Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PITX1 paired-like homeodomain 1 [Homo sapiens (human)]

Gene Symbol PITX1
Entrez Gene ID 5307
Full Name paired-like homeodomain 1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Clubfoot, congenital, 119800 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu18454 NM_002653 Homo sapiens paired-like homeodomain 1 (PITX1), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu18454D
Sequence Information ORF Nucleotide Sequence (Length: 945bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product pituitary homeobox 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BX362641.2, BC009412.1 and AC008406.7. This sequence is a reference standard in the RefSeqGene project. On Jul 24, 2007 this sequence version replaced gi:24234701. Summary: This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BX362641.2, U70370.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962337 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)175..177(+)
Misc Feature(2)394..396(+)
Misc Feature(3)529..531(+)
Misc Feature(4)535..537(+)
Misc Feature(5)661..837(+)
Misc Feature(6)661..831(+)
Misc Feature(7)667..819(+)
Misc Feature(8)832..1230(+)
Misc Feature(9)1000..>1215(+)
Misc Feature(10)1216..1272(+)
Misc Feature(11)1231..1272(+)
Misc Feature(12)1249..1263(+)
Exon (1)1..562
Gene Synonym:
Exon (2)563..795
Gene Synonym:
Exon (3)796..2383
Gene Synonym:
Position Chain Variation Link
119 119 -, agccgg dbSNP:372983845
124 124 -, cc dbSNP:745640618
173 173 g, t dbSNP:113986847
230 230 a, c dbSNP:557346162
309 309 a, c dbSNP:542553856
339 339 a, c dbSNP:533262690
381 381 a, g dbSNP:773429300
383 383 g, t dbSNP:112693031
400 400 g, t dbSNP:574730283
401 401 c, t dbSNP:748627311
408 408 a, g dbSNP:779716521
409 409 a, c, g dbSNP:553290196
419 419 a, g dbSNP:780936376
430 430 c, g dbSNP:535018917
433 433 c, g dbSNP:564413063
453 453 g, t dbSNP:756835519
454 454 c, t dbSNP:751390239
456 456 -, gccgcc dbSNP:752690307
459 459 -, gcc dbSNP:759438461
461 461 -, gcc, gccgcc dbSNP:776272532
461 461 c, t dbSNP:763753483
467 467 a, c dbSNP:758332384
468 468 c, t dbSNP:752568337
481 481 a, g dbSNP:765150075
490 490 c, t dbSNP:759682757
496 496 c, t dbSNP:776544846
508 508 c, g dbSNP:766675727
511 511 c, t dbSNP:760760729
512 512 a, g, t dbSNP:772499567
513 513 c, g dbSNP:748678440
517 517 c, t dbSNP:750592216
522 522 c, g, t dbSNP:769254732
531 531 c, t dbSNP:745419544
532 532 g, t dbSNP:780516973
541 541 a, c, t dbSNP:746572751
549 549 c, t dbSNP:200290396
551 551 c, t dbSNP:777634577
558 558 a, g, t dbSNP:752488600
571 571 a, c, t dbSNP:779923896
574 574 a, g dbSNP:756056039
588 588 a, g dbSNP:750491703
591 591 g, t dbSNP:547969651
595 595 a, g dbSNP:757554141
605 605 a, g dbSNP:775734536
608 608 c, t dbSNP:139844695
617 617 c, t dbSNP:780664383
618 618 a, g dbSNP:764394987
619 619 a, g dbSNP:758752422
624 624 c, g dbSNP:753078578
625 625 a, g dbSNP:765717973
627 627 a, c dbSNP:760042807
628 628 g, t dbSNP:772743808
637 637 a, g dbSNP:766948741
644 644 a, c dbSNP:201133610
655 655 -, aag dbSNP:780678961
655 655 a, c dbSNP:200888898
675 675 a, g, t dbSNP:147452369
683 683 a, c dbSNP:749085613
687 687 c, t dbSNP:375811840
694 694 c, t dbSNP:769649220
703 703 c, t dbSNP:745731947
717 717 c, t dbSNP:781431926
735 735 c, g dbSNP:757467616
745 745 a, g dbSNP:571940665
753 753 c, g dbSNP:550233065
762 762 c, t dbSNP:371237885
763 763 a, g dbSNP:753029316
771 771 c, t dbSNP:765598825
780 780 c, t dbSNP:112172425
781 781 a, g dbSNP:121909109
785 785 c, t dbSNP:754287927
786 786 a, g dbSNP:766860676
787 787 c, t dbSNP:761379519
789 789 c, t dbSNP:773820698
793 793 a, c dbSNP:746217030
810 810 c, t dbSNP:749703746
811 811 a, c dbSNP:1131611
814 814 a, c dbSNP:371250970
819 819 a, c dbSNP:756617907
834 834 c, t dbSNP:750882877
843 843 c, t dbSNP:781535863
864 864 a, g dbSNP:757990459
868 868 a, g dbSNP:752113290
872 872 a, g dbSNP:765028752
879 879 g, t dbSNP:759219259
892 892 c, t dbSNP:591552
906 906 c, t dbSNP:370433085
907 907 a, g dbSNP:766215212
916 916 c, t dbSNP:760706230
919 919 a, g dbSNP:773259804
921 921 c, t dbSNP:539835333
925 925 -, ccg dbSNP:757660279
940 940 -, aac dbSNP:751855351
948 948 c, t dbSNP:761995125
949 949 g, t dbSNP:774275193
955 955 a, g dbSNP:768895777
959 959 c, t dbSNP:749444294
968 968 c, t dbSNP:201656428
973 973 c, g dbSNP:770201995
975 975 a, c dbSNP:373414953
978 978 c, t dbSNP:569223515
993 993 c, t dbSNP:144193864
994 994 c, t dbSNP:370544754
996 996 c, t dbSNP:778529455
1006 1006 a, c, g dbSNP:149498254
1007 1007 g, t dbSNP:766120302
1013 1013 c, t dbSNP:147021244
1026 1026 a, g dbSNP:202189745
1027 1027 a, t dbSNP:756005087
1030 1030 a, g dbSNP:138042194
1031 1031 a, t dbSNP:373267473
1039 1039 g, t dbSNP:373526031
1044 1044 c, g dbSNP:146204449
1065 1065 c, t dbSNP:369693251
1066 1066 a, g dbSNP:774492516
1069 1069 c, t dbSNP:764101680
1070 1070 a, c dbSNP:763006479
1080 1080 a, g dbSNP:775755663
1084 1084 a, c dbSNP:769968771
1087 1087 a, g dbSNP:746291345
1093 1093 a, g dbSNP:776808560
1125 1125 c, t dbSNP:771503278
1133 1133 a, g dbSNP:747410643
1135 1135 c, g dbSNP:778584550
1140 1140 a, c dbSNP:375442916
1141 1141 a, g dbSNP:748803285
1143 1143 c, t dbSNP:779892564
1149 1149 a, g dbSNP:755702535
1158 1158 -, ggccatgtcgccgggcgcttgcccgtacggcactc dbSNP:730882191
1158 1158 a, g dbSNP:750256759
1159 1159 a, g dbSNP:372494047
1163 1163 a, t dbSNP:767150308
1167 1167 a, g dbSNP:757231285
1171 1171 a, g dbSNP:568284959
1173 1173 c, t dbSNP:751555498
1181 1181 c, g dbSNP:764013997
1182 1182 a, c, g dbSNP:369214320
1186 1186 a, c, g dbSNP:141612135
1200 1200 c, g dbSNP:546911382
1207 1207 a, g dbSNP:528345689
1210 1210 g, t dbSNP:747391523
1214 1214 a, g dbSNP:773927273
1233 1233 a, g dbSNP:772677363
1242 1242 c, t dbSNP:748856424
1248 1248 c, g dbSNP:779663598
1250 1250 a, g dbSNP:769519435
1251 1251 a, g dbSNP:138617400
1253 1253 g, t dbSNP:780883053
1254 1254 c, g dbSNP:757066552
1272 1272 a, c, g dbSNP:61751190
1274 1274 c, t dbSNP:758279008
1275 1275 c, g dbSNP:752801398
1276 1276 c, t dbSNP:765166800
1288 1288 a, g dbSNP:759820239
1289 1289 c, g dbSNP:479632
1294 1294 c, t dbSNP:367566700
1296 1296 a, g dbSNP:761162250
1300 1300 c, g dbSNP:773690157
1302 1302 a, g dbSNP:772730554
1308 1308 a, c, g dbSNP:775077362
1314 1314 c, t dbSNP:769243992
1317 1317 a, c dbSNP:745378528
1318 1318 a, g dbSNP:140746945
1319 1319 a, c, g dbSNP:535075716
1320 1320 c, g, t dbSNP:545789577
1324 1324 c, t dbSNP:752576335
1332 1332 c, t dbSNP:778899034
1335 1335 c, g, t dbSNP:374745950
1338 1338 a, c dbSNP:766560623
1341 1341 c, g dbSNP:760930823
1342 1342 -, t dbSNP:778086133
1342 1342 a, c dbSNP:530558760
1345 1345 c, t dbSNP:767928697
1346 1346 a, g, t dbSNP:774785427
1348 1348 c, g, t dbSNP:759017264
1360 1360 -, g dbSNP:758553907
1363 1363 a, g dbSNP:776153037
1365 1365 c, t dbSNP:563224007
1366 1366 -, cggtccgc dbSNP:752712378
1368 1368 -, accacg dbSNP:765273525
1375 1375 a, g dbSNP:746594563
1376 1376 c, g dbSNP:773006761
1392 1392 c, t dbSNP:1131614
1395 1395 -, gcgcgg dbSNP:71660434
1425 1425 a, g dbSNP:574150745
1434 1434 -, a dbSNP:578106534
1441 1441 c, t dbSNP:555493930
1481 1481 a, c dbSNP:540437481
1550 1550 -, a dbSNP:70976562
1568 1568 -, gc dbSNP:368142460
1568 1568 a, g dbSNP:111319441
1602 1602 -, a dbSNP:558356217
1634 1634 c, g dbSNP:191998224
1636 1636 g, t dbSNP:148703077
1637 1637 a, g dbSNP:13436473
1640 1640 -, gt dbSNP:386405033
1649 1649 -, gt, gtt dbSNP:70976561
1683 1683 a, g dbSNP:558050532
1688 1688 c, t dbSNP:539427406
1701 1701 a, g dbSNP:115710080
1705 1705 a, g dbSNP:39599
1723 1723 a, g dbSNP:551126085
1732 1732 a, g dbSNP:766100244
1775 1775 c, t dbSNP:9327699
1816 1816 c, t dbSNP:546785030
1819 1819 -, gga dbSNP:763693824
1870 1870 c, g dbSNP:528319297
1888 1888 g, t dbSNP:187575103
1900 1900 c, t dbSNP:552535166
1906 1906 a, g dbSNP:530416455
1927 1927 -, g dbSNP:569536656
2002 2002 a, g dbSNP:115751741
2028 2028 a, g dbSNP:541464694
2045 2045 c, g dbSNP:529755600
2089 2089 a, g dbSNP:112938656
2102 2102 g, t dbSNP:562122069
2106 2106 g, t dbSNP:776522265
2122 2122 a, c dbSNP:559037873
2129 2129 c, t dbSNP:1051294
2192 2192 c, t dbSNP:116353259
2193 2193 a, g dbSNP:573127470
2205 2205 a, t dbSNP:558013328
2214 2214 c, g dbSNP:546514477
2238 2238 a, g dbSNP:548642279
2248 2248 c, g dbSNP:528473307
2265 2265 c, t dbSNP:1051297
2268 2268 a, c dbSNP:746852370
2271 2271 c, t dbSNP:575545206
2276 2276 g, t dbSNP:371961364
2280 2280 -, ct dbSNP:752270603
2288 2288 a, g dbSNP:779834411
2299 2299 c, g dbSNP:758260468
2306 2306 c, g dbSNP:535487748
2373 2373 c, g dbSNP:568541884

Target ORF information:

RefSeq Version NM_002653
Organism Homo sapiens (human)
Definition Homo sapiens paired-like homeodomain 1 (PITX1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.