
PKP2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol PKP2
Entrez Gene ID 5318
Full Name plakophilin 2
Synonyms ARVD9
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Arrhythmogenic right ventricular dysplasia, familial, 9, 609040 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_004572 NP_004563 plakophilin-2 isoform 2b
NM_001005242 NP_001005242 plakophilin-2 isoform 2a

hsa05412 Arrhythmogenic right ventricular cardiomyopathy (ARVC)
WP2118 Arrhythmogenic right ventricular cardiomyopathy

Homo sapiens (human) PKP2 NP_001005242.2
Pan troglodytes (chimpanzee) PKP2 XP_003954415.1
Canis lupus familiaris (dog) PKP2 XP_543739.2
Bos taurus (cattle) PKP2 NP_001077198.1
Mus musculus (house mouse) Pkp2 NP_080439.1
Rattus norvegicus (Norway rat) Pkp2 NP_001093969.1
Gallus gallus (chicken) PKP2 XP_416362.4
Danio rerio (zebrafish) pkp2 NP_001106904.1
Xenopus (Silurana) tropicalis (western clawed frog) pkp2 NP_001096312.1


ID Name Evidence
GO:0005634 nucleus NAS
GO:0005886 plasma membrane TAS
GO:0005911 cell-cell junction TAS
GO:0005912 adherens junction IEA
GO:0016021 integral to membrane TAS
GO:0030057 desmosome NAS


ID Name Evidence
GO:0003674 molecular_function ND
GO:0005488 binding IEA


ID Name Evidence
GO:0007507 heart development IEA
GO:0016337 cell-cell adhesion NAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following PKP2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PKP2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

***CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu23398 NM_004572 Homo sapiens plakophilin 2 (PKP2), transcript variant 2b, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 $622.30
NM_001005242 Homo sapiens plakophilin 2 (PKP2), transcript variant 2a, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $339.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

***One clone ID might be correlated to multiple accession numbers, which share the same CDS sequence.

CloneID OHu23398
Clone ID Related Accession (Same CDS sequence) NM_004572
Accession Version NM_004572.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2646bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product plakophilin-2 isoform 2b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB454360.1, X97675.1, AU125826.1, AC087588.10 and AW439621.1. This sequence is a reference standard in the RefSeqGene project. On Jun 7, 2007 this sequence version replaced gi:52630430. Summary: This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]. Transcript Variant: This transcript variant (2b) represents the longer transcript variant and encodes the longer isoform. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X97675.1, EU520483.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962346 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_004563.2
Misc Feature(1)245..247(+)
Misc Feature(2)509..511(+)
Misc Feature(3)509..511(+)
Misc Feature(4)566..568(+)
Misc Feature(5)575..577(+)
Misc Feature(6)578..580(+)
Misc Feature(7)620..622(+)
Misc Feature(8)620..622(+)
Misc Feature(9)704..706(+)
Misc Feature(10)866..868(+)
Misc Feature(11)1100..1102(+)
Misc Feature(12)1136..1264(+)
Misc Feature(13)1163..1516(+)
Misc Feature(14)1226..1516(+)
Misc Feature(15)1268..1387(+)
Misc Feature(16)1394..1516(+)
Misc Feature(17)1826..1963(+)
Misc Feature(18)2126..2248(+)
Misc Feature(19)2138..2527(+)
Misc Feature(20)2213..2527(+)
Misc Feature(21)2270..2389(+)
Misc Feature(22)2402..2527(+)
Misc Feature(23)2534..2662(+)
Exon (1)1..338
Gene Synonym:
Exon (2)339..451
Gene Synonym:
Exon (3)452..1149
Gene Synonym:
Exon (4)1150..1285
Gene Synonym:
Exon (5)1286..1493
Gene Synonym:
Exon (6)1494..1625
Gene Synonym:
Exon (7)1626..1803
Gene Synonym:
Exon (8)1804..1921
Gene Synonym:
Exon (9)1922..2086
Gene Synonym:
Exon (10)2087..2260
Gene Synonym:
Exon (11)2261..2414
Gene Synonym:
Exon (12)2415..2604
Gene Synonym:
Exon (13)2605..2692
Gene Synonym:
Exon (14)2693..4439
Gene Synonym:
Position Chain Variation Link
17 17 c, t dbSNP:565997897
26 26 g, t dbSNP:552373947
84 84 a, c dbSNP:758069762
87 87 c, g dbSNP:752524692
91 91 c, t dbSNP:765009350
94 94 c, g dbSNP:373925978
102 102 c, t dbSNP:750694426
108 108 c, t dbSNP:767539502
127 127 c, t dbSNP:397516991
129 129 a, g dbSNP:774778142
129 129 -, g dbSNP:397516996
134 134 c, t dbSNP:764645176
150 150 a, g dbSNP:763433296
153 153 a, t dbSNP:775889367
154 154 c, t dbSNP:770102631
160 160 c, t dbSNP:759214983
171 171 a, c dbSNP:776453793
182 182 c, g dbSNP:770498155
183 183 a, g dbSNP:746530389
191 191 a, g dbSNP:143004808
192 192 a, g dbSNP:772042931
193 193 a, c dbSNP:748077185
214 214 c, t dbSNP:778749586
218 218 a, g dbSNP:754791731
221 221 a, g dbSNP:750606970
225 225 a, g dbSNP:781400459
238 238 g, t dbSNP:757273590
246 246 a, g dbSNP:751629644
251 251 a, c dbSNP:764116301
261 261 a, g dbSNP:763492084
263 263 -, acag dbSNP:397516997
263 263 a, g dbSNP:753164020
270 270 a, g dbSNP:549598534
271 271 a, g dbSNP:201210997
273 273 a, g dbSNP:776363973
274 274 a, c dbSNP:770694213
282 282 c, t dbSNP:760470852
289 289 g, t dbSNP:146708884
291 291 a, t dbSNP:730880179
295 295 g, t dbSNP:748071846
299 299 a, c dbSNP:199601548
305 305 -, c dbSNP:762288961
307 307 a, c dbSNP:768376044
308 308 g, t dbSNP:143323961
309 309 c, t dbSNP:139924723
310 310 c, t dbSNP:397517014
313 313 a, g dbSNP:144106848
323 323 a, g dbSNP:751775528
324 324 c, g, t dbSNP:75909145
329 329 g, t dbSNP:397517019
337 337 c, g dbSNP:753180642
338 338 a, g dbSNP:765852160
339 339 a, g dbSNP:267603443
345 345 a, t dbSNP:754446972
350 350 c, t dbSNP:121434420
351 351 a, g dbSNP:766802880
365 365 c, t dbSNP:756468173
368 368 -, gagt dbSNP:786204388
374 374 c, g dbSNP:750028032
376 376 c, t dbSNP:767093212
379 379 c, t dbSNP:761588340
384 384 -, taca dbSNP:397517025
389 389 g, t dbSNP:773851296
390 390 c, t dbSNP:763639737
403 403 g, t dbSNP:762825735
408 408 c, t dbSNP:775434969
413 413 a, g dbSNP:769509055
414 414 a, g dbSNP:745661586
417 417 a, g dbSNP:149542398
421 421 a, c dbSNP:376613662
422 422 a, c dbSNP:139215336
428 428 c, g, t dbSNP:375035084
435 435 c, t dbSNP:749774181
440 440 a, g dbSNP:749107090
441 441 a, t dbSNP:756446946
444 444 c, t dbSNP:750744212
459 459 c, t dbSNP:199860323
472 472 c, t dbSNP:758097199
474 474 a, c dbSNP:752173491
475 475 a, g dbSNP:764868621
479 479 c, t dbSNP:759377911
480 480 a, g, t dbSNP:201306582
483 483 c, g dbSNP:760576804
484 484 a, g dbSNP:774663443
502 502 a, g dbSNP:768974835
505 505 c, t dbSNP:763303290
509 509 a, t dbSNP:750523022
510 510 a, c dbSNP:765241754
520 520 c, t dbSNP:775423741
521 521 a, g, t dbSNP:567795321
524 524 a, g dbSNP:781739949
529 529 a, t dbSNP:771153426
533 533 a, t dbSNP:727503373
534 534 c, t dbSNP:150821281
535 535 c, t dbSNP:2389115
548 548 -, ct dbSNP:199643407
562 562 g, t dbSNP:778151977
565 565 g, t dbSNP:758042119
572 572 a, g dbSNP:747856983
576 576 a, g dbSNP:778228018
577 577 c, g dbSNP:397517026
579 579 c, g dbSNP:141438322
582 582 c, t dbSNP:766360871
583 583 a, g dbSNP:756166702
588 588 a, g dbSNP:397517027
589 589 a, g dbSNP:767482842
594 594 a, g dbSNP:763249730
597 597 a, g dbSNP:775789180
599 599 a, g dbSNP:765195368
600 600 c, t dbSNP:759687672
601 601 a, g, t dbSNP:189040311
604 604 c, t dbSNP:771398047
607 607 c, t dbSNP:747582030
609 609 a, g dbSNP:773552936
613 613 c, t dbSNP:772439804
620 620 a, g dbSNP:139139859
631 631 a, c dbSNP:397517028
636 636 c, t dbSNP:754395430
640 640 a, g dbSNP:748807540
645 645 c, t dbSNP:779467662
648 648 -, t dbSNP:769220833
648 648 c, t dbSNP:756113352
656 656 c, g dbSNP:750440181
657 657 a, c dbSNP:767358039
663 663 a, g dbSNP:373222905
668 668 c, t dbSNP:571569344
669 669 a, g dbSNP:765477952
670 670 a, g dbSNP:759719235
671 671 a, g dbSNP:776770393
673 673 a, c, t dbSNP:184522105
674 674 a, g dbSNP:200095747
677 677 c, g dbSNP:773712517
683 683 c, g dbSNP:772384894
690 690 c, t dbSNP:748566573
691 691 a, g dbSNP:373380483
697 697 c, t dbSNP:532048791
701 701 c, t dbSNP:748957791
702 702 a, g dbSNP:146566525
706 706 c, t dbSNP:769438623
713 713 a, g dbSNP:369923216
715 715 a, g dbSNP:781305034
717 717 a, g dbSNP:757316313
719 719 -, g dbSNP:747504380
720 720 c, t dbSNP:751341106
724 724 c, t dbSNP:768906235
725 725 c, t dbSNP:777497296
726 726 a, g dbSNP:755215178
735 735 c, g dbSNP:754021184
737 737 a, g dbSNP:563138160
749 749 c, t dbSNP:766379716
771 771 a, g dbSNP:760774269
772 772 a, g dbSNP:750880081
778 778 a, c dbSNP:767987619
796 796 c, t dbSNP:762263587
797 797 a, g dbSNP:143954425
803 803 a, g dbSNP:543281875
811 811 c, t dbSNP:375677250
821 821 g, t dbSNP:62001015
826 826 c, t dbSNP:769383600
828 828 c, t dbSNP:560220280
829 829 a, g dbSNP:727503372
832 832 c, t dbSNP:143777637
834 834 c, t dbSNP:372700909
835 835 a, g dbSNP:777567315
840 840 c, t dbSNP:201580443
843 843 a, c dbSNP:754018608
845 845 c, g, t dbSNP:756376477
853 853 -, aggga dbSNP:780485224
853 853 a, g dbSNP:750469808
855 855 a, g dbSNP:767647926
856 856 c, g dbSNP:762366326
857 857 a, c dbSNP:752017355
863 863 c, t dbSNP:577631447
864 864 g, t dbSNP:369332786
870 870 c, t dbSNP:776049790
876 876 a, c dbSNP:769542968
882 882 c, t dbSNP:759331787
887 887 a, t dbSNP:727504430
889 889 a, g dbSNP:776268890
899 899 a, c dbSNP:199701968
903 903 c, t dbSNP:543758984
904 904 a, g dbSNP:760432217
906 906 c, t dbSNP:62001016
908 908 a, g dbSNP:555239517
910 910 g, t dbSNP:375268778
916 916 c, t dbSNP:756321518
917 917 g, t dbSNP:746144782
919 919 c, t dbSNP:781271804
920 920 a, g dbSNP:757285245
923 923 c, t dbSNP:752060568
927 927 g, t dbSNP:764490412
931 931 c, g dbSNP:758986464
932 932 c, g, t dbSNP:765756156
934 934 a, g, t dbSNP:3748279
937 937 c, g dbSNP:145886908
941 941 c, t dbSNP:201944276
945 945 c, t dbSNP:772827289
952 952 -, cg dbSNP:772220644
952 952 c, t dbSNP:572938229
953 953 a, g dbSNP:748148237
961 961 c, g dbSNP:377137357
965 965 a, g dbSNP:768451308
969 969 c, t dbSNP:372664096
974 974 a, g dbSNP:781296737
977 977 c, t dbSNP:757552761
988 988 a, t dbSNP:747032628
1001 1001 a, c dbSNP:777978966
1003 1003 c, t dbSNP:397517029
1004 1004 a, t dbSNP:758962957
1008 1008 a, c dbSNP:753271708
1010 1010 c, t dbSNP:564987195
1011 1011 a, g dbSNP:755425370
1014 1014 a, c dbSNP:553098424
1015 1015 a, g dbSNP:140235564
1024 1024 a, g dbSNP:376001513
1029 1029 a, g dbSNP:146683466
1033 1033 c, t dbSNP:368656084
1040 1040 a, g dbSNP:761677945
1042 1042 c, t dbSNP:200152448
1043 1043 a, g dbSNP:768396351
1049 1049 c, g, t dbSNP:756604557
1053 1053 a, g dbSNP:775398790
1054 1054 c, t dbSNP:61729381
1055 1055 a, g dbSNP:551812289
1056 1056 a, g dbSNP:139903989
1065 1065 c, t dbSNP:775318947
1066 1066 ac, gcacttgactgtcggccaggcggccgcaggggg dbSNP:397517030
1066 1066 a, g dbSNP:61729382
1068 1068 a, c dbSNP:181098323
1078 1078 c, t dbSNP:202207343
1079 1079 a, g, t dbSNP:200069860
1083 1083 -, ag dbSNP:745882420
1086 1086 -, ct dbSNP:779241371
1086 1086 c, g, t dbSNP:529523595
1087 1087 a, g dbSNP:142636176
1089 1089 c, t dbSNP:201803918
1090 1090 c, t dbSNP:369921166
1091 1091 a, g dbSNP:148480056
1092 1092 a, c dbSNP:762949110
1093 1093 a, g dbSNP:775137004
1094 1094 -, g dbSNP:786205353
1095 1095 a, g, t dbSNP:759660796
1097 1097 a, g dbSNP:773517387
1098 1098 c, g dbSNP:144651139
1100 1100 a, c, t dbSNP:779173447
1104 1104 g, t dbSNP:373041797
1105 1105 c, g, t dbSNP:749862514
1108 1108 c, t dbSNP:780222357
1111 1111 a, g dbSNP:144574595
1125 1125 a, g dbSNP:144401285
1127 1127 a, g dbSNP:139851304
1128 1128 a, c dbSNP:756946586
1132 1132 c, t dbSNP:751068912
1139 1139 c, t dbSNP:563797120
1143 1143 a, g dbSNP:762744983
1160 1160 a, g dbSNP:199957846
1163 1163 a, g dbSNP:147264025
1168 1168 g, t dbSNP:765200197
1178 1178 c, t dbSNP:754912778
1179 1179 a, g dbSNP:370868564
1184 1184 a, g dbSNP:766334171
1194 1194 c, t dbSNP:730880180
1195 1195 c, t dbSNP:397516984
1196 1196 a, c, g dbSNP:375404471
1201 1201 a, g dbSNP:376167178
1206 1206 a, t dbSNP:763114466
1208 1208 a, g dbSNP:143900944
1210 1210 g, t dbSNP:770333863
1212 1212 c, t dbSNP:1046116
1216 1216 a, c dbSNP:776927054
1221 1221 a, g dbSNP:771293688
1229 1229 a, c, g dbSNP:200586695
1231 1231 c, t dbSNP:142742483
1242 1242 c, t dbSNP:56869013
1245 1245 c, t dbSNP:397516985
1247 1247 c, t dbSNP:397516986
1252 1252 c, t dbSNP:754927123
1259 1259 c, t dbSNP:753839199
1260 1260 -, t dbSNP:762510904
1277 1277 c, t dbSNP:766209297
1278 1278 a, g dbSNP:756000218
1282 1282 a, g dbSNP:751778207
1292 1292 c, t dbSNP:786204393
1296 1296 a, t dbSNP:766842360
1298 1298 c, t dbSNP:761238380
1299 1299 c, g dbSNP:773611613
1305 1305 a, t dbSNP:772334698
1314 1314 a, t dbSNP:761461735
1321 1321 a, g dbSNP:773905605
1323 1323 c, t dbSNP:761027394
1326 1326 -, t dbSNP:397516989
1345 1345 c, t dbSNP:148364390
1346 1346 a, g dbSNP:192041220
1351 1351 a, g dbSNP:779749104
1352 1352 c, t dbSNP:372827156
1353 1353 a, g dbSNP:200715477
1366 1366 g, t dbSNP:567854722
1377 1377 a, g dbSNP:780977066
1386 1386 c, t dbSNP:397516990
1402 1402 c, t dbSNP:727505239
1407 1407 c, t dbSNP:143397927
1414 1414 a, g dbSNP:752919159
1422 1422 atttagtt, taaatgggg dbSNP:397516992
1431 1431 g, t dbSNP:778982154
1436 1436 c, t dbSNP:755233999
1437 1437 a, g dbSNP:753912985
1438 1438 g, t dbSNP:3748278
1441 1441 a, g dbSNP:377076035
1465 1465 a, g dbSNP:200831332
1466 1466 a, g dbSNP:756554413
1482 1482 a, g dbSNP:750897570
1484 1484 -, caaa dbSNP:397516993
1487 1487 a, g dbSNP:199571473
1491 1491 c, t dbSNP:752832849
1495 1495 c, t dbSNP:751862142
1497 1497 a, g dbSNP:376606525
1499 1499 a, g dbSNP:764608036
1500 1500 c, g dbSNP:762631031
1502 1502 a, g dbSNP:775315970
1517 1517 a, g dbSNP:267603442
1524 1524 c, g dbSNP:764794066
1530 1530 c, t dbSNP:758950276
1531 1531 a, g dbSNP:776244945
1534 1534 c, t dbSNP:377424658
1535 1535 a, g dbSNP:138538072
1536 1536 c, t dbSNP:373399921
1537 1537 a, g dbSNP:771856087
1539 1539 g, t dbSNP:749470881
1543 1543 c, t dbSNP:375918225
1546 1546 c, t dbSNP:749052785
1548 1548 c, t dbSNP:144620127
1553 1553 a, g dbSNP:727505257
1555 1555 -, tccca dbSNP:775995156
1557 1557 c, t dbSNP:557373206
1564 1564 c, t dbSNP:781397552
1569 1569 g, t dbSNP:757689437
1574 1574 a, c dbSNP:752119095
1575 1575 a, g dbSNP:778247181
1577 1577 a, g dbSNP:537458442
1579 1579 c, t dbSNP:587781108
1580 1580 a, g dbSNP:111450489
1583 1583 a, c, t dbSNP:149930872
1584 1584 a, g dbSNP:369518480
1590 1590 -, ct dbSNP:772434049
1590 1590 c, t dbSNP:760461056
1591 1591 a, g dbSNP:140301552
1595 1595 g, t dbSNP:771804771
1597 1597 a, g dbSNP:397516995
1599 1599 a, g dbSNP:774167553
1602 1602 a, t dbSNP:769899368
1603 1603 -, agtt dbSNP:745998543
1604 1604 c, t dbSNP:151212477
1605 1605 a, g dbSNP:781072699
1607 1607 a, g dbSNP:771076233
1612 1612 a, g dbSNP:747472526
1613 1613 c, t dbSNP:778406619
1618 1618 c, t dbSNP:759017992
1619 1619 c, g, t dbSNP:377000496
1626 1626 g, t dbSNP:755399089
1632 1632 c, t dbSNP:748841539
1641 1641 c, t dbSNP:374163198
1657 1657 a, g dbSNP:779733487
1660 1660 c, g dbSNP:755803749
1662 1662 a, c dbSNP:749926313
1665 1665 a, g dbSNP:144536197
1666 1666 c, t dbSNP:757126132
1670 1670 a, g dbSNP:751517092
1673 1673 a, g dbSNP:763749576
1674 1674 a, t dbSNP:762789806
1676 1676 a, g dbSNP:775192286
1682 1682 c, g dbSNP:766622938
1689 1689 g, t dbSNP:397516998
1691 1691 a, g dbSNP:397516999
1692 1692 c, t dbSNP:146882581
1693 1693 a, g dbSNP:370753286
1695 1695 c, t dbSNP:397517000
1698 1698 c, t dbSNP:774942476
1699 1699 a, g dbSNP:727504098
1703 1703 a, g dbSNP:749633320
1704 1704 a, t dbSNP:780349259
1707 1707 g, t dbSNP:147240502
1711 1711 a, c, t dbSNP:145387575
1714 1714 c, g dbSNP:756784820
1723 1723 c, t dbSNP:751082209
1728 1728 a, g dbSNP:193922672
1729 1729 a, g dbSNP:397517001
1730 1730 c, g dbSNP:543325231
1737 1737 g, t dbSNP:752524467
1744 1744 c, t dbSNP:765139046
1748 1748 a, g dbSNP:760914394
1751 1751 a, g dbSNP:368740836
1752 1752 c, g dbSNP:767654350
1756 1756 c, t dbSNP:143782040
1757 1757 g, t dbSNP:374641292
1762 1762 a, g dbSNP:148533214
1766 1766 a, g dbSNP:763427502
1770 1770 g, t dbSNP:775866434
1775 1775 a, g dbSNP:397517002
1780 1780 c, t dbSNP:745481390
1784 1784 a, g dbSNP:200343561
1786 1786 c, t dbSNP:535581825
1787 1787 a, g dbSNP:376102257
1793 1793 a, g dbSNP:777207291
1801 1801 a, g dbSNP:758301296
1808 1808 a, g dbSNP:200644080
1814 1814 a, t dbSNP:753678882
1822 1822 c, t dbSNP:780049494
1823 1823 a, g dbSNP:558637427
1824 1824 -, c dbSNP:397517005
1824 1824 c, t dbSNP:140058940
1826 1826 a, g dbSNP:764193250
1828 1828 c, t dbSNP:762962401
1839 1839 c, g dbSNP:752815624
1840 1840 a, c, g dbSNP:760093803
1847 1847 a, g dbSNP:541792948
1855 1855 c, t dbSNP:397517006
1856 1856 a, g dbSNP:771041316
1865 1865 c, g dbSNP:776922980
1869 1869 c, t dbSNP:766661152
1871 1871 c, t dbSNP:397517007
1874 1874 a, g dbSNP:146102241
1874 1874 -, g dbSNP:397517008
1875 1875 -, t dbSNP:397517009
1884 1884 c, t dbSNP:113214922
1895 1895 a, g dbSNP:727503371
1903 1903 g, t dbSNP:772764923
1910 1910 a, c dbSNP:771808028
1913 1913 a, g dbSNP:747627830
1925 1925 a, g dbSNP:766720695
1926 1926 c, t dbSNP:373360192
1927 1927 a, g dbSNP:773662874
1932 1932 a, g dbSNP:767068941
1936 1936 -, t dbSNP:397517010
1949 1949 c, t dbSNP:761611902
1952 1952 a, c dbSNP:773935751
1958 1958 a, t dbSNP:768286281
1964 1964 c, t dbSNP:201405287
1966 1966 c, g dbSNP:786205476
1976 1976 a, g dbSNP:749196250
1984 1984 a, g dbSNP:766498974
1987 1987 g, t dbSNP:370219248
1990 1990 -, a dbSNP:757849830
1995 1995 c, g dbSNP:769817013
1996 1996 c, t dbSNP:374897950
2003 2003 a, g dbSNP:745647407
2004 2004 c, t dbSNP:397517011
2005 2005 a, c dbSNP:758559511
2017 2017 c, t dbSNP:748374852
2018 2018 c, t dbSNP:778928536
2019 2019 a, g dbSNP:755076586
2027 2027 c, t dbSNP:397517012
2032 2032 c, t dbSNP:762915326
2034 2034 a, g dbSNP:753970863
2041 2041 -, caa dbSNP:750084387
2041 2041 a, c dbSNP:727503370
2043 2043 a, g dbSNP:533659697
2053 2053 a, g dbSNP:750738012
2056 2056 g, t dbSNP:767935208
2063 2063 a, g dbSNP:761487035
2066 2066 c, t dbSNP:751288871
2067 2067 a, g dbSNP:763648594
2070 2070 -, gaag dbSNP:397517013
2072 2072 a, c, g dbSNP:775103879
2089 2089 a, g dbSNP:138901574
2093 2093 c, t dbSNP:762753884
2094 2094 a, g dbSNP:752092708
2095 2095 a, c, g dbSNP:759353036
2098 2098 c, t dbSNP:752732048
2099 2099 a, g dbSNP:770909247
2104 2104 a, g dbSNP:760434776
2109 2109 c, g dbSNP:773061639
2110 2110 a, g dbSNP:146144731
2114 2114 g, t dbSNP:397517015
2116 2116 a, g dbSNP:749536693
2121 2121 g, t dbSNP:779926314
2125 2125 c, t dbSNP:769943903
2127 2127 a, c dbSNP:746310911
2128 2128 -, c dbSNP:764817683
2134 2134 c, t dbSNP:368325383
2135 2135 a, g dbSNP:143038626
2136 2136 c, t dbSNP:751965920
2143 2143 a, g dbSNP:193922673
2147 2147 g, t dbSNP:200327989
2150 2150 c, g dbSNP:757922359
2151 2151 a, c dbSNP:752426672
2155 2155 a, c, t dbSNP:138495471
2156 2156 a, c, g dbSNP:753331575
2159 2159 -, gtta dbSNP:761072902
2164 2164 a, g dbSNP:766302397
2167 2167 a, g dbSNP:760660042
2170 2170 a, g dbSNP:772931025
2177 2177 c, t dbSNP:144601090
2179 2179 c, t dbSNP:763042549
2185 2185 c, t dbSNP:538127756
2186 2186 a, g dbSNP:759920696
2189 2189 a, t dbSNP:745927810
2190 2190 a, g dbSNP:776915959
2192 2192 a, g dbSNP:375295635
2195 2195 a, g dbSNP:747525514
2198 2198 c, t dbSNP:199583774
2199 2199 a, g dbSNP:758813231
2202 2202 a, g dbSNP:140852019
2205 2205 a, g dbSNP:778600610
2212 2212 a, g dbSNP:727505293
2226 2226 a, g dbSNP:754656865
2229 2229 c, t dbSNP:753335349
2234 2234 c, t dbSNP:397517017
2236 2236 g, t dbSNP:765884775
2240 2240 c, t dbSNP:397517018
2244 2244 c, t dbSNP:397517016
2245 2245 a, g, t dbSNP:371089832
2248 2248 c, t dbSNP:529442984
2249 2249 a, g dbSNP:200844640
2264 2264 c, t dbSNP:757205704
2265 2265 c, g, t dbSNP:144018320
2266 2266 a, g dbSNP:147995773
2283 2283 c, t dbSNP:754136164
2284 2284 a, g, t dbSNP:377504106
2285 2285 a, g dbSNP:773496326
2293 2293 a, g dbSNP:772622598
2303 2303 a, g dbSNP:762243016
2312 2312 cacacc, g dbSNP:397517021
2312 2312 c, g dbSNP:771760693
2313 2313 -, acacc dbSNP:759179184
2317 2317 c, g dbSNP:587781109
2318 2318 c, t dbSNP:121434421
2319 2319 a, g dbSNP:547215531
2321 2321 a, g dbSNP:779654873
2326 2326 a, g dbSNP:769476045
2337 2337 g, t dbSNP:143503798
2344 2344 a, g dbSNP:780623116
2348 2348 g, t dbSNP:757159896
2368 2368 a, g dbSNP:139098675
2373 2373 a, t dbSNP:777577592
2387 2387 c, g, t dbSNP:537046857
2388 2388 a, g dbSNP:397517020
2400 2400 c, t dbSNP:761037679
2405 2405 a, c dbSNP:750463185
2406 2406 a, g dbSNP:767496004
2408 2408 c, g dbSNP:368986542
2418 2418 a, c dbSNP:201487421
2419 2419 a, t dbSNP:752507257
2422 2422 a, t dbSNP:201910118
2426 2426 c, g dbSNP:749154219
2444 2444 atcatt, g dbSNP:786204394
2444 2444 a, c dbSNP:749907181
2447 2447 a, g dbSNP:556563706
2449 2449 cagt, tcctg dbSNP:397517022
2450 2450 c, g dbSNP:757565158
2451 2451 c, g dbSNP:751577129
2452 2452 c, t dbSNP:764172059
2463 2463 c, t dbSNP:758834771
2464 2464 a, g dbSNP:753226330
2468 2468 a, g dbSNP:765782274
2473 2473 c, t dbSNP:759790276
2475 2475 g, t dbSNP:145553222
2476 2476 g, t dbSNP:777122614
2479 2479 c, t dbSNP:765938307
2480 2480 a, g dbSNP:551045165
2481 2481 a, c, t dbSNP:543233804
2493 2493 a, c dbSNP:727504950
2507 2507 a, g dbSNP:112592855
2512 2512 a, g dbSNP:267603441
2527 2527 a, g dbSNP:200272388
2530 2530 c, t dbSNP:774405490
2531 2531 a, g dbSNP:768677218
2537 2537 c, g dbSNP:749029420
2543 2543 a, g dbSNP:779956129
2545 2545 a, g dbSNP:770999774
2546 2546 a, c, t dbSNP:139734328
2547 2547 a, g dbSNP:533884071
2548 2548 c, t dbSNP:369166666
2549 2549 a, g dbSNP:200947767
2555 2555 c, t dbSNP:371917866
2558 2558 aacacc, gaaa dbSNP:786204395
2563 2563 c, t dbSNP:369837002
2564 2564 a, g dbSNP:766775778
2570 2570 a, t dbSNP:147653624
2579 2579 a, g, t dbSNP:145324631
2596 2596 a, g dbSNP:139258347
2597 2597 a, g dbSNP:750119363
2599 2599 c, t dbSNP:727504509
2600 2600 a, g dbSNP:151264959
2602 2602 c, t dbSNP:142362933
2603 2603 c, g dbSNP:768463319
2607 2607 a, g dbSNP:200411128
2610 2610 c, t dbSNP:763663760
2616 2616 a, g dbSNP:762759462
2617 2617 c, g dbSNP:775519219
2619 2619 a, g dbSNP:372729739
2622 2622 a, c dbSNP:759322948
2624 2624 -, a dbSNP:727504432
2626 2626 c, t dbSNP:532024812
2634 2634 c, t dbSNP:267603440
2638 2638 c, t dbSNP:772225819
2639 2639 a, g dbSNP:368633311
2642 2642 c, t dbSNP:774258852
2652 2652 c, t dbSNP:768808114
2656 2656 a, g dbSNP:374689137
2658 2658 c, g dbSNP:117425357
2665 2665 c, t dbSNP:756749174
2666 2666 -, a dbSNP:727504786
2667 2667 c, t dbSNP:146118033
2668 2668 a, g dbSNP:199900632
2669 2669 a, g dbSNP:727505312
2675 2675 c, t dbSNP:397517023
2685 2685 a, t dbSNP:751287217
2704 2704 a, g dbSNP:777477467
2708 2708 a, g dbSNP:758045048
2718 2718 a, t dbSNP:752195586
2721 2721 a, c dbSNP:764733489
2726 2726 c, t dbSNP:754873048
2727 2727 a, g dbSNP:372263407
2730 2730 c, t dbSNP:370599966
2734 2734 c, t dbSNP:747191995
2735 2735 a, t dbSNP:760426951
2743 2743 a, c dbSNP:772944101
2746 2746 a, c dbSNP:202094467
2749 2749 c, t dbSNP:763095604
2751 2751 c, t dbSNP:775572104
2768 2768 c, t dbSNP:368280823
2774 2774 a, g dbSNP:760070309
2775 2775 a, g dbSNP:777255175
2782 2782 c, t dbSNP:374423082
2783 2783 a, g, t dbSNP:371003054
2785 2785 c, t dbSNP:112122278
2789 2789 a, c dbSNP:577371727
2795 2795 c, t dbSNP:747790233
2800 2800 a, g dbSNP:192293307
2802 2802 a, g dbSNP:754465954
2808 2808 c, t dbSNP:753390355
2809 2809 -, a dbSNP:369140281
2844 2844 a, g dbSNP:543423631
2871 2871 g, t dbSNP:575103888
2963 2963 c, t dbSNP:77988382
2964 2964 a, g dbSNP:779904968
2975 2975 c, t dbSNP:534925569
2985 2985 g, t dbSNP:565929882
3012 3012 c, g dbSNP:12612
3042 3042 a, g dbSNP:78540632
3064 3064 a, g dbSNP:148693924
3091 3091 a, g dbSNP:375759731
3135 3135 g, t dbSNP:549779151
3155 3155 -, at dbSNP:532639658
3161 3161 a, g dbSNP:529644235
3172 3172 c, t dbSNP:373376331
3181 3181 c, t dbSNP:567593228
3233 3233 c, t dbSNP:778860945
3236 3236 a, g dbSNP:758672599
3240 3240 g, t dbSNP:547711453
3344 3344 -, acttaa dbSNP:137947383
3368 3368 a, c dbSNP:187797390
3407 3407 a, g dbSNP:144983891
3422 3422 a, c dbSNP:183456715
3432 3432 c, t dbSNP:191280908
3444 3444 c, t dbSNP:144110140
3456 3456 a, t dbSNP:1046131
3513 3513 -, a dbSNP:770216671
3515 3515 a, g dbSNP:753400788
3516 3516 c, t dbSNP:1046132
3536 3536 a, g dbSNP:543832696
3546 3546 c, t dbSNP:777141902
3553 3553 a, g dbSNP:574730494
3573 3573 c, t dbSNP:9394
3576 3576 c, t dbSNP:541327210
3600 3600 c, t dbSNP:542578192
3601 3601 a, g dbSNP:572361225
3640 3640 c, t dbSNP:752229944
3693 3693 a, c dbSNP:766792445
3705 3705 a, c dbSNP:6488090
3825 3825 c, t dbSNP:201302510
3900 3900 c, t dbSNP:538828712
3905 3905 a, g dbSNP:371438712
3957 3957 ag, ggt dbSNP:71460977
3957 3957 a, g dbSNP:1046138
3959 3959 -, t dbSNP:397850018
3960 3960 -, t dbSNP:11476598
4007 4007 c, t dbSNP:187618849
4032 4032 c, g dbSNP:12314796
4062 4062 -, t dbSNP:397840855
4072 4072 -, t dbSNP:3833501
4147 4147 a, g dbSNP:556485698
4155 4155 a, t dbSNP:112547924
4192 4192 a, g dbSNP:1046150
4243 4243 a, c dbSNP:547378328
4255 4255 c, t dbSNP:11539836
4286 4286 c, g dbSNP:552084860
4301 4301 -, at dbSNP:554108262
4324 4324 g, t dbSNP:1046154
4356 4356 a, t dbSNP:558152120
4363 4363 a, g dbSNP:760973876
4383 4383 a, g dbSNP:571538640

Target ORF information:

RefSeq Version NM_004572
Organism Homo sapiens (human)
Definition Homo sapiens plakophilin 2 (PKP2), transcript variant 2b, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23286
Clone ID Related Accession (Same CDS sequence) NM_001005242
Accession Version NM_001005242.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2514bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product plakophilin-2 isoform 2a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB454360.1, BC126199.1, AC087588.10 and AW439621.1. On Jun 7, 2007 this sequence version replaced gi:52630431. Summary: This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene product may regulate the signaling activity of beta-catenin. Two alternately spliced transcripts encoding two protein isoforms have been identified. A processed pseudogene with high similarity to this locus has been mapped to chromosome 12p13. [provided by RefSeq, Jul 2008]. Transcript Variant: This transcript variant (2a) lacks an alternate exon as compared to transcript variant 2b and encodes the shorter isoform (2a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC070083.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962346 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_001005242.2
Misc Feature(1)509..511(+)
Misc Feature(2)620..622(+)
Misc Feature(3)1163..1516(+)
Misc Feature(4)1226..1516(+)
Misc Feature(5)2006..2395(+)
Misc Feature(6)2081..2395(+)
Exon (1)1..338
Gene Synonym:
Exon (2)339..451
Gene Synonym:
Exon (3)452..1149
Gene Synonym:
Exon (4)1150..1285
Gene Synonym:
Exon (5)1286..1493
Gene Synonym:
Exon (6)1494..1671
Gene Synonym:
Exon (7)1672..1789
Gene Synonym:
Exon (8)1790..1954
Gene Synonym:
Exon (9)1955..2128
Gene Synonym:
Exon (10)2129..2282
Gene Synonym:
Exon (11)2283..2472
Gene Synonym:
Exon (12)2473..2560
Gene Synonym:
Exon (13)2561..4307
Gene Synonym:
Position Chain Variation Link
17 17 c, t dbSNP:565997897
26 26 g, t dbSNP:552373947
84 84 a, c dbSNP:758069762
87 87 c, g dbSNP:752524692
91 91 c, t dbSNP:765009350
94 94 c, g dbSNP:373925978
102 102 c, t dbSNP:750694426
108 108 c, t dbSNP:767539502
127 127 c, t dbSNP:397516991
129 129 a, g dbSNP:774778142
129 129 -, g dbSNP:397516996
134 134 c, t dbSNP:764645176
150 150 a, g dbSNP:763433296
153 153 a, t dbSNP:775889367
154 154 c, t dbSNP:770102631
160 160 c, t dbSNP:759214983
171 171 a, c dbSNP:776453793
182 182 c, g dbSNP:770498155
183 183 a, g dbSNP:746530389
191 191 a, g dbSNP:143004808
192 192 a, g dbSNP:772042931
193 193 a, c dbSNP:748077185
214 214 c, t dbSNP:778749586
218 218 a, g dbSNP:754791731
221 221 a, g dbSNP:750606970
225 225 a, g dbSNP:781400459
238 238 g, t dbSNP:757273590
246 246 a, g dbSNP:751629644
251 251 a, c dbSNP:764116301
261 261 a, g dbSNP:763492084
263 263 -, acag dbSNP:397516997
263 263 a, g dbSNP:753164020
270 270 a, g dbSNP:549598534
271 271 a, g dbSNP:201210997
273 273 a, g dbSNP:776363973
274 274 a, c dbSNP:770694213
282 282 c, t dbSNP:760470852
289 289 g, t dbSNP:146708884
291 291 a, t dbSNP:730880179
295 295 g, t dbSNP:748071846
299 299 a, c dbSNP:199601548
305 305 -, c dbSNP:762288961
307 307 a, c dbSNP:768376044
308 308 g, t dbSNP:143323961
309 309 c, t dbSNP:139924723
310 310 c, t dbSNP:397517014
313 313 a, g dbSNP:144106848
323 323 a, g dbSNP:751775528
324 324 c, g, t dbSNP:75909145
329 329 g, t dbSNP:397517019
337 337 c, g dbSNP:753180642
338 338 a, g dbSNP:765852160
339 339 a, g dbSNP:267603443
345 345 a, t dbSNP:754446972
350 350 c, t dbSNP:121434420
351 351 a, g dbSNP:766802880
365 365 c, t dbSNP:756468173
368 368 -, gagt dbSNP:786204388
374 374 c, g dbSNP:750028032
376 376 c, t dbSNP:767093212
379 379 c, t dbSNP:761588340
384 384 -, taca dbSNP:397517025
389 389 g, t dbSNP:773851296
390 390 c, t dbSNP:763639737
403 403 g, t dbSNP:762825735
408 408 c, t dbSNP:775434969
413 413 a, g dbSNP:769509055
414 414 a, g dbSNP:745661586
417 417 a, g dbSNP:149542398
421 421 a, c dbSNP:376613662
422 422 a, c dbSNP:139215336
428 428 c, g, t dbSNP:375035084
435 435 c, t dbSNP:749774181
440 440 a, g dbSNP:749107090
441 441 a, t dbSNP:756446946
444 444 c, t dbSNP:750744212
459 459 c, t dbSNP:199860323
472 472 c, t dbSNP:758097199
474 474 a, c dbSNP:752173491
475 475 a, g dbSNP:764868621
479 479 c, t dbSNP:759377911
480 480 a, g, t dbSNP:201306582
483 483 c, g dbSNP:760576804
484 484 a, g dbSNP:774663443
502 502 a, g dbSNP:768974835
505 505 c, t dbSNP:763303290
509 509 a, t dbSNP:750523022
510 510 a, c dbSNP:765241754
520 520 c, t dbSNP:775423741
521 521 a, g, t dbSNP:567795321
524 524 a, g dbSNP:781739949
529 529 a, t dbSNP:771153426
533 533 a, t dbSNP:727503373
534 534 c, t dbSNP:150821281
535 535 c, t dbSNP:2389115
548 548 -, ct dbSNP:199643407
562 562 g, t dbSNP:778151977
565 565 g, t dbSNP:758042119
572 572 a, g dbSNP:747856983
576 576 a, g dbSNP:778228018
577 577 c, g dbSNP:397517026
579 579 c, g dbSNP:141438322
582 582 c, t dbSNP:766360871
583 583 a, g dbSNP:756166702
588 588 a, g dbSNP:397517027
589 589 a, g dbSNP:767482842
594 594 a, g dbSNP:763249730
597 597 a, g dbSNP:775789180
599 599 a, g dbSNP:765195368
600 600 c, t dbSNP:759687672
601 601 a, g, t dbSNP:189040311
604 604 c, t dbSNP:771398047
607 607 c, t dbSNP:747582030
609 609 a, g dbSNP:773552936
613 613 c, t dbSNP:772439804
620 620 a, g dbSNP:139139859
631 631 a, c dbSNP:397517028
636 636 c, t dbSNP:754395430
640 640 a, g dbSNP:748807540
645 645 c, t dbSNP:779467662
648 648 -, t dbSNP:769220833
648 648 c, t dbSNP:756113352
656 656 c, g dbSNP:750440181
657 657 a, c dbSNP:767358039
663 663 a, g dbSNP:373222905
668 668 c, t dbSNP:571569344
669 669 a, g dbSNP:765477952
670 670 a, g dbSNP:759719235
671 671 a, g dbSNP:776770393
673 673 a, c, t dbSNP:184522105
674 674 a, g dbSNP:200095747
677 677 c, g dbSNP:773712517
683 683 c, g dbSNP:772384894
690 690 c, t dbSNP:748566573
691 691 a, g dbSNP:373380483
697 697 c, t dbSNP:532048791
701 701 c, t dbSNP:748957791
702 702 a, g dbSNP:146566525
706 706 c, t dbSNP:769438623
713 713 a, g dbSNP:369923216
715 715 a, g dbSNP:781305034
717 717 a, g dbSNP:757316313
719 719 -, g dbSNP:747504380
720 720 c, t dbSNP:751341106
724 724 c, t dbSNP:768906235
725 725 c, t dbSNP:777497296
726 726 a, g dbSNP:755215178
735 735 c, g dbSNP:754021184
737 737 a, g dbSNP:563138160
749 749 c, t dbSNP:766379716
771 771 a, g dbSNP:760774269
772 772 a, g dbSNP:750880081
778 778 a, c dbSNP:767987619
796 796 c, t dbSNP:762263587
797 797 a, g dbSNP:143954425
803 803 a, g dbSNP:543281875
811 811 c, t dbSNP:375677250
821 821 g, t dbSNP:62001015
826 826 c, t dbSNP:769383600
828 828 c, t dbSNP:560220280
829 829 a, g dbSNP:727503372
832 832 c, t dbSNP:143777637
834 834 c, t dbSNP:372700909
835 835 a, g dbSNP:777567315
840 840 c, t dbSNP:201580443
843 843 a, c dbSNP:754018608
845 845 c, g, t dbSNP:756376477
853 853 -, aggga dbSNP:780485224
853 853 a, g dbSNP:750469808
855 855 a, g dbSNP:767647926
856 856 c, g dbSNP:762366326
857 857 a, c dbSNP:752017355
863 863 c, t dbSNP:577631447
864 864 g, t dbSNP:369332786
870 870 c, t dbSNP:776049790
876 876 a, c dbSNP:769542968
882 882 c, t dbSNP:759331787
887 887 a, t dbSNP:727504430
889 889 a, g dbSNP:776268890
899 899 a, c dbSNP:199701968
903 903 c, t dbSNP:543758984
904 904 a, g dbSNP:760432217
906 906 c, t dbSNP:62001016
908 908 a, g dbSNP:555239517
910 910 g, t dbSNP:375268778
916 916 c, t dbSNP:756321518
917 917 g, t dbSNP:746144782
919 919 c, t dbSNP:781271804
920 920 a, g dbSNP:757285245
923 923 c, t dbSNP:752060568
927 927 g, t dbSNP:764490412
931 931 c, g dbSNP:758986464
932 932 c, g, t dbSNP:765756156
934 934 a, g, t dbSNP:3748279
937 937 c, g dbSNP:145886908
941 941 c, t dbSNP:201944276
945 945 c, t dbSNP:772827289
952 952 -, cg dbSNP:772220644
952 952 c, t dbSNP:572938229
953 953 a, g dbSNP:748148237
961 961 c, g dbSNP:377137357
965 965 a, g dbSNP:768451308
969 969 c, t dbSNP:372664096
974 974 a, g dbSNP:781296737
977 977 c, t dbSNP:757552761
988 988 a, t dbSNP:747032628
1001 1001 a, c dbSNP:777978966
1003 1003 c, t dbSNP:397517029
1004 1004 a, t dbSNP:758962957
1008 1008 a, c dbSNP:753271708
1010 1010 c, t dbSNP:564987195
1011 1011 a, g dbSNP:755425370
1014 1014 a, c dbSNP:553098424
1015 1015 a, g dbSNP:140235564
1024 1024 a, g dbSNP:376001513
1029 1029 a, g dbSNP:146683466
1033 1033 c, t dbSNP:368656084
1040 1040 a, g dbSNP:761677945
1042 1042 c, t dbSNP:200152448
1043 1043 a, g dbSNP:768396351
1049 1049 c, g, t dbSNP:756604557
1053 1053 a, g dbSNP:775398790
1054 1054 c, t dbSNP:61729381
1055 1055 a, g dbSNP:551812289
1056 1056 a, g dbSNP:139903989
1065 1065 c, t dbSNP:775318947
1066 1066 ac, gcacttgactgtcggccaggcggccgcaggggg dbSNP:397517030
1066 1066 a, g dbSNP:61729382
1068 1068 a, c dbSNP:181098323
1078 1078 c, t dbSNP:202207343
1079 1079 a, g, t dbSNP:200069860
1083 1083 -, ag dbSNP:745882420
1086 1086 -, ct dbSNP:779241371
1086 1086 c, g, t dbSNP:529523595
1087 1087 a, g dbSNP:142636176
1089 1089 c, t dbSNP:201803918
1090 1090 c, t dbSNP:369921166
1091 1091 a, g dbSNP:148480056
1092 1092 a, c dbSNP:762949110
1093 1093 a, g dbSNP:775137004
1094 1094 -, g dbSNP:786205353
1095 1095 a, g, t dbSNP:759660796
1097 1097 a, g dbSNP:773517387
1098 1098 c, g dbSNP:144651139
1100 1100 a, c, t dbSNP:779173447
1104 1104 g, t dbSNP:373041797
1105 1105 c, g, t dbSNP:749862514
1108 1108 c, t dbSNP:780222357
1111 1111 a, g dbSNP:144574595
1125 1125 a, g dbSNP:144401285
1127 1127 a, g dbSNP:139851304
1128 1128 a, c dbSNP:756946586
1132 1132 c, t dbSNP:751068912
1139 1139 c, t dbSNP:563797120
1143 1143 a, g dbSNP:762744983
1160 1160 a, g dbSNP:199957846
1163 1163 a, g dbSNP:147264025
1168 1168 g, t dbSNP:765200197
1178 1178 c, t dbSNP:754912778
1179 1179 a, g dbSNP:370868564
1184 1184 a, g dbSNP:766334171
1194 1194 c, t dbSNP:730880180
1195 1195 c, t dbSNP:397516984
1196 1196 a, c, g dbSNP:375404471
1201 1201 a, g dbSNP:376167178
1206 1206 a, t dbSNP:763114466
1208 1208 a, g dbSNP:143900944
1210 1210 g, t dbSNP:770333863
1212 1212 c, t dbSNP:1046116
1216 1216 a, c dbSNP:776927054
1221 1221 a, g dbSNP:771293688
1229 1229 a, c, g dbSNP:200586695
1231 1231 c, t dbSNP:142742483
1242 1242 c, t dbSNP:56869013
1245 1245 c, t dbSNP:397516985
1247 1247 c, t dbSNP:397516986
1252 1252 c, t dbSNP:754927123
1259 1259 c, t dbSNP:753839199
1260 1260 -, t dbSNP:762510904
1277 1277 c, t dbSNP:766209297
1278 1278 a, g dbSNP:756000218
1282 1282 a, g dbSNP:751778207
1292 1292 c, t dbSNP:786204393
1296 1296 a, t dbSNP:766842360
1298 1298 c, t dbSNP:761238380
1299 1299 c, g dbSNP:773611613
1305 1305 a, t dbSNP:772334698
1314 1314 a, t dbSNP:761461735
1321 1321 a, g dbSNP:773905605
1323 1323 c, t dbSNP:761027394
1326 1326 -, t dbSNP:397516989
1345 1345 c, t dbSNP:148364390
1346 1346 a, g dbSNP:192041220
1351 1351 a, g dbSNP:779749104
1352 1352 c, t dbSNP:372827156
1353 1353 a, g dbSNP:200715477
1366 1366 g, t dbSNP:567854722
1377 1377 a, g dbSNP:780977066
1386 1386 c, t dbSNP:397516990
1402 1402 c, t dbSNP:727505239
1407 1407 c, t dbSNP:143397927
1414 1414 a, g dbSNP:752919159
1422 1422 atttagtt, taaatgggg dbSNP:397516992
1431 1431 g, t dbSNP:778982154
1436 1436 c, t dbSNP:755233999
1437 1437 a, g dbSNP:753912985
1438 1438 g, t dbSNP:3748278
1441 1441 a, g dbSNP:377076035
1465 1465 a, g dbSNP:200831332
1466 1466 a, g dbSNP:756554413
1482 1482 a, g dbSNP:750897570
1484 1484 -, caaa dbSNP:397516993
1487 1487 a, g dbSNP:199571473
1491 1491 c, t dbSNP:752832849
1494 1494 g, t dbSNP:755399089
1500 1500 c, t dbSNP:748841539
1509 1509 c, t dbSNP:374163198
1525 1525 a, g dbSNP:779733487
1528 1528 c, g dbSNP:755803749
1530 1530 a, c dbSNP:749926313
1533 1533 a, g dbSNP:144536197
1534 1534 c, t dbSNP:757126132
1538 1538 a, g dbSNP:751517092
1541 1541 a, g dbSNP:763749576
1542 1542 a, t dbSNP:762789806
1544 1544 a, g dbSNP:775192286
1550 1550 c, g dbSNP:766622938
1557 1557 g, t dbSNP:397516998
1559 1559 a, g dbSNP:397516999
1560 1560 c, t dbSNP:146882581
1561 1561 a, g dbSNP:370753286
1563 1563 c, t dbSNP:397517000
1566 1566 c, t dbSNP:774942476
1567 1567 a, g dbSNP:727504098
1571 1571 a, g dbSNP:749633320
1572 1572 a, t dbSNP:780349259
1575 1575 g, t dbSNP:147240502
1579 1579 a, c, t dbSNP:145387575
1582 1582 c, g dbSNP:756784820
1591 1591 c, t dbSNP:751082209
1596 1596 a, g dbSNP:193922672
1597 1597 a, g dbSNP:397517001
1598 1598 c, g dbSNP:543325231
1605 1605 g, t dbSNP:752524467
1612 1612 c, t dbSNP:765139046
1616 1616 a, g dbSNP:760914394
1619 1619 a, g dbSNP:368740836
1620 1620 c, g dbSNP:767654350
1624 1624 c, t dbSNP:143782040
1625 1625 g, t dbSNP:374641292
1630 1630 a, g dbSNP:148533214
1634 1634 a, g dbSNP:763427502
1638 1638 g, t dbSNP:775866434
1643 1643 a, g dbSNP:397517002
1648 1648 c, t dbSNP:745481390
1652 1652 a, g dbSNP:200343561
1654 1654 c, t dbSNP:535581825
1655 1655 a, g dbSNP:376102257
1661 1661 a, g dbSNP:777207291
1669 1669 a, g dbSNP:758301296
1676 1676 a, g dbSNP:200644080
1682 1682 a, t dbSNP:753678882
1690 1690 c, t dbSNP:780049494
1691 1691 a, g dbSNP:558637427
1692 1692 -, c dbSNP:397517005
1692 1692 c, t dbSNP:140058940
1694 1694 a, g dbSNP:764193250
1696 1696 c, t dbSNP:762962401
1707 1707 c, g dbSNP:752815624
1708 1708 a, c, g dbSNP:760093803
1715 1715 a, g dbSNP:541792948
1723 1723 c, t dbSNP:397517006
1724 1724 a, g dbSNP:771041316
1733 1733 c, g dbSNP:776922980
1737 1737 c, t dbSNP:766661152
1739 1739 c, t dbSNP:397517007
1742 1742 a, g dbSNP:146102241
1742 1742 -, g dbSNP:397517008
1743 1743 -, t dbSNP:397517009
1752 1752 c, t dbSNP:113214922
1763 1763 a, g dbSNP:727503371
1771 1771 g, t dbSNP:772764923
1778 1778 a, c dbSNP:771808028
1781 1781 a, g dbSNP:747627830
1793 1793 a, g dbSNP:766720695
1794 1794 c, t dbSNP:373360192
1795 1795 a, g dbSNP:773662874
1800 1800 a, g dbSNP:767068941
1804 1804 -, t dbSNP:397517010
1817 1817 c, t dbSNP:761611902
1820 1820 a, c dbSNP:773935751
1826 1826 a, t dbSNP:768286281
1832 1832 c, t dbSNP:201405287
1834 1834 c, g dbSNP:786205476
1844 1844 a, g dbSNP:749196250
1852 1852 a, g dbSNP:766498974
1855 1855 g, t dbSNP:370219248
1858 1858 -, a dbSNP:757849830
1863 1863 c, g dbSNP:769817013
1864 1864 c, t dbSNP:374897950
1871 1871 a, g dbSNP:745647407
1872 1872 c, t dbSNP:397517011
1873 1873 a, c dbSNP:758559511
1885 1885 c, t dbSNP:748374852
1886 1886 c, t dbSNP:778928536
1887 1887 a, g dbSNP:755076586
1895 1895 c, t dbSNP:397517012
1900 1900 c, t dbSNP:762915326
1902 1902 a, g dbSNP:753970863
1909 1909 -, caa dbSNP:750084387
1909 1909 a, c dbSNP:727503370
1911 1911 a, g dbSNP:533659697
1921 1921 a, g dbSNP:750738012
1924 1924 g, t dbSNP:767935208
1931 1931 a, g dbSNP:761487035
1934 1934 c, t dbSNP:751288871
1935 1935 a, g dbSNP:763648594
1938 1938 -, gaag dbSNP:397517013
1940 1940 a, c, g dbSNP:775103879
1957 1957 a, g dbSNP:138901574
1961 1961 c, t dbSNP:762753884
1962 1962 a, g dbSNP:752092708
1963 1963 a, c, g dbSNP:759353036
1966 1966 c, t dbSNP:752732048
1967 1967 a, g dbSNP:770909247
1972 1972 a, g dbSNP:760434776
1977 1977 c, g dbSNP:773061639
1978 1978 a, g dbSNP:146144731
1982 1982 g, t dbSNP:397517015
1984 1984 a, g dbSNP:749536693
1989 1989 g, t dbSNP:779926314
1993 1993 c, t dbSNP:769943903
1995 1995 a, c dbSNP:746310911
1996 1996 -, c dbSNP:764817683
2002 2002 c, t dbSNP:368325383
2003 2003 a, g dbSNP:143038626
2004 2004 c, t dbSNP:751965920
2011 2011 a, g dbSNP:193922673
2015 2015 g, t dbSNP:200327989
2018 2018 c, g dbSNP:757922359
2019 2019 a, c dbSNP:752426672
2023 2023 a, c, t dbSNP:138495471
2024 2024 a, c, g dbSNP:753331575
2027 2027 -, gtta dbSNP:761072902
2032 2032 a, g dbSNP:766302397
2035 2035 a, g dbSNP:760660042
2038 2038 a, g dbSNP:772931025
2045 2045 c, t dbSNP:144601090
2047 2047 c, t dbSNP:763042549
2053 2053 c, t dbSNP:538127756
2054 2054 a, g dbSNP:759920696
2057 2057 a, t dbSNP:745927810
2058 2058 a, g dbSNP:776915959
2060 2060 a, g dbSNP:375295635
2063 2063 a, g dbSNP:747525514
2066 2066 c, t dbSNP:199583774
2067 2067 a, g dbSNP:758813231
2070 2070 a, g dbSNP:140852019
2073 2073 a, g dbSNP:778600610
2080 2080 a, g dbSNP:727505293
2094 2094 a, g dbSNP:754656865
2097 2097 c, t dbSNP:753335349
2102 2102 c, t dbSNP:397517017
2104 2104 g, t dbSNP:765884775
2108 2108 c, t dbSNP:397517018
2112 2112 c, t dbSNP:397517016
2113 2113 a, g, t dbSNP:371089832
2116 2116 c, t dbSNP:529442984
2117 2117 a, g dbSNP:200844640
2132 2132 c, t dbSNP:757205704
2133 2133 c, g, t dbSNP:144018320
2134 2134 a, g dbSNP:147995773
2151 2151 c, t dbSNP:754136164
2152 2152 a, g, t dbSNP:377504106
2153 2153 a, g dbSNP:773496326
2161 2161 a, g dbSNP:772622598
2171 2171 a, g dbSNP:762243016
2180 2180 cacacc, g dbSNP:397517021
2180 2180 c, g dbSNP:771760693
2181 2181 -, acacc dbSNP:759179184
2185 2185 c, g dbSNP:587781109
2186 2186 c, t dbSNP:121434421
2187 2187 a, g dbSNP:547215531
2189 2189 a, g dbSNP:779654873
2194 2194 a, g dbSNP:769476045
2205 2205 g, t dbSNP:143503798
2212 2212 a, g dbSNP:780623116
2216 2216 g, t dbSNP:757159896
2236 2236 a, g dbSNP:139098675
2241 2241 a, t dbSNP:777577592
2255 2255 c, g, t dbSNP:537046857
2256 2256 a, g dbSNP:397517020
2268 2268 c, t dbSNP:761037679
2273 2273 a, c dbSNP:750463185
2274 2274 a, g dbSNP:767496004
2276 2276 c, g dbSNP:368986542
2286 2286 a, c dbSNP:201487421
2287 2287 a, t dbSNP:752507257
2290 2290 a, t dbSNP:201910118
2294 2294 c, g dbSNP:749154219
2312 2312 atcatt, g dbSNP:786204394
2312 2312 a, c dbSNP:749907181
2315 2315 a, g dbSNP:556563706
2317 2317 cagt, tcctg dbSNP:397517022
2318 2318 c, g dbSNP:757565158
2319 2319 c, g dbSNP:751577129
2320 2320 c, t dbSNP:764172059
2331 2331 c, t dbSNP:758834771
2332 2332 a, g dbSNP:753226330
2336 2336 a, g dbSNP:765782274
2341 2341 c, t dbSNP:759790276
2343 2343 g, t dbSNP:145553222
2344 2344 g, t dbSNP:777122614
2347 2347 c, t dbSNP:765938307
2348 2348 a, g dbSNP:551045165
2349 2349 a, c, t dbSNP:543233804
2361 2361 a, c dbSNP:727504950
2375 2375 a, g dbSNP:112592855
2380 2380 a, g dbSNP:267603441
2395 2395 a, g dbSNP:200272388
2398 2398 c, t dbSNP:774405490
2399 2399 a, g dbSNP:768677218
2405 2405 c, g dbSNP:749029420
2411 2411 a, g dbSNP:779956129
2413 2413 a, g dbSNP:770999774
2414 2414 a, c, t dbSNP:139734328
2415 2415 a, g dbSNP:533884071
2416 2416 c, t dbSNP:369166666
2417 2417 a, g dbSNP:200947767
2423 2423 c, t dbSNP:371917866
2426 2426 aacacc, gaaa dbSNP:786204395
2431 2431 c, t dbSNP:369837002
2432 2432 a, g dbSNP:766775778
2438 2438 a, t dbSNP:147653624
2447 2447 a, g, t dbSNP:145324631
2464 2464 a, g dbSNP:139258347
2465 2465 a, g dbSNP:750119363
2467 2467 c, t dbSNP:727504509
2468 2468 a, g dbSNP:151264959
2470 2470 c, t dbSNP:142362933
2471 2471 c, g dbSNP:768463319
2475 2475 a, g dbSNP:200411128
2478 2478 c, t dbSNP:763663760
2484 2484 a, g dbSNP:762759462
2485 2485 c, g dbSNP:775519219
2487 2487 a, g dbSNP:372729739
2490 2490 a, c dbSNP:759322948
2492 2492 -, a dbSNP:727504432
2494 2494 c, t dbSNP:532024812
2502 2502 c, t dbSNP:267603440
2506 2506 c, t dbSNP:772225819
2507 2507 a, g dbSNP:368633311
2510 2510 c, t dbSNP:774258852
2520 2520 c, t dbSNP:768808114
2524 2524 a, g dbSNP:374689137
2526 2526 c, g dbSNP:117425357
2533 2533 c, t dbSNP:756749174
2534 2534 -, a dbSNP:727504786
2535 2535 c, t dbSNP:146118033
2536 2536 a, g dbSNP:199900632
2537 2537 a, g dbSNP:727505312
2543 2543 c, t dbSNP:397517023
2553 2553 a, t dbSNP:751287217
2572 2572 a, g dbSNP:777477467
2576 2576 a, g dbSNP:758045048
2586 2586 a, t dbSNP:752195586
2589 2589 a, c dbSNP:764733489
2594 2594 c, t dbSNP:754873048
2595 2595 a, g dbSNP:372263407
2598 2598 c, t dbSNP:370599966
2602 2602 c, t dbSNP:747191995
2603 2603 a, t dbSNP:760426951
2611 2611 a, c dbSNP:772944101
2614 2614 a, c dbSNP:202094467
2617 2617 c, t dbSNP:763095604
2619 2619 c, t dbSNP:775572104
2636 2636 c, t dbSNP:368280823
2642 2642 a, g dbSNP:760070309
2643 2643 a, g dbSNP:777255175
2650 2650 c, t dbSNP:374423082
2651 2651 a, g, t dbSNP:371003054
2653 2653 c, t dbSNP:112122278
2657 2657 a, c dbSNP:577371727
2663 2663 c, t dbSNP:747790233
2668 2668 a, g dbSNP:192293307
2670 2670 a, g dbSNP:754465954
2676 2676 c, t dbSNP:753390355
2677 2677 -, a dbSNP:369140281
2712 2712 a, g dbSNP:543423631
2739 2739 g, t dbSNP:575103888
2831 2831 c, t dbSNP:77988382
2832 2832 a, g dbSNP:779904968
2843 2843 c, t dbSNP:534925569
2853 2853 g, t dbSNP:565929882
2880 2880 c, g dbSNP:12612
2910 2910 a, g dbSNP:78540632
2932 2932 a, g dbSNP:148693924
2959 2959 a, g dbSNP:375759731
3003 3003 g, t dbSNP:549779151
3023 3023 -, at dbSNP:532639658
3029 3029 a, g dbSNP:529644235
3040 3040 c, t dbSNP:373376331
3049 3049 c, t dbSNP:567593228
3101 3101 c, t dbSNP:778860945
3104 3104 a, g dbSNP:758672599
3108 3108 g, t dbSNP:547711453
3212 3212 -, acttaa dbSNP:137947383
3236 3236 a, c dbSNP:187797390
3275 3275 a, g dbSNP:144983891
3290 3290 a, c dbSNP:183456715
3300 3300 c, t dbSNP:191280908
3312 3312 c, t dbSNP:144110140
3324 3324 a, t dbSNP:1046131
3381 3381 -, a dbSNP:770216671
3383 3383 a, g dbSNP:753400788
3384 3384 c, t dbSNP:1046132
3404 3404 a, g dbSNP:543832696
3414 3414 c, t dbSNP:777141902
3421 3421 a, g dbSNP:574730494
3441 3441 c, t dbSNP:9394
3444 3444 c, t dbSNP:541327210
3468 3468 c, t dbSNP:542578192
3469 3469 a, g dbSNP:572361225
3508 3508 c, t dbSNP:752229944
3561 3561 a, c dbSNP:766792445
3573 3573 a, c dbSNP:6488090
3693 3693 c, t dbSNP:201302510
3768 3768 c, t dbSNP:538828712
3773 3773 a, g dbSNP:371438712
3825 3825 ag, ggt dbSNP:71460977
3825 3825 a, g dbSNP:1046138
3827 3827 -, t dbSNP:397850018
3828 3828 -, t dbSNP:11476598
3875 3875 c, t dbSNP:187618849
3900 3900 c, g dbSNP:12314796
3930 3930 -, t dbSNP:397840855
3940 3940 -, t dbSNP:3833501
4015 4015 a, g dbSNP:556485698
4023 4023 a, t dbSNP:112547924
4060 4060 a, g dbSNP:1046150
4111 4111 a, c dbSNP:547378328
4123 4123 c, t dbSNP:11539836
4154 4154 c, g dbSNP:552084860
4169 4169 -, at dbSNP:554108262
4192 4192 g, t dbSNP:1046154
4224 4224 a, t dbSNP:558152120
4231 4231 a, g dbSNP:760973876
4251 4251 a, g dbSNP:571538640

Target ORF information:

RefSeq Version NM_001005242
Organism Homo sapiens (human)
Definition Homo sapiens plakophilin 2 (PKP2), transcript variant 2a, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


The hippo pathway is activated and is a causal mechanism for adipogenesis in arrhythmogenic cardiomyopathy
Circ. Res. 114 (3), 454-468 (2014)
Chen SN, Gurha P, Lombardi R, Ruggiero A, Willerson JT and Marian AJ.


Plakophilin 2 affects cell migration by modulating focal adhesion dynamics and integrin protein expression
J. Invest. Dermatol. 134 (1), 112-122 (2014)
Koetsier JL, Amargo EV, Todorovic V, Green KJ and Godsel LM.


Identification of a PKP2 gene deletion in a family with arrhythmogenic right ventricular cardiomyopathy
Eur. J. Hum. Genet. 21 (11), 1226-1231 (2013)
Li Mura IE, Bauce B, Nava A, Fanciulli M, Vazza G, Mazzotti E, Rigato I, De Bortoli M, Beffagna G, Lorenzon A, Calore M, Dazzo E, Nobile C, Mostacciuolo ML, Corrado D, Basso C, Daliento L, Thiene G and Rampazzo A.


Prevalence of arrhythmia-associated gene mutations and risk of sudden cardiac death in the Finnish population
Ann. Med. 45 (4), 328-335 (2013)
Lahtinen AM, Havulinna AS, Noseworthy PA, Jula A, Karhunen PJ, Perola M, Newton-Cheh C, Salomaa V and Kontula K.


Left-dominant arrhythmogenic cardiomyopathy in a large family: associated desmosomal or nondesmosomal genotype?
Heart Rhythm 10 (4), 548-559 (2013)
Groeneweg JA, van der Zwaag PA, Jongbloed JD, Cox MG, Vreeker A, de Boer RA, van der Heijden JF, van Veen TA, McKenna WJ, van Tintelen JP, Dooijes D and Hauer RN.


Plakophilin 3--a novel cell-type-specific desmosomal plaque protein
Differentiation 64 (5), 291-306 (1999)
Schmidt A, Langbein L, Pratzel S, Rode M, Rackwitz HR and Franke WW.


Desmosomal plakophilin 2 as a differentiation marker in normal and malignant tissues
Differentiation 64 (5), 277-290 (1999)
Mertens C, Kuhn C, Moll R, Schwetlick I and Franke WW.


Chromosomal mapping of human armadillo genes belonging to the p120(ctn)/plakophilin subfamily
Genomics 51 (3), 452-454 (1998)
Bonne S, van Hengel J and van Roy F.


Plakophilins 2a and 2b: constitutive proteins of dual location in the karyoplasm and the desmosomal plaque
J. Cell Biol. 135 (4), 1009-1025 (1996)
Mertens C, Kuhn C and Franke WW.


Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
McNally,E., MacLeod,H. and Dellefave-Castillo,L.
