP:15943
3099 3099 c, t dbSNP:760297711
3100 3100 a, g dbSNP:763826263
3120 3120 c, t dbSNP:753243729
3124 3124 c, t dbSNP:761409953
3133 3133 g, t dbSNP:770697702
3136 3136 c, g, t dbSNP:368526609
3137 3137 a, g, t dbSNP:372102191
3141 3141 c, g dbSNP:140380348
3149 3149 g, t dbSNP:752937000
3151 3151 c, g dbSNP:778062708
3155 3155 c, g dbSNP:749306111
3172 3172 -, g dbSNP:781136595
3172 3172 c, t dbSNP:771054574
3173 3173 a, g dbSNP:779385101
3175 3175 c, t dbSNP:756514533
3178 3178 a, g dbSNP:746410710
3184 3184 c, t dbSNP:778642797
3189 3189 -, tatat dbSNP:745681893
3196 3196 g, t dbSNP:375095104
3207 3207 a, c dbSNP:368185128
3210 3210 -, ct dbSNP:755908979
3213 3213 c, t dbSNP:745807211
3217 3217 a, g dbSNP:776362774
3244 3244 c, t dbSNP:181554208
3261 3261 a, g dbSNP:774947730

Target ORF information:

RefSeq Version NM_001173456
Organism Homo sapiens (human)
Definition Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11172
Accession Version NM_001173454.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1287bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK293250.1, BU170389.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (2) contains an additional in-frame coding exon compared to variant 1, resulting in a longer isoform (2) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK293250.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)449..1318(+)
Misc Feature(2)521..1159(+)
Misc Feature(3)611..1135(+)
Misc Feature(4)737..898(+)
Misc Feature(5)1118..1207(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..316
Gene Synonym:
Exon (3)317..376
Gene Synonym:
Exon (4)377..550
Gene Synonym:
Exon (5)551..677
Gene Synonym:
Exon (6)678..769
Gene Synonym:
Exon (7)770..862
Gene Synonym:
Exon (8)863..1018
Gene Synonym:
Exon (9)1019..1090
Gene Synonym:
Exon (10)1091..1158
Gene Synonym:
Exon (11)1159..1267
Gene Synonym:
Exon (12)1268..3486
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 -, g dbSNP:753113002
207 207 a, g dbSNP:750462643
219 219 c, t dbSNP:7883320
251 251 a, g dbSNP:780276301
268 268 c, t dbSNP:182962186
269 269 a, g dbSNP:145749914
281 281 a, t dbSNP:766213373
292 292 c, g dbSNP:747051654
300 300 c, g dbSNP:751469147
317 317 g, t dbSNP:773500511
323 323 a, g dbSNP:763398358
328 328 a, g dbSNP:770667770
333 333 c, t dbSNP:774155734
341 341 c, t dbSNP:759062849
356 356 c, g dbSNP:150318528
357 357 a, t dbSNP:752678074
364 364 a, g dbSNP:746867841
385 385 c, g dbSNP:759331650
393 393 a, g dbSNP:144967854
398 398 a, g dbSNP:745312079
404 404 g, t dbSNP:760251445
411 411 c, g dbSNP:771734567
413 413 a, g dbSNP:376746290
429 429 c, g, t dbSNP:149083818
476 476 a, c dbSNP:761538559
477 477 a, g dbSNP:765074163
511 511 a, g dbSNP:144828838
577 577 c, t dbSNP:764516370
578 578 a, g dbSNP:764996618
586 586 c, t dbSNP:772943333
596 596 c, t dbSNP:11554111
597 597 a, g dbSNP:762839069
616 616 a, g dbSNP:767569398
622 622 c, t dbSNP:183170654
638 638 c, t dbSNP:199959402
649 649 c, t dbSNP:756138817
650 650 a, g dbSNP:764303926
655 655 a, c dbSNP:757654963
665 665 a, g dbSNP:138727886
706 706 a, g dbSNP:773139249
742 742 c, t dbSNP:398123300
745 745 g, t dbSNP:762598184
766 766 a, g dbSNP:141862527
781 781 c, t dbSNP:769308417
809 809 a, g dbSNP:777678490
823 823 g, t dbSNP:749319044
830 830 c, g dbSNP:770603511
874 874 c, g, t dbSNP:137853254
907 907 a, c dbSNP:121917898
916 916 c, t dbSNP:778744930
919 919 c, t dbSNP:745607005
952 952 a, g dbSNP:138237215
955 955 c, t dbSNP:764871850
956 956 a, g dbSNP:372505888
967 967 a, g dbSNP:750307419
976 976 c, t dbSNP:769963488
986 986 a, t dbSNP:137853255
1015 1015 c, g dbSNP:768600287
1019 1019 c, g dbSNP:749333596
1021 1021 a, g dbSNP:770975182
1023 1023 a, g dbSNP:774917952
1032 1032 a, c dbSNP:137853253
1043 1043 a, g dbSNP:202166915
1046 1046 c, g dbSNP:137853259
1049 1049 c, g dbSNP:767850573
1054 1054 a, c, g dbSNP:1126565
1057 1057 a, g dbSNP:35752213
1069 1069 g, t dbSNP:763733376
1074 1074 a, g dbSNP:752225588
1096 1096 c, g dbSNP:775978359
1103 1103 a, c dbSNP:2229137
1108 1108 a, g dbSNP:768957853
1111 1111 g, t dbSNP:776339048
1113 1113 a, g dbSNP:373275701
1120 1120 -, t dbSNP:606231190
1122 1122 a, g dbSNP:137853258
1129 1129 c, t dbSNP:761411007
1138 1138 c, t dbSNP:764780830
1163 1163 c, t dbSNP:137853252
1170 1170 a, g dbSNP:766055203
1171 1171 a, c dbSNP:751513713
1176 1176 -, tagttaccgtacacgagaaga dbSNP:606231188
1186 1186 a, c dbSNP:200088791
1193 1193 -, agtaaga dbSNP:606231185
1196 1196 -, aag dbSNP:137853251
1198 1198 a, g dbSNP:374649412
1202 1202 a, g dbSNP:137853256
1207 1207 a, t dbSNP:759443348
1214 1214 c, g dbSNP:767515770
1221 1221 a, g dbSNP:752399277
1231 1231 a, g dbSNP:755945768
1237 1237 c, g, t dbSNP:779045292
1242 1242 a, g dbSNP:758465753
1243 1243 c, t dbSNP:767503319
1258 1258 a, c dbSNP:2228067
1276 1276 -, ttttaggaaattgat dbSNP:367658754
1280 1280 a, c, g dbSNP:755090271
1320 1320 c, t dbSNP:375167721
1321 1321 a, g, t dbSNP:147510382
1324 1324 c, t dbSNP:749696135
1325 1325 a, g dbSNP:770669838
1327 1327 c, t dbSNP:369185042
1332 1332 -, agccacctttggaagagctg dbSNP:606231187
1342 1342 a, g dbSNP:745312753
1361 1361 a, c dbSNP:771666787
1368 1368 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1369 1369 a, c dbSNP:775280711
1372 1372 c, t dbSNP:773338429
1373 1373 a, g dbSNP:199879809
1376 1376 c, t dbSNP:776360150
1377 1377 c, t dbSNP:761624839
1387 1387 a, c dbSNP:766521439
1392 1392 a, g dbSNP:137853250
1396 1396 c, t dbSNP:766631999
1404 1404 -, atca dbSNP:606231189
1405 1405 c, g dbSNP:767675495
1409 1409 a, c dbSNP:753124944
1411 1411 c, g dbSNP:756641063
1418 1418 -, aa dbSNP:606231186
1418 1418 a, c dbSNP:201156613
1419 1419 -, agtc dbSNP:774877318
1424 1424 c, g dbSNP:778458134
1426 1426 -, cagt dbSNP:606231184
1429 1429 c, t dbSNP:369973813
1431 1431 -, aaggggaggag dbSNP:764728647
1431 1431 -, aagggg dbSNP:762505127
1435 1435 a, g dbSNP:757713583
1440 1440 -, aga dbSNP:752082232
1442 1442 a, g dbSNP:778420248
1443 1443 a, g dbSNP:745596782
1444 1444 a, g dbSNP:771447698
1447 1447 c, g dbSNP:200547574
1448 1448 a, c dbSNP:373318863
1451 1451 g, t dbSNP:781632629
1452 1452 c, t dbSNP:768539902
1453 1453 -, taccttc, taccttcagggggctac dbSNP:762321006
1466 1466 c, g dbSNP:776552491
1471 1471 c, g, t dbSNP:111666443
1479 1479 a, g dbSNP:769687352
1481 1481 -, tc dbSNP:750727352
1488 1488 -, tggtta dbSNP:756298361
1493 1493 a, t dbSNP:774406317
1496 1496 a, g dbSNP:759852734
1501 1501 -, a dbSNP:780261890
1509 1509 a, c dbSNP:767657538
1514 1514 c, t dbSNP:11554112
1522 1522 a, c, t dbSNP:147338122
1526 1526 a, g dbSNP:778549806
1527 1527 c, t dbSNP:748689790
1532 1532 g, t dbSNP:757688624
1541 1541 -, ctt, cttc dbSNP:771171560
1542 1542 c, t dbSNP:709610
1545 1545 c, g, t dbSNP:182754597
1548 1548 -, taag dbSNP:779812493
1550 1550 -, aa dbSNP:746696047
1554 1554 a, g dbSNP:779602555
1558 1558 -, tc, tctattt, tctattttat dbSNP:745608853
1559 1559 g, t dbSNP:746449195
1563 1563 a, g dbSNP:768167537
1566 1566 a, c dbSNP:187360934
1568 1568 c, g dbSNP:781094210
1572 1572 a, g dbSNP:748123688
1576 1576 c, t dbSNP:781670523
1665 1665 a, g dbSNP:566285470
1666 1666 -, tactc dbSNP:748590147
1721 1721 -, ccagcca dbSNP:200632554
1723 1723 -, agccacc dbSNP:376636279
1733 1733 c, t dbSNP:773249692
1751 1751 g, t dbSNP:1042449
1754 1754 a, g dbSNP:1042450
1758 1758 c, g dbSNP:774381598
1762 1762 c, t dbSNP:759806053
1764 1764 a, c dbSNP:763789986
1795 1795 a, g dbSNP:372658162
1799 1799 a, g dbSNP:375225163
1802 1802 a, g dbSNP:753720613
1822 1822 a, g dbSNP:761629687
1823 1823 c, t dbSNP:765304960
1824 1824 a, g dbSNP:56318063
1829 1829 -, cat dbSNP:144356124
1830 1830 -, atc, cat dbSNP:72116174
1832 1832 -, ca, cat dbSNP:199685000
1841 1841 -, agat dbSNP:764801500
1843 1843 -, ataca dbSNP:779722514
1858 1858 a, t dbSNP:369332453
1864 1864 c, t dbSNP:754719295
1881 1881 -, tttaaaataagac dbSNP:201758797
1884 1884 -, aaaataagacttt dbSNP:375651955
1898 1898 g, t dbSNP:183744566
1907 1907 -, ccaattttgtaatcatt dbSNP:372190247
1937 1937 -, a dbSNP:763688379
1939 1939 -, tt, ttagt dbSNP:113050549
1942 1942 -, gttt dbSNP:770179781
1957 1957 c, g dbSNP:778207227
1963 1963 c, t dbSNP:749812407
1979 1979 -, tat dbSNP:770933958
1981 1981 a, g dbSNP:187525386
1995 1995 -, caaa dbSNP:746061580
2007 2007 c, t dbSNP:191995452
2021 2021 a, g dbSNP:776254250
2046 2046 g, t dbSNP:5955761
2053 2053 c, t dbSNP:537446476
2139 2139 a, g dbSNP:150945967
2157 2157 a, g dbSNP:773225586
2160 2160 c, t dbSNP:1042452
2161 2161 a, g dbSNP:376808450
2219 2219 c, t dbSNP:751130904
2270 2270 a, c dbSNP:754555154
2276 2276 a, g dbSNP:1042453
2289 2289 a, g dbSNP:182836908
2295 2295 c, t dbSNP:187083263
2296 2296 a, g dbSNP:192450087
2343 2343 -, tgtt dbSNP:749787977
2350 2350 -, a dbSNP:760736313
2354 2354 -, aaca dbSNP:757815346
2355 2355 a, g dbSNP:542108895
2369 2369 a, g dbSNP:778832973
2370 2370 a, t dbSNP:184532061
2388 2388 -, aag dbSNP:772075136
2392 2392 -, t dbSNP:775731731
2392 2392 c, t dbSNP:374396566
2445 2445 a, c dbSNP:1042456
2446 2446 a, g dbSNP:769643820
2453 2453 a, g dbSNP:140383712
2460 2460 c, t dbSNP:781582453
2463 2463 -, aaca dbSNP:776627726
2485 2485 c, t dbSNP:773012317
2487 2487 c, g, t dbSNP:762963142
2491 2491 a, g dbSNP:15816
2493 2493 a, g, t dbSNP:760828301
2502 2502 -, ct dbSNP:762592504
2502 2502 c, t dbSNP:754361374
2506 2506 c, g dbSNP:762427939
2517 2517 a, g dbSNP:765681576
2518 2518 -, tgat dbSNP:748635462
2534 2534 -, cttgt dbSNP:775059849
2534 2534 c, t dbSNP:750757959
2537 2537 c, g dbSNP:758692867
2539 2539 -, tt dbSNP:762409221
2550 2550 c, g dbSNP:779698506
2561 2561 a, g dbSNP:140145114
2564 2564 c, g dbSNP:145675672
2565 2565 c, t dbSNP:61744590
2570 2570 a, g dbSNP:756645339
2573 2573 c, t dbSNP:56021619
2574 2574 c, t dbSNP:778346850
2582 2582 c, t dbSNP:747680098
2583 2583 a, g dbSNP:756039907
2584 2584 c, t dbSNP:147753175
2586 2586 c, t dbSNP:759041463
2589 2589 c, t dbSNP:766954168
2591 2591 a, g, t dbSNP:557102951
2594 2594 -, tc dbSNP:750762941
2598 2598 c, t dbSNP:747270244
2599 2599 -, a dbSNP:761048720
2603 2603 g, t dbSNP:768831534
2609 2609 a, g dbSNP:776800732
2618 2618 -, aaac dbSNP:766536396
2620 2620 a, g dbSNP:761827915
2624 2624 -, ac dbSNP:202102403
2630 2630 -, ctgt dbSNP:755834416
2636 2636 c, t dbSNP:765707363
2640 2640 a, c dbSNP:369499936
2641 2641 a, g dbSNP:373390286
2646 2646 a, t dbSNP:770495684
2653 2653 a, g dbSNP:766795601
2661 2661 c, g dbSNP:751191482
2726 2726 g, t dbSNP:369068280
2729 2729 a, g dbSNP:778678656
2737 2737 c, t dbSNP:754247336
2738 2738 a, g dbSNP:745566169
2743 2743 c, t dbSNP:189054591
2777 2777 a, g dbSNP:193253848
2809 2809 a, g dbSNP:56039350
2826 2826 c, t dbSNP:55856360
2856 2856 a, g dbSNP:760525544
2865 2865 c, t dbSNP:779999826
2866 2866 a, g dbSNP:768422526
2882 2882 c, t dbSNP:747229060
2899 2899 a, g dbSNP:769050360
2995 2995 c, g dbSNP:7883708
3002 3002 a, t dbSNP:770658441
3017 3017 c, t dbSNP:5955550
3030 3030 c, g dbSNP:11094770
3033 3033 a, g dbSNP:771609750
3034 3034 c, g dbSNP:762905278
3079 3079 a, g dbSNP:201259816
3080 3080 a, g, t dbSNP:376593530
3090 3090 -, cttata dbSNP:760296050
3092 3092 a, t dbSNP:755594888
3094 3094 c, t dbSNP:370565981
3110 3110 g, t dbSNP:749254470
3114 3114 c, t dbSNP:55744630
3117 3117 c, g, t dbSNP:377382652
3118 3118 a, c, t dbSNP:753516995
3119 3119 a, g dbSNP:748198804
3121 3121 -, a dbSNP:762188631
3125 3125 a, g, t dbSNP:148399187
3129 3129 g, t dbSNP:763409232
3136 3136 a, g dbSNP:142533585
3143 3143 a, c dbSNP:766893716
3148 3148 a, g dbSNP:774659644
3149 3149 g, t dbSNP:150957359
3150 3150 c, g dbSNP:370651623
3167 3167 a, c dbSNP:750874490
3168 3168 c, t dbSNP:140779387
3170 3170 a, g dbSNP:752352625
3174 3174 g, t dbSNP:371285733
3182 3182 c, t dbSNP:144734730
3184 3184 -, t dbSNP:751563348
3190 3190 a, g dbSNP:763556279
3195 3195 a, c, t dbSNP:780260798
3209 3209 a, c dbSNP:373779094
3210 3210 a, c, g dbSNP:779022123
3211 3211 a, t dbSNP:758279534
3224 3224 c, g dbSNP:781550393
3227 3227 c, t dbSNP:374494282
3241 3241 c, g dbSNP:769886359
3244 3244 c, t dbSNP:777666685
3245 3245 a, g dbSNP:755016325
3246 3246 c, t dbSNP:749418204
3247 3247 a, g dbSNP:771363028
3251 3251 -, tttc dbSNP:757189654
3272 3272 c, g dbSNP:781517592
3279 3279 a, g dbSNP:759883184
3290 3290 a, c dbSNP:772494786
3301 3301 c, g dbSNP:15943
3306 3306 c, t dbSNP:760297711
3307 3307 a, g dbSNP:763826263
3327 3327 c, t dbSNP:753243729
3331 3331 c, t dbSNP:761409953
3340 3340 g, t dbSNP:770697702
3343 3343 c, g, t dbSNP:368526609
3344 3344 a, g, t dbSNP:372102191
3348 3348 c, g dbSNP:140380348
3356 3356 g, t dbSNP:752937000
3358 3358 c, g dbSNP:778062708
3362 3362 c, g dbSNP:749306111
3379 3379 -, g dbSNP:781136595
3379 3379 c, t dbSNP:771054574
3380 3380 a, g dbSNP:779385101
3382 3382 c, t dbSNP:756514533
3385 3385 a, g dbSNP:746410710
3391 3391 c, t dbSNP:778642797
3396 3396 -, tatat dbSNP:745681893
3403 3403 g, t dbSNP:375095104
3414 3414 a, c dbSNP:368185128
3417 3417 -, ct dbSNP:755908979
3420 3420 c, t dbSNP:745807211
3424 3424 a, g dbSNP:776362774
3451 3451 c, t dbSNP:181554208
3468 3468 a, g dbSNP:774947730

Target ORF information:

RefSeq Version NM_001173454
Organism Homo sapiens (human)
Definition Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu11667
Accession Version NM_001173455.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1194bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 3 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK296341.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (3) uses an alternative acceptor splice site at one of the coding exons compared to variant 1, resulting in a longer isoform (3) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296341.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)332..334(+)
Misc Feature(2)332..334(+)
Misc Feature(3)335..1225(+)
Misc Feature(4)407..1066(+)
Misc Feature(5)518..1042(+)
Misc Feature(6)644..805(+)
Misc Feature(7)860..862(+)
Misc Feature(8)896..898(+)
Misc Feature(9)896..898(+)
Misc Feature(10)995..997(+)
Misc Feature(11)1025..1114(+)
Misc Feature(12)1043..1045(+)
Misc Feature(13)1049..1051(+)
Misc Feature(14)1064..1066(+)
Misc Feature(15)1067..1069(+)
Misc Feature(16)1103..1105(+)
Misc Feature(17)1103..1105(+)
Misc Feature(18)1127..1129(+)
Misc Feature(19)1172..1174(+)
Misc Feature(20)1319..1321(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..262
Gene Synonym:
Exon (3)263..436
Gene Synonym:
Exon (4)437..584
Gene Synonym:
Exon (5)585..676
Gene Synonym:
Exon (6)677..769
Gene Synonym:
Exon (7)770..925
Gene Synonym:
Exon (8)926..997
Gene Synonym:
Exon (9)998..1065
Gene Synonym:
Exon (10)1066..1174
Gene Synonym:
Exon (11)1175..3393
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 g, t dbSNP:773500511
209 209 a, g dbSNP:763398358
214 214 a, g dbSNP:770667770
219 219 c, t dbSNP:774155734
227 227 c, t dbSNP:759062849
242 242 c, g dbSNP:150318528
243 243 a, t dbSNP:752678074
250 250 a, g dbSNP:746867841
271 271 c, g dbSNP:759331650
279 279 a, g dbSNP:144967854
284 284 a, g dbSNP:745312079
290 290 g, t dbSNP:760251445
297 297 c, g dbSNP:771734567
299 299 a, g dbSNP:376746290
315 315 c, g, t dbSNP:149083818
362 362 a, c dbSNP:761538559
363 363 a, g dbSNP:765074163
397 397 a, g dbSNP:144828838
439 439 c, t dbSNP:768225634
447 447 c, t dbSNP:776535833
449 449 c, g dbSNP:371532584
453 453 c, t dbSNP:191666624
484 484 c, t dbSNP:764516370
485 485 a, g dbSNP:764996618
493 493 c, t dbSNP:772943333
503 503 c, t dbSNP:11554111
504 504 a, g dbSNP:762839069
523 523 a, g dbSNP:767569398
529 529 c, t dbSNP:183170654
545 545 c, t dbSNP:199959402
556 556 c, t dbSNP:756138817
557 557 a, g dbSNP:764303926
562 562 a, c dbSNP:757654963
572 572 a, g dbSNP:138727886
613 613 a, g dbSNP:773139249
649 649 c, t dbSNP:398123300
652 652 g, t dbSNP:762598184
673 673 a, g dbSNP:141862527
688 688 c, t dbSNP:769308417
716 716 a, g dbSNP:777678490
730 730 g, t dbSNP:749319044
737 737 c, g dbSNP:770603511
781 781 c, g, t dbSNP:137853254
814 814 a, c dbSNP:121917898
823 823 c, t dbSNP:778744930
826 826 c, t dbSNP:745607005
859 859 a, g dbSNP:138237215
862 862 c, t dbSNP:764871850
863 863 a, g dbSNP:372505888
874 874 a, g dbSNP:750307419
883 883 c, t dbSNP:769963488
893 893 a, t dbSNP:137853255
922 922 c, g dbSNP:768600287
926 926 c, g dbSNP:749333596
928 928 a, g dbSNP:770975182
930 930 a, g dbSNP:774917952
939 939 a, c dbSNP:137853253
950 950 a, g dbSNP:202166915
953 953 c, g dbSNP:137853259
956 956 c, g dbSNP:767850573
961 961 a, c, g dbSNP:1126565
964 964 a, g dbSNP:35752213
976 976 g, t dbSNP:763733376
981 981 a, g dbSNP:752225588
1003 1003 c, g dbSNP:775978359
1010 1010 a, c dbSNP:2229137
1015 1015 a, g dbSNP:768957853
1018 1018 g, t dbSNP:776339048
1020 1020 a, g dbSNP:373275701
1027 1027 -, t dbSNP:606231190
1029 1029 a, g dbSNP:137853258
1036 1036 c, t dbSNP:761411007
1045 1045 c, t dbSNP:764780830
1070 1070 c, t dbSNP:137853252
1077 1077 a, g dbSNP:766055203
1078 1078 a, c dbSNP:751513713
1083 1083 -, tagttaccgtacacgagaaga dbSNP:606231188
1093 1093 a, c dbSNP:200088791
1100 1100 -, agtaaga dbSNP:606231185
1103 1103 -, aag dbSNP:137853251
1105 1105 a, g dbSNP:374649412
1109 1109 a, g dbSNP:137853256
1114 1114 a, t dbSNP:759443348
1121 1121 c, g dbSNP:767515770
1128 1128 a, g dbSNP:752399277
1138 1138 a, g dbSNP:755945768
1144 1144 c, g, t dbSNP:779045292
1149 1149 a, g dbSNP:758465753
1150 1150 c, t dbSNP:767503319
1165 1165 a, c dbSNP:2228067
1183 1183 -, ttttaggaaattgat dbSNP:367658754
1187 1187 a, c, g dbSNP:755090271
1227 1227 c, t dbSNP:375167721
1228 1228 a, g, t dbSNP:147510382
1231 1231 c, t dbSNP:749696135
1232 1232 a, g dbSNP:770669838
1234 1234 c, t dbSNP:369185042
1239 1239 -, agccacctttggaagagctg dbSNP:606231187
1249 1249 a, g dbSNP:745312753
1268 1268 a, c dbSNP:771666787
1275 1275 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1276 1276 a, c dbSNP:775280711
1279 1279 c, t dbSNP:773338429
1280 1280 a, g dbSNP:199879809
1283 1283 c, t dbSNP:776360150
1284 1284 c, t dbSNP:761624839
1294 1294 a, c dbSNP:766521439
1299 1299 a, g dbSNP:137853250
1303 1303 c, t dbSNP:766631999
1311 1311 -, atca dbSNP:606231189
1312 1312 c, g dbSNP:767675495
1316 1316 a, c dbSNP:753124944
1318 1318 c, g dbSNP:756641063
1325 1325 -, aa dbSNP:606231186
1325 1325 a, c dbSNP:201156613
1326 1326 -, agtc dbSNP:774877318
1331 1331 c, g dbSNP:778458134
1333 1333 -, cagt dbSNP:606231184
1336 1336 c, t dbSNP:369973813
1338 1338 -, aaggggaggag dbSNP:764728647
1338 1338 -, aagggg dbSNP:762505127
1342 1342 a, g dbSNP:757713583
1347 1347 -, aga dbSNP:752082232
1349 1349 a, g dbSNP:778420248
1350 1350 a, g dbSNP:745596782
1351 1351 a, g dbSNP:771447698
1354 1354 c, g dbSNP:200547574
1355 1355 a, c dbSNP:373318863
1358 1358 g, t dbSNP:781632629
1359 1359 c, t dbSNP:768539902
1360 1360 -, taccttc, taccttcagggggctac dbSNP:762321006
1373 1373 c, g dbSNP:776552491
1378 1378 c, g, t dbSNP:111666443
1386 1386 a, g dbSNP:769687352
1388 1388 -, tc dbSNP:750727352
1395 1395 -, tggtta dbSNP:756298361
1400 1400 a, t dbSNP:774406317
1403 1403 a, g dbSNP:759852734
1408 1408 -, a dbSNP:780261890
1416 1416 a, c dbSNP:767657538
1421 1421 c, t dbSNP:11554112
1429 1429 a, c, t dbSNP:147338122
1433 1433 a, g dbSNP:778549806
1434 1434 c, t dbSNP:748689790
1439 1439 g, t dbSNP:757688624
1448 1448 -, ctt, cttc dbSNP:771171560
1449 1449 c, t dbSNP:709610
1452 1452 c, g, t dbSNP:182754597
1455 1455 -, taag dbSNP:779812493
1457 1457 -, aa dbSNP:746696047
1461 1461 a, g dbSNP:779602555
1465 1465 -, tc, tctattt, tctattttat dbSNP:745608853
1466 1466 g, t dbSNP:746449195
1470 1470 a, g dbSNP:768167537
1473 1473 a, c dbSNP:187360934
1475 1475 c, g dbSNP:781094210
1479 1479 a, g dbSNP:748123688
1483 1483 c, t dbSNP:781670523
1572 1572 a, g dbSNP:566285470
1573 1573 -, tactc dbSNP:748590147
1628 1628 -, ccagcca dbSNP:200632554
1630 1630 -, agccacc dbSNP:376636279
1640 1640 c, t dbSNP:773249692
1658 1658 g, t dbSNP:1042449
1661 1661 a, g dbSNP:1042450
1665 1665 c, g dbSNP:774381598
1669 1669 c, t dbSNP:759806053
1671 1671 a, c dbSNP:763789986
1702 1702 a, g dbSNP:372658162
1706 1706 a, g dbSNP:375225163
1709 1709 a, g dbSNP:753720613
1729 1729 a, g dbSNP:761629687
1730 1730 c, t dbSNP:765304960
1731 1731 a, g dbSNP:56318063
1736 1736 -, cat dbSNP:144356124
1737 1737 -, atc, cat dbSNP:72116174
1739 1739 -, ca, cat dbSNP:199685000
1748 1748 -, agat dbSNP:764801500
1750 1750 -, ataca dbSNP:779722514
1765 1765 a, t dbSNP:369332453
1771 1771 c, t dbSNP:754719295
1788 1788 -, tttaaaataagac dbSNP:201758797
1791 1791 -, aaaataagacttt dbSNP:375651955
1805 1805 g, t dbSNP:183744566
1814 1814 -, ccaattttgtaatcatt dbSNP:372190247
1844 1844 -, a dbSNP:763688379
1846 1846 -, tt, ttagt dbSNP:113050549
1849 1849 -, gttt dbSNP:770179781
1864 1864 c, g dbSNP:778207227
1870 1870 c, t dbSNP:749812407
1886 1886 -, tat dbSNP:770933958
1888 1888 a, g dbSNP:187525386
1902 1902 -, caaa dbSNP:746061580
1914 1914 c, t dbSNP:191995452
1928 1928 a, g dbSNP:776254250
1953 1953 g, t dbSNP:5955761
1960 1960 c, t dbSNP:537446476
2046 2046 a, g dbSNP:150945967
2064 2064 a, g dbSNP:773225586
2067 2067 c, t dbSNP:1042452
2068 2068 a, g dbSNP:376808450
2126 2126 c, t dbSNP:751130904
2177 2177 a, c dbSNP:754555154
2183 2183 a, g dbSNP:1042453
2196 2196 a, g dbSNP:182836908
2202 2202 c, t dbSNP:187083263
2203 2203 a, g dbSNP:192450087
2250 2250 -, tgtt dbSNP:749787977
2257 2257 -, a dbSNP:760736313
2261 2261 -, aaca dbSNP:757815346
2262 2262 a, g dbSNP:542108895
2276 2276 a, g dbSNP:778832973
2277 2277 a, t dbSNP:184532061
2295 2295 -, aag dbSNP:772075136
2299 2299 -, t dbSNP:775731731
2299 2299 c, t dbSNP:374396566
2352 2352 a, c dbSNP:1042456
2353 2353 a, g dbSNP:769643820
2360 2360 a, g dbSNP:140383712
2367 2367 c, t dbSNP:781582453
2370 2370 -, aaca dbSNP:776627726
2392 2392 c, t dbSNP:773012317
2394 2394 c, g, t dbSNP:762963142
2398 2398 a, g dbSNP:15816
2400 2400 a, g, t dbSNP:760828301
2409 2409 -, ct dbSNP:762592504
2409 2409 c, t dbSNP:754361374
2413 2413 c, g dbSNP:762427939
2424 2424 a, g dbSNP:765681576
2425 2425 -, tgat dbSNP:748635462
2441 2441 -, cttgt dbSNP:775059849
2441 2441 c, t dbSNP:750757959
2444 2444 c, g dbSNP:758692867
2446 2446 -, tt dbSNP:762409221
2457 2457 c, g dbSNP:779698506
2468 2468 a, g dbSNP:140145114
2471 2471 c, g dbSNP:145675672
2472 2472 c, t dbSNP:61744590
2477 2477 a, g dbSNP:756645339
2480 2480 c, t dbSNP:56021619
2481 2481 c, t dbSNP:778346850
2489 2489 c, t dbSNP:747680098
2490 2490 a, g dbSNP:756039907
2491 2491 c, t dbSNP:147753175
2493 2493 c, t dbSNP:759041463
2496 2496 c, t dbSNP:766954168
2498 2498 a, g, t dbSNP:557102951
2501 2501 -, tc dbSNP:750762941
2505 2505 c, t dbSNP:747270244
2506 2506 -, a dbSNP:761048720
2510 2510 g, t dbSNP:768831534
2516 2516 a, g dbSNP:776800732
2525 2525 -, aaac dbSNP:766536396
2527 2527 a, g dbSNP:761827915
2531 2531 -, ac dbSNP:202102403
2537 2537 -, ctgt dbSNP:755834416
2543 2543 c, t dbSNP:765707363
2547 2547 a, c dbSNP:369499936
2548 2548 a, g dbSNP:373390286
2553 2553 a, t dbSNP:770495684
2560 2560 a, g dbSNP:766795601
2568 2568 c, g dbSNP:751191482
2633 2633 g, t dbSNP:369068280
2636 2636 a, g dbSNP:778678656
2644 2644 c, t dbSNP:754247336
2645 2645 a, g dbSNP:745566169
2650 2650 c, t dbSNP:189054591
2684 2684 a, g dbSNP:193253848
2716 2716 a, g dbSNP:56039350
2733 2733 c, t dbSNP:55856360
2763 2763 a, g dbSNP:760525544
2772 2772 c, t dbSNP:779999826
2773 2773 a, g dbSNP:768422526
2789 2789 c, t dbSNP:747229060
2806 2806 a, g dbSNP:769050360
2902 2902 c, g dbSNP:7883708
2909 2909 a, t dbSNP:770658441
2924 2924 c, t dbSNP:5955550
2937 2937 c, g dbSNP:11094770
2940 2940 a, g