Email to GenScript

PDPK1 3-phosphoinositide dependent protein kinase 1 [Homo sapiens (human)]

Gene Symbol PDPK1
Entrez Gene ID 5170
Full Name 3-phosphoinositide dependent protein kinase 1
Synonyms PDK1, PDPK2, PDPK2P, PRO0461
General protein information
Preferred Names
3-phosphoinositide-dependent protein kinase 1
Names
3-phosphoinositide-dependent protein kinase 1
PkB-like 1
PkB kinase like gene 1
NP_001248745.1
NP_002604.1
NP_112558.2
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

16

16p13.3

Summary lac of sum
Disorder MIM:

605213

Disorder Html:





The following PDPK1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PDPK1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu59606 XM_011522521 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu59607 XM_011522522 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu48855 XM_005255356 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $439
OHu59608 XM_011522523 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu59609 XM_011522524 PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu13008 NM_002613 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$328.3
$469
OHu13009 NM_031268 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$265.3
$379
OHu13007 NM_001261816 Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu59606
Accession Version XM_011522521.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1773bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGTTGAAGA TGTGGGTTAG TGAAATTGAG ACCTGGCGCT TCCTGAGGCT GGCAGCCCGG 
TTGAGCCTGA GGACCAGACT TGAGGCAGTT GGCAGTCCGC GCCTCGTTGC CCTCTGTCTG
CCCTGGTATG ACGCCGTGCC CATCCAGTCC AGCGTGGTGT TATGTTCCTG CCCATCCCCA
TCAATGGTGA GGACCCAGAC TGAGTCCAGC ACGCCCCCTG GCATTCCTGG TGGCAGCAGG
CAGGGCCCCG CCATGGACGG CACTGCAGCC GAGCCTCGGC CCGGCGCCGG CTCCCTGCAG
CATGCCCAGC CTCCGCCGCA GCCTCGGAAG AAGCGGCCTG AGGACTTCAA GTTTGGGAAA
ATCCTTGGGG AAGGCTCTTT TTCCACGGTT GTCCTGGCTC GAGAACTGGC AACCTCCAGA
GAATATGCGA TTAAAATTCT GGAGAAGCGA CATATCATAA AAGAGAACAA GGTCCCCTAT
GTAACCAGAG AGCGGGATGT CATGTCGCGC CTGGATCACC CCTTCTTTGT TAAGCTTTAC
TTCACATTTC AGGACGACGA GAAGCTGTAT TTCGGCCTTA GTTATGCCAA AAATGGAGAA
CTACTTAAAT ATATTCGCAA AATCGGTTCA TTCGATGAGA CCTGTACCCG ATTTTACACG
GCTGAGATTG TGTCTGCTTT AGAGTACTTG CACGGCAAGG GCATCATTCA CAGGGACCTT
AAACCGGAAA ACATTTTGTT AAATGAAGAT ATGCACATCC AGATCACAGA TTTTGGAACA
GCAAAAGTCT TATCCCCAGA GAGCAAACAA GCCAGGGCCA ACTCATTCGT GGGAACAGCG
CAGTACGTTT CTCCAGAGCT GCTCACGGAG AAGTCCGCCT GTAAGAGTTC AGACCTTTGG
GCTCTTGGAT GCATAATATA CCAGCTTGTG GCAGGACTCC CACCATTCCG AGCTGGAAAC
GAGTATCTTA TATTTCAGAA GATCATTAAG TTGGAATATG ACTTTCCAGA AAAATTCTTC
CCTAAGGCAA GAGACCTCGT GGAGAAACTT TTGGTTTTAG ATGCCACAAA GCGGTTAGGC
TGTGAGGAAA TGGAAGGATA CGGACCTCTT AAAGCACACC CGTTCTTCGA GTCCGTCACG
TGGGAGAACC TGCACCAGCA GACGCCTCCG AAGCTCACCG CTTACCTGCC GGCTATGTCG
GAAGACGACG AGGACTGCTA TGGCAATTAT GACAATCTCC TGAGCCAGTT TGGCTGCATG
CAGGTGTCTT CGTCCTCCTC CTCACACTCC CTGTCAGCCT CCGACACGGG CCTGCCCCAG
AGGTCAGGCA GCAACATAGA GCAGTACATT CACGATCTGG ACTCGAACTC CTTTGAACTG
GACTTACAGT TTTCCGAAGA TGAGAAGAGG TTGTTGTTGG AGAAGCAGGC TGGCGGAAAC
CCTTGGCACC AGTTTGTAGA AAATAATTTA ATACTAAAGA TGGGCCCAGT GGATAAGCGG
AAGGGTTTAT TTGCAAGACG ACGACAGCTG TTGCTCACAG AAGGACCACA TTTATATTAT
GTGGATCCTG TCAACAAAGT TCTGAAAGGT GAAATTCCTT GGTCACAAGA ACTTCGACCA
GAGGCCAAGA ATTTTAAAAC TTTCTTTGTC CACACGCCTA ACAGGACGTA TTATCTGATG
GACCCCAGCG GGAACGCACA CAAGTGGTGC AGGAAGATCC AGGAGGTTTG GAGGCAGCGA
TACCAGAGCC ACCCGGACGC CGCTGTGCAG TGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011520823.1
CDS947..2719
Misc Feature(1)1286..2074(+)
Misc Feature(2)1292..2074(+)
Misc Feature(3)1310..1897(+)
Misc Feature(4)1310..1717(+)
Misc Feature(5)1322..1897(+)
Misc Feature(6)1712..1789(+)
Misc Feature(7)2369..2689(+)
Misc Feature(8)2441..2611(+)
Translation
Position Chain Variation Link
236 236 c, t dbSNP:547040445
255 255 c, g dbSNP:374019322
262 262 c, g dbSNP:561153470
272 272 -, gatt dbSNP:150836742
331 331 c, t dbSNP:530277736
351 351 a, g dbSNP:376949540
355 355 a, g dbSNP:550228970
372 372 a, g dbSNP:570354791
402 402 a, c dbSNP:111439925
425 425 a, g dbSNP:538947141
522 522 c, t dbSNP:552643682
546 546 a, c dbSNP:566033938
576 576 a, c dbSNP:780121126
580 580 a, c dbSNP:535133318
894 894 a, g dbSNP:555066937
909 909 g, t dbSNP:573906874
1099 1099 c, t dbSNP:61747742
1104 1104 -, tgt dbSNP:750485483
1134 1134 c, t dbSNP:772871628
1159 1159 a, g dbSNP:762649804
1170 1170 c, t dbSNP:55824600
1183 1183 c, t dbSNP:770708494
1195 1195 c, t dbSNP:539550094
1198 1198 c, t dbSNP:759430577
1199 1199 a, g dbSNP:767328553
1204 1204 c, t dbSNP:752733022
1214 1214 c, g dbSNP:760555326
1216 1216 c, t dbSNP:553067229
1217 1217 a, g dbSNP:753919385
1223 1223 c, t dbSNP:757413961
1224 1224 a, g dbSNP:779166111
1226 1226 c, t dbSNP:750784265
1228 1228 c, t dbSNP:573496896
1229 1229 a, g dbSNP:780402170
1231 1231 c, t dbSNP:747501354
1232 1232 a, g dbSNP:769074523
1234 1234 c, t dbSNP:777349106
1235 1235 a, g dbSNP:748817353
1238 1238 g, t dbSNP:770692110
1242 1242 a, t dbSNP:774190389
1246 1246 a, g dbSNP:759232667
1251 1251 c, t dbSNP:771854875
1259 1259 c, g, t dbSNP:775183994
1260 1260 c, t dbSNP:535696352
1261 1261 a, g dbSNP:776681039
1263 1263 c, t dbSNP:761949625
1264 1264 a, g dbSNP:765411861
1272 1272 a, g dbSNP:750705121
1279 1279 a, g dbSNP:372064092
1280 1280 c, t dbSNP:766725088
1281 1281 a, g dbSNP:751870190
1283 1283 a, c, g dbSNP:755452051
1286 1286 c, g dbSNP:748800896
1289 1289 a, g dbSNP:756879724
1291 1291 c, t dbSNP:778591061
1296 1296 a, g dbSNP:745496613
1306 1306 a, g dbSNP:575887920
1309 1309 c, t dbSNP:758319
1312 1312 c, t dbSNP:775298281
1317 1317 -, a dbSNP:780646954
1321 1321 -, ct dbSNP:747519638
1322 1322 g, t dbSNP:746838429
1330 1330 a, c dbSNP:146388630
1333 1333 a, g dbSNP:776593118
1425 1425 a, g dbSNP:551607067
1501 1501 -, cgac dbSNP:748593314
1503 1503 a, t dbSNP:748035328
1504 1504 c, t dbSNP:769723811
1576 1576 a, g dbSNP:2041206
1768 1768 c, g dbSNP:764571812
1774 1774 c, t dbSNP:749948247
1783 1783 a, g dbSNP:574452215
1785 1785 c, t dbSNP:757889593
1789 1789 a, g dbSNP:543688348
1793 1793 a, g dbSNP:370069297
1802 1802 a, g dbSNP:373278831
1804 1804 a, g dbSNP:139543796
1807 1807 a, g dbSNP:780894116
1812 1812 c, t dbSNP:144186731
1821 1821 c, t dbSNP:769705993
1822 1822 c, t dbSNP:200735205
1823 1823 a, g dbSNP:749355083
2181 2181 a, g dbSNP:755812280
2186 2186 c, g dbSNP:763731140
2194 2194 g, t dbSNP:561462097
2202 2202 a, g dbSNP:753681549
2208 2208 a, g dbSNP:370279457
2217 2217 c, t dbSNP:779064858
2218 2218 c, g dbSNP:377095764
2221 2221 c, g dbSNP:758602254
2226 2226 c, g dbSNP:200076126
2235 2235 c, g dbSNP:780305703
2236 2236 c, t dbSNP:747157063
2237 2237 c, g dbSNP:768924605
2238 2238 g, t dbSNP:776800040
2239 2239 a, g dbSNP:748599366
2241 2241 c, t dbSNP:370494924
2248 2248 c, t dbSNP:773747255
2251 2251 c, t dbSNP:759022782
2252 2252 a, g dbSNP:76887737
2253 2253 c, t dbSNP:75824263
2254 2254 a, c, g, t dbSNP:75077217
2256 2256 a, g dbSNP:139732994
2258 2258 c, t dbSNP:201780963
2262 2262 a, c dbSNP:535986266
2263 2263 c, g dbSNP:750340247
2271 2271 c, t dbSNP:758443705
2276 2276 a, g dbSNP:780213417
2278 2278 c, t dbSNP:747123753
2279 2279 a, c dbSNP:755138312
2280 2280 a, g dbSNP:149931764
2290 2290 a, g dbSNP:748428723
2292 2292 a, g dbSNP:770192179
2293 2293 c, t dbSNP:778131329
2299 2299 c, t dbSNP:532663585
2301 2301 a, g dbSNP:771442872
2302 2302 c, t dbSNP:774850892
2303 2303 c, t dbSNP:760300604
2310 2310 c, t dbSNP:547797391
2311 2311 a, c, g dbSNP:768166848
2314 2314 c, t dbSNP:761396833
2316 2316 c, g dbSNP:765088097
2328 2328 a, t dbSNP:552355299
2333 2333 c, g dbSNP:145034828
2341 2341 c, t dbSNP:766478163
2342 2342 a, g dbSNP:751583488
2347 2347 c, t dbSNP:145594574
2355 2355 a, g dbSNP:374111988
2357 2357 c, t dbSNP:752913176
2363 2363 c, t dbSNP:756358328
2366 2366 g, t dbSNP:142153837
2367 2367 a, t dbSNP:749712375
2380 2380 c, t dbSNP:771424447
2382 2382 g, t dbSNP:533780852
2408 2408 a, g dbSNP:374649760
2414 2414 c, t dbSNP:777350674
2444 2444 c, t dbSNP:753410336
2461 2461 a, g dbSNP:535332245
2479 2479 c, g dbSNP:773372279
2485 2485 a, g dbSNP:763017868
2500 2500 a, g dbSNP:771291308
2503 2503 c, t dbSNP:774842989
2506 2506 c, t dbSNP:760019244
2519 2519 a, g dbSNP:768116696
2520 2520 a, t dbSNP:775814028
2537 2537 a, g dbSNP:761277571
2553 2553 a, g dbSNP:764588339
2557 2557 a, t dbSNP:749966481
2570 2570 a, g dbSNP:758036081
2589 2589 a, t dbSNP:766091042
2601 2601 c, t dbSNP:549158095
2602 2602 a, g dbSNP:751320393
2608 2608 c, t dbSNP:752547402
2614 2614 a, g, t dbSNP:755991413
2626 2626 a, g dbSNP:749357936
2635 2635 c, t dbSNP:147843249
2641 2641 c, t dbSNP:141143951
2657 2657 a, c dbSNP:143425561
2671 2671 c, g dbSNP:551293304
2672 2672 a, g dbSNP:772355571
2680 2680 a, g dbSNP:775707536
2685 2685 a, g dbSNP:148008907
2701 2701 a, g dbSNP:747477279
2704 2704 c, t dbSNP:201375554
2707 2707 c, t dbSNP:201646295
2708 2708 a, g dbSNP:201983709
2716 2716 a, g dbSNP:770386112
2720 2720 c, t dbSNP:141708903
2721 2721 g, t dbSNP:759130714
2729 2729 c, t dbSNP:567030364
2730 2730 a, g dbSNP:371050359
2733 2733 c, t dbSNP:760558101
2734 2734 a, g dbSNP:375625632
2745 2745 c, t dbSNP:753787792
2746 2746 a, g, t dbSNP:757267684
2747 2747 c, t dbSNP:750591733
2751 2751 c, t dbSNP:758548197
2752 2752 a, g dbSNP:775000968
2754 2754 a, g dbSNP:747310334
2760 2760 c, t dbSNP:763407617
2764 2764 c, t dbSNP:769012428
2767 2767 g, t dbSNP:781565770
2768 2768 c, t dbSNP:748585190
2769 2769 a, g dbSNP:770298078
2770 2770 c, t dbSNP:368140738
2771 2771 a, g dbSNP:111905533
2772 2772 g, t dbSNP:374100568
2786 2786 c, t dbSNP:759166098
2793 2793 c, t dbSNP:576603878
2827 2827 c, t dbSNP:10866
2864 2864 a, g dbSNP:3087784
2869 2869 a, g dbSNP:559332782
2879 2879 a, c dbSNP:563682651
2904 2904 a, g dbSNP:375635017
2906 2906 c, g dbSNP:776687154
2920 2920 a, g dbSNP:762295195
2950 2950 g, t dbSNP:767628948
2955 2955 a, t dbSNP:572774850
2958 2958 c, g dbSNP:752529981
2988 2988 c, g dbSNP:529226935
2995 2995 c, g dbSNP:148121766
3002 3002 a, c dbSNP:561226269
3015 3015 c, t dbSNP:140982354
3021 3021 c, t dbSNP:13335284
3022 3022 a, g dbSNP:369818229
3025 3025 c, t dbSNP:374470586
3057 3057 g, t dbSNP:371038846
3083 3083 g, t dbSNP:563611183
3090 3090 c, t dbSNP:543128805
3098 3098 a, g dbSNP:531570429
3119 3119 a, g dbSNP:528250860
3128 3128 g, t dbSNP:189787811
3149 3149 c, t dbSNP:754005480
3164 3164 a, g dbSNP:753864539
3204 3204 a, g dbSNP:571210384
3207 3207 c, t dbSNP:758382220
3214 3214 g, t dbSNP:181078294
3219 3219 -, cgggggccgcagctttgtgg dbSNP:374612917
3224 3224 a, g dbSNP:113332295
3228 3228 a, g dbSNP:547002823
3235 3235 a, t dbSNP:559554679
3249 3249 c, g dbSNP:751303008
3259 3259 a, c dbSNP:375417064
3299 3299 a, t dbSNP:535850233
3305 3305 a, t dbSNP:556257698
3329 3329 c, t dbSNP:780858375
3338 3338 g, t dbSNP:750481961
3346 3346 c, t dbSNP:185952911
3351 3351 c, t dbSNP:539284441
3355 3355 -, a dbSNP:560922224
3365 3365 a, g dbSNP:559150292
3367 3367 a, g dbSNP:572787105
3430 3430 a, g dbSNP:541712873
3451 3451 c, g dbSNP:79745244
3476 3476 g, t dbSNP:574807920
3488 3488 c, g dbSNP:745471795
3496 3496 a, t dbSNP:528570052
3507 3507 c, t dbSNP:138049982
3523 3523 c, t dbSNP:769465822
3536 3536 a, g dbSNP:563848860
3550 3550 c, t dbSNP:779506921
3555 3555 c, g dbSNP:748844927
3602 3602 g, t dbSNP:71386677
3606 3606 c, g dbSNP:142512073
3653 3653 a, g dbSNP:762232443
3665 3665 a, g dbSNP:564701168
3719 3719 c, t dbSNP:190327635
3730 3730 -, a dbSNP:571502069
3757 3757 a, g dbSNP:547314582
3764 3764 c, t dbSNP:78560075
3773 3773 g, t dbSNP:529734340
3785 3785 a, g dbSNP:138756291
3803 3803 g, t dbSNP:760941132
3815 3815 a, g dbSNP:766750148
3817 3817 c, g dbSNP:769055116
3869 3869 c, t dbSNP:76291069
3884 3884 a, g dbSNP:74003037
3902 3902 -, g dbSNP:765252878
3927 3927 c, t dbSNP:144433575
3936 3936 c, t dbSNP:566250204
3945 3945 c, t dbSNP:550576606
3948 3948 a, g dbSNP:748644397
3970 3970 c, t dbSNP:759751812
3971 3971 a, g dbSNP:376035884
3991 3991 c, t dbSNP:148393103
3992 3992 a, c, g dbSNP:141692563
4007 4007 g, t dbSNP:147153606
4018 4018 c, t dbSNP:183283033
4037 4037 a, c dbSNP:576938086
4042 4042 c, t dbSNP:770202665
4072 4072 c, t dbSNP:545861137
4097 4097 a, t dbSNP:559396383
4105 4105 c, t dbSNP:28679688
4197 4197 -, tgc dbSNP:149315179
4225 4225 a, g dbSNP:540817771
4238 4238 c, t dbSNP:561282155
4360 4360 a, g dbSNP:370396602
4372 4372 c, t dbSNP:367998725
4384 4384 c, g dbSNP:529898940
4408 4408 c, t dbSNP:549760673
4425 4425 c, g dbSNP:373772013
4428 4428 c, g dbSNP:372067195
4453 4453 a, c dbSNP:532266776
4525 4525 c, t dbSNP:552329672
4526 4526 a, g dbSNP:4786296
4538 4538 a, g dbSNP:565767072
4568 4568 c, t dbSNP:535278860
4619 4619 g, t dbSNP:4786297
4634 4634 c, g dbSNP:548496512
4669 4669 a, g dbSNP:568740588
4673 4673 a, g dbSNP:147975625
4695 4695 -, gtcctgtgtctccat dbSNP:370970044
4695 4695 g, t dbSNP:537310185
4711 4711 g, t dbSNP:557345495
4743 4743 a, g dbSNP:187363186
4755 4755 c, g dbSNP:28457160
4756 4756 a, g dbSNP:535074412
4757 4757 a, g dbSNP:572997169
4787 4787 g, t dbSNP:113716221
4804 4804 c, t dbSNP:541222591
4818 4818 c, t dbSNP:190975527
4823 4823 c, t dbSNP:574692618
4824 4824 a, g dbSNP:543323513
4834 4834 c, t dbSNP:563577752
4908 4908 a, g dbSNP:113054936
4917 4917 c, t dbSNP:532181910
4939 4939 a, g dbSNP:28615548
4948 4948 c, t dbSNP:775324213
4960 4960 c, t dbSNP:565667834
4967 4967 c, t dbSNP:372950862
4974 4974 c, t dbSNP:559538467
4977 4977 c, t dbSNP:534714693
5011 5011 c, t dbSNP:548777339
5029 5029 c, t dbSNP:149131034
5046 5046 c, t dbSNP:531109247
5074 5074 c, t dbSNP:551022507
5097 5097 c, g dbSNP:71386681
5119 5119 c, t dbSNP:570799401
5129 5129 g, t dbSNP:539495695
5134 5134 a, g dbSNP:552900581
5142 5142 a, g dbSNP:566632715
5162 5162 a, g dbSNP:535544455
5175 5175 c, t dbSNP:558027230
5176 5176 g, t dbSNP:577872209
5210 5210 -, a dbSNP:199508475
5284 5284 c, t dbSNP:554773031
5300 5300 a, g dbSNP:574574151
5302 5302 c, g, t dbSNP:543744889
5311 5311 a, c dbSNP:557336688
5317 5317 c, t dbSNP:147659496
5334 5334 c, t dbSNP:577209776
5340 5340 c, t dbSNP:545819504
5442 5442 a, g dbSNP:559353007
5686 5686 c, t dbSNP:528209602
5717 5717 c, t dbSNP:541587272
5730 5730 -, c dbSNP:534151146
5772 5772 c, t dbSNP:561803954
5787 5787 a, g dbSNP:531050862
5838 5838 c, t dbSNP:551150791
5839 5839 a, g dbSNP:570813362
5846 5846 a, c dbSNP:533404808
5848 5848 c, t dbSNP:546604706
5856 5856 -, tcg dbSNP:753607913
5932 5932 a, g dbSNP:566501788
5973 5973 c, t dbSNP:557265376
5991 5991 -, aa dbSNP:58747637
5991 5991 a, t dbSNP:535820869
6036 6036 a, g dbSNP:182763560
6059 6059 c, t dbSNP:61080418
6069 6069 -, c dbSNP:764729763
6070 6070 c, t dbSNP:569327197
6072 6072 c, g dbSNP:573995032
6097 6097 c, t dbSNP:536897617
6146 6146 a, g dbSNP:187478880
6154 6154 a, g dbSNP:577221830
6161 6161 c, t dbSNP:546088965
6165 6165 a, c dbSNP:761743692
6167 6167 c, g dbSNP:3112704
6167 6167 c, g dbSNP:112319026
6170 6170 a, c dbSNP:191845035
6175 6175 a, g dbSNP:144753105
6191 6191 g, t dbSNP:561678389
6197 6197 c, t dbSNP:575253021
6207 6207 c, t dbSNP:544409330
6228 6228 a, g dbSNP:182493826
6233 6233 a, g dbSNP:533467818
6234 6234 c, t dbSNP:546919073
6307 6307 c, t dbSNP:556685997
6314 6314 a, c, t dbSNP:559677768
6324 6324 c, t dbSNP:11554593
6350 6350 c, g, t dbSNP:769734148
6357 6357 c, g dbSNP:549358180
6388 6388 c, t dbSNP:112703875
6411 6411 c, g dbSNP:539534788
6413 6413 a, g dbSNP:538298991
6433 6433 g, t dbSNP:751576674
6434 6434 c, t dbSNP:750511319
6435 6435 a, g dbSNP:757123594
6450 6450 c, t dbSNP:767388984
6459 6459 c, t dbSNP:550813362
6461 6461 a, t dbSNP:750180444
6466 6466 a, c dbSNP:373860725
6468 6468 a, t dbSNP:573302563
6471 6471 c, t dbSNP:766162407
6507 6507 a, t dbSNP:570686169
6523 6523 c, t dbSNP:539624769
6560 6560 a, c dbSNP:367757589
6569 6569 a, g dbSNP:371321013
6574 6574 c, t dbSNP:779625508
6581 6581 g, t dbSNP:368594243
6591 6591 -, tt dbSNP:545088750
6606 6606 a, g dbSNP:535107274
6607 6607 c, t dbSNP:773937993
6654 6654 -, gtgggg dbSNP:33994421
6719 6719 g, t dbSNP:555301555
6735 6735 c, g dbSNP:575259088
6745 6745 c, t dbSNP:543874303
6758 6758 -, c dbSNP:552798143
6759 6759 -, c dbSNP:565144559
6764 6764 a, c dbSNP:563817322
6765 6765 c, g dbSNP:56318884
6766 6766 -, c dbSNP:376887169
6795 6795 c, t dbSNP:550881899
6805 6805 a, g dbSNP:2335110
6858 6858 a, t dbSNP:561386521
6874 6874 a, t dbSNP:560670835
6885 6885 a, g dbSNP:187543589
6908 6908 c, g dbSNP:549120788
6910 6910 c, t dbSNP:2335111
6912 6912 c, t dbSNP:137906061
6955 6955 c, t dbSNP:755221626
6956 6956 a, g dbSNP:530400633
6995 6995 c, t dbSNP:551935898
7026 7026 c, g dbSNP:3095103
7049 7049 c, t dbSNP:539689181
7050 7050 a, g dbSNP:369381082
7081 7081 a, t dbSNP:565662700
7105 7105 a, g dbSNP:376666016
7121 7121 g, t dbSNP:566661760
7124 7124 c, t dbSNP:185737005
7134 7134 a, c dbSNP:190542981
7151 7151 c, g dbSNP:555090482
7163 7163 a, g dbSNP:754582678
7172 7172 -, a dbSNP:200815032
7202 7202 a, g dbSNP:200359888
7209 7209 a, g dbSNP:575224409
7240 7240 c, g dbSNP:537432131
7256 7256 c, g dbSNP:368831914
7268 7268 a, g dbSNP:557471998
7310 7310 g, t dbSNP:577316175
7369 7369 c, t dbSNP:540431729
7370 7370 c, g dbSNP:748479536
7390 7390 c, t dbSNP:371727709
7391 7391 a, g dbSNP:929457
7427 7427 a, g dbSNP:201156361
7443 7443 c, t dbSNP:534430467
7479 7479 a, g dbSNP:575136663
7492 7492 a, g dbSNP:184540154
7493 7493 c, t dbSNP:189062814
7509 7509 c, t dbSNP:778213681
7544 7544 g, t dbSNP:745355644
7546 7546 c, t dbSNP:545414930
7551 7551 -, gtaa dbSNP:5815128
7554 7554 -, agta dbSNP:3030674
7554 7554 -, gtaa dbSNP:761147047
7561 7561 c, t dbSNP:565379490
7625 7625 a, g dbSNP:527745262
7628 7628 a, g dbSNP:375159135
7639 7639 g, t dbSNP:566631892
7667 7667 a, g dbSNP:529055336
7668 7668 g, t dbSNP:549294670
7670 7670 a, g dbSNP:568802639
7672 7672 a, g dbSNP:537496663
7711 7711 -, tg dbSNP:771759264
7748 7748 c, t dbSNP:557285323
7768 7768 c, g dbSNP:571020949
7774 7774 g, t dbSNP:533610862
7784 7784 g, t dbSNP:554095762
7800 7800 a, t dbSNP:545626630
7804 7804 a, g dbSNP:574208711
7820 7820 a, g dbSNP:542840852
7821 7821 -, ttg dbSNP:540470378
7831 7831 c, g dbSNP:553056589
7842 7842 -, tg dbSNP:201869822
7857 7857 a, c dbSNP:748736402
7891 7891 c, t dbSNP:556860773
7971 7971 a, g dbSNP:11554591
8022 8022 g, t dbSNP:772425944
8039 8039 c, t dbSNP:576761849
8040 8040 -, t, tt dbSNP:111618468
8042 8042 a, g dbSNP:11554592
8047 8047 c, g, t dbSNP:181213412
8051 8051 -, tc dbSNP:201698119
8058 8058 a, c dbSNP:527809139
8069 8069 a, g dbSNP:557863257
8071 8071 a, g dbSNP:185318792
8095 8095 a, t dbSNP:189105574
8103 8103 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_011522521
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011522521

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGTTGAAGA TGTGGGTTAG TGAAATTGAG ACCTGGCGCT TCCTGAGGCT GGCAGCCCGG 
TTGAGCCTGA GGACCAGACT TGAGGCAGTT GGCAGTCCGC GCCTCGTTGC CCTCTGTCTG
CCCTGGTATG ACGCCGTGCC CATCCAGTCC AGCGTGGTGT TATGTTCCTG CCCATCCCCA
TCAATGGTGA GGACCCAGAC TGAGTCCAGC ACGCCCCCTG GCATTCCTGG TGGCAGCAGG
CAGGGCCCCG CCATGGACGG CACTGCAGCC GAGCCTCGGC CCGGCGCCGG CTCCCTGCAG
CATGCCCAGC CTCCGCCGCA GCCTCGGAAG AAGCGGCCTG AGGACTTCAA GTTTGGGAAA
ATCCTTGGGG AAGGCTCTTT TTCCACGGTT GTCCTGGCTC GAGAACTGGC AACCTCCAGA
GAATATGCGA TTAAAATTCT GGAGAAGCGA CATATCATAA AAGAGAACAA GGTCCCCTAT
GTAACCAGAG AGCGGGATGT CATGTCGCGC CTGGATCACC CCTTCTTTGT TAAGCTTTAC
TTCACATTTC AGGACGACGA GAAGCTGTAT TTCGGCCTTA GTTATGCCAA AAATGGAGAA
CTACTTAAAT ATATTCGCAA AATCGGTTCA TTCGATGAGA CCTGTACCCG ATTTTACACG
GCTGAGATTG TGTCTGCTTT AGAGTACTTG CACGGCAAGG GCATCATTCA CAGGGACCTT
AAACCGGAAA ACATTTTGTT AAATGAAGAT ATGCACATCC AGATCACAGA TTTTGGAACA
GCAAAAGTCT TATCCCCAGA GAGCAAACAA GCCAGGGCCA ACTCATTCGT GGGAACAGCG
CAGTACGTTT CTCCAGAGCT GCTCACGGAG AAGTCCGCCT GTAAGAGTTC AGACCTTTGG
GCTCTTGGAT GCATAATATA CCAGCTTGTG GCAGGACTCC CACCATTCCG AGCTGGAAAC
GAGTATCTTA TATTTCAGAA GATCATTAAG TTGGAATATG ACTTTCCAGA AAAATTCTTC
CCTAAGGCAA GAGACCTCGT GGAGAAACTT TTGGTTTTAG ATGCCACAAA GCGGTTAGGC
TGTGAGGAAA TGGAAGGATA CGGACCTCTT AAAGCACACC CGTTCTTCGA GTCCGTCACG
TGGGAGAACC TGCACCAGCA GACGCCTCCG AAGCTCACCG CTTACCTGCC GGCTATGTCG
GAAGACGACG AGGACTGCTA TGGCAATTAT GACAATCTCC TGAGCCAGTT TGGCTGCATG
CAGGTGTCTT CGTCCTCCTC CTCACACTCC CTGTCAGCCT CCGACACGGG CCTGCCCCAG
AGGTCAGGCA GCAACATAGA GCAGTACATT CACGATCTGG ACTCGAACTC CTTTGAACTG
GACTTACAGT TTTCCGAAGA TGAGAAGAGG TTGTTGTTGG AGAAGCAGGC TGGCGGAAAC
CCTTGGCACC AGTTTGTAGA AAATAATTTA ATACTAAAGA TGGGCCCAGT GGATAAGCGG
AAGGGTTTAT TTGCAAGACG ACGACAGCTG TTGCTCACAG AAGGACCACA TTTATATTAT
GTGGATCCTG TCAACAAAGT TCTGAAAGGT GAAATTCCTT GGTCACAAGA ACTTCGACCA
GAGGCCAAGA ATTTTAAAAC TTTCTTTGTC CACACGCCTA ACAGGACGTA TTATCTGATG
GACCCCAGCG GGAACGCACA CAAGTGGTGC AGGAAGATCC AGGAGGTTTG GAGGCAGCGA
TACCAGAGCC ACCCGGACGC CGCTGTGCAG TGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59607
Accession Version XM_011522522.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1677bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
ATGGGTCGGA GAGCGGTGGC TTACCCACAG TATGACGCCG TGCCCATCCA GTCCAGCGTG 
GTGTTATGTT CCTGCCCATC CCCATCAATG GTGAGGACCC AGACTGAGTC CAGCACGCCC
CCTGGCATTC CTGGTGGCAG CAGGCAGGGC CCCGCCATGG ACGGCACTGC AGCCGAGCCT
CGGCCCGGCG CCGGCTCCCT GCAGCATGCC CAGCCTCCGC CGCAGCCTCG GAAGAAGCGG
CCTGAGGACT TCAAGTTTGG GAAAATCCTT GGGGAAGGCT CTTTTTCCAC GGTTGTCCTG
GCTCGAGAAC TGGCAACCTC CAGAGAATAT GCGATTAAAA TTCTGGAGAA GCGACATATC
ATAAAAGAGA ACAAGGTCCC CTATGTAACC AGAGAGCGGG ATGTCATGTC GCGCCTGGAT
CACCCCTTCT TTGTTAAGCT TTACTTCACA TTTCAGGACG ACGAGAAGCT GTATTTCGGC
CTTAGTTATG CCAAAAATGG AGAACTACTT AAATATATTC GCAAAATCGG TTCATTCGAT
GAGACCTGTA CCCGATTTTA CACGGCTGAG ATTGTGTCTG CTTTAGAGTA CTTGCACGGC
AAGGGCATCA TTCACAGGGA CCTTAAACCG GAAAACATTT TGTTAAATGA AGATATGCAC
ATCCAGATCA CAGATTTTGG AACAGCAAAA GTCTTATCCC CAGAGAGCAA ACAAGCCAGG
GCCAACTCAT TCGTGGGAAC AGCGCAGTAC GTTTCTCCAG AGCTGCTCAC GGAGAAGTCC
GCCTGTAAGA GTTCAGACCT TTGGGCTCTT GGATGCATAA TATACCAGCT TGTGGCAGGA
CTCCCACCAT TCCGAGCTGG AAACGAGTAT CTTATATTTC AGAAGATCAT TAAGTTGGAA
TATGACTTTC CAGAAAAATT CTTCCCTAAG GCAAGAGACC TCGTGGAGAA ACTTTTGGTT
TTAGATGCCA CAAAGCGGTT AGGCTGTGAG GAAATGGAAG GATACGGACC TCTTAAAGCA
CACCCGTTCT TCGAGTCCGT CACGTGGGAG AACCTGCACC AGCAGACGCC TCCGAAGCTC
ACCGCTTACC TGCCGGCTAT GTCGGAAGAC GACGAGGACT GCTATGGCAA TTATGACAAT
CTCCTGAGCC AGTTTGGCTG CATGCAGGTG TCTTCGTCCT CCTCCTCACA CTCCCTGTCA
GCCTCCGACA CGGGCCTGCC CCAGAGGTCA GGCAGCAACA TAGAGCAGTA CATTCACGAT
CTGGACTCGA ACTCCTTTGA ACTGGACTTA CAGTTTTCCG AAGATGAGAA GAGGTTGTTG
TTGGAGAAGC AGGCTGGCGG AAACCCTTGG CACCAGTTTG TAGAAAATAA TTTAATACTA
AAGATGGGCC CAGTGGATAA GCGGAAGGGT TTATTTGCAA GACGACGACA GCTGTTGCTC
ACAGAAGGAC CACATTTATA TTATGTGGAT CCTGTCAACA AAGTTCTGAA AGGTGAAATT
CCTTGGTCAC AAGAACTTCG ACCAGAGGCC AAGAATTTTA AAACTTTCTT TGTCCACACG
CCTAACAGGA CGTATTATCT GATGGACCCC AGCGGGAACG CACACAAGTG GTGCAGGAAG
ATCCAGGAGG TTTGGAGGCA GCGATACCAG AGCCACCCGG ACGCCGCTGT GCAGTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011520824.1
CDS395..2071
Misc Feature(1)638..1426(+)
Misc Feature(2)644..1426(+)
Misc Feature(3)662..1249(+)
Misc Feature(4)662..1069(+)
Misc Feature(5)674..1249(+)
Misc Feature(6)1064..1141(+)
Misc Feature(7)1721..2041(+)
Misc Feature(8)1793..1963(+)
Translation
Position Chain Variation Link
254 254 a, g dbSNP:28619947
451 451 c, t dbSNP:61747742
456 456 -, tgt dbSNP:750485483
486 486 c, t dbSNP:772871628
511 511 a, g dbSNP:762649804
522 522 c, t dbSNP:55824600
535 535 c, t dbSNP:770708494
547 547 c, t dbSNP:539550094
550 550 c, t dbSNP:759430577
551 551 a, g dbSNP:767328553
556 556 c, t dbSNP:752733022
566 566 c, g dbSNP:760555326
568 568 c, t dbSNP:553067229
569 569 a, g dbSNP:753919385
575 575 c, t dbSNP:757413961
576 576 a, g dbSNP:779166111
578 578 c, t dbSNP:750784265
580 580 c, t dbSNP:573496896
581 581 a, g dbSNP:780402170
583 583 c, t dbSNP:747501354
584 584 a, g dbSNP:769074523
586 586 c, t dbSNP:777349106
587 587 a, g dbSNP:748817353
590 590 g, t dbSNP:770692110
594 594 a, t dbSNP:774190389
598 598 a, g dbSNP:759232667
603 603 c, t dbSNP:771854875
611 611 c, g, t dbSNP:775183994
612 612 c, t dbSNP:535696352
613 613 a, g dbSNP:776681039
615 615 c, t dbSNP:761949625
616 616 a, g dbSNP:765411861
624 624 a, g dbSNP:750705121
631 631 a, g dbSNP:372064092
632 632 c, t dbSNP:766725088
633 633 a, g dbSNP:751870190
635 635 a, c, g dbSNP:755452051
638 638 c, g dbSNP:748800896
641 641 a, g dbSNP:756879724
643 643 c, t dbSNP:778591061
648 648 a, g dbSNP:745496613
658 658 a, g dbSNP:575887920
661 661 c, t dbSNP:758319
664 664 c, t dbSNP:775298281
669 669 -, a dbSNP:780646954
673 673 -, ct dbSNP:747519638
674 674 g, t dbSNP:746838429
682 682 a, c dbSNP:146388630
685 685 a, g dbSNP:776593118
777 777 a, g dbSNP:551607067
853 853 -, cgac dbSNP:748593314
855 855 a, t dbSNP:748035328
856 856 c, t dbSNP:769723811
928 928 a, g dbSNP:2041206
1120 1120 c, g dbSNP:764571812
1126 1126 c, t dbSNP:749948247
1135 1135 a, g dbSNP:574452215
1137 1137 c, t dbSNP:757889593
1141 1141 a, g dbSNP:543688348
1145 1145 a, g dbSNP:370069297
1154 1154 a, g dbSNP:373278831
1156 1156 a, g dbSNP:139543796
1159 1159 a, g dbSNP:780894116
1164 1164 c, t dbSNP:144186731
1173 1173 c, t dbSNP:769705993
1174 1174 c, t dbSNP:200735205
1175 1175 a, g dbSNP:749355083
1533 1533 a, g dbSNP:755812280
1538 1538 c, g dbSNP:763731140
1546 1546 g, t dbSNP:561462097
1554 1554 a, g dbSNP:753681549
1560 1560 a, g dbSNP:370279457
1569 1569 c, t dbSNP:779064858
1570 1570 c, g dbSNP:377095764
1573 1573 c, g dbSNP:758602254
1578 1578 c, g dbSNP:200076126
1587 1587 c, g dbSNP:780305703
1588 1588 c, t dbSNP:747157063
1589 1589 c, g dbSNP:768924605
1590 1590 g, t dbSNP:776800040
1591 1591 a, g dbSNP:748599366
1593 1593 c, t dbSNP:370494924
1600 1600 c, t dbSNP:773747255
1603 1603 c, t dbSNP:759022782
1604 1604 a, g dbSNP:76887737
1605 1605 c, t dbSNP:75824263
1606 1606 a, c, g, t dbSNP:75077217
1608 1608 a, g dbSNP:139732994
1610 1610 c, t dbSNP:201780963
1614 1614 a, c dbSNP:535986266
1615 1615 c, g dbSNP:750340247
1623 1623 c, t dbSNP:758443705
1628 1628 a, g dbSNP:780213417
1630 1630 c, t dbSNP:747123753
1631 1631 a, c dbSNP:755138312
1632 1632 a, g dbSNP:149931764
1642 1642 a, g dbSNP:748428723
1644 1644 a, g dbSNP:770192179
1645 1645 c, t dbSNP:778131329
1651 1651 c, t dbSNP:532663585
1653 1653 a, g dbSNP:771442872
1654 1654 c, t dbSNP:774850892
1655 1655 c, t dbSNP:760300604
1662 1662 c, t dbSNP:547797391
1663 1663 a, c, g dbSNP:768166848
1666 1666 c, t dbSNP:761396833
1668 1668 c, g dbSNP:765088097
1680 1680 a, t dbSNP:552355299
1685 1685 c, g dbSNP:145034828
1693 1693 c, t dbSNP:766478163
1694 1694 a, g dbSNP:751583488
1699 1699 c, t dbSNP:145594574
1707 1707 a, g dbSNP:374111988
1709 1709 c, t dbSNP:752913176
1715 1715 c, t dbSNP:756358328
1718 1718 g, t dbSNP:142153837
1719 1719 a, t dbSNP:749712375
1732 1732 c, t dbSNP:771424447
1734 1734 g, t dbSNP:533780852
1760 1760 a, g dbSNP:374649760
1766 1766 c, t dbSNP:777350674
1796 1796 c, t dbSNP:753410336
1813 1813 a, g dbSNP:535332245
1831 1831 c, g dbSNP:773372279
1837 1837 a, g dbSNP:763017868
1852 1852 a, g dbSNP:771291308
1855 1855 c, t dbSNP:774842989
1858 1858 c, t dbSNP:760019244
1871 1871 a, g dbSNP:768116696
1872 1872 a, t dbSNP:775814028
1889 1889 a, g dbSNP:761277571
1905 1905 a, g dbSNP:764588339
1909 1909 a, t dbSNP:749966481
1922 1922 a, g dbSNP:758036081
1941 1941 a, t dbSNP:766091042
1953 1953 c, t dbSNP:549158095
1954 1954 a, g dbSNP:751320393
1960 1960 c, t dbSNP:752547402
1966 1966 a, g, t dbSNP:755991413
1978 1978 a, g dbSNP:749357936
1987 1987 c, t dbSNP:147843249
1993 1993 c, t dbSNP:141143951
2009 2009 a, c dbSNP:143425561
2023 2023 c, g dbSNP:551293304
2024 2024 a, g dbSNP:772355571
2032 2032 a, g dbSNP:775707536
2037 2037 a, g dbSNP:148008907
2053 2053 a, g dbSNP:747477279
2056 2056 c, t dbSNP:201375554
2059 2059 c, t dbSNP:201646295
2060 2060 a, g dbSNP:201983709
2068 2068 a, g dbSNP:770386112
2072 2072 c, t dbSNP:141708903
2073 2073 g, t dbSNP:759130714
2081 2081 c, t dbSNP:567030364
2082 2082 a, g dbSNP:371050359
2085 2085 c, t dbSNP:760558101
2086 2086 a, g dbSNP:375625632
2097 2097 c, t dbSNP:753787792
2098 2098 a, g, t dbSNP:757267684
2099 2099 c, t dbSNP:750591733
2103 2103 c, t dbSNP:758548197
2104 2104 a, g dbSNP:775000968
2106 2106 a, g dbSNP:747310334
2112 2112 c, t dbSNP:763407617
2116 2116 c, t dbSNP:769012428
2119 2119 g, t dbSNP:781565770
2120 2120 c, t dbSNP:748585190
2121 2121 a, g dbSNP:770298078
2122 2122 c, t dbSNP:368140738
2123 2123 a, g dbSNP:111905533
2124 2124 g, t dbSNP:374100568
2138 2138 c, t dbSNP:759166098
2145 2145 c, t dbSNP:576603878
2179 2179 c, t dbSNP:10866
2216 2216 a, g dbSNP:3087784
2221 2221 a, g dbSNP:559332782
2231 2231 a, c dbSNP:563682651
2256 2256 a, g dbSNP:375635017
2258 2258 c, g dbSNP:776687154
2272 2272 a, g dbSNP:762295195
2302 2302 g, t dbSNP:767628948
2307 2307 a, t dbSNP:572774850
2310 2310 c, g dbSNP:752529981
2340 2340 c, g dbSNP:529226935
2347 2347 c, g dbSNP:148121766
2354 2354 a, c dbSNP:561226269
2367 2367 c, t dbSNP:140982354
2373 2373 c, t dbSNP:13335284
2374 2374 a, g dbSNP:369818229
2377 2377 c, t dbSNP:374470586
2409 2409 g, t dbSNP:371038846
2435 2435 g, t dbSNP:563611183
2442 2442 c, t dbSNP:543128805
2450 2450 a, g dbSNP:531570429
2471 2471 a, g dbSNP:528250860
2480 2480 g, t dbSNP:189787811
2501 2501 c, t dbSNP:754005480
2516 2516 a, g dbSNP:753864539
2556 2556 a, g dbSNP:571210384
2559 2559 c, t dbSNP:758382220
2566 2566 g, t dbSNP:181078294
2571 2571 -, cgggggccgcagctttgtgg dbSNP:374612917
2576 2576 a, g dbSNP:113332295
2580 2580 a, g dbSNP:547002823
2587 2587 a, t dbSNP:559554679
2601 2601 c, g dbSNP:751303008
2611 2611 a, c dbSNP:375417064
2651 2651 a, t dbSNP:535850233
2657 2657 a, t dbSNP:556257698
2681 2681 c, t dbSNP:780858375
2690 2690 g, t dbSNP:750481961
2698 2698 c, t dbSNP:185952911
2703 2703 c, t dbSNP:539284441
2707 2707 -, a dbSNP:560922224
2717 2717 a, g dbSNP:559150292
2719 2719 a, g dbSNP:572787105
2782 2782 a, g dbSNP:541712873
2803 2803 c, g dbSNP:79745244
2828 2828 g, t dbSNP:574807920
2840 2840 c, g dbSNP:745471795
2848 2848 a, t dbSNP:528570052
2859 2859 c, t dbSNP:138049982
2875 2875 c, t dbSNP:769465822
2888 2888 a, g dbSNP:563848860
2902 2902 c, t dbSNP:779506921
2907 2907 c, g dbSNP:748844927
2954 2954 g, t dbSNP:71386677
2958 2958 c, g dbSNP:142512073
3005 3005 a, g dbSNP:762232443
3017 3017 a, g dbSNP:564701168
3071 3071 c, t dbSNP:190327635
3082 3082 -, a dbSNP:571502069
3109 3109 a, g dbSNP:547314582
3116 3116 c, t dbSNP:78560075
3125 3125 g, t dbSNP:529734340
3137 3137 a, g dbSNP:138756291
3155 3155 g, t dbSNP:760941132
3167 3167 a, g dbSNP:766750148
3169 3169 c, g dbSNP:769055116
3221 3221 c, t dbSNP:76291069
3236 3236 a, g dbSNP:74003037
3254 3254 -, g dbSNP:765252878
3279 3279 c, t dbSNP:144433575
3288 3288 c, t dbSNP:566250204
3297 3297 c, t dbSNP:550576606
3300 3300 a, g dbSNP:748644397
3322 3322 c, t dbSNP:759751812
3323 3323 a, g dbSNP:376035884
3343 3343 c, t dbSNP:148393103
3344 3344 a, c, g dbSNP:141692563
3359 3359 g, t dbSNP:147153606
3370 3370 c, t dbSNP:183283033
3389 3389 a, c dbSNP:576938086
3394 3394 c, t dbSNP:770202665
3424 3424 c, t dbSNP:545861137
3449 3449 a, t dbSNP:559396383
3457 3457 c, t dbSNP:28679688
3549 3549 -, tgc dbSNP:149315179
3577 3577 a, g dbSNP:540817771
3590 3590 c, t dbSNP:561282155
3712 3712 a, g dbSNP:370396602
3724 3724 c, t dbSNP:367998725
3736 3736 c, g dbSNP:529898940
3760 3760 c, t dbSNP:549760673
3777 3777 c, g dbSNP:373772013
3780 3780 c, g dbSNP:372067195
3805 3805 a, c dbSNP:532266776
3877 3877 c, t dbSNP:552329672
3878 3878 a, g dbSNP:4786296
3890 3890 a, g dbSNP:565767072
3920 3920 c, t dbSNP:535278860
3971 3971 g, t dbSNP:4786297
3986 3986 c, g dbSNP:548496512
4021 4021 a, g dbSNP:568740588
4025 4025 a, g dbSNP:147975625
4047 4047 -, gtcctgtgtctccat dbSNP:370970044
4047 4047 g, t dbSNP:537310185
4063 4063 g, t dbSNP:557345495
4095 4095 a, g dbSNP:187363186
4107 4107 c, g dbSNP:28457160
4108 4108 a, g dbSNP:535074412
4109 4109 a, g dbSNP:572997169
4139 4139 g, t dbSNP:113716221
4156 4156 c, t dbSNP:541222591
4170 4170 c, t dbSNP:190975527
4175 4175 c, t dbSNP:574692618
4176 4176 a, g dbSNP:543323513
4186 4186 c, t dbSNP:563577752
4260 4260 a, g dbSNP:113054936
4269 4269 c, t dbSNP:532181910
4291 4291 a, g dbSNP:28615548
4300 4300 c, t dbSNP:775324213
4312 4312 c, t dbSNP:565667834
4319 4319 c, t dbSNP:372950862
4326 4326 c, t dbSNP:559538467
4329 4329 c, t dbSNP:534714693
4363 4363 c, t dbSNP:548777339
4381 4381 c, t dbSNP:149131034
4398 4398 c, t dbSNP:531109247
4426 4426 c, t dbSNP:551022507
4449 4449 c, g dbSNP:71386681
4471 4471 c, t dbSNP:570799401
4481 4481 g, t dbSNP:539495695
4486 4486 a, g dbSNP:552900581
4494 4494 a, g dbSNP:566632715
4514 4514 a, g dbSNP:535544455
4527 4527 c, t dbSNP:558027230
4528 4528 g, t dbSNP:577872209
4562 4562 -, a dbSNP:199508475
4636 4636 c, t dbSNP:554773031
4652 4652 a, g dbSNP:574574151
4654 4654 c, g, t dbSNP:543744889
4663 4663 a, c dbSNP:557336688
4669 4669 c, t dbSNP:147659496
4686 4686 c, t dbSNP:577209776
4692 4692 c, t dbSNP:545819504
4794 4794 a, g dbSNP:559353007
5038 5038 c, t dbSNP:528209602
5069 5069 c, t dbSNP:541587272
5082 5082 -, c dbSNP:534151146
5124 5124 c, t dbSNP:561803954
5139 5139 a, g dbSNP:531050862
5190 5190 c, t dbSNP:551150791
5191 5191 a, g dbSNP:570813362
5198 5198 a, c dbSNP:533404808
5200 5200 c, t dbSNP:546604706
5208 5208 -, tcg dbSNP:753607913
5284 5284 a, g dbSNP:566501788
5325 5325 c, t dbSNP:557265376
5343 5343 -, aa dbSNP:58747637
5343 5343 a, t dbSNP:535820869
5388 5388 a, g dbSNP:182763560
5411 5411 c, t dbSNP:61080418
5421 5421 -, c dbSNP:764729763
5422 5422 c, t dbSNP:569327197
5424 5424 c, g dbSNP:573995032
5449 5449 c, t dbSNP:536897617
5498 5498 a, g dbSNP:187478880
5506 5506 a, g dbSNP:577221830
5513 5513 c, t dbSNP:546088965
5517 5517 a, c dbSNP:761743692
5519 5519 c, g dbSNP:3112704
5519 5519 c, g dbSNP:112319026
5522 5522 a, c dbSNP:191845035
5527 5527 a, g dbSNP:144753105
5543 5543 g, t dbSNP:561678389
5549 5549 c, t dbSNP:575253021
5559 5559 c, t dbSNP:544409330
5580 5580 a, g dbSNP:182493826
5585 5585 a, g dbSNP:533467818
5586 5586 c, t dbSNP:546919073
5659 5659 c, t dbSNP:556685997
5666 5666 a, c, t dbSNP:559677768
5676 5676 c, t dbSNP:11554593
5702 5702 c, g, t dbSNP:769734148
5709 5709 c, g dbSNP:549358180
5740 5740 c, t dbSNP:112703875
5763 5763 c, g dbSNP:539534788
5765 5765 a, g dbSNP:538298991
5785 5785 g, t dbSNP:751576674
5786 5786 c, t dbSNP:750511319
5787 5787 a, g dbSNP:757123594
5802 5802 c, t dbSNP:767388984
5811 5811 c, t dbSNP:550813362
5813 5813 a, t dbSNP:750180444
5818 5818 a, c dbSNP:373860725
5820 5820 a, t dbSNP:573302563
5823 5823 c, t dbSNP:766162407
5859 5859 a, t dbSNP:570686169
5875 5875 c, t dbSNP:539624769
5912 5912 a, c dbSNP:367757589
5921 5921 a, g dbSNP:371321013
5926 5926 c, t dbSNP:779625508
5933 5933 g, t dbSNP:368594243
5943 5943 -, tt dbSNP:545088750
5958 5958 a, g dbSNP:535107274
5959 5959 c, t dbSNP:773937993
6006 6006 -, gtgggg dbSNP:33994421
6071 6071 g, t dbSNP:555301555
6087 6087 c, g dbSNP:575259088
6097 6097 c, t dbSNP:543874303
6110 6110 -, c dbSNP:552798143
6111 6111 -, c dbSNP:565144559
6116 6116 a, c dbSNP:563817322
6117 6117 c, g dbSNP:56318884
6118 6118 -, c dbSNP:376887169
6147 6147 c, t dbSNP:550881899
6157 6157 a, g dbSNP:2335110
6210 6210 a, t dbSNP:561386521
6226 6226 a, t dbSNP:560670835
6237 6237 a, g dbSNP:187543589
6260 6260 c, g dbSNP:549120788
6262 6262 c, t dbSNP:2335111
6264 6264 c, t dbSNP:137906061
6307 6307 c, t dbSNP:755221626
6308 6308 a, g dbSNP:530400633
6347 6347 c, t dbSNP:551935898
6378 6378 c, g dbSNP:3095103
6401 6401 c, t dbSNP:539689181
6402 6402 a, g dbSNP:369381082
6433 6433 a, t dbSNP:565662700
6457 6457 a, g dbSNP:376666016
6473 6473 g, t dbSNP:566661760
6476 6476 c, t dbSNP:185737005
6486 6486 a, c dbSNP:190542981
6503 6503 c, g dbSNP:555090482
6515 6515 a, g dbSNP:754582678
6524 6524 -, a dbSNP:200815032
6554 6554 a, g dbSNP:200359888
6561 6561 a, g dbSNP:575224409
6592 6592 c, g dbSNP:537432131
6608 6608 c, g dbSNP:368831914
6620 6620 a, g dbSNP:557471998
6662 6662 g, t dbSNP:577316175
6721 6721 c, t dbSNP:540431729
6722 6722 c, g dbSNP:748479536
6742 6742 c, t dbSNP:371727709
6743 6743 a, g dbSNP:929457
6779 6779 a, g dbSNP:201156361
6795 6795 c, t dbSNP:534430467
6831 6831 a, g dbSNP:575136663
6844 6844 a, g dbSNP:184540154
6845 6845 c, t dbSNP:189062814
6861 6861 c, t dbSNP:778213681
6896 6896 g, t dbSNP:745355644
6898 6898 c, t dbSNP:545414930
6903 6903 -, gtaa dbSNP:5815128
6906 6906 -, agta dbSNP:3030674
6906 6906 -, gtaa dbSNP:761147047
6913 6913 c, t dbSNP:565379490
6977 6977 a, g dbSNP:527745262
6980 6980 a, g dbSNP:375159135
6991 6991 g, t dbSNP:566631892
7019 7019 a, g dbSNP:529055336
7020 7020 g, t dbSNP:549294670
7022 7022 a, g dbSNP:568802639
7024 7024 a, g dbSNP:537496663
7063 7063 -, tg dbSNP:771759264
7100 7100 c, t dbSNP:557285323
7120 7120 c, g dbSNP:571020949
7126 7126 g, t dbSNP:533610862
7136 7136 g, t dbSNP:554095762
7152 7152 a, t dbSNP:545626630
7156 7156 a, g dbSNP:574208711
7172 7172 a, g dbSNP:542840852
7173 7173 -, ttg dbSNP:540470378
7183 7183 c, g dbSNP:553056589
7194 7194 -, tg dbSNP:201869822
7209 7209 a, c dbSNP:748736402
7243 7243 c, t dbSNP:556860773
7323 7323 a, g dbSNP:11554591
7374 7374 g, t dbSNP:772425944
7391 7391 c, t dbSNP:576761849
7392 7392 -, t, tt dbSNP:111618468
7394 7394 a, g dbSNP:11554592
7399 7399 c, g, t dbSNP:181213412
7403 7403 -, tc dbSNP:201698119
7410 7410 a, c dbSNP:527809139
7421 7421 a, g dbSNP:557863257
7423 7423 a, g dbSNP:185318792
7447 7447 a, t dbSNP:189105574
7455 7455 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_011522522
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011522522

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
ATGGGTCGGA GAGCGGTGGC TTACCCACAG TATGACGCCG TGCCCATCCA GTCCAGCGTG 
GTGTTATGTT CCTGCCCATC CCCATCAATG GTGAGGACCC AGACTGAGTC CAGCACGCCC
CCTGGCATTC CTGGTGGCAG CAGGCAGGGC CCCGCCATGG ACGGCACTGC AGCCGAGCCT
CGGCCCGGCG CCGGCTCCCT GCAGCATGCC CAGCCTCCGC CGCAGCCTCG GAAGAAGCGG
CCTGAGGACT TCAAGTTTGG GAAAATCCTT GGGGAAGGCT CTTTTTCCAC GGTTGTCCTG
GCTCGAGAAC TGGCAACCTC CAGAGAATAT GCGATTAAAA TTCTGGAGAA GCGACATATC
ATAAAAGAGA ACAAGGTCCC CTATGTAACC AGAGAGCGGG ATGTCATGTC GCGCCTGGAT
CACCCCTTCT TTGTTAAGCT TTACTTCACA TTTCAGGACG ACGAGAAGCT GTATTTCGGC
CTTAGTTATG CCAAAAATGG AGAACTACTT AAATATATTC GCAAAATCGG TTCATTCGAT
GAGACCTGTA CCCGATTTTA CACGGCTGAG ATTGTGTCTG CTTTAGAGTA CTTGCACGGC
AAGGGCATCA TTCACAGGGA CCTTAAACCG GAAAACATTT TGTTAAATGA AGATATGCAC
ATCCAGATCA CAGATTTTGG AACAGCAAAA GTCTTATCCC CAGAGAGCAA ACAAGCCAGG
GCCAACTCAT TCGTGGGAAC AGCGCAGTAC GTTTCTCCAG AGCTGCTCAC GGAGAAGTCC
GCCTGTAAGA GTTCAGACCT TTGGGCTCTT GGATGCATAA TATACCAGCT TGTGGCAGGA
CTCCCACCAT TCCGAGCTGG AAACGAGTAT CTTATATTTC AGAAGATCAT TAAGTTGGAA
TATGACTTTC CAGAAAAATT CTTCCCTAAG GCAAGAGACC TCGTGGAGAA ACTTTTGGTT
TTAGATGCCA CAAAGCGGTT AGGCTGTGAG GAAATGGAAG GATACGGACC TCTTAAAGCA
CACCCGTTCT TCGAGTCCGT CACGTGGGAG AACCTGCACC AGCAGACGCC TCCGAAGCTC
ACCGCTTACC TGCCGGCTAT GTCGGAAGAC GACGAGGACT GCTATGGCAA TTATGACAAT
CTCCTGAGCC AGTTTGGCTG CATGCAGGTG TCTTCGTCCT CCTCCTCACA CTCCCTGTCA
GCCTCCGACA CGGGCCTGCC CCAGAGGTCA GGCAGCAACA TAGAGCAGTA CATTCACGAT
CTGGACTCGA ACTCCTTTGA ACTGGACTTA CAGTTTTCCG AAGATGAGAA GAGGTTGTTG
TTGGAGAAGC AGGCTGGCGG AAACCCTTGG CACCAGTTTG TAGAAAATAA TTTAATACTA
AAGATGGGCC CAGTGGATAA GCGGAAGGGT TTATTTGCAA GACGACGACA GCTGTTGCTC
ACAGAAGGAC CACATTTATA TTATGTGGAT CCTGTCAACA AAGTTCTGAA AGGTGAAATT
CCTTGGTCAC AAGAACTTCG ACCAGAGGCC AAGAATTTTA AAACTTTCTT TGTCCACACG
CCTAACAGGA CGTATTATCT GATGGACCCC AGCGGGAACG CACACAAGTG GTGCAGGAAG
ATCCAGGAGG TTTGGAGGCA GCGATACCAG AGCCACCCGG ACGCCGCTGT GCAGTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu48855
Accession Version XM_005255356.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1590bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
ATGGTGAGGA CCCAGACTGA GTCCAGCACG CCCCCTGGCA TTCCTGGTGG CAGCAGGCAG 
GGCCCCGCCA TGGACGGCAC TGCAGCCGAG CCTCGGCCCG GCGCCGGCTC CCTGCAGCAT
GCCCAGCCTC CGCCGCAGCC TCGGAAGAAG CGGCCTGAGG ACTTCAAGTT TGGGAAAATC
CTTGGGGAAG GCTCTTTTTC CACGGTTGTC CTGGCTCGAG AACTGGCAAC CTCCAGAGAA
TATGCGATTA AAATTCTGGA GAAGCGACAT ATCATAAAAG AGAACAAGGT CCCCTATGTA
ACCAGAGAGC GGGATGTCAT GTCGCGCCTG GATCACCCCT TCTTTGTTAA GCTTTACTTC
ACATTTCAGG ACGACGAGAA GCTGTATTTC GGCCTTAGTT ATGCCAAAAA TGGAGAACTA
CTTAAATATA TTCGCAAAAT CGGTTCATTC GATGAGACCT GTACCCGATT TTACACGGCT
GAGATTGTGT CTGCTTTAGA GTACTTGCAC GGCAAGGGCA TCATTCACAG GGACCTTAAA
CCGGAAAACA TTTTGTTAAA TGAAGATATG CACATCCAGA TCACAGATTT TGGAACAGCA
AAAGTCTTAT CCCCAGAGAG CAAACAAGCC AGGGCCAACT CATTCGTGGG AACAGCGCAG
TACGTTTCTC CAGAGCTGCT CACGGAGAAG TCCGCCTGTA AGAGTTCAGA CCTTTGGGCT
CTTGGATGCA TAATATACCA GCTTGTGGCA GGACTCCCAC CATTCCGAGC TGGAAACGAG
TATCTTATAT TTCAGAAGAT CATTAAGTTG GAATATGACT TTCCAGAAAA ATTCTTCCCT
AAGGCAAGAG ACCTCGTGGA GAAACTTTTG GTTTTAGATG CCACAAAGCG GTTAGGCTGT
GAGGAAATGG AAGGATACGG ACCTCTTAAA GCACACCCGT TCTTCGAGTC CGTCACGTGG
GAGAACCTGC ACCAGCAGAC GCCTCCGAAG CTCACCGCTT ACCTGCCGGC TATGTCGGAA
GACGACGAGG ACTGCTATGG CAATTATGAC AATCTCCTGA GCCAGTTTGG CTGCATGCAG
GTGTCTTCGT CCTCCTCCTC ACACTCCCTG TCAGCCTCCG ACACGGGCCT GCCCCAGAGG
TCAGGCAGCA ACATAGAGCA GTACATTCAC GATCTGGACT CGAACTCCTT TGAACTGGAC
TTACAGTTTT CCGAAGATGA GAAGAGGTTG TTGTTGGAGA AGCAGGCTGG CGGAAACCCT
TGGCACCAGT TTGTAGAAAA TAATTTAATA CTAAAGATGG GCCCAGTGGA TAAGCGGAAG
GGTTTATTTG CAAGACGACG ACAGCTGTTG CTCACAGAAG GACCACATTT ATATTATGTG
GATCCTGTCA ACAAAGTTCT GAAAGGTGAA ATTCCTTGGT CACAAGAACT TCGACCAGAG
GCCAAGAATT TTAAAACTTT CTTTGTCCAC ACGCCTAACA GGACGTATTA TCTGATGGAC
CCCAGCGGGA ACGCACACAA GTGGTGCAGG AAGATCCAGG AGGTTTGGAG GCAGCGATAC
CAGAGCCACC CGGACGCCGC TGTGCAGTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_005255413.1
CDS327..1916
Misc Feature(1)483..1271(+)
Misc Feature(2)489..1271(+)
Misc Feature(3)507..1094(+)
Misc Feature(4)507..914(+)
Misc Feature(5)519..1094(+)
Misc Feature(6)909..986(+)
Misc Feature(7)1566..1886(+)
Misc Feature(8)1638..1808(+)
Translation
Position Chain Variation Link
11 11 c, t dbSNP:554386561
29 29 a, g dbSNP:574291369
62 62 c, t dbSNP:756230861
130 130 g, t dbSNP:375222208
132 132 c, g dbSNP:751427856
143 143 c, g dbSNP:759476910
148 148 c, t dbSNP:368581424
160 160 g, t dbSNP:751645751
179 179 g, t dbSNP:767501518
199 199 a, t dbSNP:752718167
228 228 a, g dbSNP:756261088
256 256 a, g dbSNP:777838874
269 269 a, g dbSNP:187474021
296 296 c, t dbSNP:61747742
301 301 -, tgt dbSNP:750485483
331 331 c, t dbSNP:772871628
356 356 a, g dbSNP:762649804
367 367 c, t dbSNP:55824600
380 380 c, t dbSNP:770708494
392 392 c, t dbSNP:539550094
395 395 c, t dbSNP:759430577
396 396 a, g dbSNP:767328553
401 401 c, t dbSNP:752733022
411 411 c, g dbSNP:760555326
413 413 c, t dbSNP:553067229
414 414 a, g dbSNP:753919385
420 420 c, t dbSNP:757413961
421 421 a, g dbSNP:779166111
423 423 c, t dbSNP:750784265
425 425 c, t dbSNP:573496896
426 426 a, g dbSNP:780402170
428 428 c, t dbSNP:747501354
429 429 a, g dbSNP:769074523
431 431 c, t dbSNP:777349106
432 432 a, g dbSNP:748817353
435 435 g, t dbSNP:770692110
439 439 a, t dbSNP:774190389
443 443 a, g dbSNP:759232667
448 448 c, t dbSNP:771854875
456 456 c, g, t dbSNP:775183994
457 457 c, t dbSNP:535696352
458 458 a, g dbSNP:776681039
460 460 c, t dbSNP:761949625
461 461 a, g dbSNP:765411861
469 469 a, g dbSNP:750705121
476 476 a, g dbSNP:372064092
477 477 c, t dbSNP:766725088
478 478 a, g dbSNP:751870190
480 480 a, c, g dbSNP:755452051
483 483 c, g dbSNP:748800896
486 486 a, g dbSNP:756879724
488 488 c, t dbSNP:778591061
493 493 a, g dbSNP:745496613
503 503 a, g dbSNP:575887920
506 506 c, t dbSNP:758319
509 509 c, t dbSNP:775298281
514 514 -, a dbSNP:780646954
518 518 -, ct dbSNP:747519638
519 519 g, t dbSNP:746838429
527 527 a, c dbSNP:146388630
530 530 a, g dbSNP:776593118
622 622 a, g dbSNP:551607067
698 698 -, cgac dbSNP:748593314
700 700 a, t dbSNP:748035328
701 701 c, t dbSNP:769723811
773 773 a, g dbSNP:2041206
965 965 c, g dbSNP:764571812
971 971 c, t dbSNP:749948247
980 980 a, g dbSNP:574452215
982 982 c, t dbSNP:757889593
986 986 a, g dbSNP:543688348
990 990 a, g dbSNP:370069297
999 999 a, g dbSNP:373278831
1001 1001 a, g dbSNP:139543796
1004 1004 a, g dbSNP:780894116
1009 1009 c, t dbSNP:144186731
1018 1018 c, t dbSNP:769705993
1019 1019 c, t dbSNP:200735205
1020 1020 a, g dbSNP:749355083
1378 1378 a, g dbSNP:755812280
1383 1383 c, g dbSNP:763731140
1391 1391 g, t dbSNP:561462097
1399 1399 a, g dbSNP:753681549
1405 1405 a, g dbSNP:370279457
1414 1414 c, t dbSNP:779064858
1415 1415 c, g dbSNP:377095764
1418 1418 c, g dbSNP:758602254
1423 1423 c, g dbSNP:200076126
1432 1432 c, g dbSNP:780305703
1433 1433 c, t dbSNP:747157063
1434 1434 c, g dbSNP:768924605
1435 1435 g, t dbSNP:776800040
1436 1436 a, g dbSNP:748599366
1438 1438 c, t dbSNP:370494924
1445 1445 c, t dbSNP:773747255
1448 1448 c, t dbSNP:759022782
1449 1449 a, g dbSNP:76887737
1450 1450 c, t dbSNP:75824263
1451 1451 a, c, g, t dbSNP:75077217
1453 1453 a, g dbSNP:139732994
1455 1455 c, t dbSNP:201780963
1459 1459 a, c dbSNP:535986266
1460 1460 c, g dbSNP:750340247
1468 1468 c, t dbSNP:758443705
1473 1473 a, g dbSNP:780213417
1475 1475 c, t dbSNP:747123753
1476 1476 a, c dbSNP:755138312
1477 1477 a, g dbSNP:149931764
1487 1487 a, g dbSNP:748428723
1489 1489 a, g dbSNP:770192179
1490 1490 c, t dbSNP:778131329
1496 1496 c, t dbSNP:532663585
1498 1498 a, g dbSNP:771442872
1499 1499 c, t dbSNP:774850892
1500 1500 c, t dbSNP:760300604
1507 1507 c, t dbSNP:547797391
1508 1508 a, c, g dbSNP:768166848
1511 1511 c, t dbSNP:761396833
1513 1513 c, g dbSNP:765088097
1525 1525 a, t dbSNP:552355299
1530 1530 c, g dbSNP:145034828
1538 1538 c, t dbSNP:766478163
1539 1539 a, g dbSNP:751583488
1544 1544 c, t dbSNP:145594574
1552 1552 a, g dbSNP:374111988
1554 1554 c, t dbSNP:752913176
1560 1560 c, t dbSNP:756358328
1563 1563 g, t dbSNP:142153837
1564 1564 a, t dbSNP:749712375
1577 1577 c, t dbSNP:771424447
1579 1579 g, t dbSNP:533780852
1605 1605 a, g dbSNP:374649760
1611 1611 c, t dbSNP:777350674
1641 1641 c, t dbSNP:753410336
1658 1658 a, g dbSNP:535332245
1676 1676 c, g dbSNP:773372279
1682 1682 a, g dbSNP:763017868
1697 1697 a, g dbSNP:771291308
1700 1700 c, t dbSNP:774842989
1703 1703 c, t dbSNP:760019244
1716 1716 a, g dbSNP:768116696
1717 1717 a, t dbSNP:775814028
1734 1734 a, g dbSNP:761277571
1750 1750 a, g dbSNP:764588339
1754 1754 a, t dbSNP:749966481
1767 1767 a, g dbSNP:758036081
1786 1786 a, t dbSNP:766091042
1798 1798 c, t dbSNP:549158095
1799 1799 a, g dbSNP:751320393
1805 1805 c, t dbSNP:752547402
1811 1811 a, g, t dbSNP:755991413
1823 1823 a, g dbSNP:749357936
1832 1832 c, t dbSNP:147843249
1838 1838 c, t dbSNP:141143951
1854 1854 a, c dbSNP:143425561
1868 1868 c, g dbSNP:551293304
1869 1869 a, g dbSNP:772355571
1877 1877 a, g dbSNP:775707536
1882 1882 a, g dbSNP:148008907
1898 1898 a, g dbSNP:747477279
1901 1901 c, t dbSNP:201375554
1904 1904 c, t dbSNP:201646295
1905 1905 a, g dbSNP:201983709
1913 1913 a, g dbSNP:770386112
1917 1917 c, t dbSNP:141708903
1918 1918 g, t dbSNP:759130714
1926 1926 c, t dbSNP:567030364
1927 1927 a, g dbSNP:371050359
1930 1930 c, t dbSNP:760558101
1931 1931 a, g dbSNP:375625632
1942 1942 c, t dbSNP:753787792
1943 1943 a, g, t dbSNP:757267684
1944 1944 c, t dbSNP:750591733
1948 1948 c, t dbSNP:758548197
1949 1949 a, g dbSNP:775000968
1951 1951 a, g dbSNP:747310334
1957 1957 c, t dbSNP:763407617
1961 1961 c, t dbSNP:769012428
1964 1964 g, t dbSNP:781565770
1965 1965 c, t dbSNP:748585190
1966 1966 a, g dbSNP:770298078
1967 1967 c, t dbSNP:368140738
1968 1968 a, g dbSNP:111905533
1969 1969 g, t dbSNP:374100568
1983 1983 c, t dbSNP:759166098
1990 1990 c, t dbSNP:576603878
2024 2024 c, t dbSNP:10866
2061 2061 a, g dbSNP:3087784
2066 2066 a, g dbSNP:559332782
2076 2076 a, c dbSNP:563682651
2101 2101 a, g dbSNP:375635017
2103 2103 c, g dbSNP:776687154
2117 2117 a, g dbSNP:762295195
2147 2147 g, t dbSNP:767628948
2152 2152 a, t dbSNP:572774850
2155 2155 c, g dbSNP:752529981
2185 2185 c, g dbSNP:529226935
2192 2192 c, g dbSNP:148121766
2199 2199 a, c dbSNP:561226269
2212 2212 c, t dbSNP:140982354
2218 2218 c, t dbSNP:13335284
2219 2219 a, g dbSNP:369818229
2222 2222 c, t dbSNP:374470586
2254 2254 g, t dbSNP:371038846
2280 2280 g, t dbSNP:563611183
2287 2287 c, t dbSNP:543128805
2295 2295 a, g dbSNP:531570429
2316 2316 a, g dbSNP:528250860
2325 2325 g, t dbSNP:189787811
2346 2346 c, t dbSNP:754005480
2361 2361 a, g dbSNP:753864539
2401 2401 a, g dbSNP:571210384
2404 2404 c, t dbSNP:758382220
2411 2411 g, t dbSNP:181078294
2416 2416 -, cgggggccgcagctttgtgg dbSNP:374612917
2421 2421 a, g dbSNP:113332295
2425 2425 a, g dbSNP:547002823
2432 2432 a, t dbSNP:559554679
2446 2446 c, g dbSNP:751303008
2456 2456 a, c dbSNP:375417064
2496 2496 a, t dbSNP:535850233
2502 2502 a, t dbSNP:556257698
2526 2526 c, t dbSNP:780858375
2535 2535 g, t dbSNP:750481961
2543 2543 c, t dbSNP:185952911
2548 2548 c, t dbSNP:539284441
2552 2552 -, a dbSNP:560922224
2562 2562 a, g dbSNP:559150292
2564 2564 a, g dbSNP:572787105
2627 2627 a, g dbSNP:541712873
2648 2648 c, g dbSNP:79745244
2673 2673 g, t dbSNP:574807920
2685 2685 c, g dbSNP:745471795
2693 2693 a, t dbSNP:528570052
2704 2704 c, t dbSNP:138049982
2720 2720 c, t dbSNP:769465822
2733 2733 a, g dbSNP:563848860
2747 2747 c, t dbSNP:779506921
2752 2752 c, g dbSNP:748844927
2799 2799 g, t dbSNP:71386677
2803 2803 c, g dbSNP:142512073
2850 2850 a, g dbSNP:762232443
2862 2862 a, g dbSNP:564701168
2916 2916 c, t dbSNP:190327635
2927 2927 -, a dbSNP:571502069
2954 2954 a, g dbSNP:547314582
2961 2961 c, t dbSNP:78560075
2970 2970 g, t dbSNP:529734340
2982 2982 a, g dbSNP:138756291
3000 3000 g, t dbSNP:760941132
3012 3012 a, g dbSNP:766750148
3014 3014 c, g dbSNP:769055116
3066 3066 c, t dbSNP:76291069
3081 3081 a, g dbSNP:74003037
3099 3099 -, g dbSNP:765252878
3124 3124 c, t dbSNP:144433575
3133 3133 c, t dbSNP:566250204
3142 3142 c, t dbSNP:550576606
3145 3145 a, g dbSNP:748644397
3167 3167 c, t dbSNP:759751812
3168 3168 a, g dbSNP:376035884
3188 3188 c, t dbSNP:148393103
3189 3189 a, c, g dbSNP:141692563
3204 3204 g, t dbSNP:147153606
3215 3215 c, t dbSNP:183283033
3234 3234 a, c dbSNP:576938086
3239 3239 c, t dbSNP:770202665
3269 3269 c, t dbSNP:545861137
3294 3294 a, t dbSNP:559396383
3302 3302 c, t dbSNP:28679688
3394 3394 -, tgc dbSNP:149315179
3422 3422 a, g dbSNP:540817771
3435 3435 c, t dbSNP:561282155
3557 3557 a, g dbSNP:370396602
3569 3569 c, t dbSNP:367998725
3581 3581 c, g dbSNP:529898940
3605 3605 c, t dbSNP:549760673
3622 3622 c, g dbSNP:373772013
3625 3625 c, g dbSNP:372067195
3650 3650 a, c dbSNP:532266776
3722 3722 c, t dbSNP:552329672
3723 3723 a, g dbSNP:4786296
3735 3735 a, g dbSNP:565767072
3765 3765 c, t dbSNP:535278860
3816 3816 g, t dbSNP:4786297
3831 3831 c, g dbSNP:548496512
3866 3866 a, g dbSNP:568740588
3870 3870 a, g dbSNP:147975625
3892 3892 -, gtcctgtgtctccat dbSNP:370970044
3892 3892 g, t dbSNP:537310185
3908 3908 g, t dbSNP:557345495
3940 3940 a, g dbSNP:187363186
3952 3952 c, g dbSNP:28457160
3953 3953 a, g dbSNP:535074412
3954 3954 a, g dbSNP:572997169
3984 3984 g, t dbSNP:113716221
4001 4001 c, t dbSNP:541222591
4015 4015 c, t dbSNP:190975527
4020 4020 c, t dbSNP:574692618
4021 4021 a, g dbSNP:543323513
4031 4031 c, t dbSNP:563577752
4105 4105 a, g dbSNP:113054936
4114 4114 c, t dbSNP:532181910
4136 4136 a, g dbSNP:28615548
4145 4145 c, t dbSNP:775324213
4157 4157 c, t dbSNP:565667834
4164 4164 c, t dbSNP:372950862
4171 4171 c, t dbSNP:559538467
4174 4174 c, t dbSNP:534714693
4208 4208 c, t dbSNP:548777339
4226 4226 c, t dbSNP:149131034
4243 4243 c, t dbSNP:531109247
4271 4271 c, t dbSNP:551022507
4294 4294 c, g dbSNP:71386681
4316 4316 c, t dbSNP:570799401
4326 4326 g, t dbSNP:539495695
4331 4331 a, g dbSNP:552900581
4339 4339 a, g dbSNP:566632715
4359 4359 a, g dbSNP:535544455
4372 4372 c, t dbSNP:558027230
4373 4373 g, t dbSNP:577872209
4407 4407 -, a dbSNP:199508475
4481 4481 c, t dbSNP:554773031
4497 4497 a, g dbSNP:574574151
4499 4499 c, g, t dbSNP:543744889
4508 4508 a, c dbSNP:557336688
4514 4514 c, t dbSNP:147659496
4531 4531 c, t dbSNP:577209776
4537 4537 c, t dbSNP:545819504
4639 4639 a, g dbSNP:559353007
4883 4883 c, t dbSNP:528209602
4914 4914 c, t dbSNP:541587272
4927 4927 -, c dbSNP:534151146
4969 4969 c, t dbSNP:561803954
4984 4984 a, g dbSNP:531050862
5035 5035 c, t dbSNP:551150791
5036 5036 a, g dbSNP:570813362
5043 5043 a, c dbSNP:533404808
5045 5045 c, t dbSNP:546604706
5053 5053 -, tcg dbSNP:753607913
5129 5129 a, g dbSNP:566501788
5170 5170 c, t dbSNP:557265376
5188 5188 -, aa dbSNP:58747637
5188 5188 a, t dbSNP:535820869
5233 5233 a, g dbSNP:182763560
5256 5256 c, t dbSNP:61080418
5266 5266 -, c dbSNP:764729763
5267 5267 c, t dbSNP:569327197
5269 5269 c, g dbSNP:573995032
5294 5294 c, t dbSNP:536897617
5343 5343 a, g dbSNP:187478880
5351 5351 a, g dbSNP:577221830
5358 5358 c, t dbSNP:546088965
5362 5362 a, c dbSNP:761743692
5364 5364 c, g dbSNP:3112704
5364 5364 c, g dbSNP:112319026
5367 5367 a, c dbSNP:191845035
5372 5372 a, g dbSNP:144753105
5388 5388 g, t dbSNP:561678389
5394 5394 c, t dbSNP:575253021
5404 5404 c, t dbSNP:544409330
5425 5425 a, g dbSNP:182493826
5430 5430 a, g dbSNP:533467818
5431 5431 c, t dbSNP:546919073
5504 5504 c, t dbSNP:556685997
5511 5511 a, c, t dbSNP:559677768
5521 5521 c, t dbSNP:11554593
5547 5547 c, g, t dbSNP:769734148
5554 5554 c, g dbSNP:549358180
5585 5585 c, t dbSNP:112703875
5608 5608 c, g dbSNP:539534788
5610 5610 a, g dbSNP:538298991
5630 5630 g, t dbSNP:751576674
5631 5631 c, t dbSNP:750511319
5632 5632 a, g dbSNP:757123594
5647 5647 c, t dbSNP:767388984
5656 5656 c, t dbSNP:550813362
5658 5658 a, t dbSNP:750180444
5663 5663 a, c dbSNP:373860725
5665 5665 a, t dbSNP:573302563
5668 5668 c, t dbSNP:766162407
5704 5704 a, t dbSNP:570686169
5720 5720 c, t dbSNP:539624769
5757 5757 a, c dbSNP:367757589
5766 5766 a, g dbSNP:371321013
5771 5771 c, t dbSNP:779625508
5778 5778 g, t dbSNP:368594243
5788 5788 -, tt dbSNP:545088750
5803 5803 a, g dbSNP:535107274
5804 5804 c, t dbSNP:773937993
5851 5851 -, gtgggg dbSNP:33994421
5916 5916 g, t dbSNP:555301555
5932 5932 c, g dbSNP:575259088
5942 5942 c, t dbSNP:543874303
5955 5955 -, c dbSNP:552798143
5956 5956 -, c dbSNP:565144559
5961 5961 a, c dbSNP:563817322
5962 5962 c, g dbSNP:56318884
5963 5963 -, c dbSNP:376887169
5992 5992 c, t dbSNP:550881899
6002 6002 a, g dbSNP:2335110
6055 6055 a, t dbSNP:561386521
6071 6071 a, t dbSNP:560670835
6082 6082 a, g dbSNP:187543589
6105 6105 c, g dbSNP:549120788
6107 6107 c, t dbSNP:2335111
6109 6109 c, t dbSNP:137906061
6152 6152 c, t dbSNP:755221626
6153 6153 a, g dbSNP:530400633
6192 6192 c, t dbSNP:551935898
6223 6223 c, g dbSNP:3095103
6246 6246 c, t dbSNP:539689181
6247 6247 a, g dbSNP:369381082
6278 6278 a, t dbSNP:565662700
6302 6302 a, g dbSNP:376666016
6318 6318 g, t dbSNP:566661760
6321 6321 c, t dbSNP:185737005
6331 6331 a, c dbSNP:190542981
6348 6348 c, g dbSNP:555090482
6360 6360 a, g dbSNP:754582678
6369 6369 -, a dbSNP:200815032
6399 6399 a, g dbSNP:200359888
6406 6406 a, g dbSNP:575224409
6437 6437 c, g dbSNP:537432131
6453 6453 c, g dbSNP:368831914
6465 6465 a, g dbSNP:557471998
6507 6507 g, t dbSNP:577316175
6566 6566 c, t dbSNP:540431729
6567 6567 c, g dbSNP:748479536
6587 6587 c, t dbSNP:371727709
6588 6588 a, g dbSNP:929457
6624 6624 a, g dbSNP:201156361
6640 6640 c, t dbSNP:534430467
6676 6676 a, g dbSNP:575136663
6689 6689 a, g dbSNP:184540154
6690 6690 c, t dbSNP:189062814
6706 6706 c, t dbSNP:778213681
6741 6741 g, t dbSNP:745355644
6743 6743 c, t dbSNP:545414930
6748 6748 -, gtaa dbSNP:5815128
6751 6751 -, agta dbSNP:3030674
6751 6751 -, gtaa dbSNP:761147047
6758 6758 c, t dbSNP:565379490
6822 6822 a, g dbSNP:527745262
6825 6825 a, g dbSNP:375159135
6836 6836 g, t dbSNP:566631892
6864 6864 a, g dbSNP:529055336
6865 6865 g, t dbSNP:549294670
6867 6867 a, g dbSNP:568802639
6869 6869 a, g dbSNP:537496663
6908 6908 -, tg dbSNP:771759264
6945 6945 c, t dbSNP:557285323
6965 6965 c, g dbSNP:571020949
6971 6971 g, t dbSNP:533610862
6981 6981 g, t dbSNP:554095762
6997 6997 a, t dbSNP:545626630
7001 7001 a, g dbSNP:574208711
7017 7017 a, g dbSNP:542840852
7018 7018 -, ttg dbSNP:540470378
7028 7028 c, g dbSNP:553056589
7039 7039 -, tg dbSNP:201869822
7054 7054 a, c dbSNP:748736402
7088 7088 c, t dbSNP:556860773
7168 7168 a, g dbSNP:11554591
7219 7219 g, t dbSNP:772425944
7236 7236 c, t dbSNP:576761849
7237 7237 -, t, tt dbSNP:111618468
7239 7239 a, g dbSNP:11554592
7244 7244 c, g, t dbSNP:181213412
7248 7248 -, tc dbSNP:201698119
7255 7255 a, c dbSNP:527809139
7266 7266 a, g dbSNP:557863257
7268 7268 a, g dbSNP:185318792
7292 7292 a, t dbSNP:189105574
7300 7300 a, t dbSNP:541541489

Target ORF information:

RefSeq Version XM_005255356
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_005255356

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
ATGGTGAGGA CCCAGACTGA GTCCAGCACG CCCCCTGGCA TTCCTGGTGG CAGCAGGCAG 
GGCCCCGCCA TGGACGGCAC TGCAGCCGAG CCTCGGCCCG GCGCCGGCTC CCTGCAGCAT
GCCCAGCCTC CGCCGCAGCC TCGGAAGAAG CGGCCTGAGG ACTTCAAGTT TGGGAAAATC
CTTGGGGAAG GCTCTTTTTC CACGGTTGTC CTGGCTCGAG AACTGGCAAC CTCCAGAGAA
TATGCGATTA AAATTCTGGA GAAGCGACAT ATCATAAAAG AGAACAAGGT CCCCTATGTA
ACCAGAGAGC GGGATGTCAT GTCGCGCCTG GATCACCCCT TCTTTGTTAA GCTTTACTTC
ACATTTCAGG ACGACGAGAA GCTGTATTTC GGCCTTAGTT ATGCCAAAAA TGGAGAACTA
CTTAAATATA TTCGCAAAAT CGGTTCATTC GATGAGACCT GTACCCGATT TTACACGGCT
GAGATTGTGT CTGCTTTAGA GTACTTGCAC GGCAAGGGCA TCATTCACAG GGACCTTAAA
CCGGAAAACA TTTTGTTAAA TGAAGATATG CACATCCAGA TCACAGATTT TGGAACAGCA
AAAGTCTTAT CCCCAGAGAG CAAACAAGCC AGGGCCAACT CATTCGTGGG AACAGCGCAG
TACGTTTCTC CAGAGCTGCT CACGGAGAAG TCCGCCTGTA AGAGTTCAGA CCTTTGGGCT
CTTGGATGCA TAATATACCA GCTTGTGGCA GGACTCCCAC CATTCCGAGC TGGAAACGAG
TATCTTATAT TTCAGAAGAT CATTAAGTTG GAATATGACT TTCCAGAAAA ATTCTTCCCT
AAGGCAAGAG ACCTCGTGGA GAAACTTTTG GTTTTAGATG CCACAAAGCG GTTAGGCTGT
GAGGAAATGG AAGGATACGG ACCTCTTAAA GCACACCCGT TCTTCGAGTC CGTCACGTGG
GAGAACCTGC ACCAGCAGAC GCCTCCGAAG CTCACCGCTT ACCTGCCGGC TATGTCGGAA
GACGACGAGG ACTGCTATGG CAATTATGAC AATCTCCTGA GCCAGTTTGG CTGCATGCAG
GTGTCTTCGT CCTCCTCCTC ACACTCCCTG TCAGCCTCCG ACACGGGCCT GCCCCAGAGG
TCAGGCAGCA ACATAGAGCA GTACATTCAC GATCTGGACT CGAACTCCTT TGAACTGGAC
TTACAGTTTT CCGAAGATGA GAAGAGGTTG TTGTTGGAGA AGCAGGCTGG CGGAAACCCT
TGGCACCAGT TTGTAGAAAA TAATTTAATA CTAAAGATGG GCCCAGTGGA TAAGCGGAAG
GGTTTATTTG CAAGACGACG ACAGCTGTTG CTCACAGAAG GACCACATTT ATATTATGTG
GATCCTGTCA ACAAAGTTCT GAAAGGTGAA ATTCCTTGGT CACAAGAACT TCGACCAGAG
GCCAAGAATT TTAAAACTTT CTTTGTCCAC ACGCCTAACA GGACGTATTA TCTGATGGAC
CCCAGCGGGA ACGCACACAA GTGGTGCAGG AAGATCCAGG AGGTTTGGAG GCAGCGATAC
CAGAGCCACC CGGACGCCGC TGTGCAGTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu59608
Accession Version XM_011522523.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1392bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product 3-phosphoinositide-dependent protein kinase 1 isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
ATGTTGAAGA TGTGGGTTAG TGAAATTGAG ACCTGGCGCT TCCTGAGGCT GGCAGCCCGG 
TTGAGCCTGA GGACCAGACT TGAGGCAGTT GGCAGTCCGC GCCTCGTTGC CCTCTGTCTG
CCCTGGTATG ACGCCGTGCC CATCCAGTCC AGCGTGGTGT TATGTTCCTG CCCATCCCCA
TCAATGGTGA GGACCCAGAC TGAGTCCAGC ACGCCCCCTG GCATTCCTGG TGGCAGCAGG
CAGGGCCCCG CCATGGACGG CACTGCAGCC GAGCCTCGGC CCGGCGCCGG CTCCCTGCAG
CATGCCCAGC CTCCGCCGCA GCCTCGGAAG AAGCGGCCTG AGGACTTCAA GTTTGGGAAA
ATCCTTGGGG AAGGCTCTTT TTCCACGGTT GTCCTGGCTC GAGAACTGGC AACCTCCAGA
GAATATGCGA CCAGGGCCAA CTCATTCGTG GGAACAGCGC AGTACGTTTC TCCAGAGCTG
CTCACGGAGA AGTCCGCCTG TAAGAGTTCA GACCTTTGGG CTCTTGGATG CATAATATAC
CAGCTTGTGG CAGGACTCCC ACCATTCCGA GCTGGAAACG AGTATCTTAT ATTTCAGAAG
ATCATTAAGT TGGAATATGA CTTTCCAGAA AAATTCTTCC CTAAGGCAAG AGACCTCGTG
GAGAAACTTT TGGTTTTAGA TGCCACAAAG CGGTTAGGCT GTGAGGAAAT GGAAGGATAC
GGACCTCTTA AAGCACACCC GTTCTTCGAG TCCGTCACGT GGGAGAACCT GCACCAGCAG
ACGCCTCCGA AGCTCACCGC TTACCTGCCG GCTATGTCGG AAGACGACGA GGACTGCTAT
GGCAATTATG ACAATCTCCT GAGCCAGTTT GGCTGCATGC AGGTGTCTTC GTCCTCCTCC
TCACACTCCC TGTCAGCCTC CGACACGGGC CTGCCCCAGA GGTCAGGCAG CAACATAGAG
CAGTACATTC ACGATCTGGA CTCGAACTCC TTTGAACTGG ACTTACAGTT TTCCGAAGAT
GAGAAGAGGT TGTTGTTGGA GAAGCAGGCT GGCGGAAACC CTTGGCACCA GTTTGTAGAA
AATAATTTAA TACTAAAGAT GGGCCCAGTG GATAAGCGGA AGGGTTTATT TGCAAGACGA
CGACAGCTGT TGCTCACAGA AGGACCACAT TTATATTATG TGGATCCTGT CAACAAAGTT
CTGAAAGGTG AAATTCCTTG GTCACAAGAA CTTCGACCAG AGGCCAAGAA TTTTAAAACT
TTCTTTGTCC ACACGCCTAA CAGGACGTAT TATCTGATGG ACCCCAGCGG GAACGCACAC
AAGTGGTGCA GGAAGATCCA GGAGGTTTGG AGGCAGCGAT ACCAGAGCCA CCCGGACGCC
GCTGTGCAGT GA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011520825.1
CDS947..2338
Misc Feature(1)1289..1693(+)
Misc Feature(2)1988..2308(+)
Misc Feature(3)2060..2230(+)
Translation
Position Chain Variation Link
236 236 c, t dbSNP:547040445
255 255 c, g dbSNP:374019322
262 262 c, g dbSNP:561153470
272 272 -, gatt dbSNP:150836742
331 331 c, t dbSNP:530277736
351 351 a, g dbSNP:376949540
355 355 a, g dbSNP:550228970
372 372 a, g dbSNP:570354791
402 402 a, c dbSNP:111439925
425 425 a, g dbSNP:538947141
522 522 c, t dbSNP:552643682
546 546 a, c dbSNP:566033938
576 576 a, c dbSNP:780121126
580 580 a, c dbSNP:535133318
894 894 a, g dbSNP:555066937
909 909 g, t dbSNP:573906874
1099 1099 c, t dbSNP:61747742
1104 1104 -, tgt dbSNP:750485483
1134 1134 c, t dbSNP:772871628
1159 1159 a, g dbSNP:762649804
1170 1170 c, t dbSNP:55824600
1183 1183 c, t dbSNP:770708494
1195 1195 c, t dbSNP:539550094
1198 1198 c, t dbSNP:759430577
1199 1199 a, g dbSNP:767328553
1204 1204 c, t dbSNP:752733022
1214 1214 c, g dbSNP:760555326
1216 1216 c, t dbSNP:553067229
1217 1217 a, g dbSNP:753919385
1223 1223 c, t dbSNP:757413961
1224 1224 a, g dbSNP:779166111
1226 1226 c, t dbSNP:750784265
1228 1228 c, t dbSNP:573496896
1229 1229 a, g dbSNP:780402170
1231 1231 c, t dbSNP:747501354
1232 1232 a, g dbSNP:769074523
1234 1234 c, t dbSNP:777349106
1235 1235 a, g dbSNP:748817353
1238 1238 g, t dbSNP:770692110
1242 1242 a, t dbSNP:774190389
1246 1246 a, g dbSNP:759232667
1251 1251 c, t dbSNP:771854875
1259 1259 c, g, t dbSNP:775183994
1260 1260 c, t dbSNP:535696352
1261 1261 a, g dbSNP:776681039
1263 1263 c, t dbSNP:761949625
1264 1264 a, g dbSNP:765411861
1272 1272 a, g dbSNP:750705121
1279 1279 a, g dbSNP:372064092
1280 1280 c, t dbSNP:766725088
1281 1281 a, g dbSNP:751870190
1283 1283 a, c, g dbSNP:755452051
1286 1286 c, g dbSNP:748800896
1289 1289 a, g dbSNP:756879724
1291 1291 c, t dbSNP:778591061
1296 1296 a, g dbSNP:745496613
1306 1306 a, g dbSNP:575887920
1309 1309 c, t dbSNP:758319
1312 1312 c, t dbSNP:775298281
1317 1317 -, a dbSNP:780646954
1321 1321 -, ct dbSNP:747519638
1322 1322 g, t dbSNP:746838429
1330 1330 a, c dbSNP:146388630
1333 1333 a, g dbSNP:776593118
1387 1387 c, g dbSNP:764571812
1393 1393 c, t dbSNP:749948247
1402 1402 a, g dbSNP:574452215
1404 1404 c, t dbSNP:757889593
1408 1408 a, g dbSNP:543688348
1412 1412 a, g dbSNP:370069297
1421 1421 a, g dbSNP:373278831
1423 1423 a, g dbSNP:139543796
1426 1426 a, g dbSNP:780894116
1431 1431 c, t dbSNP:144186731
1440 1440 c, t dbSNP:769705993
1441 1441 c, t dbSNP:200735205
1442 1442 a, g dbSNP:749355083
1800 1800 a, g dbSNP:755812280
1805 1805 c, g dbSNP:763731140
1813 1813 g, t dbSNP:561462097
1821 1821 a, g dbSNP:753681549
1827 1827 a, g dbSNP:370279457
1836 1836 c, t dbSNP:779064858
1837 1837 c, g dbSNP:377095764
1840 1840 c, g dbSNP:758602254
1845 1845 c, g dbSNP:200076126
1854 1854 c, g dbSNP:780305703
1855 1855 c, t dbSNP:747157063
1856 1856 c, g dbSNP:768924605
1857 1857 g, t dbSNP:776800040
1858 1858 a, g dbSNP:748599366
1860 1860 c, t dbSNP:370494924
1867 1867 c, t dbSNP:773747255
1870 1870 c, t dbSNP:759022782
1871 1871 a, g dbSNP:76887737
1872 1872 c, t dbSNP:75824263
1873 1873 a, c, g, t dbSNP:75077217
1875 1875 a, g dbSNP:139732994
1877 1877 c, t dbSNP:201780963
1881 1881 a, c dbSNP:535986266
1882 1882 c, g dbSNP:750340247
1890 1890 c, t dbSNP:758443705
1895 1895 a, g dbSNP:780213417
1897 1897 c, t dbSNP:747123753
1898 1898 a, c dbSNP:755138312
1899 1899 a, g dbSNP:149931764
1909 1909 a, g dbSNP:748428723
1911 1911 a, g dbSNP:770192179
1912 1912 c, t dbSNP:778131329
1918 1918 c, t dbSNP:532663585
1920 1920 a, g dbSNP:771442872
1921 1921 c, t dbSNP:774850892
1922 1922 c, t dbSNP:760300604
1929 1929 c, t dbSNP:547797391
1930 1930 a, c, g dbSNP:768166848
1933 1933 c, t dbSNP:761396833
1935 1935 c, g dbSNP:765088097
1947 1947 a, t dbSNP:552355299
1952 1952 c, g dbSNP:145034828
1960 1960 c, t dbSNP:766478163
1961 1961 a, g dbSNP:751583488
1966 1966 c, t dbSNP:145594574
1974 1974 a, g dbSNP:374111988
1976 1976 c, t dbSNP:752913176
1982 1982 c, t dbSNP:756358328
1985 1985 g, t dbSNP:142153837
1986 1986 a, t dbSNP:749712375
1999 1999 c, t dbSNP:771424447
2001 2001 g, t dbSNP:533780852
2027 2027 a, g dbSNP:374649760
2033 2033 c, t dbSNP:777350674
2063 2063 c, t dbSNP:753410336
2080 2080 a, g dbSNP:535332245
2098 2098 c, g dbSNP:773372279
2104 2104 a, g dbSNP:763017868
2119 2119 a, g dbSNP:771291308
2122 2122 c, t dbSNP:774842989
2125 2125 c, t dbSNP:760019244
2138 2138 a, g dbSNP:768116696
2139 2139 a, t dbSNP:775814028
2156 2156 a, g dbSNP:761277571
2172 2172 a, g dbSNP:764588339
2176 2176 a, t dbSNP:749966481
2189 2189 a, g dbSNP:758036081
2208 2208 a, t dbSNP:766091042
2220 2220 c, t dbSNP:549158095
2221 2221 a, g dbSNP:751320393
2227 2227 c, t dbSNP:752547402
2233 2233 a, g, t dbSNP:755991413
2245 2245 a, g dbSNP:749357936
2254 2254 c, t dbSNP:147843249
2260 2260 c, t dbSNP:141143951
2276 2276 a, c dbSNP:143425561
2290 2290 c, g dbSNP:551293304
2291 2291 a, g dbSNP:772355571
2299 2299 a, g dbSNP:775707536
2304 2304 a, g dbSNP:148008907
2320 2320 a, g dbSNP:747477279
2323 2323 c, t dbSNP:201375554
2326 2326 c, t dbSNP:201646295
2327 2327 a, g dbSNP:201983709
2335 2335 a, g dbSNP:770386112
2339 2339 c, t dbSNP:141708903
2340 2340 g, t dbSNP:759130714
2348 2348 c, t dbSNP:567030364
2349 2349 a, g dbSNP:371050359
2352 2352 c, t dbSNP:760558101
2353 2353 a, g dbSNP:375625632
2364 2364 c, t dbSNP:753787792
2365 2365 a, g, t dbSNP:757267684
2366 2366 c, t dbSNP:750591733
2370 2370 c, t dbSNP:758548197
2371 2371 a, g dbSNP:775000968
2373 2373 a, g dbSNP:747310334
2379 2379 c, t dbSNP:763407617
2383 2383 c, t dbSNP:769012428
2386 2386 g, t dbSNP:781565770
2387 2387 c, t dbSNP:748585190
2388 2388 a, g dbSNP:770298078
2389 2389 c, t dbSNP:368140738
2390 2390 a, g dbSNP:111905533
2391 2391 g, t dbSNP:374100568
2405 2405 c, t dbSNP:759166098
2412 2412 c, t dbSNP:576603878
2446 2446 c, t dbSNP:10866
2483 2483 a, g dbSNP:3087784
2488 2488 a, g dbSNP:559332782
2498 2498 a, c dbSNP:563682651
2523 2523 a, g dbSNP:375635017
2525 2525 c, g dbSNP:776687154
2539 2539 a, g dbSNP:762295195
2569 2569 g, t dbSNP:767628948
2574 2574 a, t dbSNP:572774850
2577 2577 c, g dbSNP:752529981
2607 2607 c, g dbSNP:529226935
2614 2614 c, g dbSNP:148121766
2621 2621 a, c dbSNP:561226269
2634 2634 c, t dbSNP:140982354
2640 2640 c, t dbSNP:13335284
2641 2641 a, g dbSNP:369818229
2644 2644 c, t dbSNP:374470586
2676 2676 g, t dbSNP:371038846
2702 2702 g, t dbSNP:563611183
2709 2709 c, t dbSNP:543128805
2717 2717 a, g dbSNP:531570429
2738 2738 a, g dbSNP:528250860
2747 2747 g, t dbSNP:189787811
2768 2768 c, t dbSNP:754005480
2783 2783 a, g dbSNP:753864539
2823 2823 a, g dbSNP:571210384
2826 2826 c, t dbSNP:758382220
2833 2833 g, t dbSNP:181078294
2838 2838 -, cgggggccgcagctttgtgg dbSNP:374612917
2843 2843 a, g dbSNP:113332295
2847 2847 a, g dbSNP:547002823
2854 2854 a, t dbSNP:559554679
2868 2868 c, g dbSNP:751303008
2878 2878 a, c dbSNP:375417064
2918 2918 a, t dbSNP:535850233
2924 2924 a, t dbSNP:556257698
2948 2948 c, t dbSNP:780858375
2957 2957 g, t dbSNP:750481961
2965 2965 c, t dbSNP:185952911
2970 2970 c, t dbSNP:539284441
2974 2974 -, a dbSNP:560922224
2984 2984 a, g dbSNP:559150292
2986 2986 a, g dbSNP:572787105
3049 3049 a, g dbSNP:541712873
3070 3070 c, g dbSNP:79745244
3095 3095 g, t dbSNP:574807920
3107 3107 c, g dbSNP:745471795
3115 3115 a, t dbSNP:528570052
3126 3126 c, t dbSNP:138049982
3142 3142 c, t dbSNP:769465822
3155 3155 a, g dbSNP:563848860
3169 3169 c, t dbSNP:779506921
3174 3174 c, g dbSNP:748844927
3221 3221 g, t dbSNP:71386677
3225 3225 c, g dbSNP:142512073
3272 3272 a, g dbSNP:762232443
3284 3284 a, g dbSNP:564701168
3338 3338 c, t dbSNP:190327635
3349 3349 -, a dbSNP:571502069
3376 3376 a, g dbSNP:547314582
3383 3383 c, t dbSNP:78560075
3392 3392 g, t dbSNP:529734340
3404 3404 a, g dbSNP:138756291
3422 3422 g, t dbSNP:760941132
3434 3434 a, g dbSNP:766750148
3436 3436 c, g dbSNP:769055116
3488 3488 c, t dbSNP:76291069
3503 3503 a, g dbSNP:74003037
3521 3521 -, g dbSNP:765252878
3546 3546 c, t dbSNP:144433575
3555 3555 c, t dbSNP:566250204
3564 3564 c, t dbSNP:550576606
3567 3567 a, g dbSNP:748644397
3589 3589 c, t dbSNP:759751812
3590 3590 a, g dbSNP:376035884
3610 3610 c, t dbSNP:148393103
3611 3611 a, c, g dbSNP:141692563
3626 3626 g, t dbSNP:147153606
3637 3637 c, t dbSNP:183283033
3656 3656 a, c dbSNP:576938086
3661 3661 c, t dbSNP:770202665
3691 3691 c, t dbSNP:545861137
3716 3716 a, t dbSNP:559396383
3724 3724 c, t dbSNP:28679688
3816 3816 -, tgc dbSNP:149315179
3844 3844 a, g dbSNP:540817771
3857 3857 c, t dbSNP:561282155
3979 3979 a, g dbSNP:370396602
3991 3991 c, t dbSNP:367998725
4003 4003 c, g dbSNP:529898940
4027 4027 c, t dbSNP:549760673
4044 4044 c, g dbSNP:373772013
4047 4047 c, g dbSNP:372067195
4072 4072 a, c dbSNP:532266776
4144 4144 c, t dbSNP:552329672
4145 4145 a, g dbSNP:4786296
4157 4157 a, g dbSNP:565767072
4187 4187 c, t dbSNP:535278860
4238 4238 g, t dbSNP:4786297
4253 4253 c, g dbSNP:548496512
4288 4288 a, g dbSNP:568740588
4292 4292 a, g dbSNP:147975625
4314 4314 -, gtcctgtgtctccat dbSNP:370970044
4314 4314 g, t dbSNP:537310185
4330 4330 g, t dbSNP:557345495
4362 4362 a, g dbSNP:187363186
4374 4374 c, g dbSNP:28457160
4375 4375 a, g dbSNP:535074412
4376 4376 a, g dbSNP:572997169
4406 4406 g, t dbSNP:113716221
4423 4423 c, t dbSNP:541222591
4437 4437 c, t dbSNP:190975527
4442 4442 c, t dbSNP:574692618
4443 4443 a, g dbSNP:543323513
4453 4453 c, t dbSNP:563577752
4527 4527 a, g dbSNP:113054936
4536 4536 c, t dbSNP:532181910
4558 4558 a, g dbSNP:28615548
4567 4567 c, t dbSNP:775324213
4579 4579 c, t dbSNP:565667834
4586 4586 c, t dbSNP:372950862
4593 4593 c, t dbSNP:559538467
4596 4596 c, t dbSNP:534714693
4630 4630 c, t dbSNP:548777339
4648 4648 c, t dbSNP:149131034
4665 4665 c, t dbSNP:531109247
4693 4693 c, t dbSNP:551022507
4716 4716 c, g dbSNP:71386681
4738 4738 c, t dbSNP:570799401
4748 4748 g, t dbSNP:539495695
4753 4753 a, g dbSNP:552900581
4761 4761 a, g dbSNP:566632715
4781 4781 a, g dbSNP:535544455
4794 4794 c, t dbSNP:558027230
4795 4795 g, t dbSNP:577872209
4829 4829 -, a dbSNP:199508475
4903 4903 c, t dbSNP:554773031
4919 4919 a, g dbSNP:574574151
4921 4921 c, g, t dbSNP:543744889
4930 4930 a, c dbSNP:557336688
4936 4936 c, t dbSNP:147659496
4953 4953 c, t dbSNP:577209776
4959 4959 c, t dbSNP:545819504
5061 5061 a, g dbSNP:559353007
5305 5305 c, t dbSNP:528209602
5336 5336 c, t dbSNP:541587272
5349 5349 -, c dbSNP:534151146
5391 5391 c, t dbSNP:561803954
5406 5406 a, g dbSNP:531050862
5457 5457 c, t dbSNP:551150791
5458 5458 a, g dbSNP:570813362
5465 5465 a, c dbSNP:533404808
5467 5467 c, t dbSNP:546604706
5475 5475 -, tcg dbSNP:753607913
5551 5551 a, g dbSNP:566501788
5592 5592 c, t dbSNP:557265376
5610 5610 -, aa dbSNP:58747637
5610 5610 a, t dbSNP:535820869
5655 5655 a, g dbSNP:182763560
5678 5678 c, t dbSNP:61080418
5688 5688 -, c dbSNP:764729763
5689 5689 c, t dbSNP:569327197
5691 5691 c, g dbSNP:573995032
5716 5716 c, t dbSNP:536897617
5765 5765 a, g dbSNP:187478880
5773 5773 a, g dbSNP:577221830
5780 5780 c, t dbSNP:546088965
5784 5784 a, c dbSNP:761743692
5786 5786 c, g dbSNP:3112704
5786 5786 c, g dbSNP:112319026
5789 5789 a, c dbSNP:191845035
5794 5794 a, g dbSNP:144753105
5810 5810 g, t dbSNP:561678389
5816 5816 c, t dbSNP:575253021
5826 5826 c, t dbSNP:544409330
5847 5847 a, g dbSNP:182493826
5852 5852 a, g dbSNP:533467818
5853 5853 c, t dbSNP:546919073
5926 5926 c, t dbSNP:556685997
5933 5933 a, c, t dbSNP:559677768
5943 5943 c, t dbSNP:11554593
5969 5969 c, g, t dbSNP:769734148
5976 5976 c, g dbSNP:549358180
6007 6007 c, t dbSNP:112703875
6030 6030 c, g dbSNP:539534788
6032 6032 a, g dbSNP:538298991
6052 6052 g, t dbSNP:751576674
6053 6053 c, t dbSNP:750511319
6054 6054 a, g dbSNP:757123594
6069 6069 c, t dbSNP:767388984
6078 6078 c, t dbSNP:550813362
6080 6080 a, t dbSNP:750180444
6085 6085 a, c dbSNP:373860725
6087 6087 a, t