Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PDPK1 3-phosphoinositide dependent protein kinase 1 [Homo sapiens (human)]

Gene Symbol PDPK1
Entrez Gene ID 5170
Full Name 3-phosphoinositide dependent protein kinase 1
Synonyms PDK1, PDPK2, PDPK2P, PRO0461
General protein information
Preferred Names
3-phosphoinositide-dependent protein kinase 1
3-phosphoinositide-dependent protein kinase 1
PkB-like 1
PkB kinase like gene 1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu59606 XM_011522521 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu59607 XM_011522522 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu48855 XM_005255356 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu59608 XM_011522523 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu59609 XM_011522524 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu13008 NM_002613 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu13009 NM_031268 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu13007 NM_001261816 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu59606D
Sequence Information ORF Nucleotide Sequence (Length: 1773bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1286..2074(+)
Misc Feature(2)1292..2074(+)
Misc Feature(3)1310..1897(+)
Misc Feature(4)1310..1717(+)
Misc Feature(5)1322..1897(+)
Misc Feature(6)1712..1789(+)
Misc Feature(7)2369..2689(+)
Misc Feature(8)2441..2611(+)
Position Chain Variation Link
236 236 c, t dbSNP:547040445
255 255 c, g dbSNP:374019322
262 262 c, g dbSNP:561153470
272 272 -, gatt dbSNP:150836742
331 331 c, t dbSNP:530277736
351 351 a, g dbSNP:376949540
355 355 a, g dbSNP:550228970
372 372 a, g dbSNP:570354791
402 402 a, c dbSNP:111439925
425 425 a, g dbSNP:538947141
522 522 c, t dbSNP:552643682
546 546 a, c dbSNP:566033938
576 576 a, c dbSNP:780121126
580 580 a, c dbSNP:535133318
894 894 a, g dbSNP:555066937
909 909 g, t dbSNP:573906874
1099 1099 c, t dbSNP:61747742
1104 1104 -, tgt dbSNP:750485483
1134 1134 c, t dbSNP:772871628
1159 1159 a, g dbSNP:762649804
1170 1170 c, t dbSNP:55824600
1183 1183 c, t dbSNP:770708494
1195 1195 c, t dbSNP:539550094
1198 1198 c, t dbSNP:759430577
1199 1199 a, g dbSNP:767328553
1204 1204 c, t dbSNP:752733022
1214 1214 c, g dbSNP:760555326
1216 1216 c, t dbSNP:553067229
1217 1217 a, g dbSNP:753919385
1223 1223 c, t dbSNP:757413961
1224 1224 a, g dbSNP:779166111
1226 1226 c, t dbSNP:750784265
1228 1228 c, t dbSNP:573496896
1229 1229 a, g dbSNP:780402170
1231 1231 c, t dbSNP:747501354
1232 1232 a, g dbSNP:769074523
1234 1234 c, t dbSNP:777349106
1235 1235 a, g dbSNP:748817353
1238 1238 g, t dbSNP:770692110
1242 1242 a, t dbSNP:774190389
1246 1246 a, g dbSNP:759232667
1251 1251 c, t dbSNP:771854875
1259 1259 c, g, t dbSNP:775183994
1260 1260 c, t dbSNP:535696352
1261 1261 a, g dbSNP:776681039
1263 1263 c, t dbSNP:761949625
1264 1264 a, g dbSNP:765411861
1272 1272 a, g dbSNP:750705121
1279 1279 a, g dbSNP:372064092
1280 1280 c, t dbSNP:766725088
1281 1281 a, g dbSNP:751870190
1283 1283 a, c, g dbSNP:755452051
1286 1286 c, g dbSNP:748800896
1289 1289 a, g dbSNP:756879724
1291 1291 c, t dbSNP:778591061
1296 1296 a, g dbSNP:745496613
1306 1306 a, g dbSNP:575887920
1309 1309 c, t dbSNP:758319
1312 1312 c, t dbSNP:775298281
1317 1317 -, a dbSNP:780646954
1321 1321 -, ct dbSNP:747519638
1322 1322 g, t dbSNP:746838429
1330 1330 a, c dbSNP:146388630
1333 1333 a, g dbSNP:776593118
1425 1425 a, g dbSNP:551607067
1501 1501 -, cgac dbSNP:748593314
1503 1503 a, t dbSNP:748035328
1504 1504 c, t dbSNP:769723811
1576 1576 a, g dbSNP:2041206
1768 1768 c, g dbSNP:764571812
1774 1774 c, t dbSNP:749948247
1783 1783 a, g dbSNP:574452215
1785 1785 c, t dbSNP:757889593
1789 1789 a, g dbSNP:543688348
1793 1793 a, g dbSNP:370069297
1802 1802 a, g dbSNP:373278831
1804 1804 a, g dbSNP:139543796
1807 1807 a, g dbSNP:780894116
1812 1812 c, t dbSNP:144186731
1821 1821 c, t dbSNP:769705993
1822 1822 c, t dbSNP:200735205
1823 1823 a, g dbSNP:749355083
2181 2181 a, g dbSNP:755812280
2186 2186 c, g dbSNP:763731140
2194 2194 g, t dbSNP:561462097
2202 2202 a, g dbSNP:753681549
2208 2208 a, g dbSNP:370279457
2217 2217 c, t dbSNP:779064858
2218 2218 c, g dbSNP:377095764
2221 2221 c, g dbSNP:758602254
2226 2226 c, g dbSNP:200076126
2235 2235 c, g dbSNP:780305703
2236 2236 c, t dbSNP:747157063
2237 2237 c, g dbSNP:768924605
2238 2238 g, t dbSNP:776800040
2239 2239 a, g dbSNP:748599366
2241 2241 c, t dbSNP:370494924
2248 2248 c, t dbSNP:773747255
2251 2251 c, t dbSNP:759022782
2252 2252 a, g dbSNP:76887737
2253 2253 c, t dbSNP:75824263
2254 2254 a, c, g, t dbSNP:75077217
2256 2256 a, g dbSNP:139732994
2258 2258 c, t dbSNP:201780963
2262 2262 a, c dbSNP:535986266
2263 2263 c, g dbSNP:750340247
2271 2271 c, t dbSNP:758443705
2276 2276 a, g dbSNP:780213417
2278 2278 c, t dbSNP:747123753
2279 2279 a, c dbSNP:755138312
2280 2280 a, g dbSNP:149931764
2290 2290 a, g dbSNP:748428723
2292 2292 a, g dbSNP:770192179
2293 2293 c, t dbSNP:778131329
2299 2299 c, t dbSNP:532663585
2301 2301 a, g dbSNP:771442872
2302 2302 c, t dbSNP:774850892
2303 2303 c, t dbSNP:760300604
2310 2310 c, t dbSNP:547797391
2311 2311 a, c, g dbSNP:768166848
2314 2314 c, t dbSNP:761396833
2316 2316 c, g dbSNP:765088097
2328 2328 a, t dbSNP:552355299
2333 2333 c, g dbSNP:145034828
2341 2341 c, t dbSNP:766478163
2342 2342 a, g dbSNP:751583488
2347 2347 c, t dbSNP:145594574
2355 2355 a, g dbSNP:374111988
2357 2357 c, t dbSNP:752913176
2363 2363 c, t dbSNP:756358328
2366 2366 g, t dbSNP:142153837
2367 2367 a, t dbSNP:749712375
2380 2380 c, t dbSNP:771424447
2382 2382 g, t dbSNP:533780852
2408 2408 a, g dbSNP:374649760
2414 2414 c, t dbSNP:777350674
2444 2444 c, t dbSNP:753410336
2461 2461 a, g dbSNP:535332245
2479 2479 c, g dbSNP:773372279
2485 2485 a, g dbSNP:763017868
2500 2500 a, g dbSNP:771291308
2503 2503 c, t dbSNP:774842989
2506 2506 c, t dbSNP:760019244
2519 2519 a, g dbSNP:768116696
2520 2520 a, t dbSNP:775814028
2537 2537 a, g dbSNP:761277571
2553 2553 a, g dbSNP:764588339
2557 2557 a, t dbSNP:749966481
2570 2570 a, g dbSNP:758036081
2589 2589 a, t dbSNP:766091042
2601 2601 c, t dbSNP:549158095
2602 2602 a, g dbSNP:751320393
2608 2608 c, t dbSNP:752547402
2614 2614 a, g, t dbSNP:755991413
2626 2626 a, g dbSNP:749357936
2635 2635 c, t dbSNP:147843249
2641 2641 c, t dbSNP:141143951
2657 2657 a, c dbSNP:143425561
2671 2671 c, g dbSNP:551293304
2672 2672 a, g dbSNP:772355571
2680 2680 a, g dbSNP:775707536
2685 2685 a, g dbSNP:148008907
2701 2701 a, g dbSNP:747477279
2704 2704 c, t dbSNP:201375554
2707 2707 c, t dbSNP:201646295
2708 2708 a, g dbSNP:201983709
2716 2716 a, g dbSNP:770386112
2720 2720 c, t dbSNP:141708903
2721 2721 g, t dbSNP:759130714
2729 2729 c, t dbSNP:567030364
2730 2730 a, g dbSNP:371050359
2733 2733 c, t dbSNP:760558101
2734 2734 a, g dbSNP:375625632
2745 2745 c, t dbSNP:753787792
2746 2746 a, g, t dbSNP:757267684
2747 2747 c, t dbSNP:750591733
2751 2751 c, t dbSNP:758548197
2752 2752 a, g dbSNP:775000968
2754 2754 a, g dbSNP:747310334
2760 2760 c, t dbSNP:763407617
2764 2764 c, t dbSNP:769012428
2767 2767 g, t dbSNP:781565770
2768 2768 c, t dbSNP:748585190
2769 2769 a, g dbSNP:770298078
2770 2770 c, t dbSNP:368140738
2771 2771 a, g dbSNP:111905533
2772 2772 g, t dbSNP:374100568
2786 2786 c, t dbSNP:759166098
2793 2793 c, t dbSNP:576603878
2827 2827 c, t dbSNP:10866
2864 2864 a, g dbSNP:3087784
2869 2869 a, g dbSNP:559332782
2879 2879 a, c dbSNP:563682651
2904 2904 a, g dbSNP:375635017
2906 2906 c, g dbSNP:776687154
2920 2920 a, g dbSNP:762295195
2950 2950 g, t dbSNP:767628948
2955 2955 a, t dbSNP:572774850
2958 2958 c, g dbSNP:752529981
2988 2988 c, g dbSNP:529226935
2995 2995 c, g dbSNP:148121766
3002 3002 a, c dbSNP:561226269
3015 3015 c, t dbSNP:140982354
3021 3021 c, t dbSNP:13335284
3022 3022 a, g dbSNP:369818229
3025 3025 c, t dbSNP:374470586
3057 3057 g, t dbSNP:371038846
3083 3083 g, t dbSNP:563611183
3090 3090 c, t dbSNP:543128805
3098 3098 a, g dbSNP:531570429
3119 3119 a, g dbSNP:528250860
3128 3128 g, t dbSNP:189787811
3149 3149 c, t dbSNP:754005480
3164 3164 a, g dbSNP:753864539
3204 3204 a, g dbSNP:571210384
3207 3207 c, t dbSNP:758382220
3214 3214 g, t dbSNP:181078294
3219 3219 -, cgggggccgcagctttgtgg dbSNP:374612917
3224 3224 a, g dbSNP:113332295
3228 3228 a, g dbSNP:547002823
3235 3235 a, t dbSNP:559554679
3249 3249 c, g dbSNP:751303008
3259 3259 a, c dbSNP:375417064
3299 3299 a, t dbSNP:535850233
3305 3305 a, t dbSNP:556257698
3329 3329 c, t dbSNP:780858375
3338 3338 g, t dbSNP:750481961
3346 3346 c, t dbSNP:185952911
3351 3351 c, t dbSNP:539284441
3355 3355 -, a dbSNP:560922224
3365 3365 a, g dbSNP:559150292
3367 3367 a, g dbSNP:572787105
3430 3430 a, g dbSNP:541712873
3451 3451 c, g dbSNP:79745244
3476 3476 g, t dbSNP:574807920
3488 3488 c, g dbSNP:745471795
3496 3496 a, t dbSNP:528570052
3507 3507 c, t dbSNP:138049982
3523 3523 c, t dbSNP:769465822
3536 3536 a, g dbSNP:563848860
3550 3550 c, t dbSNP:779506921
3555 3555 c, g dbSNP:748844927
3602 3602 g, t dbSNP:71386677
3606 3606 c, g dbSNP:142512073
3653 3653 a, g dbSNP:762232443
3665 3665 a, g dbSNP:564701168
3719 3719 c, t dbSNP:190327635
3730 3730 -, a dbSNP:571502069
3757 3757 a, g dbSNP:547314582
3764 3764 c, t dbSNP:78560075
3773 3773 g, t dbSNP:529734340
3785 3785 a, g dbSNP:138756291
3803 3803 g, t dbSNP:760941132
3815 3815 a, g dbSNP:766750148
3817 3817 c, g dbSNP:769055116
3869 3869 c, t dbSNP:76291069
3884 3884 a, g dbSNP:74003037
3902 3902 -, g dbSNP:765252878
3927 3927 c, t dbSNP:144433575
3936 3936 c, t dbSNP:566250204
3945 3945 c, t dbSNP:550576606
3948 3948 a, g dbSNP:748644397
3970 3970 c, t dbSNP:759751812
3971 3971 a, g dbSNP:376035884
3991 3991 c, t dbSNP:148393103
3992 3992 a, c, g dbSNP:141692563
4007 4007 g, t dbSNP:147153606
4018 4018 c, t dbSNP:183283033
4037 4037 a, c dbSNP:576938086
4042 4042 c, t dbSNP:770202665
4072 4072 c, t dbSNP:545861137
4097 4097 a, t dbSNP:559396383
4105 4105 c, t dbSNP:28679688
4197 4197 -, tgc dbSNP:149315179
4225 4225 a, g dbSNP:540817771
4238 4238 c, t dbSNP:561282155
4360 4360 a, g dbSNP:370396602
4372 4372 c, t dbSNP:367998725
4384 4384 c, g dbSNP:529898940
4408 4408 c, t dbSNP:549760673
4425 4425 c, g dbSNP:373772013
4428 4428 c, g dbSNP:372067195
4453 4453 a, c dbSNP:532266776
4525 4525 c, t dbSNP:552329672
4526 4526 a, g dbSNP:4786296
4538 4538 a, g dbSNP:565767072
4568 4568 c, t dbSNP:535278860
4619 4619 g, t dbSNP:4786297
4634 4634 c, g dbSNP:548496512
4669 4669 a, g dbSNP:568740588
4673 4673 a, g dbSNP:147975625
4695 4695 -, gtcctgtgtctccat dbSNP:370970044
4695 4695 g, t dbSNP:537310185
4711 4711 g, t dbSNP:557345495
4743 4743 a, g dbSNP:187363186
4755 4755 c, g dbSNP:28457160
4756 4756 a, g dbSNP:535074412
4757 4757 a, g dbSNP:572997169
4787 4787 g, t dbSNP:113716221
4804 4804 c, t dbSNP:541222591
4818 4818 c, t dbSNP:190975527
4823 4823 c, t dbSNP:574692618
4824 4824 a, g dbSNP:543323513
4834 4834 c, t dbSNP:563577752
4908 4908 a, g dbSNP:113054936
4917 4917 c, t dbSNP:532181910
4939 4939 a, g dbSNP:28615548
4948 4948 c, t dbSNP:775324213
4960 4960 c, t dbSNP:565667834
4967 4967 c, t dbSNP:372950862
4974 4974 c, t dbSNP:559538467
4977 4977 c, t dbSNP:534714693
5011 5011 c, t dbSNP:548777339
5029 5029 c, t dbSNP:149131034
5046 5046 c, t dbSNP:531109247
5074 5074 c, t dbSNP:551022507
5097 5097 c, g dbSNP:71386681
5119 5119 c, t dbSNP:570799401
5129 5129 g, t dbSNP:539495695
5134 5134 a, g dbSNP:552900581
5142 5142 a, g dbSNP:566632715
5162 5162 a, g dbSNP:535544455
5175 5175 c, t dbSNP:558027230
5176 5176 g, t dbSNP:577872209
5210 5210 -, a dbSNP:199508475
5284 5284 c, t dbSNP:554773031
5300 5300 a, g dbSNP:574574151
5302 5302 c, g, t dbSNP:543744889
5311 5311 a, c dbSNP:557336688
5317 5317 c, t dbSNP:147659496
5334 5334 c, t dbSNP:577209776
5340 5340 c, t dbSNP:545819504
5442 5442 a, g dbSNP:559353007
5686 5686 c, t dbSNP:528209602
5717 5717 c, t dbSNP:541587272
5730 5730 -, c dbSNP:534151146
5772 5772 c, t dbSNP:561803954
5787 5787 a, g dbSNP:531050862
5838 5838 c, t dbSNP:551150791
5839 5839 a, g dbSNP:570813362
5846 5846 a, c dbSNP:533404808
5848 5848 c, t dbSNP:546604706
5856 5856 -, tcg dbSNP:753607913
5932 5932 a, g dbSNP:566501788
5973 5973 c, t dbSNP:557265376
5991 5991 -, aa dbSNP:58747637
5991 5991 a, t dbSNP:535820869
6036 6036 a, g dbSNP:182763560
6059 6059 c, t dbSNP:61080418
6069 6069 -, c dbSNP:764729763
6070 6070 c, t dbSNP:569327197
6072 6072 c, g dbSNP:573995032
6097 6097 c, t dbSNP:536897617
6146 6146 a, g dbSNP:187478880
6154 6154 a, g dbSNP:577221830
6161 6161 c, t dbSNP:546088965
6165 6165 a, c dbSNP:761743692
6167 6167 c, g dbSNP:3112704
6167 6167 c, g dbSNP:112319026
6170 6170 a, c dbSNP:191845035
6175 6175 a, g dbSNP:144753105
6191 6191 g, t dbSNP:561678389
6197 6197 c, t dbSNP:575253021
6207 6207 c, t dbSNP:544409330
6228 6228 a, g dbSNP:182493826
6233 6233 a, g dbSNP:533467818
6234 6234 c, t dbSNP:546919073
6307 6307 c, t dbSNP:556685997
6314 6314 a, c, t dbSNP:559677768
6324 6324 c, t dbSNP:11554593
6350 6350 c, g, t dbSNP:769734148
6357 6357 c, g dbSNP:549358180
6388 6388 c, t dbSNP:112703875
6411 6411 c, g dbSNP:539534788
6413 6413 a, g dbSNP:538298991
6433 6433 g, t dbSNP:751576674
6434 6434 c, t dbSNP:750511319
6435 6435 a, g dbSNP:757123594
6450 6450 c, t dbSNP:767388984
6459 6459 c, t dbSNP:550813362
6461 6461 a, t dbSNP:750180444
6466 6466 a, c dbSNP:373860725
6468 6468 a, t dbSNP:573302563
6471 6471 c, t dbSNP:766162407
6507 6507 a, t dbSNP:570686169
6523 6523 c, t dbSNP:539624769
6560 6560 a, c dbSNP:367757589
6569 6569 a, g dbSNP:371321013
6574 6574 c, t dbSNP:779625508
6581 6581 g, t dbSNP:368594243
6591 6591 -, tt dbSNP:545088750
6606 6606 a, g dbSNP:535107274
6607 6607 c, t dbSNP:773937993
6654 6654 -, gtgggg dbSNP:33994421
6719 6719 g, t dbSNP:555301555
6735 6735 c, g dbSNP:575259088
6745 6745 c, t dbSNP:543874303
6758 6758 -, c dbSNP:552798143
6759 6759 -, c dbSNP:565144559
6764 6764 a, c dbSNP:563817322
6765 6765 c, g dbSNP:56318884
6766 6766 -, c dbSNP:376887169
6795 6795 c, t dbSNP:550881899
6805 6805 a, g dbSNP:2335110
6858 6858 a, t dbSNP:561386521
6874 6874 a, t dbSNP:560670835
6885 6885 a, g dbSNP:187543589
6908 6908 c, g dbSNP:549120788
6910 6910 c, t dbSNP:2335111
6912 6912 c, t dbSNP:137906061
6955 6955 c, t dbSNP:755221626
6956 6956 a, g dbSNP:530400633
6995 6995 c, t dbSNP:551935898
7026 7026 c, g dbSNP:3095103
7049 7049 c, t dbSNP:539689181
7050 7050 a, g dbSNP:369381082
7081 7081 a, t dbSNP:565662700
7105 7105 a, g dbSNP:376666016
7121 7121 g, t dbSNP:566661760
7124 7124 c, t dbSNP:185737005
7134 7134 a, c dbSNP:190542981
7151 7151 c, g dbSNP:555090482
7163 7163 a, g dbSNP:754582678
7172 7172 -, a dbSNP:200815032
7202 7202 a, g dbSNP:200359888
7209 7209 a, g dbSNP:575224409
7240 7240 c, g dbSNP:537432131
7256 7256 c, g dbSNP:368831914
7268 7268 a, g dbSNP:557471998
7310 7310 g, t dbSNP:577316175
7369 7369 c, t dbSNP:540431729
7370 7370 c, g dbSNP:748479536
7390 7390 c, t dbSNP:371727709
7391 7391 a, g dbSNP:929457
7427 7427 a, g dbSNP:201156361
7443 7443 c, t dbSNP:534430467
7479 7479 a, g dbSNP:575136663
7492 7492 a, g dbSNP:184540154
7493 7493 c, t dbSNP:189062814
7509 7509 c, t dbSNP:778213681
7544 7544 g, t dbSNP:745355644
7546 7546 c, t dbSNP:545414930
7551 7551 -, gtaa dbSNP:5815128
7554 7554 -, agta dbSNP:3030674
7554 7554 -, gtaa dbSNP:761147047
7561 7561 c, t dbSNP:565379490
7625 7625 a, g dbSNP:527745262
7628 7628 a, g dbSNP:375159135
7639 7639 g, t dbSNP:566631892
7667 7667 a, g dbSNP:529055336
7668 7668 g, t dbSNP:549294670
7670 7670 a, g dbSNP:568802639
7672 7672 a, g dbSNP:537496663
7711 7711 -, tg dbSNP:771759264
7748 7748 c, t dbSNP:557285323
7768 7768 c, g dbSNP:571020949
7774 7774 g, t dbSNP:533610862
7784 7784 g, t dbSNP:554095762
7800 7800 a, t dbSNP:545626630
7804 7804 a, g dbSNP:574208711
7820 7820 a, g dbSNP:542840852
7821 7821 -, ttg dbSNP:540470378
7831 7831 c, g dbSNP:553056589
7842 7842 -, tg dbSNP:201869822
7857 7857 a, c dbSNP:748736402
7891 7891 c, t dbSNP:556860773
7971 7971 a, g dbSNP:11554591
8022 8022 g, t dbSNP:772425944
8039 8039 c, t dbSNP:576761849
8040 8040 -, t, tt dbSNP:111618468
8042 8042 a, g dbSNP:11554592
8047 8047 c, g, t dbSNP:181213412
8051 8051 -, tc dbSNP:201698119
8058 8058 a, c dbSNP:527809139
8069 8069 a, g dbSNP:557863257
8071 8071 a, g dbSNP:185318792
8095 8095 a, t dbSNP:189105574
8103 8103 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_011522521
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59607D
Sequence Information ORF Nucleotide Sequence (Length: 1677bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)638..1426(+)
Misc Feature(2)644..1426(+)
Misc Feature(3)662..1249(+)
Misc Feature(4)662..1069(+)
Misc Feature(5)674..1249(+)
Misc Feature(6)1064..1141(+)
Misc Feature(7)1721..2041(+)
Misc Feature(8)1793..1963(+)
Position Chain Variation Link
254 254 a, g dbSNP:28619947
451 451 c, t dbSNP:61747742
456 456 -, tgt dbSNP:750485483
486 486 c, t dbSNP:772871628
511 511 a, g dbSNP:762649804
522 522 c, t dbSNP:55824600
535 535 c, t dbSNP:770708494
547 547 c, t dbSNP:539550094
550 550 c, t dbSNP:759430577
551 551 a, g dbSNP:767328553
556 556 c, t dbSNP:752733022
566 566 c, g dbSNP:760555326
568 568 c, t dbSNP:553067229
569 569 a, g dbSNP:753919385
575 575 c, t dbSNP:757413961
576 576 a, g dbSNP:779166111
578 578 c, t dbSNP:750784265
580 580 c, t dbSNP:573496896
581 581 a, g dbSNP:780402170
583 583 c, t dbSNP:747501354
584 584 a, g dbSNP:769074523
586 586 c, t dbSNP:777349106
587 587 a, g dbSNP:748817353
590 590 g, t dbSNP:770692110
594 594 a, t dbSNP:774190389
598 598 a, g dbSNP:759232667
603 603 c, t dbSNP:771854875
611 611 c, g, t dbSNP:775183994
612 612 c, t dbSNP:535696352
613 613 a, g dbSNP:776681039
615 615 c, t dbSNP:761949625
616 616 a, g dbSNP:765411861
624 624 a, g dbSNP:750705121
631 631 a, g dbSNP:372064092
632 632 c, t dbSNP:766725088
633 633 a, g dbSNP:751870190
635 635 a, c, g dbSNP:755452051
638 638 c, g dbSNP:748800896
641 641 a, g dbSNP:756879724
643 643 c, t dbSNP:778591061
648 648 a, g dbSNP:745496613
658 658 a, g dbSNP:575887920
661 661 c, t dbSNP:758319
664 664 c, t dbSNP:775298281
669 669 -, a dbSNP:780646954
673 673 -, ct dbSNP:747519638
674 674 g, t dbSNP:746838429
682 682 a, c dbSNP:146388630
685 685 a, g dbSNP:776593118
777 777 a, g dbSNP:551607067
853 853 -, cgac dbSNP:748593314
855 855 a, t dbSNP:748035328
856 856 c, t dbSNP:769723811
928 928 a, g dbSNP:2041206
1120 1120 c, g dbSNP:764571812
1126 1126 c, t dbSNP:749948247
1135 1135 a, g dbSNP:574452215
1137 1137 c, t dbSNP:757889593
1141 1141 a, g dbSNP:543688348
1145 1145 a, g dbSNP:370069297
1154 1154 a, g dbSNP:373278831
1156 1156 a, g dbSNP:139543796
1159 1159 a, g dbSNP:780894116
1164 1164 c, t dbSNP:144186731
1173 1173 c, t dbSNP:769705993
1174 1174 c, t dbSNP:200735205
1175 1175 a, g dbSNP:749355083
1533 1533 a, g dbSNP:755812280
1538 1538 c, g dbSNP:763731140
1546 1546 g, t dbSNP:561462097
1554 1554 a, g dbSNP:753681549
1560 1560 a, g dbSNP:370279457
1569 1569 c, t dbSNP:779064858
1570 1570 c, g dbSNP:377095764
1573 1573 c, g dbSNP:758602254
1578 1578 c, g dbSNP:200076126
1587 1587 c, g dbSNP:780305703
1588 1588 c, t dbSNP:747157063
1589 1589 c, g dbSNP:768924605
1590 1590 g, t dbSNP:776800040
1591 1591 a, g dbSNP:748599366
1593 1593 c, t dbSNP:370494924
1600 1600 c, t dbSNP:773747255
1603 1603 c, t dbSNP:759022782
1604 1604 a, g dbSNP:76887737
1605 1605 c, t dbSNP:75824263
1606 1606 a, c, g, t dbSNP:75077217
1608 1608 a, g dbSNP:139732994
1610 1610 c, t dbSNP:201780963
1614 1614 a, c dbSNP:535986266
1615 1615 c, g dbSNP:750340247
1623 1623 c, t dbSNP:758443705
1628 1628 a, g dbSNP:780213417
1630 1630 c, t dbSNP:747123753
1631 1631 a, c dbSNP:755138312
1632 1632 a, g dbSNP:149931764
1642 1642 a, g dbSNP:748428723
1644 1644 a, g dbSNP:770192179
1645 1645 c, t dbSNP:778131329
1651 1651 c, t dbSNP:532663585
1653 1653 a, g dbSNP:771442872
1654 1654 c, t dbSNP:774850892
1655 1655 c, t dbSNP:760300604
1662 1662 c, t dbSNP:547797391
1663 1663 a, c, g dbSNP:768166848
1666 1666 c, t dbSNP:761396833
1668 1668 c, g dbSNP:765088097
1680 1680 a, t dbSNP:552355299
1685 1685 c, g dbSNP:145034828
1693 1693 c, t dbSNP:766478163
1694 1694 a, g dbSNP:751583488
1699 1699 c, t dbSNP:145594574
1707 1707 a, g dbSNP:374111988
1709 1709 c, t dbSNP:752913176
1715 1715 c, t dbSNP:756358328
1718 1718 g, t dbSNP:142153837
1719 1719 a, t dbSNP:749712375
1732 1732 c, t dbSNP:771424447
1734 1734 g, t dbSNP:533780852
1760 1760 a, g dbSNP:374649760
1766 1766 c, t dbSNP:777350674
1796 1796 c, t dbSNP:753410336
1813 1813 a, g dbSNP:535332245
1831 1831 c, g dbSNP:773372279
1837 1837 a, g dbSNP:763017868
1852 1852 a, g dbSNP:771291308
1855 1855 c, t dbSNP:774842989
1858 1858 c, t dbSNP:760019244
1871 1871 a, g dbSNP:768116696
1872 1872 a, t dbSNP:775814028
1889 1889 a, g dbSNP:761277571
1905 1905 a, g dbSNP:764588339
1909 1909 a, t dbSNP:749966481
1922 1922 a, g dbSNP:758036081
1941 1941 a, t dbSNP:766091042
1953 1953 c, t dbSNP:549158095
1954 1954 a, g dbSNP:751320393
1960 1960 c, t dbSNP:752547402
1966 1966 a, g, t dbSNP:755991413
1978 1978 a, g dbSNP:749357936
1987 1987 c, t dbSNP:147843249
1993 1993 c, t dbSNP:141143951
2009 2009 a, c dbSNP:143425561
2023 2023 c, g dbSNP:551293304
2024 2024 a, g dbSNP:772355571
2032 2032 a, g dbSNP:775707536
2037 2037 a, g dbSNP:148008907
2053 2053 a, g dbSNP:747477279
2056 2056 c, t dbSNP:201375554
2059 2059 c, t dbSNP:201646295
2060 2060 a, g dbSNP:201983709
2068 2068 a, g dbSNP:770386112
2072 2072 c, t dbSNP:141708903
2073 2073 g, t dbSNP:759130714
2081 2081 c, t dbSNP:567030364
2082 2082 a, g dbSNP:371050359
2085 2085 c, t dbSNP:760558101
2086 2086 a, g dbSNP:375625632
2097 2097 c, t dbSNP:753787792
2098 2098 a, g, t dbSNP:757267684
2099 2099 c, t dbSNP:750591733
2103 2103 c, t dbSNP:758548197
2104 2104 a, g dbSNP:775000968
2106 2106 a, g dbSNP:747310334
2112 2112 c, t dbSNP:763407617
2116 2116 c, t dbSNP:769012428
2119 2119 g, t dbSNP:781565770
2120 2120 c, t dbSNP:748585190
2121 2121 a, g dbSNP:770298078
2122 2122 c, t dbSNP:368140738
2123 2123 a, g dbSNP:111905533
2124 2124 g, t dbSNP:374100568
2138 2138 c, t dbSNP:759166098
2145 2145 c, t dbSNP:576603878
2179 2179 c, t dbSNP:10866
2216 2216 a, g dbSNP:3087784
2221 2221 a, g dbSNP:559332782
2231 2231 a, c dbSNP:563682651
2256 2256 a, g dbSNP:375635017
2258 2258 c, g dbSNP:776687154
2272 2272 a, g dbSNP:762295195
2302 2302 g, t dbSNP:767628948
2307 2307 a, t dbSNP:572774850
2310 2310 c, g dbSNP:752529981
2340 2340 c, g dbSNP:529226935
2347 2347 c, g dbSNP:148121766
2354 2354 a, c dbSNP:561226269
2367 2367 c, t dbSNP:140982354
2373 2373 c, t dbSNP:13335284
2374 2374 a, g dbSNP:369818229
2377 2377 c, t dbSNP:374470586
2409 2409 g, t dbSNP:371038846
2435 2435 g, t dbSNP:563611183
2442 2442 c, t dbSNP:543128805
2450 2450 a, g dbSNP:531570429
2471 2471 a, g dbSNP:528250860
2480 2480 g, t dbSNP:189787811
2501 2501 c, t dbSNP:754005480
2516 2516 a, g dbSNP:753864539
2556 2556 a, g dbSNP:571210384
2559 2559 c, t dbSNP:758382220
2566 2566 g, t dbSNP:181078294
2571 2571 -, cgggggccgcagctttgtgg dbSNP:374612917
2576 2576 a, g dbSNP:113332295
2580 2580 a, g dbSNP:547002823
2587 2587 a, t dbSNP:559554679
2601 2601 c, g dbSNP:751303008
2611 2611 a, c dbSNP:375417064
2651 2651 a, t dbSNP:535850233
2657 2657 a, t dbSNP:556257698
2681 2681 c, t dbSNP:780858375
2690 2690 g, t dbSNP:750481961
2698 2698 c, t dbSNP:185952911
2703 2703 c, t dbSNP:539284441
2707 2707 -, a dbSNP:560922224
2717 2717 a, g dbSNP:559150292
2719 2719 a, g dbSNP:572787105
2782 2782 a, g dbSNP:541712873
2803 2803 c, g dbSNP:79745244
2828 2828 g, t dbSNP:574807920
2840 2840 c, g dbSNP:745471795
2848 2848 a, t dbSNP:528570052
2859 2859 c, t dbSNP:138049982
2875 2875 c, t dbSNP:769465822
2888 2888 a, g dbSNP:563848860
2902 2902 c, t dbSNP:779506921
2907 2907 c, g dbSNP:748844927
2954 2954 g, t dbSNP:71386677
2958 2958 c, g dbSNP:142512073
3005 3005 a, g dbSNP:762232443
3017 3017 a, g dbSNP:564701168
3071 3071 c, t dbSNP:190327635
3082 3082 -, a dbSNP:571502069
3109 3109 a, g dbSNP:547314582
3116 3116 c, t dbSNP:78560075
3125 3125 g, t dbSNP:529734340
3137 3137 a, g dbSNP:138756291
3155 3155 g, t dbSNP:760941132
3167 3167 a, g dbSNP:766750148
3169 3169 c, g dbSNP:769055116
3221 3221 c, t dbSNP:76291069
3236 3236 a, g dbSNP:74003037
3254 3254 -, g dbSNP:765252878
3279 3279 c, t dbSNP:144433575
3288 3288 c, t dbSNP:566250204
3297 3297 c, t dbSNP:550576606
3300 3300 a, g dbSNP:748644397
3322 3322 c, t dbSNP:759751812
3323 3323 a, g dbSNP:376035884
3343 3343 c, t dbSNP:148393103
3344 3344 a, c, g dbSNP:141692563
3359 3359 g, t dbSNP:147153606
3370 3370 c, t dbSNP:183283033
3389 3389 a, c dbSNP:576938086
3394 3394 c, t dbSNP:770202665
3424 3424 c, t dbSNP:545861137
3449 3449 a, t dbSNP:559396383
3457 3457 c, t dbSNP:28679688
3549 3549 -, tgc dbSNP:149315179
3577 3577 a, g dbSNP:540817771
3590 3590 c, t dbSNP:561282155
3712 3712 a, g dbSNP:370396602
3724 3724 c, t dbSNP:367998725
3736 3736 c, g dbSNP:529898940
3760 3760 c, t dbSNP:549760673
3777 3777 c, g dbSNP:373772013
3780 3780 c, g dbSNP:372067195
3805 3805 a, c dbSNP:532266776
3877 3877 c, t dbSNP:552329672
3878 3878 a, g dbSNP:4786296
3890 3890 a, g dbSNP:565767072
3920 3920 c, t dbSNP:535278860
3971 3971 g, t dbSNP:4786297
3986 3986 c, g dbSNP:548496512
4021 4021 a, g dbSNP:568740588
4025 4025 a, g dbSNP:147975625
4047 4047 -, gtcctgtgtctccat dbSNP:370970044
4047 4047 g, t dbSNP:537310185
4063 4063 g, t dbSNP:557345495
4095 4095 a, g dbSNP:187363186
4107 4107 c, g dbSNP:28457160
4108 4108 a, g dbSNP:535074412
4109 4109 a, g dbSNP:572997169
4139 4139 g, t dbSNP:113716221
4156 4156 c, t dbSNP:541222591
4170 4170 c, t dbSNP:190975527
4175 4175 c, t dbSNP:574692618
4176 4176 a, g dbSNP:543323513
4186 4186 c, t dbSNP:563577752
4260 4260 a, g dbSNP:113054936
4269 4269 c, t dbSNP:532181910
4291 4291 a, g dbSNP:28615548
4300 4300 c, t dbSNP:775324213
4312 4312 c, t dbSNP:565667834
4319 4319 c, t dbSNP:372950862
4326 4326 c, t dbSNP:559538467
4329 4329 c, t dbSNP:534714693
4363 4363 c, t dbSNP:548777339
4381 4381 c, t dbSNP:149131034
4398 4398 c, t dbSNP:531109247
4426 4426 c, t dbSNP:551022507
4449 4449 c, g dbSNP:71386681
4471 4471 c, t dbSNP:570799401
4481 4481 g, t dbSNP:539495695
4486 4486 a, g dbSNP:552900581
4494 4494 a, g dbSNP:566632715
4514 4514 a, g dbSNP:535544455
4527 4527 c, t dbSNP:558027230
4528 4528 g, t dbSNP:577872209
4562 4562 -, a dbSNP:199508475
4636 4636 c, t dbSNP:554773031
4652 4652 a, g dbSNP:574574151
4654 4654 c, g, t dbSNP:543744889
4663 4663 a, c dbSNP:557336688
4669 4669 c, t dbSNP:147659496
4686 4686 c, t dbSNP:577209776
4692 4692 c, t dbSNP:545819504
4794 4794 a, g dbSNP:559353007
5038 5038 c, t dbSNP:528209602
5069 5069 c, t dbSNP:541587272
5082 5082 -, c dbSNP:534151146
5124 5124 c, t dbSNP:561803954
5139 5139 a, g dbSNP:531050862
5190 5190 c, t dbSNP:551150791
5191 5191 a, g dbSNP:570813362
5198 5198 a, c dbSNP:533404808
5200 5200 c, t dbSNP:546604706
5208 5208 -, tcg dbSNP:753607913
5284 5284 a, g dbSNP:566501788
5325 5325 c, t dbSNP:557265376
5343 5343 -, aa dbSNP:58747637
5343 5343 a, t dbSNP:535820869
5388 5388 a, g dbSNP:182763560
5411 5411 c, t dbSNP:61080418
5421 5421 -, c dbSNP:764729763
5422 5422 c, t dbSNP:569327197
5424 5424 c, g dbSNP:573995032
5449 5449 c, t dbSNP:536897617
5498 5498 a, g dbSNP:187478880
5506 5506 a, g dbSNP:577221830
5513 5513 c, t dbSNP:546088965
5517 5517 a, c dbSNP:761743692
5519 5519 c, g dbSNP:3112704
5519 5519 c, g dbSNP:112319026
5522 5522 a, c dbSNP:191845035
5527 5527 a, g dbSNP:144753105
5543 5543 g, t dbSNP:561678389
5549 5549 c, t dbSNP:575253021
5559 5559 c, t dbSNP:544409330
5580 5580 a, g dbSNP:182493826
5585 5585 a, g dbSNP:533467818
5586 5586 c, t dbSNP:546919073
5659 5659 c, t dbSNP:556685997
5666 5666 a, c, t dbSNP:559677768
5676 5676 c, t dbSNP:11554593
5702 5702 c, g, t dbSNP:769734148
5709 5709 c, g dbSNP:549358180
5740 5740 c, t dbSNP:112703875
5763 5763 c, g dbSNP:539534788
5765 5765 a, g dbSNP:538298991
5785 5785 g, t dbSNP:751576674
5786 5786 c, t dbSNP:750511319
5787 5787 a, g dbSNP:757123594
5802 5802 c, t dbSNP:767388984
5811 5811 c, t dbSNP:550813362
5813 5813 a, t dbSNP:750180444
5818 5818 a, c dbSNP:373860725
5820 5820 a, t dbSNP:573302563
5823 5823 c, t dbSNP:766162407
5859 5859 a, t dbSNP:570686169
5875 5875 c, t dbSNP:539624769
5912 5912 a, c dbSNP:367757589
5921 5921 a, g dbSNP:371321013
5926 5926 c, t dbSNP:779625508
5933 5933 g, t dbSNP:368594243
5943 5943 -, tt dbSNP:545088750
5958 5958 a, g dbSNP:535107274
5959 5959 c, t dbSNP:773937993
6006 6006 -, gtgggg dbSNP:33994421
6071 6071 g, t dbSNP:555301555
6087 6087 c, g dbSNP:575259088
6097 6097 c, t dbSNP:543874303
6110 6110 -, c dbSNP:552798143
6111 6111 -, c dbSNP:565144559
6116 6116 a, c dbSNP:563817322
6117 6117 c, g dbSNP:56318884
6118 6118 -, c dbSNP:376887169
6147 6147 c, t dbSNP:550881899
6157 6157 a, g dbSNP:2335110
6210 6210 a, t dbSNP:561386521
6226 6226 a, t dbSNP:560670835
6237 6237 a, g dbSNP:187543589
6260 6260 c, g dbSNP:549120788
6262 6262 c, t dbSNP:2335111
6264 6264 c, t dbSNP:137906061
6307 6307 c, t dbSNP:755221626
6308 6308 a, g dbSNP:530400633
6347 6347 c, t dbSNP:551935898
6378 6378 c, g dbSNP:3095103
6401 6401 c, t dbSNP:539689181
6402 6402 a, g dbSNP:369381082
6433 6433 a, t dbSNP:565662700
6457 6457 a, g dbSNP:376666016
6473 6473 g, t dbSNP:566661760
6476 6476 c, t dbSNP:185737005
6486 6486 a, c dbSNP:190542981
6503 6503 c, g dbSNP:555090482
6515 6515 a, g dbSNP:754582678
6524 6524 -, a dbSNP:200815032
6554 6554 a, g dbSNP:200359888
6561 6561 a, g dbSNP:575224409
6592 6592 c, g dbSNP:537432131
6608 6608 c, g dbSNP:368831914
6620 6620 a, g dbSNP:557471998
6662 6662 g, t dbSNP:577316175
6721 6721 c, t dbSNP:540431729
6722 6722 c, g dbSNP:748479536
6742 6742 c, t dbSNP:371727709
6743 6743 a, g dbSNP:929457
6779 6779 a, g dbSNP:201156361
6795 6795 c, t dbSNP:534430467
6831 6831 a, g dbSNP:575136663
6844 6844 a, g dbSNP:184540154
6845 6845 c, t dbSNP:189062814
6861 6861 c, t dbSNP:778213681
6896 6896 g, t dbSNP:745355644
6898 6898 c, t dbSNP:545414930
6903 6903 -, gtaa dbSNP:5815128
6906 6906 -, agta dbSNP:3030674
6906 6906 -, gtaa dbSNP:761147047
6913 6913 c, t dbSNP:565379490
6977 6977 a, g dbSNP:527745262
6980 6980 a, g dbSNP:375159135
6991 6991 g, t dbSNP:566631892
7019 7019 a, g dbSNP:529055336
7020 7020 g, t dbSNP:549294670
7022 7022 a, g dbSNP:568802639
7024 7024 a, g dbSNP:537496663
7063 7063 -, tg dbSNP:771759264
7100 7100 c, t dbSNP:557285323
7120 7120 c, g dbSNP:571020949
7126 7126 g, t dbSNP:533610862
7136 7136 g, t dbSNP:554095762
7152 7152 a, t dbSNP:545626630
7156 7156 a, g dbSNP:574208711
7172 7172 a, g dbSNP:542840852
7173 7173 -, ttg dbSNP:540470378
7183 7183 c, g dbSNP:553056589
7194 7194 -, tg dbSNP:201869822
7209 7209 a, c dbSNP:748736402
7243 7243 c, t dbSNP:556860773
7323 7323 a, g dbSNP:11554591
7374 7374 g, t dbSNP:772425944
7391 7391 c, t dbSNP:576761849
7392 7392 -, t, tt dbSNP:111618468
7394 7394 a, g dbSNP:11554592
7399 7399 c, g, t dbSNP:181213412
7403 7403 -, tc dbSNP:201698119
7410 7410 a, c dbSNP:527809139
7421 7421 a, g dbSNP:557863257
7423 7423 a, g dbSNP:185318792
7447 7447 a, t dbSNP:189105574
7455 7455 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_011522522
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu48855D
Sequence Information ORF Nucleotide Sequence (Length: 1590bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)483..1271(+)
Misc Feature(2)489..1271(+)
Misc Feature(3)507..1094(+)
Misc Feature(4)507..914(+)
Misc Feature(5)519..1094(+)
Misc Feature(6)909..986(+)
Misc Feature(7)1566..1886(+)
Misc Feature(8)1638..1808(+)
Position Chain Variation Link
11 11 c, t dbSNP:554386561
29 29 a, g dbSNP:574291369
62 62 c, t dbSNP:756230861
130 130 g, t dbSNP:375222208
132 132 c, g dbSNP:751427856
143 143 c, g dbSNP:759476910
148 148 c, t dbSNP:368581424
160 160 g, t dbSNP:751645751
179 179 g, t dbSNP:767501518
199 199 a, t dbSNP:752718167
228 228 a, g dbSNP:756261088
256 256 a, g dbSNP:777838874
269 269 a, g dbSNP:187474021
296 296 c, t dbSNP:61747742
301 301 -, tgt dbSNP:750485483
331 331 c, t dbSNP:772871628
356 356 a, g dbSNP:762649804
367 367 c, t dbSNP:55824600
380 380 c, t dbSNP:770708494
392 392 c, t dbSNP:539550094
395 395 c, t dbSNP:759430577
396 396 a, g dbSNP:767328553
401 401 c, t dbSNP:752733022
411 411 c, g dbSNP:760555326
413 413 c, t dbSNP:553067229
414 414 a, g dbSNP:753919385
420 420 c, t dbSNP:757413961
421 421 a, g dbSNP:779166111
423 423 c, t dbSNP:750784265
425 425 c, t dbSNP:573496896
426 426 a, g dbSNP:780402170
428 428 c, t dbSNP:747501354
429 429 a, g dbSNP:769074523
431 431 c, t dbSNP:777349106
432 432 a, g dbSNP:748817353
435 435 g, t dbSNP:770692110
439 439 a, t dbSNP:774190389
443 443 a, g dbSNP:759232667
448 448 c, t dbSNP:771854875
456 456 c, g, t dbSNP:775183994
457 457 c, t dbSNP:535696352
458 458 a, g dbSNP:776681039
460 460 c, t dbSNP:761949625
461 461 a, g dbSNP:765411861
469 469 a, g dbSNP:750705121
476 476 a, g dbSNP:372064092
477 477 c, t dbSNP:766725088
478 478 a, g dbSNP:751870190
480 480 a, c, g dbSNP:755452051
483 483 c, g dbSNP:748800896
486 486 a, g dbSNP:756879724
488 488 c, t dbSNP:778591061
493 493 a, g dbSNP:745496613
503 503 a, g dbSNP:575887920
506 506 c, t dbSNP:758319
509 509 c, t dbSNP:775298281
514 514 -, a dbSNP:780646954
518 518 -, ct dbSNP:747519638
519 519 g, t dbSNP:746838429
527 527 a, c dbSNP:146388630
530 530 a, g dbSNP:776593118
622 622 a, g dbSNP:551607067
698 698 -, cgac dbSNP:748593314
700 700 a, t dbSNP:748035328
701 701 c, t dbSNP:769723811
773 773 a, g dbSNP:2041206
965 965 c, g dbSNP:764571812
971 971 c, t dbSNP:749948247
980 980 a, g dbSNP:574452215
982 982 c, t dbSNP:757889593
986 986 a, g dbSNP:543688348
990 990 a, g dbSNP:370069297
999 999 a, g dbSNP:373278831
1001 1001 a, g dbSNP:139543796
1004 1004 a, g dbSNP:780894116
1009 1009 c, t dbSNP:144186731
1018 1018 c, t dbSNP:769705993
1019 1019 c, t dbSNP:200735205
1020 1020 a, g dbSNP:749355083
1378 1378 a, g dbSNP:755812280
1383 1383 c, g dbSNP:763731140
1391 1391 g, t dbSNP:561462097
1399 1399 a, g dbSNP:753681549
1405 1405 a, g dbSNP:370279457
1414 1414 c, t dbSNP:779064858
1415 1415 c, g dbSNP:377095764
1418 1418 c, g dbSNP:758602254
1423 1423 c, g dbSNP:200076126
1432 1432 c, g dbSNP:780305703
1433 1433 c, t dbSNP:747157063
1434 1434 c, g dbSNP:768924605
1435 1435 g, t dbSNP:776800040
1436 1436 a, g dbSNP:748599366
1438 1438 c, t dbSNP:370494924
1445 1445 c, t dbSNP:773747255
1448 1448 c, t dbSNP:759022782
1449 1449 a, g dbSNP:76887737
1450 1450 c, t dbSNP:75824263
1451 1451 a, c, g, t dbSNP:75077217
1453 1453 a, g dbSNP:139732994
1455 1455 c, t dbSNP:201780963
1459 1459 a, c dbSNP:535986266
1460 1460 c, g dbSNP:750340247
1468 1468 c, t dbSNP:758443705
1473 1473 a, g dbSNP:780213417
1475 1475 c, t dbSNP:747123753
1476 1476 a, c dbSNP:755138312
1477 1477 a, g dbSNP:149931764
1487 1487 a, g dbSNP:748428723
1489 1489 a, g dbSNP:770192179
1490 1490 c, t dbSNP:778131329
1496 1496 c, t dbSNP:532663585
1498 1498 a, g dbSNP:771442872
1499 1499 c, t dbSNP:774850892
1500 1500 c, t dbSNP:760300604
1507 1507 c, t dbSNP:547797391
1508 1508 a, c, g dbSNP:768166848
1511 1511 c, t dbSNP:761396833
1513 1513 c, g dbSNP:765088097
1525 1525 a, t dbSNP:552355299
1530 1530 c, g dbSNP:145034828
1538 1538 c, t dbSNP:766478163
1539 1539 a, g dbSNP:751583488
1544 1544 c, t dbSNP:145594574
1552 1552 a, g dbSNP:374111988
1554 1554 c, t dbSNP:752913176
1560 1560 c, t dbSNP:756358328
1563 1563 g, t dbSNP:142153837
1564 1564 a, t dbSNP:749712375
1577 1577 c, t dbSNP:771424447
1579 1579 g, t dbSNP:533780852
1605 1605 a, g dbSNP:374649760
1611 1611 c, t dbSNP:777350674
1641 1641 c, t dbSNP:753410336
1658 1658 a, g dbSNP:535332245
1676 1676 c, g dbSNP:773372279
1682 1682 a, g dbSNP:763017868
1697 1697 a, g dbSNP:771291308
1700 1700 c, t dbSNP:774842989
1703 1703 c, t dbSNP:760019244
1716 1716 a, g dbSNP:768116696
1717 1717 a, t dbSNP:775814028
1734 1734 a, g dbSNP:761277571
1750 1750 a, g dbSNP:764588339
1754 1754 a, t dbSNP:749966481
1767 1767 a, g dbSNP:758036081
1786 1786 a, t dbSNP:766091042
1798 1798 c, t dbSNP:549158095
1799 1799 a, g dbSNP:751320393
1805 1805 c, t dbSNP:752547402
1811 1811 a, g, t dbSNP:755991413
1823 1823 a, g dbSNP:749357936
1832 1832 c, t dbSNP:147843249
1838 1838 c, t dbSNP:141143951
1854 1854 a, c dbSNP:143425561
1868 1868 c, g dbSNP:551293304
1869 1869 a, g dbSNP:772355571
1877 1877 a, g dbSNP:775707536
1882 1882 a, g dbSNP:148008907
1898 1898 a, g dbSNP:747477279
1901 1901 c, t dbSNP:201375554
1904 1904 c, t dbSNP:201646295
1905 1905 a, g dbSNP:201983709
1913 1913 a, g dbSNP:770386112
1917 1917 c, t dbSNP:141708903
1918 1918 g, t dbSNP:759130714
1926 1926 c, t dbSNP:567030364
1927 1927 a, g dbSNP:371050359
1930 1930 c, t dbSNP:760558101
1931 1931 a, g dbSNP:375625632
1942 1942 c, t dbSNP:753787792
1943 1943 a, g, t dbSNP:757267684
1944 1944 c, t dbSNP:750591733
1948 1948 c, t dbSNP:758548197
1949 1949 a, g dbSNP:775000968
1951 1951 a, g dbSNP:747310334
1957 1957 c, t dbSNP:763407617
1961 1961 c, t dbSNP:769012428
1964 1964 g, t dbSNP:781565770
1965 1965 c, t dbSNP:748585190
1966 1966 a, g dbSNP:770298078
1967 1967 c, t dbSNP:368140738
1968 1968 a, g dbSNP:111905533
1969 1969 g, t dbSNP:374100568
1983 1983 c, t dbSNP:759166098
1990 1990 c, t dbSNP:576603878
2024 2024 c, t dbSNP:10866
2061 2061 a, g dbSNP:3087784
2066 2066 a, g dbSNP:559332782
2076 2076 a, c dbSNP:563682651
2101 2101 a, g dbSNP:375635017
2103 2103 c, g dbSNP:776687154
2117 2117 a, g dbSNP:762295195
2147 2147 g, t dbSNP:767628948
2152 2152 a, t dbSNP:572774850
2155 2155 c, g dbSNP:752529981
2185 2185 c, g dbSNP:529226935
2192 2192 c, g dbSNP:148121766
2199 2199 a, c dbSNP:561226269
2212 2212 c, t dbSNP:140982354
2218 2218 c, t dbSNP:13335284
2219 2219 a, g dbSNP:369818229
2222 2222 c, t dbSNP:374470586
2254 2254 g, t dbSNP:371038846
2280 2280 g, t dbSNP:563611183
2287 2287 c, t dbSNP:543128805
2295 2295 a, g dbSNP:531570429
2316 2316 a, g dbSNP:528250860
2325 2325 g, t dbSNP:189787811
2346 2346 c, t dbSNP:754005480
2361 2361 a, g dbSNP:753864539
2401 2401 a, g dbSNP:571210384
2404 2404 c, t dbSNP:758382220
2411 2411 g, t dbSNP:181078294
2416 2416 -, cgggggccgcagctttgtgg dbSNP:374612917
2421 2421 a, g dbSNP:113332295
2425 2425 a, g dbSNP:547002823
2432 2432 a, t dbSNP:559554679
2446 2446 c, g dbSNP:751303008
2456 2456 a, c dbSNP:375417064
2496 2496 a, t dbSNP:535850233
2502 2502 a, t dbSNP:556257698
2526 2526 c, t dbSNP:780858375
2535 2535 g, t dbSNP:750481961
2543 2543 c, t dbSNP:185952911
2548 2548 c, t dbSNP:539284441
2552 2552 -, a dbSNP:560922224
2562 2562 a, g dbSNP:559150292
2564 2564 a, g dbSNP:572787105
2627 2627 a, g dbSNP:541712873
2648 2648 c, g dbSNP:79745244
2673 2673 g, t dbSNP:574807920
2685 2685 c, g dbSNP:745471795
2693 2693 a, t dbSNP:528570052
2704 2704 c, t dbSNP:138049982
2720 2720 c, t dbSNP:769465822
2733 2733 a, g dbSNP:563848860
2747 2747 c, t dbSNP:779506921
2752 2752 c, g dbSNP:748844927
2799 2799 g, t dbSNP:71386677
2803 2803 c, g dbSNP:142512073
2850 2850 a, g dbSNP:762232443
2862 2862 a, g dbSNP:564701168
2916 2916 c, t dbSNP:190327635
2927 2927 -, a dbSNP:571502069
2954 2954 a, g dbSNP:547314582
2961 2961 c, t dbSNP:78560075
2970 2970 g, t dbSNP:529734340
2982 2982 a, g dbSNP:138756291
3000 3000 g, t dbSNP:760941132
3012 3012 a, g dbSNP:766750148
3014 3014 c, g dbSNP:769055116
3066 3066 c, t dbSNP:76291069
3081 3081 a, g dbSNP:74003037
3099 3099 -, g dbSNP:765252878
3124 3124 c, t dbSNP:144433575
3133 3133 c, t dbSNP:566250204
3142 3142 c, t dbSNP:550576606
3145 3145 a, g dbSNP:748644397
3167 3167 c, t dbSNP:759751812
3168 3168 a, g dbSNP:376035884
3188 3188 c, t dbSNP:148393103
3189 3189 a, c, g dbSNP:141692563
3204 3204 g, t dbSNP:147153606
3215 3215 c, t dbSNP:183283033
3234 3234 a, c dbSNP:576938086
3239 3239 c, t dbSNP:770202665
3269 3269 c, t dbSNP:545861137
3294 3294 a, t dbSNP:559396383
3302 3302 c, t dbSNP:28679688
3394 3394 -, tgc dbSNP:149315179
3422 3422 a, g dbSNP:540817771
3435 3435 c, t dbSNP:561282155
3557 3557 a, g dbSNP:370396602
3569 3569 c, t dbSNP:367998725
3581 3581 c, g dbSNP:529898940
3605 3605 c, t dbSNP:549760673
3622 3622 c, g dbSNP:373772013
3625 3625 c, g dbSNP:372067195
3650 3650 a, c dbSNP:532266776
3722 3722 c, t dbSNP:552329672
3723 3723 a, g dbSNP:4786296
3735 3735 a, g dbSNP:565767072
3765 3765 c, t dbSNP:535278860
3816 3816 g, t dbSNP:4786297
3831 3831 c, g dbSNP:548496512
3866 3866 a, g dbSNP:568740588
3870 3870 a, g dbSNP:147975625
3892 3892 -, gtcctgtgtctccat dbSNP:370970044
3892 3892 g, t dbSNP:537310185
3908 3908 g, t dbSNP:557345495
3940 3940 a, g dbSNP:187363186
3952 3952 c, g dbSNP:28457160
3953 3953 a, g dbSNP:535074412
3954 3954 a, g dbSNP:572997169
3984 3984 g, t dbSNP:113716221
4001 4001 c, t dbSNP:541222591
4015 4015 c, t dbSNP:190975527
4020 4020 c, t dbSNP:574692618
4021 4021 a, g dbSNP:543323513
4031 4031 c, t dbSNP:563577752
4105 4105 a, g dbSNP:113054936
4114 4114 c, t dbSNP:532181910
4136 4136 a, g dbSNP:28615548
4145 4145 c, t dbSNP:775324213
4157 4157 c, t dbSNP:565667834
4164 4164 c, t dbSNP:372950862
4171 4171 c, t dbSNP:559538467
4174 4174 c, t dbSNP:534714693
4208 4208 c, t dbSNP:548777339
4226 4226 c, t dbSNP:149131034
4243 4243 c, t dbSNP:531109247
4271 4271 c, t dbSNP:551022507
4294 4294 c, g dbSNP:71386681
4316 4316 c, t dbSNP:570799401
4326 4326 g, t dbSNP:539495695
4331 4331 a, g dbSNP:552900581
4339 4339 a, g dbSNP:566632715
4359 4359 a, g dbSNP:535544455
4372 4372 c, t dbSNP:558027230
4373 4373 g, t dbSNP:577872209
4407 4407 -, a dbSNP:199508475
4481 4481 c, t dbSNP:554773031
4497 4497 a, g dbSNP:574574151
4499 4499 c, g, t dbSNP:543744889
4508 4508 a, c dbSNP:557336688
4514 4514 c, t dbSNP:147659496
4531 4531 c, t dbSNP:577209776
4537 4537 c, t dbSNP:545819504
4639 4639 a, g dbSNP:559353007
4883 4883 c, t dbSNP:528209602
4914 4914 c, t dbSNP:541587272
4927 4927 -, c dbSNP:534151146
4969 4969 c, t dbSNP:561803954
4984 4984 a, g dbSNP:531050862
5035 5035 c, t dbSNP:551150791
5036 5036 a, g dbSNP:570813362
5043 5043 a, c dbSNP:533404808
5045 5045 c, t dbSNP:546604706
5053 5053 -, tcg dbSNP:753607913
5129 5129 a, g dbSNP:566501788
5170 5170 c, t dbSNP:557265376
5188 5188 -, aa dbSNP:58747637
5188 5188 a, t dbSNP:535820869
5233 5233 a, g dbSNP:182763560
5256 5256 c, t dbSNP:61080418
5266 5266 -, c dbSNP:764729763
5267 5267 c, t dbSNP:569327197
5269 5269 c, g dbSNP:573995032
5294 5294 c, t dbSNP:536897617
5343 5343 a, g dbSNP:187478880
5351 5351 a, g dbSNP:577221830
5358 5358 c, t dbSNP:546088965
5362 5362 a, c dbSNP:761743692
5364 5364 c, g dbSNP:3112704
5364 5364 c, g dbSNP:112319026
5367 5367 a, c dbSNP:191845035
5372 5372 a, g dbSNP:144753105
5388 5388 g, t dbSNP:561678389
5394 5394 c, t dbSNP:575253021
5404 5404 c, t dbSNP:544409330
5425 5425 a, g dbSNP:182493826
5430 5430 a, g dbSNP:533467818
5431 5431 c, t dbSNP:546919073
5504 5504 c, t dbSNP:556685997
5511 5511 a, c, t dbSNP:559677768
5521 5521 c, t dbSNP:11554593
5547 5547 c, g, t dbSNP:769734148
5554 5554 c, g dbSNP:549358180
5585 5585 c, t dbSNP:112703875
5608 5608 c, g dbSNP:539534788
5610 5610 a, g dbSNP:538298991
5630 5630 g, t dbSNP:751576674
5631 5631 c, t dbSNP:750511319
5632 5632 a, g dbSNP:757123594
5647 5647 c, t dbSNP:767388984
5656 5656 c, t dbSNP:550813362
5658 5658 a, t dbSNP:750180444
5663 5663 a, c dbSNP:373860725
5665 5665 a, t dbSNP:573302563
5668 5668 c, t dbSNP:766162407
5704 5704 a, t dbSNP:570686169
5720 5720 c, t dbSNP:539624769
5757 5757 a, c dbSNP:367757589
5766 5766 a, g dbSNP:371321013
5771 5771 c, t dbSNP:779625508
5778 5778 g, t dbSNP:368594243
5788 5788 -, tt dbSNP:545088750
5803 5803 a, g dbSNP:535107274
5804 5804 c, t dbSNP:773937993
5851 5851 -, gtgggg dbSNP:33994421
5916 5916 g, t dbSNP:555301555
5932 5932 c, g dbSNP:575259088
5942 5942 c, t dbSNP:543874303
5955 5955 -, c dbSNP:552798143
5956 5956 -, c dbSNP:565144559
5961 5961 a, c dbSNP:563817322
5962 5962 c, g dbSNP:56318884
5963 5963 -, c dbSNP:376887169
5992 5992 c, t dbSNP:550881899
6002 6002 a, g dbSNP:2335110
6055 6055 a, t dbSNP:561386521
6071 6071 a, t dbSNP:560670835
6082 6082 a, g dbSNP:187543589
6105 6105 c, g dbSNP:549120788
6107 6107 c, t dbSNP:2335111
6109 6109 c, t dbSNP:137906061
6152 6152 c, t dbSNP:755221626
6153 6153 a, g dbSNP:530400633
6192 6192 c, t dbSNP:551935898
6223 6223 c, g dbSNP:3095103
6246 6246 c, t dbSNP:539689181
6247 6247 a, g dbSNP:369381082
6278 6278 a, t dbSNP:565662700
6302 6302 a, g dbSNP:376666016
6318 6318 g, t dbSNP:566661760
6321 6321 c, t dbSNP:185737005
6331 6331 a, c dbSNP:190542981
6348 6348 c, g dbSNP:555090482
6360 6360 a, g dbSNP:754582678
6369 6369 -, a dbSNP:200815032
6399 6399 a, g dbSNP:200359888
6406 6406 a, g dbSNP:575224409
6437 6437 c, g dbSNP:537432131
6453 6453 c, g dbSNP:368831914
6465 6465 a, g dbSNP:557471998
6507 6507 g, t dbSNP:577316175
6566 6566 c, t dbSNP:540431729
6567 6567 c, g dbSNP:748479536
6587 6587 c, t dbSNP:371727709
6588 6588 a, g dbSNP:929457
6624 6624 a, g dbSNP:201156361
6640 6640 c, t dbSNP:534430467
6676 6676 a, g dbSNP:575136663
6689 6689 a, g dbSNP:184540154
6690 6690 c, t dbSNP:189062814
6706 6706 c, t dbSNP:778213681
6741 6741 g, t dbSNP:745355644
6743 6743 c, t dbSNP:545414930
6748 6748 -, gtaa dbSNP:5815128
6751 6751 -, agta dbSNP:3030674
6751 6751 -, gtaa dbSNP:761147047
6758 6758 c, t dbSNP:565379490
6822 6822 a, g dbSNP:527745262
6825 6825 a, g dbSNP:375159135
6836 6836 g, t dbSNP:566631892
6864 6864 a, g dbSNP:529055336
6865 6865 g, t dbSNP:549294670
6867 6867 a, g dbSNP:568802639
6869 6869 a, g dbSNP:537496663
6908 6908 -, tg dbSNP:771759264
6945 6945 c, t dbSNP:557285323
6965 6965 c, g dbSNP:571020949
6971 6971 g, t dbSNP:533610862
6981 6981 g, t dbSNP:554095762
6997 6997 a, t dbSNP:545626630
7001 7001 a, g dbSNP:574208711
7017 7017 a, g dbSNP:542840852
7018 7018 -, ttg dbSNP:540470378
7028 7028 c, g dbSNP:553056589
7039 7039 -, tg dbSNP:201869822
7054 7054 a, c dbSNP:748736402
7088 7088 c, t dbSNP:556860773
7168 7168 a, g dbSNP:11554591
7219 7219 g, t dbSNP:772425944
7236 7236 c, t dbSNP:576761849
7237 7237 -, t, tt dbSNP:111618468
7239 7239 a, g dbSNP:11554592
7244 7244 c, g, t dbSNP:181213412
7248 7248 -, tc dbSNP:201698119
7255 7255 a, c dbSNP:527809139
7266 7266 a, g dbSNP:557863257
7268 7268 a, g dbSNP:185318792
7292 7292 a, t dbSNP:189105574
7300 7300 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_005255356
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59608D
Sequence Information ORF Nucleotide Sequence (Length: 1392bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1289..1693(+)
Misc Feature(2)1988..2308(+)
Misc Feature(3)2060..2230(+)
Position Chain Variation Link
236 236 c, t dbSNP:547040445
255 255 c, g dbSNP:374019322
262 262 c, g dbSNP:561153470
272 272 -, gatt dbSNP:150836742
331 331 c, t dbSNP:530277736
351 351 a, g dbSNP:376949540
355 355 a, g dbSNP:550228970
372 372 a, g dbSNP:570354791
402 402 a, c dbSNP:111439925
425 425 a, g dbSNP:538947141
522 522 c, t dbSNP:552643682
546 546 a, c dbSNP:566033938
576 576 a, c dbSNP:780121126
580 580 a, c dbSNP:535133318
894 894 a, g dbSNP:555066937
909 909 g, t dbSNP:573906874
1099 1099 c, t dbSNP:61747742
1104 1104 -, tgt dbSNP:750485483
1134 1134 c, t dbSNP:772871628
1159 1159 a, g dbSNP:762649804
1170 1170 c, t dbSNP:55824600
1183 1183 c, t dbSNP:770708494
1195 1195 c, t dbSNP:539550094
1198 1198 c, t dbSNP:759430577
1199 1199 a, g dbSNP:767328553
1204 1204 c, t dbSNP:752733022
1214 1214 c, g dbSNP:760555326
1216 1216 c, t dbSNP:553067229
1217 1217 a, g dbSNP:753919385
1223 1223 c, t dbSNP:757413961
1224 1224 a, g dbSNP:779166111
1226 1226 c, t dbSNP:750784265
1228 1228 c, t dbSNP:573496896
1229 1229 a, g dbSNP:780402170
1231 1231 c, t dbSNP:747501354
1232 1232 a, g dbSNP:769074523
1234 1234 c, t dbSNP:777349106
1235 1235 a, g dbSNP:748817353
1238 1238 g, t dbSNP:770692110
1242 1242 a, t dbSNP:774190389
1246 1246 a, g dbSNP:759232667
1251 1251 c, t dbSNP:771854875
1259 1259 c, g, t dbSNP:775183994
1260 1260 c, t dbSNP:535696352
1261 1261 a, g dbSNP:776681039
1263 1263 c, t dbSNP:761949625
1264 1264 a, g dbSNP:765411861
1272 1272 a, g dbSNP:750705121
1279 1279 a, g dbSNP:372064092
1280 1280 c, t dbSNP:766725088
1281 1281 a, g dbSNP:751870190
1283 1283 a, c, g dbSNP:755452051
1286 1286 c, g dbSNP:748800896
1289 1289 a, g dbSNP:756879724
1291 1291 c, t dbSNP:778591061
1296 1296 a, g dbSNP:745496613
1306 1306 a, g dbSNP:575887920
1309 1309 c, t dbSNP:758319
1312 1312 c, t dbSNP:775298281
1317 1317 -, a dbSNP:780646954
1321 1321 -, ct dbSNP:747519638
1322 1322 g, t dbSNP:746838429
1330 1330 a, c dbSNP:146388630
1333 1333 a, g dbSNP:776593118
1387 1387 c, g dbSNP:764571812
1393 1393 c, t dbSNP:749948247
1402 1402 a, g dbSNP:574452215
1404 1404 c, t dbSNP:757889593
1408 1408 a, g dbSNP:543688348
1412 1412 a, g dbSNP:370069297
1421 1421 a, g dbSNP:373278831
1423 1423 a, g dbSNP:139543796
1426 1426 a, g dbSNP:780894116
1431 1431 c, t dbSNP:144186731
1440 1440 c, t dbSNP:769705993
1441 1441 c, t dbSNP:200735205
1442 1442 a, g dbSNP:749355083
1800 1800 a, g dbSNP:755812280
1805 1805 c, g dbSNP:763731140
1813 1813 g, t dbSNP:561462097
1821 1821 a, g dbSNP:753681549
1827 1827 a, g dbSNP:370279457
1836 1836 c, t dbSNP:779064858
1837 1837 c, g dbSNP:377095764
1840 1840 c, g dbSNP:758602254
1845 1845 c, g dbSNP:200076126
1854 1854 c, g dbSNP:780305703
1855 1855 c, t dbSNP:747157063
1856 1856 c, g dbSNP:768924605
1857 1857 g, t dbSNP:776800040
1858 1858 a, g dbSNP:748599366
1860 1860 c, t dbSNP:370494924
1867 1867 c, t dbSNP:773747255
1870 1870 c, t dbSNP:759022782
1871 1871 a, g dbSNP:76887737
1872 1872 c, t dbSNP:75824263
1873 1873 a, c, g, t dbSNP:75077217
1875 1875 a, g dbSNP:139732994
1877 1877 c, t dbSNP:201780963
1881 1881 a, c dbSNP:535986266
1882 1882 c, g dbSNP:750340247
1890 1890 c, t dbSNP:758443705
1895 1895 a, g dbSNP:780213417
1897 1897 c, t dbSNP:747123753
1898 1898 a, c dbSNP:755138312
1899 1899 a, g dbSNP:149931764
1909 1909 a, g dbSNP:748428723
1911 1911 a, g dbSNP:770192179
1912 1912 c, t dbSNP:778131329
1918 1918 c, t dbSNP:532663585
1920 1920 a, g dbSNP:771442872
1921 1921 c, t dbSNP:774850892
1922 1922 c, t dbSNP:760300604
1929 1929 c, t dbSNP:547797391
1930 1930 a, c, g dbSNP:768166848
1933 1933 c, t dbSNP:761396833
1935 1935 c, g dbSNP:765088097
1947 1947 a, t dbSNP:552355299
1952 1952 c, g dbSNP:145034828
1960 1960 c, t dbSNP:766478163
1961 1961 a, g dbSNP:751583488
1966 1966 c, t dbSNP:145594574
1974 1974 a, g dbSNP:374111988
1976 1976 c, t dbSNP:752913176
1982 1982 c, t dbSNP:756358328
1985 1985 g, t dbSNP:142153837
1986 1986 a, t dbSNP:749712375
1999 1999 c, t dbSNP:771424447
2001 2001 g, t dbSNP:533780852
2027 2027 a, g dbSNP:374649760
2033 2033 c, t dbSNP:777350674
2063 2063 c, t dbSNP:753410336
2080 2080 a, g dbSNP:535332245
2098 2098 c, g dbSNP:773372279
2104 2104 a, g dbSNP:763017868
2119 2119 a, g dbSNP:771291308
2122 2122 c, t dbSNP:774842989
2125 2125 c, t dbSNP:760019244
2138 2138 a, g dbSNP:768116696
2139 2139 a, t dbSNP:775814028
2156 2156 a, g dbSNP:761277571
2172 2172 a, g dbSNP:764588339
2176 2176 a, t dbSNP:749966481
2189 2189 a, g dbSNP:758036081
2208 2208 a, t dbSNP:766091042
2220 2220 c, t dbSNP:549158095
2221 2221 a, g dbSNP:751320393
2227 2227 c, t dbSNP:752547402
2233 2233 a, g, t dbSNP:755991413
2245 2245 a, g dbSNP:749357936
2254 2254 c, t dbSNP:147843249
2260 2260 c, t dbSNP:141143951
2276 2276 a, c dbSNP:143425561
2290 2290 c, g dbSNP:551293304
2291 2291 a, g dbSNP:772355571
2299 2299 a, g dbSNP:775707536
2304 2304 a, g dbSNP:148008907
2320 2320 a, g dbSNP:747477279
2323 2323 c, t dbSNP:201375554
2326 2326 c, t dbSNP:201646295
2327 2327 a, g dbSNP:201983709
2335 2335 a, g dbSNP:770386112
2339 2339 c, t dbSNP:141708903
2340 2340 g, t dbSNP:759130714
2348 2348 c, t dbSNP:567030364
2349 2349 a, g dbSNP:371050359
2352 2352 c, t dbSNP:760558101
2353 2353 a, g dbSNP:375625632
2364 2364 c, t dbSNP:753787792
2365 2365 a, g, t dbSNP:757267684
2366 2366 c, t dbSNP:750591733
2370 2370 c, t dbSNP:758548197
2371 2371 a, g dbSNP:775000968
2373 2373 a, g dbSNP:747310334
2379 2379 c, t dbSNP:763407617
2383 2383 c, t dbSNP:769012428
2386 2386 g, t dbSNP:781565770
2387 2387 c, t dbSNP:748585190
2388 2388 a, g dbSNP:770298078
2389 2389 c, t dbSNP:368140738
2390 2390 a, g dbSNP:111905533
2391 2391 g, t dbSNP:374100568
2405 2405 c, t dbSNP:759166098
2412 2412 c, t dbSNP:576603878
2446 2446 c, t dbSNP:10866
2483 2483 a, g dbSNP:3087784
2488 2488 a, g dbSNP:559332782
2498 2498 a, c dbSNP:563682651
2523 2523 a, g dbSNP:375635017
2525 2525 c, g dbSNP:776687154
2539 2539 a, g dbSNP:762295195
2569 2569 g, t dbSNP:767628948
2574 2574 a, t dbSNP:572774850
2577 2577 c, g dbSNP:752529981
2607 2607 c, g dbSNP:529226935
2614 2614 c, g dbSNP:148121766
2621 2621 a, c dbSNP:561226269
2634 2634 c, t dbSNP:140982354
2640 2640 c, t dbSNP:13335284
2641 2641 a, g dbSNP:369818229
2644 2644 c, t dbSNP:374470586
2676 2676 g, t dbSNP:371038846
2702 2702 g, t dbSNP:563611183
2709 2709 c, t dbSNP:543128805
2717 2717 a, g dbSNP:531570429
2738 2738 a, g dbSNP:528250860
2747 2747 g, t dbSNP:189787811
2768 2768 c, t dbSNP:754005480
2783 2783 a, g dbSNP:753864539
2823 2823 a, g dbSNP:571210384
2826 2826 c, t dbSNP:758382220
2833 2833 g, t dbSNP:181078294
2838 2838 -, cgggggccgcagctttgtgg dbSNP:374612917
2843 2843 a, g dbSNP:113332295
2847 2847 a, g dbSNP:547002823
2854 2854 a, t dbSNP:559554679
2868 2868 c, g dbSNP:751303008
2878 2878 a, c dbSNP:375417064
2918 2918 a, t dbSNP:535850233
2924 2924 a, t dbSNP:556257698
2948 2948 c, t dbSNP:780858375
2957 2957 g, t dbSNP:750481961
2965 2965 c, t dbSNP:185952911
2970 2970 c, t dbSNP:539284441
2974 2974 -, a dbSNP:560922224
2984 2984 a, g dbSNP:559150292
2986 2986 a, g dbSNP:572787105
3049 3049 a, g dbSNP:541712873
3070 3070 c, g dbSNP:79745244
3095 3095 g, t dbSNP:574807920
3107 3107 c, g dbSNP:745471795
3115 3115 a, t dbSNP:528570052
3126 3126 c, t dbSNP:138049982
3142 3142 c, t dbSNP:769465822
3155 3155 a, g dbSNP:563848860
3169 3169 c, t dbSNP:779506921
3174 3174 c, g dbSNP:748844927
3221 3221 g, t dbSNP:71386677
3225 3225 c, g dbSNP:142512073
3272 3272 a, g dbSNP:762232443
3284 3284 a, g dbSNP:564701168
3338 3338 c, t dbSNP:190327635
3349 3349 -, a dbSNP:571502069
3376 3376 a, g dbSNP:547314582
3383 3383 c, t dbSNP:78560075
3392 3392 g, t dbSNP:529734340
3404 3404 a, g dbSNP:138756291
3422 3422 g, t dbSNP:760941132
3434 3434 a, g dbSNP:766750148
3436 3436 c, g dbSNP:769055116
3488 3488 c, t dbSNP:76291069
3503 3503 a, g dbSNP:74003037
3521 3521 -, g dbSNP:765252878
3546 3546 c, t dbSNP:144433575
3555 3555 c, t dbSNP:566250204
3564 3564 c, t dbSNP:550576606
3567 3567 a, g dbSNP:748644397
3589 3589 c, t dbSNP:759751812
3590 3590 a, g dbSNP:376035884
3610 3610 c, t dbSNP:148393103
3611 3611 a, c, g dbSNP:141692563
3626 3626 g, t dbSNP:147153606
3637 3637 c, t dbSNP:183283033
3656 3656 a, c dbSNP:576938086
3661 3661 c, t dbSNP:770202665
3691 3691 c, t dbSNP:545861137
3716 3716 a, t dbSNP:559396383
3724 3724 c, t dbSNP:28679688
3816 3816 -, tgc dbSNP:149315179
3844 3844 a, g dbSNP:540817771
3857 3857 c, t dbSNP:561282155
3979 3979 a, g dbSNP:370396602
3991 3991 c, t dbSNP:367998725
4003 4003 c, g dbSNP:529898940
4027 4027 c, t dbSNP:549760673
4044 4044 c, g dbSNP:373772013
4047 4047 c, g dbSNP:372067195
4072 4072 a, c dbSNP:532266776
4144 4144 c, t dbSNP:552329672
4145 4145 a, g dbSNP:4786296
4157 4157 a, g dbSNP:565767072
4187 4187 c, t dbSNP:535278860
4238 4238 g, t dbSNP:4786297
4253 4253 c, g dbSNP:548496512
4288 4288 a, g dbSNP:568740588
4292 4292 a, g dbSNP:147975625
4314 4314 -, gtcctgtgtctccat dbSNP:370970044
4314 4314 g, t dbSNP:537310185
4330 4330 g, t dbSNP:557345495
4362 4362 a, g dbSNP:187363186
4374 4374 c, g dbSNP:28457160
4375 4375 a, g dbSNP:535074412
4376 4376 a, g dbSNP:572997169
4406 4406 g, t dbSNP:113716221
4423 4423 c, t dbSNP:541222591
4437 4437 c, t dbSNP:190975527
4442 4442 c, t dbSNP:574692618
4443 4443 a, g dbSNP:543323513
4453 4453 c, t dbSNP:563577752
4527 4527 a, g dbSNP:113054936
4536 4536 c, t dbSNP:532181910
4558 4558 a, g dbSNP:28615548
4567 4567 c, t dbSNP:775324213
4579 4579 c, t dbSNP:565667834
4586 4586 c, t dbSNP:372950862
4593 4593 c, t dbSNP:559538467
4596 4596 c, t dbSNP:534714693
4630 4630 c, t dbSNP:548777339
4648 4648 c, t dbSNP:149131034
4665 4665 c, t dbSNP:531109247
4693 4693 c, t dbSNP:551022507
4716 4716 c, g dbSNP:71386681
4738 4738 c, t dbSNP:570799401
4748 4748 g, t dbSNP:539495695
4753 4753 a, g dbSNP:552900581
4761 4761 a, g dbSNP:566632715
4781 4781 a, g dbSNP:535544455
4794 4794 c, t dbSNP:558027230
4795 4795 g, t dbSNP:577872209
4829 4829 -, a dbSNP:199508475
4903 4903 c, t dbSNP:554773031
4919 4919 a, g dbSNP:574574151
4921 4921 c, g, t dbSNP:543744889
4930 4930 a, c dbSNP:557336688
4936 4936 c, t dbSNP:147659496
4953 4953 c, t dbSNP:577209776
4959 4959 c, t dbSNP:545819504
5061 5061 a, g dbSNP:559353007
5305 5305 c, t dbSNP:528209602
5336 5336 c, t dbSNP:541587272
5349 5349 -, c dbSNP:534151146
5391 5391 c, t dbSNP:561803954
5406 5406 a, g dbSNP:531050862
5457 5457 c, t dbSNP:551150791
5458 5458 a, g dbSNP:570813362
5465 5465 a, c dbSNP:533404808
5467 5467 c, t dbSNP:546604706
5475 5475 -, tcg dbSNP:753607913
5551 5551 a, g dbSNP:566501788
5592 5592 c, t dbSNP:557265376
5610 5610 -, aa dbSNP:58747637
5610 5610 a, t dbSNP:535820869
5655 5655 a, g dbSNP:182763560
5678 5678 c, t dbSNP:61080418
5688 5688 -, c dbSNP:764729763
5689 5689 c, t dbSNP:569327197
5691 5691 c, g dbSNP:573995032
5716 5716 c, t dbSNP:536897617
5765 5765 a, g dbSNP:187478880
5773 5773 a, g dbSNP:577221830
5780 5780 c, t dbSNP:546088965
5784 5784 a, c dbSNP:761743692
5786 5786 c, g dbSNP:3112704
5786 5786 c, g dbSNP:112319026
5789 5789 a, c dbSNP:191845035
5794 5794 a, g dbSNP:144753105
5810 5810 g, t dbSNP:561678389
5816 5816 c, t dbSNP:575253021
5826 5826 c, t dbSNP:544409330
5847 5847 a, g dbSNP:182493826
5852 5852 a, g dbSNP:533467818
5853 5853 c, t dbSNP:546919073
5926 5926 c, t dbSNP:556685997
5933 5933 a, c, t dbSNP:559677768
5943 5943 c, t dbSNP:11554593
5969 5969 c, g, t dbSNP:769734148
5976 5976 c, g dbSNP:549358180
6007 6007 c, t dbSNP:112703875
6030 6030 c, g dbSNP:539534788
6032 6032 a, g dbSNP:538298991
6052 6052 g, t dbSNP:751576674
6053 6053 c, t dbSNP:750511319
6054 6054 a, g dbSNP:757123594
6069 6069 c, t dbSNP:767388984
6078 6078 c, t dbSNP:550813362
6080 6080 a, t dbSNP:750180444
6085 6085 a, c dbSNP:373860725
6087 6087 a, t dbSNP:573302563
6090 6090 c, t dbSNP:766162407
6126 6126 a, t dbSNP:570686169
6142 6142 c, t dbSNP:539624769
6179 6179 a, c dbSNP:367757589
6188 6188 a, g dbSNP:371321013
6193 6193 c, t dbSNP:779625508
6200 6200 g, t dbSNP:368594243
6210 6210 -, tt dbSNP:545088750
6225 6225 a, g dbSNP:535107274
6226 6226 c, t dbSNP:773937993
6273 6273 -, gtgggg dbSNP:33994421
6338 6338 g, t dbSNP:555301555
6354 6354 c, g dbSNP:575259088
6364 6364 c, t dbSNP:543874303
6377 6377 -, c dbSNP:552798143
6378 6378 -, c dbSNP:565144559
6383 6383 a, c dbSNP:563817322
6384 6384 c, g dbSNP:56318884
6385 6385 -, c dbSNP:376887169
6414 6414 c, t dbSNP:550881899
6424 6424 a, g dbSNP:2335110
6477 6477 a, t dbSNP:561386521
6493 6493 a, t dbSNP:560670835
6504 6504 a, g dbSNP:187543589
6527 6527 c, g dbSNP:549120788
6529 6529 c, t dbSNP:2335111
6531 6531 c, t dbSNP:137906061
6574 6574 c, t dbSNP:755221626
6575 6575 a, g dbSNP:530400633
6614 6614 c, t dbSNP:551935898
6645 6645 c, g dbSNP:3095103
6668 6668 c, t dbSNP:539689181
6669 6669 a, g dbSNP:369381082
6700 6700 a, t dbSNP:565662700
6724 6724 a, g dbSNP:376666016
6740 6740 g, t dbSNP:566661760
6743 6743 c, t dbSNP:185737005
6753 6753 a, c dbSNP:190542981
6770 6770 c, g dbSNP:555090482
6782 6782 a, g dbSNP:754582678
6791 6791 -, a dbSNP:200815032
6821 6821 a, g dbSNP:200359888
6828 6828 a, g dbSNP:575224409
6859 6859 c, g dbSNP:537432131
6875 6875 c, g dbSNP:368831914
6887 6887 a, g dbSNP:557471998
6929 6929 g, t dbSNP:577316175
6988 6988 c, t dbSNP:540431729
6989 6989 c, g dbSNP:748479536
7009 7009 c, t dbSNP:371727709
7010 7010 a, g dbSNP:929457
7046 7046 a, g dbSNP:201156361
7062 7062 c, t dbSNP:534430467
7098 7098 a, g dbSNP:575136663
7111 7111 a, g dbSNP:184540154
7112 7112 c, t dbSNP:189062814
7128 7128 c, t dbSNP:778213681
7163 7163 g, t dbSNP:745355644
7165 7165 c, t dbSNP:545414930
7170 7170 -, gtaa dbSNP:5815128
7173 7173 -, agta dbSNP:3030674
7173 7173 -, gtaa dbSNP:761147047
7180 7180 c, t dbSNP:565379490
7244 7244 a, g dbSNP:527745262
7247 7247 a, g dbSNP:375159135
7258 7258 g, t dbSNP:566631892
7286 7286 a, g dbSNP:529055336
7287 7287 g, t dbSNP:549294670
7289 7289 a, g dbSNP:568802639
7291 7291 a, g dbSNP:537496663
7330 7330 -, tg dbSNP:771759264
7367 7367 c, t dbSNP:557285323
7387 7387 c, g dbSNP:571020949
7393 7393 g, t dbSNP:533610862
7403 7403 g, t dbSNP:554095762
7419 7419 a, t dbSNP:545626630
7423 7423 a, g dbSNP:574208711
7439 7439 a, g dbSNP:542840852
7440 7440 -, ttg dbSNP:540470378
7450 7450 c, g dbSNP:553056589
7461 7461 -, tg dbSNP:201869822
7476 7476 a, c dbSNP:748736402
7510 7510 c, t dbSNP:556860773
7590 7590 a, g dbSNP:11554591
7641 7641 g, t dbSNP:772425944
7658 7658 c, t dbSNP:576761849
7659 7659 -, t, tt dbSNP:111618468
7661 7661 a, g dbSNP:11554592
7666 7666 c, g, t dbSNP:181213412
7670 7670 -, tc dbSNP:201698119
7677 7677 a, c dbSNP:527809139
7688 7688 a, g dbSNP:557863257
7690 7690 a, g dbSNP:185318792
7714 7714 a, t dbSNP:189105574
7722 7722 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_011522523
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu59609D
Sequence Information ORF Nucleotide Sequence (Length: 912bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X5
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1286..>1819(+)
Misc Feature(2)1292..>1753(+)
Misc Feature(3)1310..1717(+)
Position Chain Variation Link
236 236 c, t dbSNP:547040445
255 255 c, g dbSNP:374019322
262 262 c, g dbSNP:561153470
272 272 -, gatt dbSNP:150836742
331 331 c, t dbSNP:530277736
351 351 a, g dbSNP:376949540
355 355 a, g dbSNP:550228970
372 372 a, g dbSNP:570354791
402 402 a, c dbSNP:111439925
425 425 a, g dbSNP:538947141
522 522 c, t dbSNP:552643682
546 546 a, c dbSNP:566033938
576 576 a, c dbSNP:780121126
580 580 a, c