Email to GenScript

PITX1 paired-like homeodomain 1 [Homo sapiens (human)]

Gene Symbol PITX1
Entrez Gene ID 5307
Full Name paired-like homeodomain 1
Synonyms BFT, CCF, LBNBG, POTX, PTX1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

5

5q31.1

Summary This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

602149

Disorder Html: Clubfoot, congenital, 119800 (3)





The following PITX1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PITX1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu18454 NM_002653 Homo sapiens paired-like homeodomain 1 (PITX1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$216.3
$309

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu18454
Accession Version NM_002653.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 945bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product pituitary homeobox 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BX362641.2, BC009412.1 and AC008406.7. This sequence is a reference standard in the RefSeqGene project. On Jul 24, 2007 this sequence version replaced gi:24234701. Summary: This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BX362641.2, U70370.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962337 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGGACGCCT TCAAGGGGGG CATGAGCCTG GAGCGGCTGC CGGAGGGGCT CCGGCCGCCG 
CCGCCGCCAC CCCATGACAT GGGGCCCGCC TTCCACCTGG CCCGGCCCGC CGACCCCCGC
GAGCCGCTCG AGAACTCCGC CAGCGAGTCG TCTGACACGG AGCTGCCAGA GAAGGAGCGC
GGCGGGGAAC CCAAGGGGCC CGAGGACAGT GGTGCGGGAG GCACGGGCTG CGGCGGCGCA
GACGACCCAG CCAAGAAGAA GAAGCAGCGG CGGCAACGTA CGCACTTCAC AAGCCAGCAG
TTGCAAGAGC TAGAGGCCAC GTTCCAGAGG AACCGCTACC CCGACATGAG CATGAGGGAG
GAGATCGCCG TGTGGACCAA CCTCACCGAG CCGCGCGTGC GGGTCTGGTT CAAGAACCGG
CGAGCCAAGT GGCGTAAGCG CGAGCGTAAC CAGCAGCTGG ACCTGTGCAA GGGTGGCTAC
GTGCCGCAGT TCAGCGGCCT AGTGCAGCCC TACGAGGACG TGTACGCCGC CGGCTACTCC
TACAACAACT GGGCCGCCAA GAGCCTGGCG CCAGCGCCGC TCTCCACCAA GAGCTTCACC
TTCTTCAACT CCATGAGCCC GCTGTCGTCG CAGTCCATGT TCTCAGCACC CAGCTCCATC
TCCTCCATGA CCATGCCGTC CAGCATGGGC CCAGGCGCCG TGCCTGGCAT GCCCAACTCG
GGCCTCAACA ACATCAACAA CCTCACCGGC TCCTCGCTCA ACTCGGCCAT GTCGCCGGGC
GCTTGCCCGT ACGGCACTCC CGCCTCGCCC TACAGCGTCT ACCGGGACAC GTGCAACTCG
AGCCTAGCCA GCCTGCGGCT CAAGTCCAAA CAGCACTCGT CGTTTGGCTA CGGCGGCCTG
CAGGGCCCGG CCTCGGGCCT CAACGCGTGC CAGTACAACA GCTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_002644.4
CDS394..1338
Misc Feature(1)175..177(+)
Misc Feature(2)394..396(+)
Misc Feature(3)529..531(+)
Misc Feature(4)535..537(+)
Misc Feature(5)661..837(+)
Misc Feature(6)661..831(+)
Misc Feature(7)667..819(+)
Misc Feature(8)832..1230(+)
Misc Feature(9)1000..>1215(+)
Misc Feature(10)1216..1272(+)
Misc Feature(11)1231..1272(+)
Misc Feature(12)1249..1263(+)
Exon (1)1..562
Gene:PITX1
Gene Synonym:
Exon (2)563..795
Gene:PITX1
Gene Synonym:
Exon (3)796..2383
Gene:PITX1
Gene Synonym:
Translation
Position Chain Variation Link
119 119 -, agccgg dbSNP:372983845
124 124 -, cc dbSNP:745640618
173 173 g, t dbSNP:113986847
230 230 a, c dbSNP:557346162
309 309 a, c dbSNP:542553856
339 339 a, c dbSNP:533262690
381 381 a, g dbSNP:773429300
383 383 g, t dbSNP:112693031
400 400 g, t dbSNP:574730283
401 401 c, t dbSNP:748627311
408 408 a, g dbSNP:779716521
409 409 a, c, g dbSNP:553290196
419 419 a, g dbSNP:780936376
430 430 c, g dbSNP:535018917
433 433 c, g dbSNP:564413063
453 453 g, t dbSNP:756835519
454 454 c, t dbSNP:751390239
456 456 -, gccgcc dbSNP:752690307
459 459 -, gcc dbSNP:759438461
461 461 -, gcc, gccgcc dbSNP:776272532
461 461 c, t dbSNP:763753483
467 467 a, c dbSNP:758332384
468 468 c, t dbSNP:752568337
481 481 a, g dbSNP:765150075
490 490 c, t dbSNP:759682757
496 496 c, t dbSNP:776544846
508 508 c, g dbSNP:766675727
511 511 c, t dbSNP:760760729
512 512 a, g, t dbSNP:772499567
513 513 c, g dbSNP:748678440
517 517 c, t dbSNP:750592216
522 522 c, g, t dbSNP:769254732
531 531 c, t dbSNP:745419544
532 532 g, t dbSNP:780516973
541 541 a, c, t dbSNP:746572751
549 549 c, t dbSNP:200290396
551 551 c, t dbSNP:777634577
558 558 a, g, t dbSNP:752488600
571 571 a, c, t dbSNP:779923896
574 574 a, g dbSNP:756056039
588 588 a, g dbSNP:750491703
591 591 g, t dbSNP:547969651
595 595 a, g dbSNP:757554141
605 605 a, g dbSNP:775734536
608 608 c, t dbSNP:139844695
617 617 c, t dbSNP:780664383
618 618 a, g dbSNP:764394987
619 619 a, g dbSNP:758752422
624 624 c, g dbSNP:753078578
625 625 a, g dbSNP:765717973
627 627 a, c dbSNP:760042807
628 628 g, t dbSNP:772743808
637 637 a, g dbSNP:766948741
644 644 a, c dbSNP:201133610
655 655 -, aag dbSNP:780678961
655 655 a, c dbSNP:200888898
675 675 a, g, t dbSNP:147452369
683 683 a, c dbSNP:749085613
687 687 c, t dbSNP:375811840
694 694 c, t dbSNP:769649220
703 703 c, t dbSNP:745731947
717 717 c, t dbSNP:781431926
735 735 c, g dbSNP:757467616
745 745 a, g dbSNP:571940665
753 753 c, g dbSNP:550233065
762 762 c, t dbSNP:371237885
763 763 a, g dbSNP:753029316
771 771 c, t dbSNP:765598825
780 780 c, t dbSNP:112172425
781 781 a, g dbSNP:121909109
785 785 c, t dbSNP:754287927
786 786 a, g dbSNP:766860676
787 787 c, t dbSNP:761379519
789 789 c, t dbSNP:773820698
793 793 a, c dbSNP:746217030
810 810 c, t dbSNP:749703746
811 811 a, c dbSNP:1131611
814 814 a, c dbSNP:371250970
819 819 a, c dbSNP:756617907
834 834 c, t dbSNP:750882877
843 843 c, t dbSNP:781535863
864 864 a, g dbSNP:757990459
868 868 a, g dbSNP:752113290
872 872 a, g dbSNP:765028752
879 879 g, t dbSNP:759219259
892 892 c, t dbSNP:591552
906 906 c, t dbSNP:370433085
907 907 a, g dbSNP:766215212
916 916 c, t dbSNP:760706230
919 919 a, g dbSNP:773259804
921 921 c, t dbSNP:539835333
925 925 -, ccg dbSNP:757660279
940 940 -, aac dbSNP:751855351
948 948 c, t dbSNP:761995125
949 949 g, t dbSNP:774275193
955 955 a, g dbSNP:768895777
959 959 c, t dbSNP:749444294
968 968 c, t dbSNP:201656428
973 973 c, g dbSNP:770201995
975 975 a, c dbSNP:373414953
978 978 c, t dbSNP:569223515
993 993 c, t dbSNP:144193864
994 994 c, t dbSNP:370544754
996 996 c, t dbSNP:778529455
1006 1006 a, c, g dbSNP:149498254
1007 1007 g, t dbSNP:766120302
1013 1013 c, t dbSNP:147021244
1026 1026 a, g dbSNP:202189745
1027 1027 a, t dbSNP:756005087
1030 1030 a, g dbSNP:138042194
1031 1031 a, t dbSNP:373267473
1039 1039 g, t dbSNP:373526031
1044 1044 c, g dbSNP:146204449
1065 1065 c, t dbSNP:369693251
1066 1066 a, g dbSNP:774492516
1069 1069 c, t dbSNP:764101680
1070 1070 a, c dbSNP:763006479
1080 1080 a, g dbSNP:775755663
1084 1084 a, c dbSNP:769968771
1087 1087 a, g dbSNP:746291345
1093 1093 a, g dbSNP:776808560
1125 1125 c, t dbSNP:771503278
1133 1133 a, g dbSNP:747410643
1135 1135 c, g dbSNP:778584550
1140 1140 a, c dbSNP:375442916
1141 1141 a, g dbSNP:748803285
1143 1143 c, t dbSNP:779892564
1149 1149 a, g dbSNP:755702535
1158 1158 -, ggccatgtcgccgggcgcttgcccgtacggcactc dbSNP:730882191
1158 1158 a, g dbSNP:750256759
1159 1159 a, g dbSNP:372494047
1163 1163 a, t dbSNP:767150308
1167 1167 a, g dbSNP:757231285
1171 1171 a, g dbSNP:568284959
1173 1173 c, t dbSNP:751555498
1181 1181 c, g dbSNP:764013997
1182 1182 a, c, g dbSNP:369214320
1186 1186 a, c, g dbSNP:141612135
1200 1200 c, g dbSNP:546911382
1207 1207 a, g dbSNP:528345689
1210 1210 g, t dbSNP:747391523
1214 1214 a, g dbSNP:773927273
1233 1233 a, g dbSNP:772677363
1242 1242 c, t dbSNP:748856424
1248 1248 c, g dbSNP:779663598
1250 1250 a, g dbSNP:769519435
1251 1251 a, g dbSNP:138617400
1253 1253 g, t dbSNP:780883053
1254 1254 c, g dbSNP:757066552
1272 1272 a, c, g dbSNP:61751190
1274 1274 c, t dbSNP:758279008
1275 1275 c, g dbSNP:752801398
1276 1276 c, t dbSNP:765166800
1288 1288 a, g dbSNP:759820239
1289 1289 c, g dbSNP:479632
1294 1294 c, t dbSNP:367566700
1296 1296 a, g dbSNP:761162250
1300 1300 c, g dbSNP:773690157
1302 1302 a, g dbSNP:772730554
1308 1308 a, c, g dbSNP:775077362
1314 1314 c, t dbSNP:769243992
1317 1317 a, c dbSNP:745378528
1318 1318 a, g dbSNP:140746945
1319 1319 a, c, g dbSNP:535075716
1320 1320 c, g, t dbSNP:545789577
1324 1324 c, t dbSNP:752576335
1332 1332 c, t dbSNP:778899034
1335 1335 c, g, t dbSNP:374745950
1338 1338 a, c dbSNP:766560623
1341 1341 c, g dbSNP:760930823
1342 1342 -, t dbSNP:778086133
1342 1342 a, c dbSNP:530558760
1345 1345 c, t dbSNP:767928697
1346 1346 a, g, t dbSNP:774785427
1348 1348 c, g, t dbSNP:759017264
1360 1360 -, g dbSNP:758553907
1363 1363 a, g dbSNP:776153037
1365 1365 c, t dbSNP:563224007
1366 1366 -, cggtccgc dbSNP:752712378
1368 1368 -, accacg dbSNP:765273525
1375 1375 a, g dbSNP:746594563
1376 1376 c, g dbSNP:773006761
1392 1392 c, t dbSNP:1131614
1395 1395 -, gcgcgg dbSNP:71660434
1425 1425 a, g dbSNP:574150745
1434 1434 -, a dbSNP:578106534
1441 1441 c, t dbSNP:555493930
1481 1481 a, c dbSNP:540437481
1550 1550 -, a dbSNP:70976562
1568 1568 -, gc dbSNP:368142460
1568 1568 a, g dbSNP:111319441
1602 1602 -, a dbSNP:558356217
1634 1634 c, g dbSNP:191998224
1636 1636 g, t dbSNP:148703077
1637 1637 a, g dbSNP:13436473
1640 1640 -, gt dbSNP:386405033
1649 1649 -, gt, gtt dbSNP:70976561
1683 1683 a, g dbSNP:558050532
1688 1688 c, t dbSNP:539427406
1701 1701 a, g dbSNP:115710080
1705 1705 a, g dbSNP:39599
1723 1723 a, g dbSNP:551126085
1732 1732 a, g dbSNP:766100244
1775 1775 c, t dbSNP:9327699
1816 1816 c, t dbSNP:546785030
1819 1819 -, gga dbSNP:763693824
1870 1870 c, g dbSNP:528319297
1888 1888 g, t dbSNP:187575103
1900 1900 c, t dbSNP:552535166
1906 1906 a, g dbSNP:530416455
1927 1927 -, g dbSNP:569536656
2002 2002 a, g dbSNP:115751741
2028 2028 a, g dbSNP:541464694
2045 2045 c, g dbSNP:529755600
2089 2089 a, g dbSNP:112938656
2102 2102 g, t dbSNP:562122069
2106 2106 g, t dbSNP:776522265
2122 2122 a, c dbSNP:559037873
2129 2129 c, t dbSNP:1051294
2192 2192 c, t dbSNP:116353259
2193 2193 a, g dbSNP:573127470
2205 2205 a, t dbSNP:558013328
2214 2214 c, g dbSNP:546514477
2238 2238 a, g dbSNP:548642279
2248 2248 c, g dbSNP:528473307
2265 2265 c, t dbSNP:1051297
2268 2268 a, c dbSNP:746852370
2271 2271 c, t dbSNP:575545206
2276 2276 g, t dbSNP:371961364
2280 2280 -, ct dbSNP:752270603
2288 2288 a, g dbSNP:779834411
2299 2299 c, g dbSNP:758260468
2306 2306 c, g dbSNP:535487748
2373 2373 c, g dbSNP:568541884

Target ORF information:

RefSeq Version NM_002653
Organism Homo sapiens (human)
Definition Homo sapiens paired-like homeodomain 1 (PITX1), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_002653

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGGACGCCT TCAAGGGGGG CATGAGCCTG GAGCGGCTGC CGGAGGGGCT CCGGCCGCCG 
CCGCCGCCAC CCCATGACAT GGGGCCCGCC TTCCACCTGG CCCGGCCCGC CGACCCCCGC
GAGCCGCTCG AGAACTCCGC CAGCGAGTCG TCTGACACGG AGCTGCCAGA GAAGGAGCGC
GGCGGGGAAC CCAAGGGGCC CGAGGACAGT GGTGCGGGAG GCACGGGCTG CGGCGGCGCA
GACGACCCAG CCAAGAAGAA GAAGCAGCGG CGGCAACGTA CGCACTTCAC AAGCCAGCAG
TTGCAAGAGC TAGAGGCCAC GTTCCAGAGG AACCGCTACC CCGACATGAG CATGAGGGAG
GAGATCGCCG TGTGGACCAA CCTCACCGAG CCGCGCGTGC GGGTCTGGTT CAAGAACCGG
CGAGCCAAGT GGCGTAAGCG CGAGCGTAAC CAGCAGCTGG ACCTGTGCAA GGGTGGCTAC
GTGCCGCAGT TCAGCGGCCT AGTGCAGCCC TACGAGGACG TGTACGCCGC CGGCTACTCC
TACAACAACT GGGCCGCCAA GAGCCTGGCG CCAGCGCCGC TCTCCACCAA GAGCTTCACC
TTCTTCAACT CCATGAGCCC GCTGTCGTCG CAGTCCATGT TCTCAGCACC CAGCTCCATC
TCCTCCATGA CCATGCCGTC CAGCATGGGC CCAGGCGCCG TGCCTGGCAT GCCCAACTCG
GGCCTCAACA ACATCAACAA CCTCACCGGC TCCTCGCTCA ACTCGGCCAT GTCGCCGGGC
GCTTGCCCGT ACGGCACTCC CGCCTCGCCC TACAGCGTCT ACCGGGACAC GTGCAACTCG
AGCCTAGCCA GCCTGCGGCT CAAGTCCAAA CAGCACTCGT CGTTTGGCTA CGGCGGCCTG
CAGGGCCCGG CCTCGGGCCT CAACGCGTGC CAGTACAACA GCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.