Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PDHA1 pyruvate dehydrogenase (lipoamide) alpha 1 [Homo sapiens (human)]

Gene Symbol PDHA1
Entrez Gene ID 5160
Full Name pyruvate dehydrogenase (lipoamide) alpha 1
General protein information
Preferred Names
pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
PDHE1-A type I
pyruvate dehydrogenase complex, E1-alpha polypeptide 1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. lac of sum
Disorder MIM:


Disorder Html: Pyruvate dehydrogenase deficiency, 312170 (3); Leigh syndrome,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu59599 XM_011545531 PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu59600 XM_011545532 PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu10616 NM_001173456 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu11172 NM_001173454 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu11667 NM_001173455 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu20621 NM_000284 Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu59599D
Sequence Information ORF Nucleotide Sequence (Length: 1308bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)436..1326(+)
Misc Feature(2)508..1167(+)
Misc Feature(3)619..1143(+)
Misc Feature(4)745..906(+)
Misc Feature(5)1126..1215(+)
Position Chain Variation Link
22 22 g, t dbSNP:781441358
35 35 c, t dbSNP:192773464
45 45 a, g dbSNP:5955751
61 61 a, g dbSNP:778593749
75 75 c, t dbSNP:775567462
82 82 c, g, t dbSNP:745758119
83 83 g, t dbSNP:771905403
87 87 c, t dbSNP:778551493
89 89 a, c dbSNP:745761659
91 91 g, t dbSNP:772091896
92 92 c, g dbSNP:779608230
107 107 a, g dbSNP:746757266
109 109 c, t dbSNP:768574096
110 110 c, g dbSNP:773557576
113 113 g, t dbSNP:763337765
116 116 a, g dbSNP:770889326
118 118 c, t dbSNP:774543652
123 123 c, t dbSNP:746571233
124 124 c, t dbSNP:76809608
128 128 a, g dbSNP:768029512
140 140 a, g dbSNP:753208097
148 148 a, g dbSNP:768396832
149 149 c, t dbSNP:764498937
160 160 a, c dbSNP:753484182
161 161 c, g dbSNP:137853257
163 163 a, g dbSNP:756973583
174 174 c, t dbSNP:778260543
190 190 -, g dbSNP:753113002
194 194 a, g dbSNP:750462643
206 206 c, t dbSNP:7883320
238 238 a, g dbSNP:780276301
255 255 c, t dbSNP:182962186
256 256 a, g dbSNP:145749914
268 268 a, t dbSNP:766213373
279 279 c, g dbSNP:747051654
287 287 c, g dbSNP:751469147
304 304 g, t dbSNP:773500511
310 310 a, g dbSNP:763398358
315 315 a, g dbSNP:770667770
320 320 c, t dbSNP:774155734
328 328 c, t dbSNP:759062849
343 343 c, g dbSNP:150318528
344 344 a, t dbSNP:752678074
351 351 a, g dbSNP:746867841
372 372 c, g dbSNP:759331650
380 380 a, g dbSNP:144967854
385 385 a, g dbSNP:745312079
391 391 g, t dbSNP:760251445
398 398 c, g dbSNP:771734567
400 400 a, g dbSNP:376746290
416 416 c, g, t dbSNP:149083818
463 463 a, c dbSNP:761538559
464 464 a, g dbSNP:765074163
498 498 a, g dbSNP:144828838
540 540 c, t dbSNP:768225634
548 548 c, t dbSNP:776535833
550 550 c, g dbSNP:371532584
554 554 c, t dbSNP:191666624
585 585 c, t dbSNP:764516370
586 586 a, g dbSNP:764996618
594 594 c, t dbSNP:772943333
604 604 c, t dbSNP:11554111
605 605 a, g dbSNP:762839069
624 624 a, g dbSNP:767569398
630 630 c, t dbSNP:183170654
646 646 c, t dbSNP:199959402
657 657 c, t dbSNP:756138817
658 658 a, g dbSNP:764303926
663 663 a, c dbSNP:757654963
673 673 a, g dbSNP:138727886
714 714 a, g dbSNP:773139249
750 750 c, t dbSNP:398123300
753 753 g, t dbSNP:762598184
774 774 a, g dbSNP:141862527
789 789 c, t dbSNP:769308417
817 817 a, g dbSNP:777678490
831 831 g, t dbSNP:749319044
838 838 c, g dbSNP:770603511
882 882 c, g, t dbSNP:137853254
915 915 a, c dbSNP:121917898
924 924 c, t dbSNP:778744930
927 927 c, t dbSNP:745607005
960 960 a, g dbSNP:138237215
963 963 c, t dbSNP:764871850
964 964 a, g dbSNP:372505888
975 975 a, g dbSNP:750307419
984 984 c, t dbSNP:769963488
994 994 a, t dbSNP:137853255
1023 1023 c, g dbSNP:768600287
1027 1027 c, g dbSNP:749333596
1029 1029 a, g dbSNP:770975182
1031 1031 a, g dbSNP:774917952
1040 1040 a, c dbSNP:137853253
1051 1051 a, g dbSNP:202166915
1054 1054 c, g dbSNP:137853259
1057 1057 c, g dbSNP:767850573
1062 1062 a, c, g dbSNP:1126565
1065 1065 a, g dbSNP:35752213
1077 1077 g, t dbSNP:763733376
1082 1082 a, g dbSNP:752225588
1104 1104 c, g dbSNP:775978359
1111 1111 a, c dbSNP:2229137
1116 1116 a, g dbSNP:768957853
1119 1119 g, t dbSNP:776339048
1121 1121 a, g dbSNP:373275701
1128 1128 -, t dbSNP:606231190
1130 1130 a, g dbSNP:137853258
1137 1137 c, t dbSNP:761411007
1146 1146 c, t dbSNP:764780830
1171 1171 c, t dbSNP:137853252
1178 1178 a, g dbSNP:766055203
1179 1179 a, c dbSNP:751513713
1184 1184 -, tagttaccgtacacgagaaga dbSNP:606231188
1194 1194 a, c dbSNP:200088791
1201 1201 -, agtaaga dbSNP:606231185
1204 1204 -, aag dbSNP:137853251
1206 1206 a, g dbSNP:374649412
1210 1210 a, g dbSNP:137853256
1215 1215 a, t dbSNP:759443348
1222 1222 c, g dbSNP:767515770
1229 1229 a, g dbSNP:752399277
1239 1239 a, g dbSNP:755945768
1245 1245 c, g, t dbSNP:779045292
1250 1250 a, g dbSNP:758465753
1251 1251 c, t dbSNP:767503319
1266 1266 a, c dbSNP:2228067
1284 1284 -, ttttaggaaattgat dbSNP:367658754
1288 1288 a, c, g dbSNP:755090271
1328 1328 c, t dbSNP:375167721
1329 1329 a, g, t dbSNP:147510382
1332 1332 c, t dbSNP:749696135
1333 1333 a, g dbSNP:770669838
1335 1335 c, t dbSNP:369185042
1340 1340 -, agccacctttggaagagctg dbSNP:606231187
1350 1350 a, g dbSNP:745312753
1369 1369 a, c dbSNP:771666787
1376 1376 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1377 1377 a, c dbSNP:775280711
1380 1380 c, t dbSNP:773338429
1381 1381 a, g dbSNP:199879809
1384 1384 c, t dbSNP:776360150
1385 1385 c, t dbSNP:761624839
1395 1395 a, c dbSNP:766521439
1400 1400 a, g dbSNP:137853250
1404 1404 c, t dbSNP:766631999
1412 1412 -, atca dbSNP:606231189
1413 1413 c, g dbSNP:767675495
1417 1417 a, c dbSNP:753124944
1419 1419 c, g dbSNP:756641063
1426 1426 -, aa dbSNP:606231186
1426 1426 a, c dbSNP:201156613
1427 1427 -, agtc dbSNP:774877318
1432 1432 c, g dbSNP:778458134
1434 1434 -, cagt dbSNP:606231184
1437 1437 c, t dbSNP:369973813
1439 1439 -, aaggggaggag dbSNP:764728647
1439 1439 -, aagggg dbSNP:762505127
1443 1443 a, g dbSNP:757713583
1448 1448 -, aga dbSNP:752082232
1450 1450 a, g dbSNP:778420248
1451 1451 a, g dbSNP:745596782
1452 1452 a, g dbSNP:771447698
1455 1455 c, g dbSNP:200547574
1456 1456 a, c dbSNP:373318863
1459 1459 g, t dbSNP:781632629
1460 1460 c, t dbSNP:768539902
1461 1461 -, taccttc, taccttcagggggctac dbSNP:762321006
1474 1474 c, g dbSNP:776552491
1479 1479 c, g, t dbSNP:111666443
1487 1487 a, g dbSNP:769687352
1489 1489 -, tc dbSNP:750727352
1496 1496 -, tggtta dbSNP:756298361
1501 1501 a, t dbSNP:774406317
1504 1504 a, g dbSNP:759852734
1509 1509 -, a dbSNP:780261890
1517 1517 a, c dbSNP:767657538
1522 1522 c, t dbSNP:11554112
1530 1530 a, c, t dbSNP:147338122
1534 1534 a, g dbSNP:778549806
1535 1535 c, t dbSNP:748689790
1540 1540 g, t dbSNP:757688624
1549 1549 -, ctt, cttc dbSNP:771171560
1550 1550 c, t dbSNP:709610
1553 1553 c, g, t dbSNP:182754597
1556 1556 -, taag dbSNP:779812493
1558 1558 -, aa dbSNP:746696047
1562 1562 a, g dbSNP:779602555
1566 1566 -, tc, tctattt, tctattttat dbSNP:745608853
1567 1567 g, t dbSNP:746449195
1571 1571 a, g dbSNP:768167537
1574 1574 a, c dbSNP:187360934
1576 1576 c, g dbSNP:781094210
1580 1580 a, g dbSNP:748123688
1584 1584 c, t dbSNP:781670523
1673 1673 a, g dbSNP:566285470
1674 1674 -, tactc dbSNP:748590147
1729 1729 -, ccagcca dbSNP:200632554
1731 1731 -, agccacc dbSNP:376636279
1741 1741 c, t dbSNP:773249692
1759 1759 g, t dbSNP:1042449
1762 1762 a, g dbSNP:1042450
1766 1766 c, g dbSNP:774381598
1770 1770 c, t dbSNP:759806053
1772 1772 a, c dbSNP:763789986
1803 1803 a, g dbSNP:372658162
1807 1807 a, g dbSNP:375225163
1810 1810 a, g dbSNP:753720613
1830 1830 a, g dbSNP:761629687
1831 1831 c, t dbSNP:765304960
1832 1832 a, g dbSNP:56318063
1837 1837 -, cat dbSNP:144356124
1838 1838 -, atc, cat dbSNP:72116174
1840 1840 -, ca, cat dbSNP:199685000
1849 1849 -, agat dbSNP:764801500
1851 1851 -, ataca dbSNP:779722514
1866 1866 a, t dbSNP:369332453
1872 1872 c, t dbSNP:754719295
1889 1889 -, tttaaaataagac dbSNP:201758797
1892 1892 -, aaaataagacttt dbSNP:375651955
1906 1906 g, t dbSNP:183744566
1915 1915 -, ccaattttgtaatcatt dbSNP:372190247
1945 1945 -, a dbSNP:763688379
1947 1947 -, tt, ttagt dbSNP:113050549
1950 1950 -, gttt dbSNP:770179781
1965 1965 c, g dbSNP:778207227
1971 1971 c, t dbSNP:749812407
1987 1987 -, tat dbSNP:770933958
1989 1989 a, g dbSNP:187525386
2003 2003 -, caaa dbSNP:746061580
2015 2015 c, t dbSNP:191995452
2029 2029 a, g dbSNP:776254250
2054 2054 g, t dbSNP:5955761
2061 2061 c, t dbSNP:537446476
2147 2147 a, g dbSNP:150945967
2165 2165 a, g dbSNP:773225586
2168 2168 c, t dbSNP:1042452
2169 2169 a, g dbSNP:376808450
2227 2227 c, t dbSNP:751130904
2278 2278 a, c dbSNP:754555154
2284 2284 a, g dbSNP:1042453
2297 2297 a, g dbSNP:182836908
2303 2303 c, t dbSNP:187083263
2304 2304 a, g dbSNP:192450087
2351 2351 -, tgtt dbSNP:749787977
2358 2358 -, a dbSNP:760736313
2362 2362 -, aaca dbSNP:757815346
2363 2363 a, g dbSNP:542108895
2377 2377 a, g dbSNP:778832973
2378 2378 a, t dbSNP:184532061
2396 2396 -, aag dbSNP:772075136
2400 2400 -, t dbSNP:775731731
2400 2400 c, t dbSNP:374396566
2453 2453 a, c dbSNP:1042456
2454 2454 a, g dbSNP:769643820
2461 2461 a, g dbSNP:140383712
2468 2468 c, t dbSNP:781582453
2471 2471 -, aaca dbSNP:776627726
2493 2493 c, t dbSNP:773012317
2495 2495 c, g, t dbSNP:762963142
2499 2499 a, g dbSNP:15816
2501 2501 a, g, t dbSNP:760828301
2510 2510 -, ct dbSNP:762592504
2510 2510 c, t dbSNP:754361374
2514 2514 c, g dbSNP:762427939
2525 2525 a, g dbSNP:765681576
2526 2526 -, tgat dbSNP:748635462
2542 2542 -, cttgt dbSNP:775059849
2542 2542 c, t dbSNP:750757959
2545 2545 c, g dbSNP:758692867
2547 2547 -, tt dbSNP:762409221
2558 2558 c, g dbSNP:779698506
2569 2569 a, g dbSNP:140145114
2572 2572 c, g dbSNP:145675672
2573 2573 c, t dbSNP:61744590
2578 2578 a, g dbSNP:756645339
2581 2581 c, t dbSNP:56021619
2582 2582 c, t dbSNP:778346850
2590 2590 c, t dbSNP:747680098
2591 2591 a, g dbSNP:756039907
2592 2592 c, t dbSNP:147753175
2594 2594 c, t dbSNP:759041463
2597 2597 c, t dbSNP:766954168
2599 2599 a, g, t dbSNP:557102951
2602 2602 -, tc dbSNP:750762941
2606 2606 c, t dbSNP:747270244
2607 2607 -, a dbSNP:761048720
2611 2611 g, t dbSNP:768831534
2617 2617 a, g dbSNP:776800732
2626 2626 -, aaac dbSNP:766536396
2628 2628 a, g dbSNP:761827915
2632 2632 -, ac dbSNP:202102403
2638 2638 -, ctgt dbSNP:755834416
2644 2644 c, t dbSNP:765707363
2648 2648 a, c dbSNP:369499936
2649 2649 a, g dbSNP:373390286
2654 2654 a, t dbSNP:770495684
2661 2661 a, g dbSNP:766795601
2669 2669 c, g dbSNP:751191482
2734 2734 g, t dbSNP:369068280
2737 2737 a, g dbSNP:778678656
2745 2745 c, t dbSNP:754247336
2746 2746 a, g dbSNP:745566169
2751 2751 c, t dbSNP:189054591
2785 2785 a, g dbSNP:193253848
2817 2817 a, g dbSNP:56039350
2834 2834 c, t dbSNP:55856360
2864 2864 a, g dbSNP:760525544
2873 2873 c, t dbSNP:779999826
2874 2874 a, g dbSNP:768422526
2890 2890 c, t dbSNP:747229060
2907 2907 a, g dbSNP:769050360
3003 3003 c, g dbSNP:7883708
3010 3010 a, t dbSNP:770658441
3025 3025 c, t dbSNP:5955550
3038 3038 c, g dbSNP:11094770
3041 3041 a, g dbSNP:771609750
3042 3042 c, g dbSNP:762905278
3087 3087 a, g dbSNP:201259816
3088 3088 a, g, t dbSNP:376593530
3098 3098 -, cttata dbSNP:760296050
3100 3100 a, t dbSNP:755594888
3102 3102 c, t dbSNP:370565981
3118 3118 g, t dbSNP:749254470
3122 3122 c, t dbSNP:55744630
3125 3125 c, g, t dbSNP:377382652
3126 3126 a, c, t dbSNP:753516995
3127 3127 a, g dbSNP:748198804
3129 3129 -, a dbSNP:762188631
3133 3133 a, g, t dbSNP:148399187
3137 3137 g, t dbSNP:763409232
3144 3144 a, g dbSNP:142533585
3151 3151 a, c dbSNP:766893716
3156 3156 a, g dbSNP:774659644
3157 3157 g, t dbSNP:150957359
3158 3158 c, g dbSNP:370651623
3175 3175 a, c dbSNP:750874490
3176 3176 c, t dbSNP:140779387
3178 3178 a, g dbSNP:752352625
3182 3182 g, t dbSNP:371285733
3190 3190 c, t dbSNP:144734730
3192 3192 -, t dbSNP:751563348
3198 3198 a, g dbSNP:763556279
3203 3203 a, c, t dbSNP:780260798
3217 3217 a, c dbSNP:373779094
3218 3218 a, c, g dbSNP:779022123
3219 3219 a, t dbSNP:758279534
3232 3232 c, g dbSNP:781550393
3235 3235 c, t dbSNP:374494282
3249 3249 c, g dbSNP:769886359
3252 3252 c, t dbSNP:777666685
3253 3253 a, g dbSNP:755016325
3254 3254 c, t dbSNP:749418204
3255 3255 a, g dbSNP:771363028
3259 3259 -, tttc dbSNP:757189654
3280 3280 c, g dbSNP:781517592
3287 3287 a, g dbSNP:759883184
3298 3298 a, c dbSNP:772494786
3309 3309 c, g dbSNP:15943
3314 3314 c, t dbSNP:760297711
3315 3315 a, g dbSNP:763826263
3335 3335 c, t dbSNP:753243729
3339 3339 c, t dbSNP:761409953
3348 3348 g, t dbSNP:770697702
3351 3351 c, g, t dbSNP:368526609
3352 3352 a, g, t dbSNP:372102191
3356 3356 c, g dbSNP:140380348
3364 3364 g, t dbSNP:752937000
3366 3366 c, g dbSNP:778062708
3370 3370 c, g dbSNP:749306111
3387 3387 -, g dbSNP:781136595
3387 3387 c, t dbSNP:771054574
3388 3388 a, g dbSNP:779385101
3390 3390 c, t dbSNP:756514533
3393 3393 a, g dbSNP:746410710
3399 3399 c, t dbSNP:778642797
3404 3404 -, tatat dbSNP:745681893
3411 3411 g, t dbSNP:375095104
3422 3422 a, c dbSNP:368185128
3425 3425 -, ct dbSNP:755908979
3428 3428 c, t dbSNP:745807211
3432 3432 a, g dbSNP:776362774

Target ORF information:

RefSeq Version XM_011545531
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59600D
Sequence Information ORF Nucleotide Sequence (Length: 1215bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_167197.2) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)436..1233(+)
Misc Feature(2)508..1074(+)
Misc Feature(3)619..1050(+)
Misc Feature(4)745..813(+)
Misc Feature(5)1033..1122(+)
Position Chain Variation Link
22 22 g, t dbSNP:781441358
35 35 c, t dbSNP:192773464
45 45 a, g dbSNP:5955751
61 61 a, g dbSNP:778593749
75 75 c, t dbSNP:775567462
82 82 c, g, t dbSNP:745758119
83 83 g, t dbSNP:771905403
87 87 c, t dbSNP:778551493
89 89 a, c dbSNP:745761659
91 91 g, t dbSNP:772091896
92 92 c, g dbSNP:779608230
107 107 a, g dbSNP:746757266
109 109 c, t dbSNP:768574096
110 110 c, g dbSNP:773557576
113 113 g, t dbSNP:763337765
116 116 a, g dbSNP:770889326
118 118 c, t dbSNP:774543652
123 123 c, t dbSNP:746571233
124 124 c, t dbSNP:76809608
128 128 a, g dbSNP:768029512
140 140 a, g dbSNP:753208097
148 148 a, g dbSNP:768396832
149 149 c, t dbSNP:764498937
160 160 a, c dbSNP:753484182
161 161 c, g dbSNP:137853257
163 163 a, g dbSNP:756973583
174 174 c, t dbSNP:778260543
190 190 -, g dbSNP:753113002
194 194 a, g dbSNP:750462643
206 206 c, t dbSNP:7883320
238 238 a, g dbSNP:780276301
255 255 c, t dbSNP:182962186
256 256 a, g dbSNP:145749914
268 268 a, t dbSNP:766213373
279 279 c, g dbSNP:747051654
287 287 c, g dbSNP:751469147
304 304 g, t dbSNP:773500511
310 310 a, g dbSNP:763398358
315 315 a, g dbSNP:770667770
320 320 c, t dbSNP:774155734
328 328 c, t dbSNP:759062849
343 343 c, g dbSNP:150318528
344 344 a, t dbSNP:752678074
351 351 a, g dbSNP:746867841
372 372 c, g dbSNP:759331650
380 380 a, g dbSNP:144967854
385 385 a, g dbSNP:745312079
391 391 g, t dbSNP:760251445
398 398 c, g dbSNP:771734567
400 400 a, g dbSNP:376746290
416 416 c, g, t dbSNP:149083818
463 463 a, c dbSNP:761538559
464 464 a, g dbSNP:765074163
498 498 a, g dbSNP:144828838
540 540 c, t dbSNP:768225634
548 548 c, t dbSNP:776535833
550 550 c, g dbSNP:371532584
554 554 c, t dbSNP:191666624
585 585 c, t dbSNP:764516370
586 586 a, g dbSNP:764996618
594 594 c, t dbSNP:772943333
604 604 c, t dbSNP:11554111
605 605 a, g dbSNP:762839069
624 624 a, g dbSNP:767569398
630 630 c, t dbSNP:183170654
646 646 c, t dbSNP:199959402
657 657 c, t dbSNP:756138817
658 658 a, g dbSNP:764303926
663 663 a, c dbSNP:757654963
673 673 a, g dbSNP:138727886
714 714 a, g dbSNP:773139249
750 750 c, t dbSNP:398123300
753 753 g, t dbSNP:762598184
774 774 a, g dbSNP:141862527
789 789 c, g, t dbSNP:137853254
822 822 a, c dbSNP:121917898
831 831 c, t dbSNP:778744930
834 834 c, t dbSNP:745607005
867 867 a, g dbSNP:138237215
870 870 c, t dbSNP:764871850
871 871 a, g dbSNP:372505888
882 882 a, g dbSNP:750307419
891 891 c, t dbSNP:769963488
901 901 a, t dbSNP:137853255
930 930 c, g dbSNP:768600287
934 934 c, g dbSNP:749333596
936 936 a, g dbSNP:770975182
938 938 a, g dbSNP:774917952
947 947 a, c dbSNP:137853253
958 958 a, g dbSNP:202166915
961 961 c, g dbSNP:137853259
964 964 c, g dbSNP:767850573
969 969 a, c, g dbSNP:1126565
972 972 a, g dbSNP:35752213
984 984 g, t dbSNP:763733376
989 989 a, g dbSNP:752225588
1011 1011 c, g dbSNP:775978359
1018 1018 a, c dbSNP:2229137
1023 1023 a, g dbSNP:768957853
1026 1026 g, t dbSNP:776339048
1028 1028 a, g dbSNP:373275701
1035 1035 -, t dbSNP:606231190
1037 1037 a, g dbSNP:137853258
1044 1044 c, t dbSNP:761411007
1053 1053 c, t dbSNP:764780830
1078 1078 c, t dbSNP:137853252
1085 1085 a, g dbSNP:766055203
1086 1086 a, c dbSNP:751513713
1091 1091 -, tagttaccgtacacgagaaga dbSNP:606231188
1101 1101 a, c dbSNP:200088791
1108 1108 -, agtaaga dbSNP:606231185
1111 1111 -, aag dbSNP:137853251
1113 1113 a, g dbSNP:374649412
1117 1117 a, g dbSNP:137853256
1122 1122 a, t dbSNP:759443348
1129 1129 c, g dbSNP:767515770
1136 1136 a, g dbSNP:752399277
1146 1146 a, g dbSNP:755945768
1152 1152 c, g, t dbSNP:779045292
1157 1157 a, g dbSNP:758465753
1158 1158 c, t dbSNP:767503319
1173 1173 a, c dbSNP:2228067
1191 1191 -, ttttaggaaattgat dbSNP:367658754
1195 1195 a, c, g dbSNP:755090271
1235 1235 c, t dbSNP:375167721
1236 1236 a, g, t dbSNP:147510382
1239 1239 c, t dbSNP:749696135
1240 1240 a, g dbSNP:770669838
1242 1242 c, t dbSNP:369185042
1247 1247 -, agccacctttggaagagctg dbSNP:606231187
1257 1257 a, g dbSNP:745312753
1276 1276 a, c dbSNP:771666787
1283 1283 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1284 1284 a, c dbSNP:775280711
1287 1287 c, t dbSNP:773338429
1288 1288 a, g dbSNP:199879809
1291 1291 c, t dbSNP:776360150
1292 1292 c, t dbSNP:761624839
1302 1302 a, c dbSNP:766521439
1307 1307 a, g dbSNP:137853250
1311 1311 c, t dbSNP:766631999
1319 1319 -, atca dbSNP:606231189
1320 1320 c, g dbSNP:767675495
1324 1324 a, c dbSNP:753124944
1326 1326 c, g dbSNP:756641063
1333 1333 -, aa dbSNP:606231186
1333 1333 a, c dbSNP:201156613
1334 1334 -, agtc dbSNP:774877318
1339 1339 c, g dbSNP:778458134
1341 1341 -, cagt dbSNP:606231184
1344 1344 c, t dbSNP:369973813
1346 1346 -, aaggggaggag dbSNP:764728647
1346 1346 -, aagggg dbSNP:762505127
1350 1350 a, g dbSNP:757713583
1355 1355 -, aga dbSNP:752082232
1357 1357 a, g dbSNP:778420248
1358 1358 a, g dbSNP:745596782
1359 1359 a, g dbSNP:771447698
1362 1362 c, g dbSNP:200547574
1363 1363 a, c dbSNP:373318863
1366 1366 g, t dbSNP:781632629
1367 1367 c, t dbSNP:768539902
1368 1368 -, taccttc, taccttcagggggctac dbSNP:762321006
1381 1381 c, g dbSNP:776552491
1386 1386 c, g, t dbSNP:111666443
1394 1394 a, g dbSNP:769687352
1396 1396 -, tc dbSNP:750727352
1403 1403 -, tggtta dbSNP:756298361
1408 1408 a, t dbSNP:774406317
1411 1411 a, g dbSNP:759852734
1416 1416 -, a dbSNP:780261890
1424 1424 a, c dbSNP:767657538
1429 1429 c, t dbSNP:11554112
1437 1437 a, c, t dbSNP:147338122
1441 1441 a, g dbSNP:778549806
1442 1442 c, t dbSNP:748689790
1447 1447 g, t dbSNP:757688624
1456 1456 -, ctt, cttc dbSNP:771171560
1457 1457 c, t dbSNP:709610
1460 1460 c, g, t dbSNP:182754597
1463 1463 -, taag dbSNP:779812493
1465 1465 -, aa dbSNP:746696047
1469 1469 a, g dbSNP:779602555
1473 1473 -, tc, tctattt, tctattttat dbSNP:745608853
1474 1474 g, t dbSNP:746449195
1478 1478 a, g dbSNP:768167537
1481 1481 a, c dbSNP:187360934
1483 1483 c, g dbSNP:781094210
1487 1487 a, g dbSNP:748123688
1491 1491 c, t dbSNP:781670523
1580 1580 a, g dbSNP:566285470
1581 1581 -, tactc dbSNP:748590147
1636 1636 -, ccagcca dbSNP:200632554
1638 1638 -, agccacc dbSNP:376636279
1648 1648 c, t dbSNP:773249692
1666 1666 g, t dbSNP:1042449
1669 1669 a, g dbSNP:1042450
1673 1673 c, g dbSNP:774381598
1677 1677 c, t dbSNP:759806053
1679 1679 a, c dbSNP:763789986
1710 1710 a, g dbSNP:372658162
1714 1714 a, g dbSNP:375225163
1717 1717 a, g dbSNP:753720613
1737 1737 a, g dbSNP:761629687
1738 1738 c, t dbSNP:765304960
1739 1739 a, g dbSNP:56318063
1744 1744 -, cat dbSNP:144356124
1745 1745 -, atc, cat dbSNP:72116174
1747 1747 -, ca, cat dbSNP:199685000
1756 1756 -, agat dbSNP:764801500
1758 1758 -, ataca dbSNP:779722514
1773 1773 a, t dbSNP:369332453
1779 1779 c, t dbSNP:754719295
1796 1796 -, tttaaaataagac dbSNP:201758797
1799 1799 -, aaaataagacttt dbSNP:375651955
1813 1813 g, t dbSNP:183744566
1822 1822 -, ccaattttgtaatcatt dbSNP:372190247
1852 1852 -, a dbSNP:763688379
1854 1854 -, tt, ttagt dbSNP:113050549
1857 1857 -, gttt dbSNP:770179781
1872 1872 c, g dbSNP:778207227
1878 1878 c, t dbSNP:749812407
1894 1894 -, tat dbSNP:770933958
1896 1896 a, g dbSNP:187525386
1910 1910 -, caaa dbSNP:746061580
1922 1922 c, t dbSNP:191995452
1936 1936 a, g dbSNP:776254250
1961 1961 g, t dbSNP:5955761
1968 1968 c, t dbSNP:537446476
2054 2054 a, g dbSNP:150945967
2072 2072 a, g dbSNP:773225586
2075 2075 c, t dbSNP:1042452
2076 2076 a, g dbSNP:376808450
2134 2134 c, t dbSNP:751130904
2185 2185 a, c dbSNP:754555154
2191 2191 a, g dbSNP:1042453
2204 2204 a, g dbSNP:182836908
2210 2210 c, t dbSNP:187083263
2211 2211 a, g dbSNP:192450087
2258 2258 -, tgtt dbSNP:749787977
2265 2265 -, a dbSNP:760736313
2269 2269 -, aaca dbSNP:757815346
2270 2270 a, g dbSNP:542108895
2284 2284 a, g dbSNP:778832973
2285 2285 a, t dbSNP:184532061
2303 2303 -, aag dbSNP:772075136
2307 2307 -, t dbSNP:775731731
2307 2307 c, t dbSNP:374396566
2360 2360 a, c dbSNP:1042456
2361 2361 a, g dbSNP:769643820
2368 2368 a, g dbSNP:140383712
2375 2375 c, t dbSNP:781582453
2378 2378 -, aaca dbSNP:776627726
2400 2400 c, t dbSNP:773012317
2402 2402 c, g, t dbSNP:762963142
2406 2406 a, g dbSNP:15816
2408 2408 a, g, t dbSNP:760828301
2417 2417 -, ct dbSNP:762592504
2417 2417 c, t dbSNP:754361374
2421 2421 c, g dbSNP:762427939
2432 2432 a, g dbSNP:765681576
2433 2433 -, tgat dbSNP:748635462
2449 2449 -, cttgt dbSNP:775059849
2449 2449 c, t dbSNP:750757959
2452 2452 c, g dbSNP:758692867
2454 2454 -, tt dbSNP:762409221
2465 2465 c, g dbSNP:779698506
2476 2476 a, g dbSNP:140145114
2479 2479 c, g dbSNP:145675672
2480 2480 c, t dbSNP:61744590
2485 2485 a, g dbSNP:756645339
2488 2488 c, t dbSNP:56021619
2489 2489 c, t dbSNP:778346850
2497 2497 c, t dbSNP:747680098
2498 2498 a, g dbSNP:756039907
2499 2499 c, t dbSNP:147753175
2501 2501 c, t dbSNP:759041463
2504 2504 c, t dbSNP:766954168
2506 2506 a, g, t dbSNP:557102951
2509 2509 -, tc dbSNP:750762941
2513 2513 c, t dbSNP:747270244
2514 2514 -, a dbSNP:761048720
2518 2518 g, t dbSNP:768831534
2524 2524 a, g dbSNP:776800732
2533 2533 -, aaac dbSNP:766536396
2535 2535 a, g dbSNP:761827915
2539 2539 -, ac dbSNP:202102403
2545 2545 -, ctgt dbSNP:755834416
2551 2551 c, t dbSNP:765707363
2555 2555 a, c dbSNP:369499936
2556 2556 a, g dbSNP:373390286
2561 2561 a, t dbSNP:770495684
2568 2568 a, g dbSNP:766795601
2576 2576 c, g dbSNP:751191482
2641 2641 g, t dbSNP:369068280
2644 2644 a, g dbSNP:778678656
2652 2652 c, t dbSNP:754247336
2653 2653 a, g dbSNP:745566169
2658 2658 c, t dbSNP:189054591
2692 2692 a, g dbSNP:193253848
2724 2724 a, g dbSNP:56039350
2741 2741 c, t dbSNP:55856360
2771 2771 a, g dbSNP:760525544
2780 2780 c, t dbSNP:779999826
2781 2781 a, g dbSNP:768422526
2797 2797 c, t dbSNP:747229060
2814 2814 a, g dbSNP:769050360
2910 2910 c, g dbSNP:7883708
2917 2917 a, t dbSNP:770658441
2932 2932 c, t dbSNP:5955550
2945 2945 c, g dbSNP:11094770
2948 2948 a, g dbSNP:771609750
2949 2949 c, g dbSNP:762905278
2994 2994 a, g dbSNP:201259816
2995 2995 a, g, t dbSNP:376593530
3005 3005 -, cttata dbSNP:760296050
3007 3007 a, t dbSNP:755594888
3009 3009 c, t dbSNP:370565981
3025 3025 g, t dbSNP:749254470
3029 3029 c, t dbSNP:55744630
3032 3032 c, g, t dbSNP:377382652
3033 3033 a, c, t dbSNP:753516995
3034 3034 a, g dbSNP:748198804
3036 3036 -, a dbSNP:762188631
3040 3040 a, g, t dbSNP:148399187
3044 3044 g, t dbSNP:763409232
3051 3051 a, g dbSNP:142533585
3058 3058 a, c dbSNP:766893716
3063 3063 a, g dbSNP:774659644
3064 3064 g, t dbSNP:150957359
3065 3065 c, g dbSNP:370651623
3082 3082 a, c dbSNP:750874490
3083 3083 c, t dbSNP:140779387
3085 3085 a, g dbSNP:752352625
3089 3089 g, t dbSNP:371285733
3097 3097 c, t dbSNP:144734730
3099 3099 -, t dbSNP:751563348
3105 3105 a, g dbSNP:763556279
3110 3110 a, c, t dbSNP:780260798
3124 3124 a, c dbSNP:373779094
3125 3125 a, c, g dbSNP:779022123
3126 3126 a, t dbSNP:758279534
3139 3139 c, g dbSNP:781550393
3142 3142 c, t dbSNP:374494282
3156 3156 c, g dbSNP:769886359
3159 3159 c, t dbSNP:777666685
3160 3160 a, g dbSNP:755016325
3161 3161 c, t dbSNP:749418204
3162 3162 a, g dbSNP:771363028
3166 3166 -, tttc dbSNP:757189654
3187 3187 c, g dbSNP:781517592
3194 3194 a, g dbSNP:759883184
3205 3205 a, c dbSNP:772494786
3216 3216 c, g dbSNP:15943
3221 3221 c, t dbSNP:760297711
3222 3222 a, g dbSNP:763826263
3242 3242 c, t dbSNP:753243729
3246 3246 c, t dbSNP:761409953
3255 3255 g, t dbSNP:770697702
3258 3258 c, g, t dbSNP:368526609
3259 3259 a, g, t dbSNP:372102191
3263 3263 c, g dbSNP:140380348
3271 3271 g, t dbSNP:752937000
3273 3273 c, g dbSNP:778062708
3277 3277 c, g dbSNP:749306111
3294 3294 -, g dbSNP:781136595
3294 3294 c, t dbSNP:771054574
3295 3295 a, g dbSNP:779385101
3297 3297 c, t dbSNP:756514533
3300 3300 a, g dbSNP:746410710
3306 3306 c, t dbSNP:778642797
3311 3311 -, tatat dbSNP:745681893
3318 3318 g, t dbSNP:375095104
3329 3329 a, c dbSNP:368185128
3332 3332 -, ct dbSNP:755908979
3335 3335 c, t dbSNP:745807211
3339 3339 a, g dbSNP:776362774

Target ORF information:

RefSeq Version XM_011545532
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu10616D
Sequence Information ORF Nucleotide Sequence (Length: 1080bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 4 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK296457.1, AK296341.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (4) is missing an in-frame coding exon compared to variant 1, resulting in a shorter isoform (4) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296457.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)335..1111(+)
Misc Feature(2)407..952(+)
Misc Feature(3)497..928(+)
Misc Feature(4)623..691(+)
Misc Feature(5)911..1000(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..262
Gene Synonym:
Exon (3)263..436
Gene Synonym:
Exon (4)437..563
Gene Synonym:
Exon (5)564..655
Gene Synonym:
Exon (6)656..811
Gene Synonym:
Exon (7)812..883
Gene Synonym:
Exon (8)884..951
Gene Synonym:
Exon (9)952..1060
Gene Synonym:
Exon (10)1061..3279
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 g, t dbSNP:773500511
209 209 a, g dbSNP:763398358
214 214 a, g dbSNP:770667770
219 219 c, t dbSNP:774155734
227 227 c, t dbSNP:759062849
242 242 c, g dbSNP:150318528
243 243 a, t dbSNP:752678074
250 250 a, g dbSNP:746867841
271 271 c, g dbSNP:759331650
279 279 a, g dbSNP:144967854
284 284 a, g dbSNP:745312079
290 290 g, t dbSNP:760251445
297 297 c, g dbSNP:771734567
299 299 a, g dbSNP:376746290
315 315 c, g, t dbSNP:149083818
362 362 a, c dbSNP:761538559
363 363 a, g dbSNP:765074163
397 397 a, g dbSNP:144828838
463 463 c, t dbSNP:764516370
464 464 a, g dbSNP:764996618
472 472 c, t dbSNP:772943333
482 482 c, t dbSNP:11554111
483 483 a, g dbSNP:762839069
502 502 a, g dbSNP:767569398
508 508 c, t dbSNP:183170654
524 524 c, t dbSNP:199959402
535 535 c, t dbSNP:756138817
536 536 a, g dbSNP:764303926
541 541 a, c dbSNP:757654963
551 551 a, g dbSNP:138727886
592 592 a, g dbSNP:773139249
628 628 c, t dbSNP:398123300
631 631 g, t dbSNP:762598184
652 652 a, g dbSNP:141862527
667 667 c, g, t dbSNP:137853254
700 700 a, c dbSNP:121917898
709 709 c, t dbSNP:778744930
712 712 c, t dbSNP:745607005
745 745 a, g dbSNP:138237215
748 748 c, t dbSNP:764871850
749 749 a, g dbSNP:372505888
760 760 a, g dbSNP:750307419
769 769 c, t dbSNP:769963488
779 779 a, t dbSNP:137853255
808 808 c, g dbSNP:768600287
812 812 c, g dbSNP:749333596
814 814 a, g dbSNP:770975182
816 816 a, g dbSNP:774917952
825 825 a, c dbSNP:137853253
836 836 a, g dbSNP:202166915
839 839 c, g dbSNP:137853259
842 842 c, g dbSNP:767850573
847 847 a, c, g dbSNP:1126565
850 850 a, g dbSNP:35752213
862 862 g, t dbSNP:763733376
867 867 a, g dbSNP:752225588
889 889 c, g dbSNP:775978359
896 896 a, c dbSNP:2229137
901 901 a, g dbSNP:768957853
904 904 g, t dbSNP:776339048
906 906 a, g dbSNP:373275701
913 913 -, t dbSNP:606231190
915 915 a, g dbSNP:137853258
922 922 c, t dbSNP:761411007
931 931 c, t dbSNP:764780830
956 956 c, t dbSNP:137853252
963 963 a, g dbSNP:766055203
964 964 a, c dbSNP:751513713
969 969 -, tagttaccgtacacgagaaga dbSNP:606231188
979 979 a, c dbSNP:200088791
986 986 -, agtaaga dbSNP:606231185
989 989 -, aag dbSNP:137853251
991 991 a, g dbSNP:374649412
995 995 a, g dbSNP:137853256
1000 1000 a, t dbSNP:759443348
1007 1007 c, g dbSNP:767515770
1014 1014 a, g dbSNP:752399277
1024 1024 a, g dbSNP:755945768
1030 1030 c, g, t dbSNP:779045292
1035 1035 a, g dbSNP:758465753
1036 1036 c, t dbSNP:767503319
1051 1051 a, c dbSNP:2228067
1069 1069 -, ttttaggaaattgat dbSNP:367658754
1073 1073 a, c, g dbSNP:755090271
1113 1113 c, t dbSNP:375167721
1114 1114 a, g, t dbSNP:147510382
1117 1117 c, t dbSNP:749696135
1118 1118 a, g dbSNP:770669838
1120 1120 c, t dbSNP:369185042
1125 1125 -, agccacctttggaagagctg dbSNP:606231187
1135 1135 a, g dbSNP:745312753
1154 1154 a, c dbSNP:771666787
1161 1161 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1162 1162 a, c dbSNP:775280711
1165 1165 c, t dbSNP:773338429
1166 1166 a, g dbSNP:199879809
1169 1169 c, t dbSNP:776360150
1170 1170 c, t dbSNP:761624839
1180 1180 a, c dbSNP:766521439
1185 1185 a, g dbSNP:137853250
1189 1189 c, t dbSNP:766631999
1197 1197 -, atca dbSNP:606231189
1198 1198 c, g dbSNP:767675495
1202 1202 a, c dbSNP:753124944
1204 1204 c, g dbSNP:756641063
1211 1211 -, aa dbSNP:606231186
1211 1211 a, c dbSNP:201156613
1212 1212 -, agtc dbSNP:774877318
1217 1217 c, g dbSNP:778458134
1219 1219 -, cagt dbSNP:606231184
1222 1222 c, t dbSNP:369973813
1224 1224 -, aaggggaggag dbSNP:764728647
1224 1224 -, aagggg dbSNP:762505127
1228 1228 a, g dbSNP:757713583
1233 1233 -, aga dbSNP:752082232
1235 1235 a, g dbSNP:778420248
1236 1236 a, g dbSNP:745596782
1237 1237 a, g dbSNP:771447698
1240 1240 c, g dbSNP:200547574
1241 1241 a, c dbSNP:373318863
1244 1244 g, t dbSNP:781632629
1245 1245 c, t dbSNP:768539902
1246 1246 -, taccttc, taccttcagggggctac dbSNP:762321006
1259 1259 c, g dbSNP:776552491
1264 1264 c, g, t dbSNP:111666443
1272 1272 a, g dbSNP:769687352
1274 1274 -, tc dbSNP:750727352
1281 1281 -, tggtta dbSNP:756298361
1286 1286 a, t dbSNP:774406317
1289 1289 a, g dbSNP:759852734
1294 1294 -, a dbSNP:780261890
1302 1302 a, c dbSNP:767657538
1307 1307 c, t dbSNP:11554112
1315 1315 a, c, t dbSNP:147338122
1319 1319 a, g dbSNP:778549806
1320 1320 c, t dbSNP:748689790
1325 1325 g, t dbSNP:757688624
1334 1334 -, ctt, cttc dbSNP:771171560
1335 1335 c, t dbSNP:709610
1338 1338 c, g, t dbSNP:182754597
1341 1341 -, taag dbSNP:779812493
1343 1343 -, aa dbSNP:746696047
1347 1347 a, g dbSNP:779602555
1351 1351 -, tc, tctattt, tctattttat dbSNP:745608853
1352 1352 g, t dbSNP:746449195
1356 1356 a, g dbSNP:768167537
1359 1359 a, c dbSNP:187360934
1361 1361 c, g dbSNP:781094210
1365 1365 a, g dbSNP:748123688
1369 1369 c, t dbSNP:781670523
1458 1458 a, g dbSNP:566285470
1459 1459 -, tactc dbSNP:748590147
1514 1514 -, ccagcca dbSNP:200632554
1516 1516 -, agccacc dbSNP:376636279
1526 1526 c, t dbSNP:773249692
1544 1544 g, t dbSNP:1042449
1547 1547 a, g dbSNP:1042450
1551 1551 c, g dbSNP:774381598
1555 1555 c, t dbSNP:759806053
1557 1557 a, c dbSNP:763789986
1588 1588 a, g dbSNP:372658162
1592 1592 a, g dbSNP:375225163
1595 1595 a, g dbSNP:753720613
1615 1615 a, g dbSNP:761629687
1616 1616 c, t dbSNP:765304960
1617 1617 a, g dbSNP:56318063
1622 1622 -, cat dbSNP:144356124
1623 1623 -, atc, cat dbSNP:72116174
1625 1625 -, ca, cat dbSNP:199685000
1634 1634 -, agat dbSNP:764801500
1636 1636 -, ataca dbSNP:779722514
1651 1651 a, t dbSNP:369332453
1657 1657 c, t dbSNP:754719295
1674 1674 -, tttaaaataagac dbSNP:201758797
1677 1677 -, aaaataagacttt dbSNP:375651955
1691 1691 g, t dbSNP:183744566
1700 1700 -, ccaattttgtaatcatt dbSNP:372190247
1730 1730 -, a dbSNP:763688379
1732 1732 -, tt, ttagt dbSNP:113050549
1735 1735 -, gttt dbSNP:770179781
1750 1750 c, g dbSNP:778207227
1756 1756 c, t dbSNP:749812407
1772 1772 -, tat dbSNP:770933958
1774 1774 a, g dbSNP:187525386
1788 1788 -, caaa dbSNP:746061580
1800 1800 c, t dbSNP:191995452
1814 1814 a, g dbSNP:776254250
1839 1839 g, t dbSNP:5955761
1846 1846 c, t dbSNP:537446476
1932 1932 a, g dbSNP:150945967
1950 1950 a, g dbSNP:773225586
1953 1953 c, t dbSNP:1042452
1954 1954 a, g dbSNP:376808450
2012 2012 c, t dbSNP:751130904
2063 2063 a, c dbSNP:754555154
2069 2069 a, g dbSNP:1042453
2082 2082 a, g dbSNP:182836908
2088 2088 c, t dbSNP:187083263
2089 2089 a, g dbSNP:192450087
2136 2136 -, tgtt dbSNP:749787977
2143 2143 -, a dbSNP:760736313
2147 2147 -, aaca dbSNP:757815346
2148 2148 a, g dbSNP:542108895
2162 2162 a, g dbSNP:778832973
2163 2163 a, t dbSNP:184532061
2181 2181 -, aag dbSNP:772075136
2185 2185 -, t dbSNP:775731731
2185 2185 c, t dbSNP:374396566
2238 2238 a, c dbSNP:1042456
2239 2239 a, g dbSNP:769643820
2246 2246 a, g dbSNP:140383712
2253 2253 c, t dbSNP:781582453
2256 2256 -, aaca dbSNP:776627726
2278 2278 c, t dbSNP:773012317
2280 2280 c, g, t dbSNP:762963142
2284 2284 a, g dbSNP:15816
2286 2286 a, g, t dbSNP:760828301
2295 2295 -, ct dbSNP:762592504
2295 2295 c, t dbSNP:754361374
2299 2299 c, g dbSNP:762427939
2310 2310 a, g dbSNP:765681576
2311 2311 -, tgat dbSNP:748635462
2327 2327 -, cttgt dbSNP:775059849
2327 2327 c, t dbSNP:750757959
2330 2330 c, g dbSNP:758692867
2332 2332 -, tt dbSNP:762409221
2343 2343 c, g dbSNP:779698506
2354 2354 a, g dbSNP:140145114
2357 2357 c, g dbSNP:145675672
2358 2358 c, t dbSNP:61744590
2363 2363 a, g dbSNP:756645339
2366 2366 c, t dbSNP:56021619
2367 2367 c, t dbSNP:778346850
2375 2375 c, t dbSNP:747680098
2376 2376 a, g dbSNP:756039907
2377 2377 c, t dbSNP:147753175
2379 2379 c, t dbSNP:759041463
2382 2382 c, t dbSNP:766954168
2384 2384 a, g, t dbSNP:557102951
2387 2387 -, tc dbSNP:750762941
2391 2391 c, t dbSNP:747270244
2392 2392 -, a dbSNP:761048720
2396 2396 g, t dbSNP:768831534
2402 2402 a, g dbSNP:776800732
2411 2411 -, aaac dbSNP:766536396
2413 2413 a, g dbSNP:761827915
2417 2417 -, ac dbSNP:202102403
2423 2423 -, ctgt dbSNP:755834416
2429 2429 c, t dbSNP:765707363
2433 2433 a, c dbSNP:369499936
2434 2434 a, g dbSNP:373390286
2439 2439 a, t dbSNP:770495684
2446 2446 a, g dbSNP:766795601
2454 2454 c, g dbSNP:751191482
2519 2519 g, t dbSNP:369068280
2522 2522 a, g dbSNP:778678656
2530 2530 c, t dbSNP:754247336
2531 2531 a, g dbSNP:745566169
2536 2536 c, t dbSNP:189054591
2570 2570 a, g dbSNP:193253848
2602 2602 a, g dbSNP:56039350
2619 2619 c, t dbSNP:55856360
2649 2649 a, g dbSNP:760525544
2658 2658 c, t dbSNP:779999826
2659 2659 a, g dbSNP:768422526
2675 2675 c, t dbSNP:747229060
2692 2692 a, g dbSNP:769050360
2788 2788 c, g dbSNP:7883708
2795 2795 a, t dbSNP:770658441
2810 2810 c, t dbSNP:5955550
2823 2823 c, g dbSNP:11094770
2826 2826 a, g dbSNP:771609750
2827 2827 c, g dbSNP:762905278
2872 2872 a, g dbSNP:201259816
2873 2873 a, g, t dbSNP:376593530
2883 2883 -, cttata dbSNP:760296050
2885 2885 a, t dbSNP:755594888
2887 2887 c, t dbSNP:370565981
2903 2903 g, t dbSNP:749254470
2907 2907 c, t dbSNP:55744630
2910 2910 c, g, t dbSNP:377382652
2911 2911 a, c, t dbSNP:753516995
2912 2912 a, g dbSNP:748198804
2914 2914 -, a dbSNP:762188631
2918 2918 a, g, t dbSNP:148399187
2922 2922 g, t dbSNP:763409232
2929 2929 a, g dbSNP:142533585
2936 2936 a, c dbSNP:766893716
2941 2941 a, g dbSNP:774659644
2942 2942 g, t dbSNP:150957359
2943 2943 c, g dbSNP:370651623
2960 2960 a, c dbSNP:750874490
2961 2961 c, t dbSNP:140779387
2963 2963 a, g dbSNP:752352625
2967 2967 g, t dbSNP:371285733
2975 2975 c, t dbSNP:144734730
2977 2977 -, t dbSNP:751563348
2983 2983 a, g dbSNP:763556279
2988 2988 a, c, t dbSNP:780260798
3002 3002 a, c dbSNP:373779094
3003 3003 a, c, g dbSNP:779022123
3004 3004 a, t dbSNP:758279534
3017 3017 c, g dbSNP:781550393
3020 3020 c, t dbSNP:374494282
3034 3034 c, g dbSNP:769886359
3037 3037 c, t dbSNP:777666685
3038 3038 a, g dbSNP:755016325
3039 3039 c, t dbSNP:749418204
3040 3040 a, g dbSNP:771363028
3044 3044 -, tttc dbSNP:757189654
3065 3065 c, g dbSNP:781517592
3072 3072 a, g dbSNP:759883184
3083 3083 a, c dbSNP:772494786
3094 3094 c, g dbSNP:15943
3099 3099 c, t dbSNP:760297711
3100 3100 a, g dbSNP:763826263
3120 3120 c, t dbSNP:753243729
3124 3124 c, t dbSNP:761409953
3133 3133 g, t dbSNP:770697702
3136 3136 c, g, t dbSNP:368526609
3137 3137 a, g, t dbSNP:372102191
3141 3141 c, g dbSNP:140380348
3149 3149 g, t dbSNP:752937000
3151 3151 c, g dbSNP:778062708
3155 3155 c, g dbSNP:749306111
3172 3172 -, g dbSNP:781136595
3172 3172 c, t dbSNP:771054574
3173 3173 a, g dbSNP:779385101
3175 3175 c, t dbSNP:756514533
3178 3178 a, g dbSNP:746410710
3184 3184 c, t dbSNP:778642797
3189 3189 -, tatat dbSNP:745681893
3196 3196 g, t dbSNP:375095104
3207 3207 a, c dbSNP:368185128
3210 3210 -, ct dbSNP:755908979
3213 3213 c, t dbSNP:745807211
3217 3217 a, g dbSNP:776362774
3244 3244 c, t dbSNP:181554208
3261 3261 a, g dbSNP:774947730

Target ORF information:

RefSeq Version NM_001173456
Organism Homo sapiens (human)
Definition Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu11172D
Sequence Information ORF Nucleotide Sequence (Length: 1287bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK293250.1, BU170389.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (2) contains an additional in-frame coding exon compared to variant 1, resulting in a longer isoform (2) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK293250.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968189 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)449..1318(+)
Misc Feature(2)521..1159(+)
Misc Feature(3)611..1135(+)
Misc Feature(4)737..898(+)
Misc Feature(5)1118..1207(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..316
Gene Synonym:
Exon (3)317..376
Gene Synonym:
Exon (4)377..550
Gene Synonym:
Exon (5)551..677
Gene Synonym:
Exon (6)678..769
Gene Synonym:
Exon (7)770..862
Gene Synonym:
Exon (8)863..1018
Gene Synonym:
Exon (9)1019..1090
Gene Synonym:
Exon (10)1091..1158
Gene Synonym:
Exon (11)1159..1267
Gene Synonym:
Exon (12)1268..3486
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 -, g dbSNP:753113002
207 207 a, g dbSNP:750462643
219 219 c, t dbSNP:7883320
251 251 a, g dbSNP:780276301
268 268 c, t dbSNP:182962186
269 269 a, g dbSNP:145749914
281 281 a, t dbSNP:766213373
292 292 c, g dbSNP:747051654
300 300 c, g dbSNP:751469147
317 317 g, t dbSNP:773500511
323 323 a, g dbSNP:763398358
328 328 a, g dbSNP:770667770
333 333 c, t dbSNP:774155734
341 341 c, t dbSNP:759062849
356 356 c, g dbSNP:150318528
357 357 a, t dbSNP:752678074
364 364 a, g dbSNP:746867841
385 385 c, g dbSNP:759331650
393 393 a, g dbSNP:144967854
398 398 a, g dbSNP:745312079
404 404 g, t dbSNP:760251445
411 411 c, g dbSNP:771734567
413 413 a, g dbSNP:376746290
429 429 c, g, t dbSNP:149083818
476 476 a, c dbSNP:761538559
477 477 a, g dbSNP:765074163
511 511 a, g dbSNP:144828838
577 577 c, t dbSNP:764516370
578 578 a, g dbSNP:764996618
586 586 c, t dbSNP:772943333
596 596 c, t dbSNP:11554111
597 597 a, g dbSNP:762839069
616 616 a, g dbSNP:767569398
622 622 c, t dbSNP:183170654
638 638 c, t dbSNP:199959402
649 649 c, t dbSNP:756138817
650 650 a, g dbSNP:764303926
655 655 a, c dbSNP:757654963
665 665 a, g dbSNP:138727886
706 706 a, g dbSNP:773139249
742 742 c, t dbSNP:398123300
745 745 g, t dbSNP:762598184
766 766 a, g dbSNP:141862527
781 781 c, t dbSNP:769308417
809 809 a, g dbSNP:777678490
823 823 g, t dbSNP:749319044
830 830 c, g dbSNP:770603511
874 874 c, g, t dbSNP:137853254
907 907 a, c dbSNP:121917898
916 916 c, t dbSNP:778744930
919 919 c, t dbSNP:745607005
952 952 a, g dbSNP:138237215
955 955 c, t dbSNP:764871850
956 956 a, g dbSNP:372505888
967 967 a, g dbSNP:750307419
976 976 c, t dbSNP:769963488
986 986 a, t dbSNP:137853255
1015 1015 c, g dbSNP:768600287
1019 1019 c, g dbSNP:749333596
1021 1021 a, g dbSNP:770975182
1023 1023 a, g dbSNP:774917952
1032 1032 a, c dbSNP:137853253
1043 1043 a, g dbSNP:202166915
1046 1046 c, g dbSNP:137853259
1049 1049 c, g dbSNP:767850573
1054 1054 a, c, g dbSNP:1126565
1057 1057 a, g dbSNP:35752213
1069 1069 g, t dbSNP:763733376
1074 1074 a, g dbSNP:752225588
1096 1096 c, g dbSNP:775978359
1103 1103 a, c dbSNP:2229137
1108 1108 a, g dbSNP:768957853
1111 1111 g, t dbSNP:776339048
1113 1113 a, g dbSNP:373275701
1120 1120 -, t dbSNP:606231190
1122 1122 a, g dbSNP:137853258
1129 1129 c, t dbSNP:761411007
1138 1138 c, t dbSNP:764780830
1163 1163 c, t dbSNP:137853252
1170 1170 a, g dbSNP:766055203
1171 1171 a, c dbSNP:751513713
1176 1176 -, tagttaccgtacacgagaaga dbSNP:606231188
1186 1186 a, c dbSNP:200088791
1193 1193 -, agtaaga dbSNP:606231185
1196 1196 -, aag dbSNP:137853251
1198 1198 a, g dbSNP:374649412
1202 1202 a, g dbSNP:137853256
1207 1207 a, t dbSNP:759443348
1214 1214 c, g dbSNP:767515770
1221 1221 a, g dbSNP:752399277
1231 1231 a, g dbSNP:755945768
1237 1237 c, g, t dbSNP:779045292
1242 1242 a, g dbSNP:758465753
1243 1243 c, t dbSNP:767503319
1258 1258 a, c dbSNP:2228067
1276 1276 -, ttttaggaaattgat dbSNP:367658754
1280 1280 a, c, g dbSNP:755090271
1320 1320 c, t dbSNP:375167721
1321 1321 a, g, t dbSNP:147510382
1324 1324 c, t dbSNP:749696135
1325 1325 a, g dbSNP:770669838
1327 1327 c, t dbSNP:369185042
1332 1332 -, agccacctttggaagagctg dbSNP:606231187
1342 1342 a, g dbSNP:745312753
1361 1361 a, c dbSNP:771666787
1368 1368 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1369 1369 a, c dbSNP:775280711
1372 1372 c, t dbSNP:773338429
1373 1373 a, g dbSNP:199879809
1376 1376 c, t dbSNP:776360150
1377 1377 c, t dbSNP:761624839
1387 1387 a, c dbSNP:766521439
1392 1392 a, g dbSNP:137853250
1396 1396 c, t dbSNP:766631999
1404 1404 -, atca dbSNP:606231189
1405 1405 c, g dbSNP:767675495
1409 1409 a, c dbSNP:753124944
1411 1411 c, g dbSNP:756641063
1418 1418 -, aa dbSNP:606231186
1418 1418 a, c dbSNP:201156613
1419 1419 -, agtc dbSNP:774877318
1424 1424 c, g dbSNP:778458134
1426 1426 -, cagt dbSNP:606231184
1429 1429 c, t dbSNP:369973813
1431 1431 -, aaggggaggag dbSNP:764728647
1431 1431 -, aagggg dbSNP:762505127
1435 1435 a, g dbSNP:757713583
1440 1440 -, aga dbSNP:752082232
1442 1442 a, g dbSNP:778420248
1443 1443 a, g dbSNP:745596782
1444 1444 a, g dbSNP:771447698
1447 1447 c, g dbSNP:200547574
1448 1448 a, c dbSNP:373318863
1451 1451 g, t dbSNP:781632629
1452 1452 c, t dbSNP:768539902
1453 1453 -, taccttc, taccttcagggggctac dbSNP:762321006
1466 1466 c, g dbSNP:776552491
1471 1471 c, g, t dbSNP:111666443
1479 1479 a, g dbSNP:769687352
1481 1481 -, tc dbSNP:750727352
1488 1488 -, tggtta dbSNP:756298361
1493 1493 a, t dbSNP:774406317
1496 1496 a, g dbSNP:759852734
1501 1501 -, a dbSNP:780261890
1509 1509 a, c dbSNP:767657538
1514 1514 c, t dbSNP:11554112
1522 1522 a, c, t dbSNP:147338122
1526 1526 a, g dbSNP:778549806
1527 1527 c, t dbSNP:748689790
1532 1532 g, t dbSNP:757688624
1541 1541 -, ctt, cttc dbSNP:771171560
1542 1542 c, t dbSNP:709610
1545 1545 c, g, t dbSNP:182754597
1548 1548 -, taag dbSNP:779812493
1550 1550 -, aa dbSNP:746696047
1554 1554 a, g dbSNP:779602555
1558 1558 -, tc, tctattt, tctattttat dbSNP:745608853
1559 1559 g, t dbSNP:746449195
1563 1563 a, g dbSNP:768167537
1566 1566 a, c dbSNP:187360934
1568 1568 c, g dbSNP:781094210
1572 1572 a, g dbSNP:748123688
1576 1576 c, t dbSNP:781670523
1665 1665 a, g dbSNP:566285470
1666 1666 -, tactc dbSNP:748590147
1721 1721 -, ccagcca dbSNP:200632554
1723 1723 -, agccacc dbSNP:376636279
1733 1733 c, t dbSNP:773249692
1751 1751 g, t dbSNP:1042449
1754 1754 a, g dbSNP:1042450
1758 1758 c, g dbSNP:774381598
1762 1762 c, t dbSNP:759806053
1764 1764 a, c dbSNP:763789986
1795 1795 a, g dbSNP:372658162
1799 1799 a, g dbSNP:375225163
1802 1802 a, g dbSNP:753720613
1822 1822 a, g dbSNP:761629687
1823 1823 c, t dbSNP:765304960
1824 1824 a, g dbSNP:56318063
1829 1829 -, cat dbSNP:144356124
1830 1830 -, atc, cat dbSNP:72116174
1832 1832 -, ca, cat dbSNP:199685000
1841 1841 -, agat dbSNP:764801500
1843 1843 -, ataca dbSNP:779722514
1858 1858 a, t dbSNP:369332453
1864 1864 c, t dbSNP:754719295
1881 1881 -, tttaaaataagac dbSNP:201758797
1884 1884 -, aaaataagacttt dbSNP:375651955
1898 1898 g, t dbSNP:183744566
1907 1907 -, ccaattttgtaatcatt dbSNP:372190247
1937 1937 -, a dbSNP:763688379
1939 1939 -, tt, ttagt dbSNP:113050549
1942 1942 -, gttt dbSNP:770179781
1957 1957 c, g dbSNP:778207227
1963 1963 c, t dbSNP:749812407
1979 1979 -, tat dbSNP:770933958
1981 1981 a, g dbSNP:187525386
1995 1995 -, caaa dbSNP:746061580
2007 2007 c, t dbSNP:191995452
2021 2021 a, g dbSNP:776254250
2046 2046 g, t dbSNP:5955761
2053 2053 c, t dbSNP:537446476
2139 2139 a, g dbSNP:150945967
2157 2157 a, g dbSNP:773225586
2160 2160 c, t dbSNP:1042452
2161 2161 a, g dbSNP:376808450
2219 2219 c, t dbSNP:751130904
2270 2270 a, c dbSNP:754555154
2276 2276 a, g dbSNP:1042453
2289 2289 a, g dbSNP:182836908
2295 2295 c, t dbSNP:187083263
2296 2296 a, g dbSNP:192450087
2343 2343 -, tgtt dbSNP:749787977
2350 2350 -, a dbSNP:760736313
2354 2354 -, aaca dbSNP:757815346
2355 2355 a, g dbSNP:542108895
2369 2369 a, g dbSNP:778832973
2370 2370 a, t dbSNP:184532061
2388 2388 -, aag dbSNP:772075136
2392 2392 -, t dbSNP:775731731
2392 2392 c, t dbSNP:374396566
2445 2445 a, c dbSNP:1042456
2446 2446 a, g dbSNP:769643820
2453 2453 a, g dbSNP:140383712
2460 2460 c, t dbSNP:781582453
2463 2463 -, aaca dbSNP:776627726
2485 2485 c, t dbSNP:773012317
2487 2487 c, g, t dbSNP:762963142
2491 2491 a, g dbSNP:15816
2493 2493 a, g, t dbSNP:760828301
2502 2502 -, ct dbSNP:762592504
2502 2502 c, t dbSNP:754361374
2506 2506 c, g dbSNP:762427939
2517 2517 a, g dbSNP:765681576
2518 2518 -, tgat dbSNP:748635462
2534 2534 -, cttgt dbSNP:775059849
2534 2534 c, t dbSNP:750757959
2537 2537 c, g dbSNP:758692867
2539 2539 -, tt dbSNP:762409221
2550 2550 c, g dbSNP:779698506
2561 2561 a, g dbSNP:140145114
2564 2564 c, g dbSNP:145675672
2565 2565 c, t dbSNP:61744590
2570 2570 a, g dbSNP:756645339
2573 2573 c, t dbSNP:56021619
2574 2574 c, t dbSNP:778346850
2582 2582 c, t dbSNP:747680098
2583 2583 a, g dbSNP:756039907
2584 2584 c, t dbSNP:147753175
2586 2586 c, t dbSNP:759041463
2589 2589 c, t dbSNP:766954168
2591 2591 a, g, t dbSNP:557102951
2594 2594 -, tc dbSNP:750762941
2598 2598 c, t dbSNP:747270244
2599 2599 -, a dbSNP:761048720
2603 2603 g, t dbSNP:768831534
2609 2609 a, g dbSNP:776800732
2618 2618 -, aaac dbSNP:766536396
2620 2620 a, g dbSNP:761827915
2624 2624 -, ac dbSNP:202102403
2630 2630 -, ctgt dbSNP:755834416
2636 2636 c, t dbSNP:765707363
2640 2640 a, c dbSNP:369499936
2641 2641 a, g dbSNP:373390286
2646 2646 a, t dbSNP:770495684
2653 2653 a, g dbSNP:766795601
2661 2661 c, g dbSNP:751191482
2726 2726 g, t dbSNP:369068280
2729 2729 a, g dbSNP:778678656
2737 2737 c, t dbSNP:754247336
2738 2738 a, g dbSNP:745566169
2743 2743 c, t dbSNP:189054591
2777 2777 a, g dbSNP:193253848
2809 2809 a, g dbSNP:56039350
2826 2826 c, t dbSNP:55856360
2856 2856 a, g dbSNP:760525544
2865 2865 c, t dbSNP:779999826
2866 2866 a, g dbSNP:768422526
2882 2882 c, t dbSNP:747229060
2899 2899 a, g dbSNP:769050360
2995 2995 c, g dbSNP:7883708
3002 3002 a, t dbSNP:770658441
3017 3017 c, t dbSNP:5955550
3030 3030 c, g dbSNP:11094770
3033 3033 a, g dbSNP:771609750
3034 3034 c, g dbSNP:762905278
3079 3079 a, g dbSNP:201259816
3080 3080 a, g, t dbSNP:376593530
3090 3090 -, cttata dbSNP:760296050
3092 3092 a, t dbSNP:755594888
3094 3094 c, t dbSNP:370565981
3110 3110 g, t dbSNP:749254470
3114 3114 c, t dbSNP:55744630
3117 3117 c, g, t dbSNP:377382652
3118 3118 a, c, t dbSNP:753516995
3119 3119 a, g dbSNP:748198804
3121 3121 -, a dbSNP:762188631
3125 3125 a, g, t dbSNP:148399187
3129 3129 g, t dbSNP:763409232
3136 3136 a, g dbSNP:142533585
3143 3143 a, c dbSNP:766893716
3148 3148 a, g dbSNP:774659644
3149 3149 g, t dbSNP:150957359
3150 3150 c, g dbSNP:370651623
3167 3167 a, c dbSNP:750874490
3168 3168 c, t dbSNP:140779387
3170 3170 a, g dbSNP:752352625
3174 3174 g, t dbSNP:371285733
3182 3182 c, t dbSNP:144734730
3184 3184 -, t dbSNP:751563348
3190 3190 a, g dbSNP:763556279
3195 3195 a, c, t dbSNP:780260798
3209 3209 a, c dbSNP:373779094
3210 3210 a, c, g dbSNP:779022123
3211 3211 a, t dbSNP:758279534
3224 3224 c, g dbSNP:781550393
3227 3227 c, t dbSNP:374494282
3241 3241 c, g dbSNP:769886359
3244 3244 c, t dbSNP:777666685
3245 3245 a, g dbSNP:755016325
3246 3246 c, t dbSNP:749418204
3247 3247 a, g dbSNP:771363028
3251 3251 -, tttc dbSNP:757189654
3272 3272 c, g dbSNP:781517592
3279 3279 a, g dbSNP:759883184
3290 3290 a, c dbSNP:772494786
3301 3301 c, g dbSNP:15943
3306 3306 c, t dbSNP:760297711
3307 3307 a, g dbSNP:763826263
3327 3327 c, t dbSNP:753243729
3331 3331 c, t dbSNP:761409953
3340 3340 g, t dbSNP:770697702
3343 3343 c, g, t dbSNP:368526609
3344 3344 a, g, t dbSNP:372102191
3348 3348 c, g dbSNP:140380348
3356 3356 g, t dbSNP:752937000
3358 3358 c, g dbSNP:778062708
3362 3362 c, g dbSNP:749306111
3379 3379 -, g dbSNP:781136595
3379 3379 c, t dbSNP:771054574
3380 3380 a, g dbSNP:779385101
3382 3382 c, t dbSNP:756514533
3385 3385 a, g dbSNP:746410710
3391 3391 c, t dbSNP:778642797
3396 3396 -, tatat dbSNP:745681893
3403 3403 g, t dbSNP:375095104
3414 3414 a, c dbSNP:368185128
3417 3417 -, ct dbSNP:755908979
3420 3420 c, t dbSNP:745807211
3424 3424 a, g dbSNP:776362774
3451 3451 c, t dbSNP:181554208
3468 3468 a, g dbSNP:774947730

Target ORF information:

RefSeq Version NM_001173454
Organism Homo sapiens (human)
Definition Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu11667D
Sequence Information ORF Nucleotide Sequence (Length: 1194bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 3 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, AK296341.1, AL732326.4 and R49470.1. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (3) uses an alternative acceptor splice site at one of the coding exons compared to variant 1, resulting in a longer isoform (3) compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296341.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1966682, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)332..334(+)
Misc Feature(2)332..334(+)
Misc Feature(3)335..1225(+)
Misc Feature(4)407..1066(+)
Misc Feature(5)518..1042(+)
Misc Feature(6)644..805(+)
Misc Feature(7)860..862(+)
Misc Feature(8)896..898(+)
Misc Feature(9)896..898(+)
Misc Feature(10)995..997(+)
Misc Feature(11)1025..1114(+)
Misc Feature(12)1043..1045(+)
Misc Feature(13)1049..1051(+)
Misc Feature(14)1064..1066(+)
Misc Feature(15)1067..1069(+)
Misc Feature(16)1103..1105(+)
Misc Feature(17)1103..1105(+)
Misc Feature(18)1127..1129(+)
Misc Feature(19)1172..1174(+)
Misc Feature(20)1319..1321(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..262
Gene Synonym:
Exon (3)263..436
Gene Synonym:
Exon (4)437..584
Gene Synonym:
Exon (5)585..676
Gene Synonym:
Exon (6)677..769
Gene Synonym:
Exon (7)770..925
Gene Synonym:
Exon (8)926..997
Gene Synonym:
Exon (9)998..1065
Gene Synonym:
Exon (10)1066..1174
Gene Synonym:
Exon (11)1175..3393
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 g, t dbSNP:773500511
209 209 a, g dbSNP:763398358
214 214 a, g dbSNP:770667770
219 219 c, t dbSNP:774155734
227 227 c, t dbSNP:759062849
242 242 c, g dbSNP:150318528
243 243 a, t dbSNP:752678074
250 250 a, g dbSNP:746867841
271 271 c, g dbSNP:759331650
279 279 a, g dbSNP:144967854
284 284 a, g dbSNP:745312079
290 290 g, t dbSNP:760251445
297 297 c, g dbSNP:771734567
299 299 a, g dbSNP:376746290
315 315 c, g, t dbSNP:149083818
362 362 a, c dbSNP:761538559
363 363 a, g dbSNP:765074163
397 397 a, g dbSNP:144828838
439 439 c, t dbSNP:768225634
447 447 c, t dbSNP:776535833
449 449 c, g dbSNP:371532584
453 453 c, t dbSNP:191666624
484 484 c, t dbSNP:764516370
485 485 a, g dbSNP:764996618
493 493 c, t dbSNP:772943333
503 503 c, t dbSNP:11554111
504 504 a, g dbSNP:762839069
523 523 a, g dbSNP:767569398
529 529 c, t dbSNP:183170654
545 545 c, t dbSNP:199959402
556 556 c, t dbSNP:756138817
557 557 a, g dbSNP:764303926
562 562 a, c dbSNP:757654963
572 572 a, g dbSNP:138727886
613 613 a, g dbSNP:773139249
649 649 c, t dbSNP:398123300
652 652 g, t dbSNP:762598184
673 673 a, g dbSNP:141862527
688 688 c, t dbSNP:769308417
716 716 a, g dbSNP:777678490
730 730 g, t dbSNP:749319044
737 737 c, g dbSNP:770603511
781 781 c, g, t dbSNP:137853254
814 814 a, c dbSNP:121917898
823 823 c, t dbSNP:778744930
826 826 c, t dbSNP:745607005
859 859 a, g dbSNP:138237215
862 862 c, t dbSNP:764871850
863 863 a, g dbSNP:372505888
874 874 a, g dbSNP:750307419
883 883 c, t dbSNP:769963488
893 893 a, t dbSNP:137853255
922 922 c, g dbSNP:768600287
926 926 c, g dbSNP:749333596
928 928 a, g dbSNP:770975182
930 930 a, g dbSNP:774917952
939 939 a, c dbSNP:137853253
950 950 a, g dbSNP:202166915
953 953 c, g dbSNP:137853259
956 956 c, g dbSNP:767850573
961 961 a, c, g dbSNP:1126565
964 964 a, g dbSNP:35752213
976 976 g, t dbSNP:763733376
981 981 a, g dbSNP:752225588
1003 1003 c, g dbSNP:775978359
1010 1010 a, c dbSNP:2229137
1015 1015 a, g dbSNP:768957853
1018 1018 g, t dbSNP:776339048
1020 1020 a, g dbSNP:373275701
1027 1027 -, t dbSNP:606231190
1029 1029 a, g dbSNP:137853258
1036 1036 c, t dbSNP:761411007
1045 1045 c, t dbSNP:764780830
1070 1070 c, t dbSNP:137853252
1077 1077 a, g dbSNP:766055203
1078 1078 a, c dbSNP:751513713
1083 1083 -, tagttaccgtacacgagaaga dbSNP:606231188
1093 1093 a, c dbSNP:200088791
1100 1100 -, agtaaga dbSNP:606231185
1103 1103 -, aag dbSNP:137853251
1105 1105 a, g dbSNP:374649412
1109 1109 a, g dbSNP:137853256
1114 1114 a, t dbSNP:759443348
1121 1121 c, g dbSNP:767515770
1128 1128 a, g dbSNP:752399277
1138 1138 a, g dbSNP:755945768
1144 1144 c, g, t dbSNP:779045292
1149 1149 a, g dbSNP:758465753
1150 1150 c, t dbSNP:767503319
1165 1165 a, c dbSNP:2228067
1183 1183 -, ttttaggaaattgat dbSNP:367658754
1187 1187 a, c, g dbSNP:755090271
1227 1227 c, t dbSNP:375167721
1228 1228 a, g, t dbSNP:147510382
1231 1231 c, t dbSNP:749696135
1232 1232 a, g dbSNP:770669838
1234 1234 c, t dbSNP:369185042
1239 1239 -, agccacctttggaagagctg dbSNP:606231187
1249 1249 a, g dbSNP:745312753
1268 1268 a, c dbSNP:771666787
1275 1275 -, gccacctttggaagagctgggctaccacatctactc dbSNP:606231191
1276 1276 a, c dbSNP:775280711
1279 1279 c, t dbSNP:773338429
1280 1280 a, g dbSNP:199879809
1283 1283 c, t dbSNP:776360150
1284 1284 c, t dbSNP:761624839
1294 1294 a, c dbSNP:766521439
1299 1299 a, g dbSNP:137853250
1303 1303 c, t dbSNP:766631999
1311 1311 -, atca dbSNP:606231189
1312 1312 c, g dbSNP:767675495
1316 1316 a, c dbSNP:753124944
1318 1318 c, g dbSNP:756641063
1325 1325 -, aa dbSNP:606231186
1325 1325 a, c dbSNP:201156613
1326 1326 -, agtc dbSNP:774877318
1331 1331 c, g dbSNP:778458134
1333 1333 -, cagt dbSNP:606231184
1336 1336 c, t dbSNP:369973813
1338 1338 -, aaggggaggag dbSNP:764728647
1338 1338 -, aagggg dbSNP:762505127
1342 1342 a, g dbSNP:757713583
1347 1347 -, aga dbSNP:752082232
1349 1349 a, g dbSNP:778420248
1350 1350 a, g dbSNP:745596782
1351 1351 a, g dbSNP:771447698
1354 1354 c, g dbSNP:200547574
1355 1355 a, c dbSNP:373318863
1358 1358 g, t dbSNP:781632629
1359 1359 c, t dbSNP:768539902
1360 1360 -, taccttc, taccttcagggggctac dbSNP:762321006
1373 1373 c, g dbSNP:776552491
1378 1378 c, g, t dbSNP:111666443
1386 1386 a, g dbSNP:769687352
1388 1388 -, tc dbSNP:750727352
1395 1395 -, tggtta dbSNP:756298361
1400 1400 a, t dbSNP:774406317
1403 1403 a, g dbSNP:759852734
1408 1408 -, a dbSNP:780261890
1416 1416 a, c dbSNP:767657538
1421 1421 c, t dbSNP:11554112
1429 1429 a, c, t dbSNP:147338122
1433 1433 a, g dbSNP:778549806
1434 1434 c, t dbSNP:748689790
1439 1439 g, t dbSNP:757688624
1448 1448 -, ctt, cttc dbSNP:771171560
1449 1449 c, t dbSNP:709610
1452 1452 c, g, t dbSNP:182754597
1455 1455 -, taag dbSNP:779812493
1457 1457 -, aa dbSNP:746696047
1461 1461 a, g dbSNP:779602555
1465 1465 -, tc, tctattt, tctattttat dbSNP:745608853
1466 1466 g, t dbSNP:746449195
1470 1470 a, g dbSNP:768167537
1473 1473 a, c dbSNP:187360934
1475 1475 c, g dbSNP:781094210
1479 1479 a, g dbSNP:748123688
1483 1483 c, t dbSNP:781670523
1572 1572 a, g dbSNP:566285470
1573 1573 -, tactc dbSNP:748590147
1628 1628 -, ccagcca dbSNP:200632554
1630 1630 -, agccacc dbSNP:376636279
1640 1640 c, t dbSNP:773249692
1658 1658 g, t dbSNP:1042449
1661 1661 a, g dbSNP:1042450
1665 1665 c, g dbSNP:774381598
1669 1669 c, t dbSNP:759806053
1671 1671 a, c dbSNP:763789986
1702 1702 a, g dbSNP:372658162
1706 1706 a, g dbSNP:375225163
1709 1709 a, g dbSNP:753720613
1729 1729 a, g dbSNP:761629687
1730 1730 c, t dbSNP:765304960
1731 1731 a, g dbSNP:56318063
1736 1736 -, cat dbSNP:144356124
1737 1737 -, atc, cat dbSNP:72116174
1739 1739 -, ca, cat dbSNP:199685000
1748 1748 -, agat dbSNP:764801500
1750 1750 -, ataca dbSNP:779722514
1765 1765 a, t dbSNP:369332453
1771 1771 c, t dbSNP:754719295
1788 1788 -, tttaaaataagac dbSNP:201758797
1791 1791 -, aaaataagacttt dbSNP:375651955
1805 1805 g, t dbSNP:183744566
1814 1814 -, ccaattttgtaatcatt dbSNP:372190247
1844 1844 -, a dbSNP:763688379
1846 1846 -, tt, ttagt dbSNP:113050549
1849 1849 -, gttt dbSNP:770179781
1864 1864 c, g dbSNP:778207227
1870 1870 c, t dbSNP:749812407
1886 1886 -, tat dbSNP:770933958
1888 1888 a, g dbSNP:187525386
1902 1902 -, caaa dbSNP:746061580
1914 1914 c, t dbSNP:191995452
1928 1928 a, g dbSNP:776254250
1953 1953 g, t dbSNP:5955761
1960 1960 c, t dbSNP:537446476
2046 2046 a, g dbSNP:150945967
2064 2064 a, g dbSNP:773225586
2067 2067 c, t dbSNP:1042452
2068 2068 a, g dbSNP:376808450
2126 2126 c, t dbSNP:751130904
2177 2177 a, c dbSNP:754555154
2183 2183 a, g dbSNP:1042453
2196 2196 a, g dbSNP:182836908
2202 2202 c, t dbSNP:187083263
2203 2203 a, g dbSNP:192450087
2250 2250 -, tgtt dbSNP:749787977
2257 2257 -, a dbSNP:760736313
2261 2261 -, aaca dbSNP:757815346
2262 2262 a, g dbSNP:542108895
2276 2276 a, g dbSNP:778832973
2277 2277 a, t dbSNP:184532061
2295 2295 -, aag dbSNP:772075136
2299 2299 -, t dbSNP:775731731
2299 2299 c, t dbSNP:374396566
2352 2352 a, c dbSNP:1042456
2353 2353 a, g dbSNP:769643820
2360 2360 a, g dbSNP:140383712
2367 2367 c, t dbSNP:781582453
2370 2370 -, aaca dbSNP:776627726
2392 2392 c, t dbSNP:773012317
2394 2394 c, g, t dbSNP:762963142
2398 2398 a, g dbSNP:15816
2400 2400 a, g, t dbSNP:760828301
2409 2409 -, ct dbSNP:762592504
2409 2409 c, t dbSNP:754361374
2413 2413 c, g dbSNP:762427939
2424 2424 a, g dbSNP:765681576
2425 2425 -, tgat dbSNP:748635462
2441 2441 -, cttgt dbSNP:775059849
2441 2441 c, t dbSNP:750757959
2444 2444 c, g dbSNP:758692867
2446 2446 -, tt dbSNP:762409221
2457 2457 c, g dbSNP:779698506
2468 2468 a, g dbSNP:140145114
2471 2471 c, g dbSNP:145675672
2472 2472 c, t dbSNP:61744590
2477 2477 a, g dbSNP:756645339
2480 2480 c, t dbSNP:56021619
2481 2481 c, t dbSNP:778346850
2489 2489 c, t dbSNP:747680098
2490 2490 a, g dbSNP:756039907
2491 2491 c, t dbSNP:147753175
2493 2493 c, t dbSNP:759041463
2496 2496 c, t dbSNP:766954168
2498 2498 a, g, t dbSNP:557102951
2501 2501 -, tc dbSNP:750762941
2505 2505 c, t dbSNP:747270244
2506 2506 -, a dbSNP:761048720
2510 2510 g, t dbSNP:768831534
2516 2516 a, g dbSNP:776800732
2525 2525 -, aaac dbSNP:766536396
2527 2527 a, g dbSNP:761827915
2531 2531 -, ac dbSNP:202102403
2537 2537 -, ctgt dbSNP:755834416
2543 2543 c, t dbSNP:765707363
2547 2547 a, c dbSNP:369499936
2548 2548 a, g dbSNP:373390286
2553 2553 a, t dbSNP:770495684
2560 2560 a, g dbSNP:766795601
2568 2568 c, g dbSNP:751191482
2633 2633 g, t dbSNP:369068280
2636 2636 a, g dbSNP:778678656
2644 2644 c, t dbSNP:754247336
2645 2645 a, g dbSNP:745566169
2650 2650 c, t dbSNP:189054591
2684 2684 a, g dbSNP:193253848
2716 2716 a, g dbSNP:56039350
2733 2733 c, t dbSNP:55856360
2763 2763 a, g dbSNP:760525544
2772 2772 c, t dbSNP:779999826
2773 2773 a, g dbSNP:768422526
2789 2789 c, t dbSNP:747229060
2806 2806 a, g dbSNP:769050360
2902 2902 c, g dbSNP:7883708
2909 2909 a, t dbSNP:770658441
2924 2924 c, t dbSNP:5955550
2937 2937 c, g dbSNP:11094770
2940 2940 a, g dbSNP:771609750
2941 2941 c, g dbSNP:762905278
2986 2986 a, g dbSNP:201259816
2987 2987 a, g, t dbSNP:376593530
2997 2997 -, cttata dbSNP:760296050
2999 2999 a, t dbSNP:755594888
3001 3001 c, t dbSNP:370565981
3017 3017 g, t dbSNP:749254470
3021 3021 c, t dbSNP:55744630
3024 3024 c, g, t dbSNP:377382652
3025 3025 a, c, t dbSNP:753516995
3026 3026 a, g dbSNP:748198804
3028 3028 -, a dbSNP:762188631
3032 3032 a, g, t dbSNP:148399187
3036 3036 g, t dbSNP:763409232
3043 3043 a, g dbSNP:142533585
3050 3050 a, c dbSNP:766893716
3055 3055 a, g dbSNP:774659644
3056 3056 g, t dbSNP:150957359
3057 3057 c, g dbSNP:370651623
3074 3074 a, c dbSNP:750874490
3075 3075 c, t dbSNP:140779387
3077 3077 a, g dbSNP:752352625
3081 3081 g, t dbSNP:371285733
3089 3089 c, t dbSNP:144734730
3091 3091 -, t dbSNP:751563348
3097 3097 a, g dbSNP:763556279
3102 3102 a, c, t dbSNP:780260798
3116 3116 a, c dbSNP:373779094
3117 3117 a, c, g dbSNP:779022123
3118 3118 a, t dbSNP:758279534
3131 3131 c, g dbSNP:781550393
3134 3134 c, t dbSNP:374494282
3148 3148 c, g dbSNP:769886359
3151 3151 c, t dbSNP:777666685
3152 3152 a, g dbSNP:755016325
3153 3153 c, t dbSNP:749418204
3154 3154 a, g dbSNP:771363028
3158 3158 -, tttc dbSNP:757189654
3179 3179 c, g dbSNP:781517592
3186 3186 a, g dbSNP:759883184
3197 3197 a, c dbSNP:772494786
3208 3208 c, g dbSNP:15943
3213 3213 c, t dbSNP:760297711
3214 3214 a, g dbSNP:763826263
3234 3234 c, t dbSNP:753243729
3238 3238 c, t dbSNP:761409953
3247 3247 g, t dbSNP:770697702
3250 3250 c, g, t dbSNP:368526609
3251 3251 a, g, t dbSNP:372102191
3255 3255 c, g dbSNP:140380348
3263 3263 g, t dbSNP:752937000
3265 3265 c, g dbSNP:778062708
3269 3269 c, g dbSNP:749306111
3286 3286 -, g dbSNP:781136595
3286 3286 c, t dbSNP:771054574
3287 3287 a, g dbSNP:779385101
3289 3289 c, t dbSNP:756514533
3292 3292 a, g dbSNP:746410710
3298 3298 c, t dbSNP:778642797
3303 3303 -, tatat dbSNP:745681893
3310 3310 g, t dbSNP:375095104
3321 3321 a, c dbSNP:368185128
3324 3324 -, ct dbSNP:755908979
3327 3327 c, t dbSNP:745807211
3331 3331 a, g dbSNP:776362774
3358 3358 c, t dbSNP:181554208
3375 3375 a, g dbSNP:774947730

Target ORF information:

RefSeq Version NM_001173455
Organism Homo sapiens (human)
Definition Homo sapiens pyruvate dehydrogenase (lipoamide) alpha 1 (PDHA1), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu20621D
Sequence Information ORF Nucleotide Sequence (Length: 1173bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 21-MAY-2015
Organism Homo sapiens (human)
Product pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC361191.1, L13318.1, BU170389.1, AL732326.4 and R49470.1. This sequence is a reference standard in the RefSeqGene project. On Mar 16, 2010 this sequence version replaced gi:164664523. Summary: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 alpha 1 subunit containing the E1 active site, and plays a key role in the function of the PDH complex. Mutations in this gene are associated with pyruvate dehydrogenase E1-alpha deficiency and X-linked Leigh syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]. Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: L48690.1, L13318.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)332..334(+)
Misc Feature(2)332..334(+)
Misc Feature(3)335..1204(+)
Misc Feature(4)407..1045(+)
Misc Feature(5)497..1021(+)
Misc Feature(6)623..784(+)
Misc Feature(7)839..841(+)
Misc Feature(8)839..841(+)
Misc Feature(9)839..841(+)
Misc Feature(10)839..841(+)
Misc Feature(11)839..841(+)
Misc Feature(12)875..877(+)
Misc Feature(13)875..877(+)
Misc Feature(14)974..976(+)
Misc Feature(15)1004..1093(+)
Misc Feature(16)1022..1024(+)
Misc Feature(17)1022..1024(+)
Misc Feature(18)1022..1024(+)
Misc Feature(19)1022..1024(+)
Misc Feature(20)1022..1024(+)
Misc Feature(21)1022..1024(+)
Misc Feature(22)1028..1030(+)
Misc Feature(23)1043..1045(+)
Misc Feature(24)1043..1045(+)
Misc Feature(25)1043..1045(+)
Misc Feature(26)1043..1045(+)
Misc Feature(27)1043..1045(+)
Misc Feature(28)1046..1048(+)
Misc Feature(29)1046..1048(+)
Misc Feature(30)1082..1084(+)
Misc Feature(31)1082..1084(+)
Misc Feature(32)1106..1108(+)
Misc Feature(33)1151..1153(+)
Misc Feature(34)1250..1252(+)
Misc Feature(35)1298..1300(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..262
Gene Synonym:
Exon (3)263..436
Gene Synonym:
Exon (4)437..563
Gene Synonym:
Exon (5)564..655
Gene Synonym:
Exon (6)656..748
Gene Synonym:
Exon (7)749..904
Gene Synonym:
Exon (8)905..976
Gene Synonym:
Exon (9)977..1044
Gene Synonym:
Exon (10)1045..1153
Gene Synonym:
Exon (11)1154..3372
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:772404896
12 12 a, t dbSNP:755180733
35 35 g, t dbSNP:781441358
48 48 c, t dbSNP:192773464
58 58 a, g dbSNP:5955751
74 74 a, g dbSNP:778593749
88 88 c, t dbSNP:775567462
95 95 c, g, t dbSNP:745758119
96 96 g, t dbSNP:771905403
100 100 c, t dbSNP:778551493
102 102 a, c dbSNP:745761659
104 104 g, t dbSNP:772091896
105 105 c, g dbSNP:779608230
120 120 a, g dbSNP:746757266
122 122 c, t dbSNP:768574096
123 123 c, g dbSNP:773557576
126 126 g, t dbSNP:763337765
129 129 a, g dbSNP:770889326
131 131 c, t dbSNP:774543652
136 136 c, t dbSNP:746571233
137 137 c, t dbSNP:76809608
141 141 a, g dbSNP:768029512
153 153 a, g dbSNP:753208097
161 161 a, g dbSNP:768396832
162 162 c, t dbSNP:764498937
173 173 a, c dbSNP:753484182
174 174 c, g dbSNP:137853257
176 176 a, g dbSNP:756973583
187 187 c, t dbSNP:778260543
203 203 g, t dbSNP:773500511
209 209 a, g dbSNP:763398358
214 214 a, g dbSNP:770667770
219 219 c, t dbSNP:774155734
227 227 c, t dbSNP:759062849
242 242 c, g dbSNP:150318528
243 243 a, t dbSNP:752678074
250 250 a, g dbSNP:746867841
271 271 c, g dbSNP:759331650
279 279 a, g dbSNP:144967854
284 284 a, g dbSNP:745312079
290 290 g, t dbSNP:760251445
297 297 c, g dbSNP:771734567
299 299 a, g dbSNP:376746290
315 315 c, g, t dbSNP:149083818
362 362 a, c dbSNP:761538559
363 363 a, g dbSNP:765074163
397 397 a, g dbSNP:144828838
463 463 c, t dbSNP:764516370
464 464 a, g dbSNP:764996618
472 472 c, t dbSNP:772943333
482 482 c, t dbSNP:11554111
483 483 a, g dbSNP:762839069
502 502 a, g dbSNP:767569398
508 508 c, t dbSNP:183170654
524 524 c, t dbSNP:199959402
535 535 c, t dbSNP:756138817
536 536 a, g dbSNP:764303926
541 541 a, c dbSNP:757654963
551 551 a, g dbSNP:138727886
592 592 a, g dbSNP:773139249
628 628 c, t dbSNP:398123300
631 631 g, t dbSNP:762598184
652 652 a, g dbSNP:141862527
667 667 c, t dbSNP:769308417
695 695 a, g dbSNP:777678490
709 709 g, t dbSNP:749319044
716 716 c, g dbSNP:770603511
760 760 c, g, t dbSNP:137853254
793 793 a, c dbSNP:121917898
802 802 c, t dbSNP:778744930
805 805 c, t dbSNP:745607005
838 838 a, g dbSNP:138237215
841 841 c, t dbSNP:764871850
842 842 a, g dbSNP:372505888
853 853 a, g dbSNP:750307419
862 862 c, t dbSNP:769963488
872 872 a, t dbSNP:137853255
901 901 c, g dbSNP:768600287
905 905 c, g dbSNP:749333596
907 907 a, g dbSNP:770975182
909 909 a, g dbSNP:774917952
918 918 a, c dbSNP:137853253
929 929 a, g dbSNP:202166915
932 932 c, g dbSNP:137853259
935 935 c, g dbSNP:767850573
940 940 a, c, g dbSNP:1126565
943 943 a, g dbSNP:35752213
955 955 g, t dbSNP:763733376
960 960 a, g dbSNP:752225588
982 982 c, g dbSNP:775978359
989 989 a, c dbSNP:2229137
994 994 a, g dbSNP:768957853
997 997 g, t dbSNP:776339048
999 999 a, g dbSNP:373275701
1006 1006 -, t dbSNP:606231190
1008 1008 a, g dbSNP:137853258
1015 1015 c, t dbSNP:761411007
1024 1024 c, t dbSNP:764780830
1049 1049 c, t dbSNP:137853252
1056 1056 a, g dbSNP:766055203
1057 1057 a, c dbSNP:751513713
1062 1062 -, tagttaccgtacacgagaaga dbSNP:606231188
1072 1072 a, c dbSNP:200088791
1079 1079 -, agtaaga dbSNP:606231185
1082 1082 -, aag dbSNP:137853251
1084 1084 a, g dbSNP:374649412
1088 1088 a, g dbSNP:137853256
1093 1093 a, t dbSNP:759443348
1100 1100